Einem mikrofluidischen Biochip-basierte Elektrochemische für Markierungsfreie DNA-Hybridisierungsanalyse

Bioengineering

Your institution must subscribe to JoVE's Bioengineering section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Wir präsentieren einen mikrofluidischen Biochip-basierten elektrochemischen DNA-Hybridisierung für Erkennung. Folgende ssDNA-Sonde Funktionalisierung werden die Spezifität, Empfindlichkeit und Nachweisgrenze mit komplementären und nicht-komplementären ssDNA Ziele untersucht. Ergebnisse veranschaulichen den Einfluss der DNA-Hybridisierungsereignisse auf dem elektrochemischen System, mit einer Nachweisgrenze von 3,8 nM.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Ben-Yoav, H., Dykstra, P. H., Gordonov, T., Bentley, W. E., Ghodssi, R. A Microfluidic-based Electrochemical Biochip for Label-free DNA Hybridization Analysis. J. Vis. Exp. (91), e51797, doi:10.3791/51797 (2014).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Miniaturisierung von analytischen Laborbedingungen in den Mikromaßstab bietet erhebliche Vorteile in Bezug auf die Reaktionszeit, der Kosten und der Integration von Vorverarbeitungsschritte. Verwendung dieser Vorrichtungen zur Analyse von DNA-Hybridisierungsereignisse ist wichtig, weil es eine Technologie zur Echtzeit-Beurteilung von Biomarkern am Point-of-Care für verschiedene Krankheiten. Wenn die Vorrichtung Grundfläche verringert jedoch die Dominanz der verschiedenen physikalischen Erscheinungen zu. Diese Phänomene beeinflussen die Fertigungsgenauigkeit und Betriebssicherheit der Vorrichtung. Daher besteht ein großer Bedarf zur genauen Herstellung und Betrieb dieser Geräte in einer reproduzierbaren Weise, um die Gesamtleistung zu verbessern. Hier beschreiben wir die Protokolle und die für die Herstellung und den Betrieb eines Mikrofluidbasis elektro Biochips für die genaue Analyse von DNA-Hybridisierungsereignissen Methoden. Der Biochip besteht aus zwei Teilen: einem Mikrofluid-Chip mitdrei parallele Mikrokanäle aus Polydimethylsiloxan (PDMS) hergestellt, und ein 3 x 3 Feld aus elektrochemischen Mikrochip. Die DNA-Hybridisierungsereignisse werden durch elektrochemische Impedanzspektroskopie (EIS)-Analyse nachgewiesen. Die EIS-Analyse ermöglicht die Überwachung Variationen der Eigenschaften des elektrochemischen Systems, das dominant in diesen Längenskalen sind. Mit der Fähigkeit, Änderungen sowohl Ladungstransfer und Diffusionswiderstand mit dem Biosensor zu überwachen, die Selektivität für komplementäre ssDNA Ziele, eine berechnete Nachweisgrenze von 3,8 nm und eine 13% Kreuzreaktivität mit anderen, nicht-komplementäre ssDNA folgenden 20 min zeigen wir, Inkubation. Diese Methode kann die Leistung von miniaturisierten Geräten durch die Aufklärung über das Verhalten der Diffusion auf der Mikroskala Regime und durch Aktivieren der Untersuchung von DNA-Hybridisierungsereignissen zu verbessern.

Introduction

Mikrofluidischen Lab-on-a-Chip (LOC)-Geräte bieten zahlreiche Vorteile in der klinischen Diagnostik, der Umweltüberwachung und der biomedizinischen Forschung. Diese Vorrichtungen verwenden mikrofluidische Kanäle, um eine Fluidströmung zu Bereichen des Chips, wo eine Vielzahl von Verfahren, einschließlich Mischen Reagens, bezogen Affinität bindende, Signaltransduktion und der Zellkulti 1-4 erfolgen steuern. Mikrofluidik bietet viele Vorteile gegenüber herkömmlichen klinischen Diagnosewerkzeuge wie Mikrotiterplatte Leser oder Elektrophorese-Gel-Shift-Assays. Mikrofluidik-Vorrichtungen erfordern 2 bis 3 Grßenordnungen (Nanolitern, im Gegensatz zu Mikroliter) weniger Reagenzien ähnliche Tests durchzuführen. Auch können diese Geräte die Geschwindigkeit, mit der einige biologische Ereignisse aufgrund der kleineren Haft der Arten innerhalb der Kanäle 5,6 zu erhöhen. Drittens können Sensoren in Mikrofluidikeinheiten mittels Lithographie und Ätzverfahren, die markierungsfreie Erken bieten können integriert werdenn. Schließlich sind diese Vorrichtungen kostengünstig in der Herstellung und erfordern wenig Aufwand seitens des Technikers zu bedienen 7-10.

Markierungsfreien Detektion wird typischerweise unter Verwendung eines optischen oder elektrischen Wandlers. Optische Vorrichtungen besser Sensorleistung aufgrund der geringeren Beeinträchtigung Analyten in der Probe vorliegt. Dennoch ist ihre Leistung in Fällen, in denen die Proben Hintergrund die gleiche Resonanzwellenlänge als Sensor 11 beeinträchtigt werden. Es gibt viele Vorteile bei der Verwendung von elektrischen Signalen, um biologische und chemische Nachweis in mikrofluidischen Systemen durchzuführen. Die Herstellung von sich aus weniger kompliziert, da diese Sensoren in der Regel nur erforderlich strukturierten Elektroden zu bedienen. Zusätzlich können elektrische Signale direkt mit den meisten Messvorrichtung verbunden werden, während eine andere Signal Modalitäten kann ein Wandler erforderlich, um das Signal umzuwandeln 12-15. Elektrische Sensoren häufig Veränderungen in impedanc messenE 16,17, Kapazität 18, 19 oder Redox-Aktivität. Allerdings werden vor neue Herausforderungen gestellt, wie diese Systeme miniaturisiert werden. Die wichtigsten Herausforderungen zu meistern sind: Probenvorbereitung und Mischen von Flüssigkeiten (aufgrund der geringen Probenvolumen und Reynolds-Zahl), physikalische und chemische Effekte (einschließlich Kapillarkräfte, Oberflächenrauhigkeit, chemische Wechselwirkungen zwischen Baumaterialien und Analyten), niedrige signal Rausch-Verhältnis 20-23 und mögliche Interferenz von elektroaktiven Analyten in komplexen biologischen Proben (zB Blut und Speichel) (durch die verringerte Oberfläche und Volumen) gemessen. Weitere Untersuchungen dieser Effekte wird Richtlinien für eine genaue Fertigung und des Betriebs dieser Geräte in einer reproduzierbaren Art und Weise, auf die Gesamtleistung verbessern würde.

DNA-Hybridisierungsdetektion wird weitgehend verwendet, um genetische Erkrankungen 24,25 und verschiedene Formen von Canc diagnostizierenER 26. Jedes Jahr werden mehrere Stämme der Influenza bei Patienten, die Ergebnisse von DNA-Hybridisierungstechniken 27 identifiziert. Das Influenza-Virus allein entfallen 36.000 Todesfälle pro Jahr in den Vereinigten Staaten 28. Solche Beispiele könnten von einer Tisch-Mikrofluid-Vorrichtung, die die gleichen Testverfahren wie einem Plattenleser oder ein Gel-Shift-Assay mit geringen Probenvolumen und zu einem Bruchteil der Kosten, ohne die Empfindlichkeit oder Spezifität führen kann profitieren. Aufgrund der vielen Vorteile der markierungsfreien elektrochemischen Sensor, es wurde ausgiebig für den Nachweis von DNA-Hybridisierungsereignissen 29,30 verwendet. Ein Setup, wo Makro-Skala Elektroden (im Millimeterbereich) in Bechergläser mit der Lösung von Interesse getaucht werden können, verwendet werden, um sehr sensible Daten über die Bindung Kinetik von Einzelstrang-DNA-Sequenzen auf ihre passenden komplementären Sequenzen liefern. Kürzlich gab es ein paar Fortschritte bei der Einbeziehung elektrochemischen Mess in MICRofluidics für die DNA-Hybridisierung. Es wurden Studien durchgeführt über Hybridisierungskinetik 31 und Integration von Sensoren für die Erkennung 15 in mikrofluidischen Kanälen. Allerdings gibt es immer noch einen Bedarf für eine schnelle Hochdurchsatz-Mikrofluid-Gerät, das DNA-Hybridisierungsereignisse parallel analysieren kann, ohne komplizierte Probenvorbereitungsschritte.

Die in dieser Arbeit vorgestellten Vorrichtung ist eine Plattform, die mehrere Wechselwirkungen, die parallel und ohne aufwendige Probenvorbereitungsschritte durchmustert werden können. Unser Protokoll zeigt, wie Mikrofluidik-basierten elektrochemische Biochips sind mit mikroelektromechanische Systeme (MEMS)-Technologie 32,33 mikrofabriziert. Wir beschreiben den Herstellungsprozeß sowohl des mikrofluidischen Chips von Polydimethylsiloxan (PDMS) und die elektrochemische Chip, der eine Anordnung von Elektroden umfasst. Die chemische Funktionalisierung des Biochips mit ssDNA-Sonden wird ebenfalls angesprochen. Schließlich wird die Abilkeit des Biosensors speziell zu erkennen und zu analysieren, ssDNA Ziele demonstriert. Insgesamt ist die mikrofluidische Basis elektro Biochip eine schnelle und hohe Durchsatzanalyse-Technik. Es kann verwendet werden, um Wechselwirkungen zwischen biologischen Molekülen und Durchführung Wandler zu untersuchen, und können in einer Vielzahl von Lab-on-a-Chip-Anwendungen verwendet werden.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Mikrofabrikation des mikrofluidischen Chips

  1. Bereiten Elektrochemische Chip
    1. Muster Goldelektroden
      1. Spülen Sie ein leeres 4 '' Silizium-Wafer (Grade-Qualität prime) mit Aceton, Methanol und Isopropanol ("AMI" sauber). Spülen Sie das Isopropanol aus dem Wafer mit deionisiertem Wasser (DI), gefolgt von Trocknen mit N 2 Pistole.
      2. Wachsen eine 1 um dicke SiO 2-Passivierungsschicht mit plasmaunterstützte chemische Gasphasenabscheidung (PECVD)-Tool. Zahlen Sie 200 Å dicke Schicht aus Chrom, gefolgt von einer 2000 Å dicken Schicht aus Gold mit einem DC-Sputtern Werkzeug.
      3. Spin "PR1" positive Photoresist (Spinnparameter: 3000 rpm, 1000 rpm / s, 30 s), um gleichmäßigen Film ~ 1,6 um dick zu erstellen. Pre-Bake-Wafers für 1 min bei 100 ° C auf einer heißen Platte.
      4. Aussetzen des Wafers mit 190 mJ / cm 2 bei 405 nm durch eine Photomaske. Entwickeln Sie die Wafer für 30 Sekunden in 352 Entwicklereloper und spülen Sie die Wafer mit DI und trocken mit N 2 Pistole.
      5. Ätzen der Gold mit Ätzmittel für 1,5 min. Ätzen der Chrom mit Chrom Ätzmittel für ~ 30 sek. Spülen des Wafers mit DI und trocken mit N 2 Pistole.
      6. Streifen der Photolack mit "AMI" saubere Verfahren.
        HINWEIS: starkes Oxidationsmittel und potenziell explosiv.
      7. Reinigen des Wafers mit 4: 1 H 2 SO 4: H 2 O 2-Gemisch ("Piranha" clean) für 1 min. Spülen des Wafers mit DI und trocken mit N 2 Pistole.
    2. Muster Platinelektroden
      1. Spin "PR2" positive Photoresist (Spinnparameter: 3000 rpm, 1000 rpm / s, 30 s), um gleichmäßigen Film ~ 1,4 um dick zu erstellen. Pre-Bake-Wafers für 1 min bei 100 ° C auf einer heißen Platte.
      2. Aussetzen des Wafers mit 30 mJ / cm 2 bei 405 nm durch eine Photomaske. Backen Sie die Wafer für 45 Sekunden bei 125 ° C auf einer heißen Platte. Hochwasser aussetzender Wafer mit 1.000 mJ / cm 2 bei 405 nm Wellenlänge ohne eine Photomaske. Entwickeln Sie die Wafer für 2 min in 6: 1 AZ400K Entwickler und spülen Sie die Wafer mit DI und trocken mit N 2 Pistole.
      3. Zahlen Sie 400 Å dicke Schicht aus Titan, gefolgt von einer 1600 Å dicken Schicht aus Platin mit einem Elektronenstrahl-Verdampfungssystem.
      4. Abheben Photoresist in einem Acetonbad ultraschall für 5 Minuten, gefolgt von Spülen mit Aceton und Isopropanol. Spülen des Wafers mit DI und trocken mit N 2 Pistole.
  2. Bereiten Assay Kanäle
    1. Bereiten Form für Assay-Kanäle
      1. Spülen Sie ein leeres 4 '' Silizium-Wafer (Test-Grade-Qualität) mit "AMI" saubere Verfahren. Spülen Sie das Isopropanol aus dem Wafer mit DI, gefolgt von Trocknen mit N 2 Pistole.
      2. Spin "PR3" negative Photolack (2-Schritt-Spinnparameter:. Schritt eins - 600 min, 120 U / sec, 10 sec Schritt zwei - 1.150 rpm, 383 rpm / sec,27 sec) zu einheitlichen Film ~ 100 um dick zu erstellen. Pre-Bake-Wafers auf einer heißen Platte (2-Schritt-Backparameter:. Schritt eins - Rampe von Raumtemperatur bis 65 ° C bei 300 ° C / h, die Temperatur für 10 min Schritt 2 - Rampe bis zu 95 ° C bei 300 ° C / h, die Temperatur 30 min).
      3. Aussetzen des Wafers mit 2500 mJ / cm 2 bei 405 nm durch eine Photomaske. Post-Bake-Wafers durch Rampen bis zu 95 ° C bei 300 ° C / h, die Temperatur für 10 min auf einer heißen Platte. Entwickeln Sie die Wafer für 10 min in Propylenglykolmonomethyletheracetat (PGMEA) Entwickler. Spülen Sie die Wafer mit Isopropanol reinigen und mit N 2 Pistole.
    2. Herzustellen Assay Kanäle
      1. Herstellung von 10: 1 Polydimethylsiloxan (PDMS)-Gemisch (20 g Elastomer, 2 g Härter) und vollständig entgasen in einer Vakuumkammer für 20 min.
      2. Definieren Sie ein Gehäuse um die Form-Wafer mit Aluminiumfolie und gießen Sie langsam das nicht ausgehärtete PDMSüber die Form.
      3. Backen Sie die Form mit den PDMS in einem Kammerofen (2-Schritt-Backparameter:. Schritt eins - 5 min Rampe von Raumtemperatur bis 80 ° C Schritt 2 - halten bei 80 ° C für 17 min).
      4. Abziehen der PDMS von der Form nehmen und auf Aluminiumfolie. Schneiden Sie die Test-Chips mit einem Chirurgen Messer, definieren Löcher mit einer Biopsie-Stanzwerkzeug.

2. Bauen Sie die Geräte-

  1. Manuell ausrichten PDMS-Assay-Kanäle mit den Arbeitselektroden auf die elektrochemische Chip. PDMS haftet gut auf die elektrochemische Chip, Abdichten der Kanäle und verhindert Leckagen.
  2. Schließen Sie einen flexiblen Schlauch (OD 0,087 'und 0,015 ID' '), um ein Kunststoff Ellenbogen oder gerader Stecker mit einem kurzen flexiblen Schlauch als Adapter (OD 0,1875' 'und 0,0625 ID' '). Befestigen Anschlüsse an jede der gelochten Einlässe in das Gerät.
  3. Eine Spritze am anderen Endedie Schläuche und legen Sie die Spritze in einer Spritzenpumpe. Alternativ kann die Menge von einer Spritze, einem Rohr und einem Verbinder gemß der erforderlichen Verfahrensschritt in Abschnitt 3 und der entsprechenden Lösung zu ändern.

3. Analysieren DNA-Hybridisierung

HINWEIS: Führen jedes Lösung langsam in den Kanal bei einer Fließgeschwindigkeit von 200 ul / h bis der gesamte Kanal gefüllt.

  1. Funktionalisieren jede vertikale Mikrokanal mit einer anderen ssDNA Sondensequenz (zuführen parallel zu den 3 separate vertikale Mikro):
    1. In jede Mikrokanal mit einer anderen ssDNA-Sonde inkubiert Lösung (10 mM Phosphatpuffer, 100 mM NaCl, 10 uM Tris (2-carboxyethyl) phosphin (TCEP) und 1 uM Sonde ssDNA), und Inkubation für 1 h, gefolgt von Spülen der Mikrokanal mit PBS.
    2. Füllen des Mikrokanals mit einer Lösung, enthaltend 1 mM 6-Mercapto-1-hexanol (MCH) in einem Puffer aus 10 mM PBS, 100 mM NaCl und 1,395 mM TCEP und incuBeize für 1 h, gefolgt von Spülen der Mikrokanal mit PBS.
  2. Heben Sie die PDMS, um 90 ° in eine horizontale Ausrichtung, und legen bis zu getrennten Reihen von Reaktionskammern mit jeder Zeile mit einer eindeutigen Zähler und Referenzelektrode (Abbildung S1) aus.
  3. Füllen Sie die Mikrokanäle mit Steuermesslösung von 4x konzentrierte Salz-Natriumcitrat (SSC)-Puffer und Inkubation für 20 min.
  4. Hintergrundmessung: Füllen Sie die Mikrokanäle mit 5 mM Ferricyanid / 5 mM Ferrocyanid in PBS-Lösung und notieren Sie die Impedanzwerte der elektrochemischen System für verschiedene Frequenzen (elektrochemische Impedanzspektroskopie, EIS) mit Hilfe eines Potentiostaten an die Arbeits, Zähler verbunden und Referenzelektroden ( EIS-Parameter: Frequenzbereich von 1 MHz bis 0,1 Hz, 10 Frequenzdatenpunkte pro Jahrzehnt, 25 mV Amplitude, 5 mV Polarisation gegenüber der Referenzelektrode). Wiederholen Sie diese Messung für jeden Arbeitselektrode in den Mikrokanälen. Messung der DNA-Hybridisierung (zuführen für jede nicht-komplementären und komplementären ssDNA-Ziel).
    1. Füllen Sie die Mikrokanäle mit Ziel ssDNA Messlösung von 4x konzentriert SSC-Puffer mit 1 uM der Ziel ssDNA, und Inkubation für 20 min. Messung der DNA nach Schritt 3.4.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Eine steuerbare und genaue Herstellungsverfahren für die Versuchsvorrichtung ist wesentlich, in der Forschung. Es erlaubt Forschern, reproduzierbare und Hochdurchsatz-Experimenten erhalten. Hier haben wir eine hohe Ausbeute, hohe Reproduzierbarkeit Mikroprozess eines mikrofluidischen Biochip-basierten elektrochemischen (Abbildung 1) gezeigt. Mit einer niedrigen Ausfallrate haben nur wenige Geräte Haft Fragen, die Leckage Lösung führen gezeigt. Um die elektrochemische Aktivität des Biochips zu validieren, werden Cyclovoltammetrie Messungen in den Mikrokanälen mit einem elektroaktiven Redoxpaar Ferricyanid / Ferrocyanid gefüllt wurde. 2 zeigt die reproduzierbare elektrochemische Reaktion von neun verschiedenen Arbeitselektrode auf dem Chip. Diese Ergebnisse zeigen, daß die elektrochemische Aktivität ist die gleiche in allen neun Kammern des Biochips ermöglichen Hochdurchsatzmessungen.

Die meisten DNA-Hybridisierung Sensoren immobilisieren ssDNASonden auf eine Sensorfläche. Wie man Gold auf die Muster-Messelektroden für die Mikrofluidik-Geräten verwendet werden, Thiole sind gute Kandidaten, um starke kovalente Bindungen bilden mit den Sensorflächen 34. Eine übliche Technik Konjugation beteiligt das Hinzufügen einer funktionellen Thiol (-SH)-Gruppe an einem Ende der ssDNA. Die SS Disulfidbindung schützt die freie Thiolgruppe von Oxidation bis zur Verwendung bereit ist. Sobald das Disulfid von Tris reduziert (2-carboxyethyl) phosphin (TCEP) Außerdem wird die freie Thiol (-SH) verfügbar, um die DNA an eine Goldoberfläche zu binden. Ohne TCEP werden die Disulfidbindungen des ssDNA auch auf der Elektrode zusammenzubauen, aber die Verbindung ist viel schwächer als die Thiol-Gold-Bindung und werden nicht während der gesamten Experiments stabil. In dieser Arbeit wird eine stabile ssDNA-Monoschicht für die Hybridisierung Nachweis wurde mit Inkubationszeiten von ein bis zwei Stunden erreicht. Sobald die ssDNA-Sonden wurden auf die Elektrode zusammengebaut ist, wird 6-Mercapto-1-hexanol (MCH) zum Erzeugen eines passiy exponierten Regionen auf der Oberfläche, um nicht-spezifische Bindungseffekte 35 zu reduzieren. Die MCH Thiolgruppe kann zur Selbstmontage an der Gold-und der Hydroxylgruppe reduziert unspezifische Adsorption von ssDNA in Lösung. Die hohe TCEP-Konzentration verwendet wird, um die Thiol-Gruppen, die oxidiert werden kann, um Disulfidbindungen zu reduzieren,. Ohne die hohen TCEP Inhalt im Puffer würde der MCH instabil Monoschichten zu bilden, und die Impedanzdaten würde dementsprechend aufgrund von Schwankungen der Oberflächenladung variieren. Die MCH hat eine weitere wichtige Funktion, wenn Sie es als Passivierung mit ssDNA-Moleküle. Die oxidative Adsorption des MCH injiziert Elektronen in die Elektrode und verringert die Oberflächenpotentials. Dies bewirkt eine elektrostatische Wirkung mit der anionischen Sonde ssDNA bereits immobilisiert und die ssDNA steht aufrecht von der Elektrode 36. Aufrecht Sonden erheblich die Hybridisierungseffizienz, da die Ziel ssDNA-Stränge viel leichteren Zugang zu der E erhöhenntire Länge der Sondensequenz. Dieser Passivierungsschritt ist wichtig für die Schaffung eines stabilen Impedanz Nullmessung des Sensors, wodurch falsche positive Signale und keine schwach gebundenen Moleküle von der Oberfläche zu entfernen.

Die Biosensor-Mechanismus der DNA-Hybridisierungsereignissen auf Abstoßungskräfte zwischen den negativ geladenen DNA und anderen elektroaktiven Molekülen. Wenn ein Hybridisierungsereignis auftritt, stärker Abstoßungskräfte zwischen der hybridisierten DNA und dem elektroaktiven Moleküle erschwert es die elektroaktive Spezies in Richtung der Elektrode 37 zu diffundieren. Hier verwenden wir ein Ferricyanid / Ferrocyanid Paar als Redox-Spezies Indikator für diese Abstoßungskräfte, die, gemessen unter Verwendung elektrochemische Impedanzspektroskopie (EIS) sind. Wir nutzen diese Biosensor-Mechanismus in der Mikrofluidik-basierten elektro Biochip, und zeigen die Fähigkeit, DNA-Hybridisierungsereignissen 33 detektieren. 3 zeigt dieSelektivität des Biosensors darstellt, von Impedanzänderungen aufgrund von Hybridisierungsereignissen zwischen drei ssDNA-Sonden und deren komplementäre ssDNA vorbei. Eine 13% Kreuzreaktivität mit anderen, nicht-komplementäre ssDNA folgenden 20 min Inkubation wurde nachgewiesen. Diese Ergebnisse zeigen die Machbarkeit der mikrogefertigten Vorrichtung zur DNA-Hybridisierungsereignissen in einer reproduzierbaren und Hochdurch Weise zu messen. Wir haben auch die Empfindlichkeit des Biosensors durch Einführen verschiedener Konzentrationen komplementärer ssDNA Ziel zu dem Fühlersonde nachgewiesen. 4 zeigt die Funktion des Biosensors mit einem Trend der zunehmenden Impedanzwerten bei höheren ssDNA Zielkonzentrationen. Folgende Berechnungen des eingeschränkten Diffusionswiderstand 33 für verschiedene Konzentrationen komplementärer ssDNA Ziel ergab eine lineare Regressionsanalyse in einem theoretischen Nachweisgrenze von 3,8 nm durch die Berechnung der entsprechenden ssDNA Zielkonzentration für das Hintergrundsignal. Insgesamt zeigt der Biochip in der Lage, schnell zu erfassen die Anwesenheit von DNA-Hybridisierungsereignissen.

Figur 1
Abbildung 1. Foto von verpackten Prüfling (Chip Abmessungen: 3,5 cm x 3,5 cm; Mikrokanalhöhe beträgt 100 um und 500 um in der Breite).

Figur 2
Abbildung 2. Elektrochemische Validierung. Cyclovoltammogramme von 9 (3 x 3 Gitter) Arbeitselektroden in Gegenwart von Ferrocyanid / Ferricyanid Redox-Paar. Die Reproduzierbarkeit zwischen den gemusterten Elektroden wird durch die ähnliche Form, Peakhöhe und Peaktrennung für alle Elektroden gezeigt."Https://www.jove.com/files/ftp_upload/51797/51797fig2highres.jpg" target = "_blank"> Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.

Figur 3
Abbildung 3. Spezifität des Biosensors. Die Auswirkungen der Hybridisierungsereignisse zwischen verschiedenen ssDNA Ziele und drei verschiedene ssDNA-Sonden auf der Ladungsübergangswiderstand. Nach DNA-Hybridisierungsereignis, das stärkere Abstoßungskraft zwischen der negativ geladenen DNA-Doppelstrang und den negativ geladenen Ferrocyanid / Ferricyanid-Moleküle zu einem höheren Ladungsübertragungswiderstand.

Figur 4
Abbildung 4. Funktionalität des Biosensors. Ortskurveelektrochemischer Impedanzspektroskopie-Messungen nach der Einführung von 0,01, 0,1, 1 und 1 uM Ziel ssDNA (Pfeil zeigt zunehmende ssDNA Zielkonzentrationen). Die erhöhten Impedanzwerte bei niedrigen Frequenzen (~ 15 Hz) für höhere Ziel ssDNA Konzentrationen sind aufgrund der stärkeren Abstoßungskräfte zwischen der dsDNA und den Ferrocyanid / Ferricyanid Molekülen.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Unsere Verfahren zeigen die Herstellung eines mikrofluidischen Basis elektro Biochip und seine Verwendung für die DNA-Hybridisierungsereignissen Analyse. Durch eine hohe Ausbeute gesteuert Mikroprozess entwickeln wir ein Gerät der Mikrokanäle mit einer Reihe von elektrochemischen Wandler integriert zusammen. Wir haben gesteuerten Bearbeitungsparameter für die Photolithographie Verfahren der elektrochemischen Chip und der mikrofluidischen Kanal Form durch einen iterativen Ansatz entwickelt. Diese Schritte stellen Leitlinien für die künftige Schaffung von anderen miniaturisierten Analysegeräte. Wichtig ist, liefern sie ein Verfahren, um verschiedene Parameter wie Biosensor Signal-zu-Rausch-Verhältnis, die Stabilität und die Empfindlichkeit zu optimieren. Nach Herstellung der Vorrichtung, funktionalisieren wir die elektrochemischen Wandler mit ssDNA-Sonde als Biorezeptor, eine einzigartige analytische Zwecke. Obwohl diese Verfahren demonstrieren niedrigen Geräteausfallrate, zeigt Leck Lösung für ein majo seinr Frage nach der Montage des Geräts und während der Durchführung der DNA-Hybridisierungstest. Weitere Untersuchungen von Verbindungsfehler in solchen Geräten würde die Ausbeute des Verfahrens zu verbessern und machen es ideal für die Mikro-Bio-Systeme Studie.

In unseren Studien zeigen wir die Fähigkeit des Biochips genau und spezifisch Sense-DNA-Hybridisierungsereignissen. Als Teil der Design-Parameter für eine neue analytische Mikro-Gerät, sollte man in Betracht die Herstellung des Gerätes, die einen iterativen Ansatz erfordert, um Herstellungsparameter optimieren nehmen (zB Photolithographie Parameter, Mikrokanalabmessungen, die Art des aufgebrachten Metalls). Um DNA-Hybridisierungsereignissen effizient erfassen, ssDNA Sondenanordnung und Hybridisierungsbedingungen müssen ebenfalls optimiert werden (zB., Inkubationszeit, Pufferkonzentration, Sondenkonzentration, die Verhinderung der unspezifischen Adsorption).

Die Fähigkeit, schnell fo Bildschirmr bestimmte DNA-Sequenzen ist sehr vorteilhaft in den Bereichen Krebsforschung, Grippe-Erkennung und Gentechnik. Die meisten angeordnet Nachweismethoden nutzen ein Etikett, um das Signal zu erzeugen und verwenden mehrere Wasch-und Inkubationsschritte. Verwendung der vorgeschlagenen mikrofluidische Vorrichtungen, die DNA-Hybridisierung mit hoher Anzahl von DNA-Sequenzen in der gleichen Vorrichtung ohne die Notwendigkeit für Etiketten aller Art durchgeführt werden. Wir stellen uns in der Nähe von Zeitanwendungen integrieren anspruchsvollere Funktionen für den Biochip, um seine Leistung zu verbessern und Modularität. Zum Beispiel hat Ventil basierten Mikrofluidik das Potential des Biochips mit automatischen und gesteuerten Analysefähigkeiten bereitzustellen. Ein weiteres Beispiel ist die Funktionalisierung der Vorrichtung mit anderen Biorezeptoren den einzigartigen Sensoreigenschaften, die in einem breiteren Bereich von Anwendungen verwendet werden kann.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Die Autoren haben nichts zu offenbaren.

Acknowledgments

Die Autoren erkennen die Robert W. Deutsch-Stiftung, die Defense Threat Reduction Agency (DTRA) und der National Science Foundation Frontiers in Schwellen Forschung und Innovation (EFRI) für finanzielle Unterstützung. Die Autoren danken auch dem Maryland und seine Nanocenter FabLab für Reinraumanlage Unterstützung.

Materials

Name Company Catalog Number Comments
4'' Silicon wafer Ultrasil 4-5664 Single side polished; P-type; Boron doped; Orientation 1-0-0; Thickness 500 micron; Resistance 10-20 ohm·cm
Shipley 1813 photoresist ("PR1") Microchem positive photoresist
AZ5214 photoresist ("PR2") Hoechst Celanse positive photoresist
SU-8 50 photoresist ("PR3") Microchem negative photoresist
Gold etchant Transene TFA No dilution
Chromium etchant Transene 1020AC No dilution
PDMS elastomer Dow Corning 3097366 1004
PDMS curing agent Dow Corning 3097358 1004
Biopsy punching tool Healthlink BP20
Tygon flexible tubing Cole Parmer  R 3603 0.015"
Tygon flexible adapter Cole Parmer  06417-41 0.0625"
1 ml syringe Beckton-Dickenson 301025
Monobasic potassium phosphate Fluka 1551139
Potassium phosphate dibasic anhydrous Sigma RES20765-A7
Sodium chloride Sigma-Aldrich S7653
tris(2-carboxyethyl)phosphine Aldrich C4706
6-mercapto-1-hexanol Aldrich 451088
20x concentrated saline-sodium citrate buffer Sigma 93017
Potassium hexacyanoferrate(III) Aldrich 455946
Complementary ssDNA #1 Integrated DNA Technologies (IDT) 100 nmole DNA oligo 5’-GGGACGTCCACGGAGCGCTA
TCGGAGCTTT-3’
Target ssDNA #2 Integrated DNA Technologies (IDT) 100 nmole DNA oligo 5’-/5ThioMC6-D/ACGCGTCAGGTCATTGACGA
ATCGATGAGT-3’
Complementary ssDNA #2 Integrated DNA Technologies (IDT) 100 nmole DNA oligo 5’-ACTCATCGATTCGTCAATGA
CCTGACCCGT-3’
Target ssDNA #3 Integrated DNA Technologies (IDT) 100 nmole DNA oligo 5’-/5ThioMC6-D/ACCTAGATCCAGTAGTTAGA
CCCATGATGA-3’
Complementary ssDNA #3 Integrated DNA Technologies (IDT) 100 nmole DNA oligo 5’-TCATCATGGGTCTAACTACT
GGATCTAGGT-3’
Instrument
Plasma Enhanced Chemical Vapor Deposition (PECVD) Oxford Instruments PlasmaLab System 100 Chamber pressure 1,000 mTorr, Tempreture 200 °C, RF power 20 W, Gasses: a) N2O flow rate 710 sccm; b) a composition of 5% SiH4 and 95% N2 gasses flow rate 170 sccm, SiO2 growth rate 690 Å/min.
DC sputtering unit AJA International ATC 1800-V For Chrome: Chamber pressure 10 mTorr, Argon flow rate 20 sccm, Supplied DC power 200 W, Sputter rate 10 nm/min. For Gold: Chamber pressure 10 mTorr, Argon flow rate 20 sccm, Supplied DC power 200 W, Sputter rate 36 nm/min.
E-beam evaporation system Denton Custom-built For Titanium: Chamber pressure < 2 x 10-6 Torr, Supplied power to the e-gun 7.5 kW, Filament current 150-200 mA, Evaporation rate 6-10 Å/sec. For Platinum: Chamber pressure < 2 x 10-6 Torr, Supplied power to the e-gun 7.5 kW, Filament current 150-200 mA, Evaporation rate 2-3 Å/sec.
Potentiostat CH Instruments 660D
Syringe pump KD Scientific KDS230

DOWNLOAD MATERIALS LIST

References

  1. Hong, J., Edel, J. B., deMello, A. J. Micro- and nanofluidic systems for high-throughput biological screening. Drug Discov. Today. 14, 134-146 (2009).
  2. Sun, Y., Kwok, Y. C. Polymeric microfluidic system for DNA analysis. Anal. Chim. Acta. 556, 80-96 (2006).
  3. Xu, Y., Yang, X., Wang, E. Review: aptamers in microfluidic chips. Anal. Chim. Acta. 683, 12-20 (2010).
  4. Yang, W., Woolley, A. T. Integrated multiprocess microfluidic systems for automating analysis. J. Lab. Automat. 15, 198-209 (2010).
  5. Gervais, T., Jensen, K. F. Mass transport and surface reactions in microfluidic systems. Chem. Eng. Sci. 61, 1102-1121 (2006).
  6. Song, H., Ismagilov, R. F. Millisecond kinetics on a microfluidic chip using nanoliters of reagents. J. Am. Chem. Soc. 125, 14613-14619 (2003).
  7. Jiang, H., Weng, X. A., Li, D. Q. Microfluidic whole-blood immunoassays. Microfluid. Nanofluid. 10, 941-964 (2011).
  8. Dutse, S. W., Yusof, N. A. Microfluidics-based lab-on-chip systems in DNA-based biosensing: an overview. Sensors. 11, 5754-5768 (2011).
  9. Dittrich, P. S., Manz, A. Lab-on-a-chip: microfluidics in drug discovery. Nat. Rev. Drug Discov. 5, 210-218 (2006).
  10. Craighead, H. Future lab-on-a-chip technologies for interrogating individual molecules. Nature. 442, 387-393 (2006).
  11. Hunt, H. K., Armani, A. M. Label-free biological and chemical sensors. Nanoscale. 2, 1544-1559 (2010).
  12. Dukkipati, V. R., Pang, S. W. Integrated microfluidic system for DNA analysis. IEEE-NANO 2006. Sixth IEEE Conference on Nanotechnology. 1, 162-165 (2006).
  13. Fang, T. H., et al. Real-time PCR microfluidic devices with concurrent electrochemical detection. Biosens. Bioelectron. 24, 2131-2136 (2009).
  14. Pavlovic, E., et al. Microfluidic device architecture for electrochemical patterning and detection of multiple DNA sequences. Langmuir. 24, 1102-1107 (2008).
  15. Xu, X., Zhang, S., Chen, H., Kong, J. Integration of electrochemistry in micro-total analysis systems for biochemical assays: recent developments. Talanta. 80, 8-18 (2009).
  16. Cai, H., Lee, T. M. -H., Hsing, I. M. Label-free protein recognition using an aptamer-based impedance measurement assay. Sensor. Actuat. B-Chem. 114, 433-437 (2006).
  17. Iliescu, C., Poenar, D. P., Carp, M., Loe, F. C. A Microfluidic device for impedance spectroscopy analysis of biological samples. Sensor. Actuat. B-Chem. 123, 168-176 (2007).
  18. Prakash, S. B., Abshire, P. Tracking cancer cell proliferation on a CMOS capacitance sensor chip. Biosens. Bioelectron. 23, 1449-1457 (2008).
  19. Yamaguchi, A., et al. Rapid fabrication of electrochemical enzyme sensor chip using polydimethylsiloxane microfluidic channel. Anal. Chim. Acta. 468, 143-152 (2002).
  20. Beebe, D. J., Mensing, G. A., Walker, G. M. Physics and applications of microfluidics in biology. Annu. Rev. Biomed. Eng. 4, 261-286 (2002).
  21. Mariella, R. Sample preparation: the weak link in microfluidics-based biodetection. Biomed. Microdevices. 10, 777-784 (2008).
  22. Bhushan, B. Springer handbook of nanotechnology. 3rd ed, Springer. (2010).
  23. Ghallab, Y. H., Badawy, W. Lab-on-a-chip: Techniques, circuits, and biomedical applications. Artech House. (2010).
  24. Chee, M., et al. Accessing genetic information with high-density DNA arrays. Science. 25, 610-614 (1996).
  25. Ma, K. -S., Zhou, H., Zoval, J., Madou, M. DNA hybridization detection by label free versus impedance amplifying label with impedance spectroscopy. Sensor. Actuat. B-Chem. 114, 58-64 (2006).
  26. Ito, T., Hosokawa, K., Maeda, M. Detection of single-base mismatch at distal end of DNA duplex by electrochemical impedance spectroscopy. Biosens. Bioelectron. 22, 1816-1819 (2007).
  27. Kao, L. T. -H., et al. Multiplexed detection and differentiation of the DNA strains for influenza A (H1N1 2009) using a silicon-based microfluidic system. Biosens. Bioelectron. 26, 2006-2011 (2011).
  28. Li, J., Chen, S., Evans, D. H. Typing and subtyping influenza virus using DNA microarrays and multiplex reverse transcriptase PCR. J. Clin. Microbiol. 39, 696-704 (2001).
  29. Gautier, C., et al. Hybridization-induced interfacial changes detected by non-faradaic impedimetric measurements compared to faradaic approach. J. Electroanal. Chem. 610, 227-233 (2007).
  30. Ma, Y., Jiao, K., Yang, T., Sun, D. Sensitive PAT gene sequence detection by nano-SiO2/p-aminothiophenol self-assembled films DNA electrochemical biosensor based on impedance measurement. Sensor. Actuat. B-Chem. 131, 565-571 (2008).
  31. Kim, J. H. -S., Marafie, A., Jia, X. -Y., Zoval, J. V., Madou, M. J. Characterization of DNA hybridization kinetics in a microfluidic flow channel. Sensor. Actuat. B-Chem. 113, 281-289 (2006).
  32. Dykstra, P. H., Roy, V., Byrd, C., Bentley, W. E., Ghodssi, R. Microfluidic electrochemical sensor array for characterizing protein interactions with various functionalized surfaces. Anal. Chem. 83, 5920-5927 (2011).
  33. Ben-Yoav, H., Dykstra, P. H., Bentley, W. E., Ghodssi, R. A Microfluidic-based electrochemical biochip for label-free diffusion-restricted DNA hybridization analysis. Biosens. Bioelectron. 38, 114-120 (2012).
  34. Wink, T., van Zuilen, S. J., Bult, A., van Bennekom, W. P. Self-assembled monolayers for biosensors. Analyst. 122, 43R-50R (1997).
  35. McEwen, G. D., Chen, F., Zhou, A. Immobilization, hybridization, and oxidation of synthetic DNA on gold surface: Electron transfer investigated by electrochemistry and scanning tunneling microscopy. Anal. Chim. Acta. 643, 26-37 (2009).
  36. Arinaga, K., Rant, U., Tornow, M., Fujita, S., Abstreiter, G., Yokoyama, N. The role of surface charging during the coadsorption of mercaptohexanol to DNA layers on gold: Direct observation of desorption and layer reorientation. Langmuir. 22, 5560-5562 (2006).
  37. Katz, E., Willner, I. Probing biomolecular interactions at conductive and semiconductive surfaces by impedance spectroscopy: Routes to impedimetric immunosensors, DNA-sensors, and enzyme biosensors. Electroanalysis. 15, 913-947 (2003).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics