Generation of Recombinant Human IgG Monoclonal Antibodies from Immortalized Sorted B Cells

1School for Mental Health and Neuroscience, Maastricht University, 2Department of Neurosciences, Institut d'Investigació Germans Trias i Pujol
* These authors contributed equally
Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Synthesis of human monoclonal antibodies is the first step in studies aimed at unraveling the pathophysiological mechanisms of auto-antibody-mediated immune responses. We have developed a protocol to generate recombinant human immunoglobulin G (IgG) monoclonal antibodies from blood sorted B cells, including B-cell isolation, antibody cloning and in vitro synthesis.

Cite this Article

Copy Citation | Download Citations

Nogales-Gadea, G., Saxena, A., Hoffmann, C., Hounjet, J., Coenen, D., Molenaar, P., Losen, M., Martinez-Martinez, P. Generation of Recombinant Human IgG Monoclonal Antibodies from Immortalized Sorted B Cells. J. Vis. Exp. (100), e52830, doi:10.3791/52830 (2015).

Abstract

Finding new methods for generating human monoclonal antibodies is an active research field that is important for both basic and applied sciences, including the development of immunotherapeutics. However, the techniques to identify and produce such antibodies tend to be arduous and sometimes the heavy and light chain pair of the antibodies are dissociated. Here, we describe a relatively simple, straightforward protocol to produce human recombinant monoclonal antibodies from human peripheral blood mononuclear cells using immortalization with Epstein-Barr Virus (EBV) and Toll-like receptor 9 activation. With an adequate staining, B cells producing antibodies can be isolated for subsequent immortalization and clonal expansion. The antibody transcripts produced by the immortalized B cell clones can be amplified by PCR, sequenced as corresponding heavy and light chain pairs and cloned into immunoglobulin expression vectors. The antibodies obtained with this technique can be powerful tools to study relevant human immune responses, including autoimmunity, and create the basis for new therapeutics.

Introduction

The goal of this article is to describe in detail a methodology to generate and characterize human IgG monoclonal antibodies obtained from human peripheral blood mononuclear cells (PBMCs).

The interest to study human antibodies has grown in many different fields of research. In particular, many research groups are interested in the pathology caused by auto-antibodies1-3. We have cloned and characterized pathogenic auto-antibodies1. The study of auto-antibodies can help to identify their targets and to develop therapeutic strategies, e.g., using competitor antibodies4. Moreover, the study of human antibodies can also be of interest in other fields of research, i.e., to evaluate the immune response after vaccination5, to characterize the antibody profile of individuals that were exposed and became resistant to specific pathogens6 or to study which antibodies are in the natural repertoire7,12.

Several techniques have been developed to generate recombinant human monoclonal antibodies8-12; most of these use phage display and B-cell immortalization. The use of phage display has been extensively applied for the discovery of new antibodies13. However it has a major disadvantage, namely that the heavy and light chain pairs of the human immunoglobulin become dissociated in the process. Production of hybridomas with human B cells or EBV transformation overcomes this drawback.

We use infection of thymic B cells with EBV in combination with polyclonal B cell stimulation via Toll-like receptor 9 (TLR-9)6,12.

In this paper, we describe in detail the technology that we use for the development of IgG human antibodies, with a complete overview of all the steps from PBMC isolation to the in vitro antibody generation. This protocol can be used for the analysis of any type of human IgG profile. In our laboratory, B cells producing IgG antibodies have been successfully separated from the rest of PBMCs after sorting. Fifty sorted B cells8 can then be plated in multi-well plates and immortalized by EBV and TLR-9 activation, for the clonal expansion of single B cells. As feeder cells, fibroblasts from human embryonic lung tissue have been used, cell line wi38, which facilitates the visualization of the immortalized B cells. From these B cells, the sequences of the heavy and light chains of the immunoglobulin can be obtained by PCR, and the antibodies' genes cloned in immunoglobulin G expression vectors and produced in vitro. Using this technique, single antibodies with exactly the same antibody sequence found in the donor can be studied.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Informed consent was obtained from the participants of the study. The study was approved by the institutional ethics committee.

1. Isolation of Peripheral Blood Mononuclear Cells (PBMCs)

  1. Centrifuge 25 ml of the participants’ heparinized blood at 900 x g for 15 min, as soon as possible after the blood extraction. If there is less blood, scale down the reagents accordingly. Perform all the next steps in a hood.
  2. Transfer the serum to a clean tube. It can be used in later steps for freezing PBMCs or in case of autoimmune patients, to test auto-antibodies.
  3. Dilute the blood with 10 ml of RPMI 1640 media and resuspend the cells by pipetting up and down.
  4. Add 15 ml of a solution containing polysucrose and sodium diatrizoate (1.077 g/ml) to a new 50 ml tube.
  5. Gently layer the blood on top of the solution in step 1.4 by bringing the two openings of the tubes close together until the two liquids come very slowly in contact, and then decant the PBMC suspension slowly on top of the 50 ml tube. This step is critical to have a good separation of the PBMCs.
  6. Centrifuge the tube obtained in step 1.5 at 400 x g without brake at RT for 20 min.
  7. After the centrifugation, recover with the pipet the white ring that appears in the middle part of the tube, which contains the PBMCs.
  8. Wash the cells with 25 ml of RPMI 1640 media.
  9. Centrifuge 300 x g at RT for 10 min.
  10. Discard the supernatant and wash the cells with 10 ml of RPMI 1640. Centrifuge again as in step 1.9.
  11. Count the PBMCs with a Neubauer chamber as previously reported14.
  12. Process the PBMCs as in section 2 or store them for later use as follows: 10 million PBMCs for freezing per Cryovial tube diluted in 1 ml of 10% dimethyl sulfoxide (DMSO) and 90% serum obtained in step 1.2. Freeze progressively and for long storage in liquid nitrogen.

2. Staining PBMCs for Sorting CD22+ and IgG+ by Cell Cytometry

  1. Plate the PBMCs in a 25 cm2 cell culture flask with 6 ml of complete RPMI 1640 medium (supplemented with L-glutamine, 10 mM HEPES buffer, 50 U/ml penicillin, 50 µg/ml streptomycin and 10% of fetal bovine serum) and let them recover O/N in the incubator at 37 °C at 5% CO2.
  2. Block sterile FACS tubes with sterile 4% albumin phosphate buffered saline (PBS) solution O/N. Wash the tubes twice with PBS and fill them with 500 µl of complete RPMI 1640 medium. Use these tubes for recovering the cells after sorting.
  3. Collect the PBMCs in a tube and centrifuge at 400 x g at RT for 5 min.
  4. Resuspend the cells in labeling buffer (see steps 2.5 and 2.6) and count them14. The labeling buffer is sterile 2% fetal bovine serum and 1 mM ethylenediaminetetraacetic acid (EDTA) in PBS.
  5. Prepare 3 fluorescence-activated cell sorting (FACS) tubes with 105 cells each and resuspend them in 100 µl of labeling buffer. These tubes will serve for defining the gates of the sorting.
    1. In the first tube add 5 µl of anti CD22 PerCP antibody (recommended in manufacturer’s datasheet), in the second tube 20 µl of anti IgG PE (recommended in manufacturer’s datasheet), and nothing in the third tube. Incubate on ice and in dark during 30 min.
  6. Resuspend 5 million cells in 200 µl of labeling buffer in a FACS tube and add 10 µl of anti CD22 PerCP and 40 µl of anti IgG PE. Incubate the cells on ice and dark during 30 min. If the sorting of a higher number of cells is desired, scale up all the reagents.
  7. Centrifuge cells at 400 x g with a low brake for 5 min at RT.
  8. Decant softly the supernatant.
  9. Resuspend the cells in 500 µl of labeling buffer. Centrifuge cells at 400 x g with a low brake for 5 min at RT. Repeat steps 2.7 and 2.8
  10. Decant softly the supernatant and resuspend the cells in 300 µl of RPMI complete media.
  11. Pass the cells through a 0.45 µm filter. Cells are ready to sort.

3. Sorting of the B Cells CD22+ and IgG+

  1. Use 3 control tubes to establish the viability of the cells. In the control with no staining, use the forward and size scatter plot to define the lymphocyte gating. The controls with the CD22 PerCP and anti-IgG PE serve to establish the gates, and the sorting gate. Perform following previously reported data15.
    Note: A gate is a set of value limits (boundaries) that serve to isolate a specific group of cytometric events, in our case cells, from a large set. In the case of a sorting gate the value limits allows the recovery of the cytometric events, cells, which are inside of the boundaries defined: CD22+ and IgG+.
  2. As a collection tube in the sorting, use the blocked tubes with 500 µl of complete RPMI 1640 medium, obtained from step 2.2.
  3. Proceed to sort double positive15: CD22+ IgG+. Note the final number of cells in each condition. Plate sorted cells on top of feeder cells as soon as possible.

4. Irradiation of Feeder Cells

Note: Perform the preparation of the feeder cells between 1 - 3 days before sorting. At least 5,000 wi38 cells are needed per well in a 96 round well plate. Perform steps 4.1, 4.2 and 4.4 in a hood.

  1. Cultivate the wi38 cells at 37 °C and 5% CO2 in complete RPMI 1640 medium (same as for PBMCs) until the desired number of cell are reached.
  2. Irradiate them at 50 Grays, following a protocol described before16 . Perform irradiation once the wi38 cells have been trypsinized and resuspended in complete RPMI medium, or with wi38 attached to the culture flask and trypsinized after the irradiation. Follow the method for trypsinization indicated by the supplier of wi38 cells. Irradiate the number of cells necessary to cover the wells needed for plating IgG+ B cells (1% of the total PBMC counted in step 1.11).
  3. Plate 90 µl containing 5,000 irradiated wi38 cells in each well of the 96 round well plate. Leave the wells in the outside row of the plate empty (because they evaporate faster), and only use the 60 wells in the middle of the plate for plating cells. Fill the outer wells that are framing the plate with 200 µl of PBS.
  4. Place them in an incubator at 37 °C at 5% CO2, until needed.

5. Plating Sorted PBMCs, EBV Infection and Growing

  1. Dilute the sorted PBMCs, to plate 50 cells in 50 µl of RPMI 1640 complete medium per well in the 96 round well plate (previously plated with wi38 irradiated cells). Perform steps in a hood equipped for EBV work.
    Note: the infection of 50 cells per well is optimized and increases the likehood to produce a monoclonal antibody8, however, it is recommended to verify this by PCR as described before1,6.
  2. Add 60 µl of EBV supernatant (containing 3 - 4 x 108 viral copies/ml) to each well in the 96 round well plate17. CAUTION should be taken during EBV work.
  3. Add 1 µg/ml of CpG (ODN2006) per well.
  4. Leave the cells in an incubator at 37 °C at 5% CO2.
  5. Visually monitor clone growing under the microscope after one week.
    Note: Some examples of B cell growth can be seen below in the results section. Notice that growth rates of the clones may vary, and extra time might be necessary to start seeing some cell mass growing in the middle of the well.
  6. After the 1st two weeks monitor clone growing under the light microscope and proceed to the first media exchange. Slowly pipet 90 µl of medium from the top part of the well and collect in a clean 96-well plate. (B cells lie in the bottom of the well, so there is no risk to aspirate them). 
    1. Add to each well 100 µl of complete RPMI 1640 media supplemented with 1 µg/ml of CpG (ODN2006) and 50 U/ml of IL2. If clones are growing, analyze this first media exchange by ELISA as in step 6.
  7. Monitor clone growing and change media after the 3rd and the 4th week of growing again by taking 90 µl of media and adding 100 µl of complete RPMI 1640 media supplemented with 1 µg/ml of CpG (ODN2006) and 50 U/ml of IL2. Use the collected supernatant to monitor IgG production by ELISA as in step 6.
    Note: After one month clone growing should be evident by observing aggregates of round cells that usually lie in the middle of the round bottom well.
  8. At this step, change media in the same way that the previous weeks but only with complete RPMI 1640 media. A good indicator to know the right moment to change media is the media color, if it is becoming yellowish cells need a media exchange.
  9. When 96-well plates are containing big clones (approximately 5 x 105 cells), transfer them to a flat well of a 24-well plate. Add 300 µl of complete RPMI 1640 media to the new well. Resuspend the 96-well growing clone, by pipetting up and down several times, and transfer cells to the new well, distributing homogeneously. Add new media when needed.
    1. When wells of the 24-well plate are full of cells (approximately 5 x 106 cells), transfer to a flat well of a 6-well plate. Add 2 ml of complete RPMI 1640 media to the new well. Resuspend the cells in the 24-well plate by pipetting up and down several times, and distribute them homogeneously in the new well.
  10. Add media when needed. If cells are not to be maintained in culture, pellet the cells at 400 x g for 5 min at RT. Store the supernatants for ELISA testing. Wash the pellet of cells once with 1 x PBS, centrifuge again at 400 x g for 5 min, and stored dry at -80 °C until RNA extraction.
    1. When the cells in the 6-well plate become confluent (approximately 20 x 106 cells), transfer to a 60 mm culture plate. Add 4 ml of complete RPMI 1640 media to the new plate. Resuspend the cells in 6-well plate and transfer them as done is steps 5.9 and 5.10.
  11. Add new media when needed. At this step, freeze cells at 10 – 30 million/ml in 90% fetal calf serum and 10% DMSO. If larger amounts of cells are wanted, continue expansion of the clones in bigger surface plates.

6. ELISA for IgG Antibody Detection

  1. Dispense 50 µl/well in a ELISA plate of goat F(ab)2 anti-human Fc antibody diluted 1 200 in coating buffer. Coating buffer contains 50 mM Na2CO3 pH 9.6.
  2. Seal the plates with a plastic sticker, and incubate 1 hr at 37 °C. Alternatively, incubate at 4 °C O/N.
  3. Wash each well 6 times with 200 µl of washing buffer. Washing buffer contains 0.05% Tween-20 in 1 x PBS. Do not touch or scratch the well surface where the antibody has bound.
  4. Block with blocking buffer, 100 µl/well. Blocking buffer contains 4% of non-fat dry milk in PBS. Seal the plate and incubate 1 hr at 37 °C.
  5. Do not wash. Discard blocking buffer and slap the plate 3 times upside down on a paper towel to remove residual liquid.
  6. Incubate clones’ supernatants and standards.
    1. For a first test, dilute clone supernatants obtained in step 5.6 or 5.7 1/3 in RPMI. For the standards dilute with RPMI medium human IgG solution to get: 1,000 ng/ml, 500 ng/ml, 250 ng/ml, 125 ng/ml, 62.5 ng/ml, 31.25 ng/ml, 15.6 ng/ml and blank. Use 50 µl/well and incubate at 37 °C for 60 min. Analyze further dilutions of the clone’ supernatant to test the antibody affinity, such as 1/10 or 1/100.
  7. Wash as done in step 6.3.
  8. Use 50 µl/well of goat F (ab)2 anti-human IgG Fc peroxidase conjugated diluted 1:20,000 in incubation buffer. Incubation buffer contains 1% BSA and 0.02% Tween 20 in 1x PBS. Incubate at 37 °C for 60 min.
  9. Wash as done in step 6.3.
  10. Add 100 µl/well substrate solution containing 0.1% 3,3’,5,5’-Tetramethylbenzidine (TMB). Incubate 10 min until a stable blue color forms in the wells. Be careful; do not wait too long!
  11. Stop the reaction by adding 50 µl of 2 M H2SO4. Measure the absorption at 450 nm, within 30 min after stopping the reaction.
    Note: All the clones’ supernatants with 3 standard deviations over the blank will be considered positive for IgG human antibodies. For confirmation of the positive clones this ELISA should be repeated at least three times in different supernatants of the same clone. Also to discard the possibility of unspecific cross reactivity is recommended to assure that there is no signal when supernatants are incubated in uncoated but blocked wells. At this step, a detection assay to screen for the antigenic specificity of the antibodies of interest can be performed prior to proceed to section 7.

7. RNA Isolation and First Strand cDNA Synthesis of the Producing IgG Clones

  1. As soon as the production of IgG is confirmed by ELISA, extract the RNA of the clone.
  2. For extracting RNA from cells growing in steps 5.7 or 5.9, use the superscript III cells direct cDNA synthesis kit, which allows obtaining DNA from 10,000 cells to one cell.
  3. For extracting RNA from larger amounts of cells, or from the pellet stored in step 5.11 use the high pure RNA isolation kit. Other systems of RNA extraction can also be suitable at this step. Follow the instructions of the manufacturer.
  4. For cell numbers between 1 x 106 and 1 x 104 use the reverse transcription system, following the instruction of the manufacturer. Other systems for first strand cDNA synthesis can also be used.

8. 1st and 2nd PCR for Amplification of the Heavy and Light Chains of the IgG-producing B-cell Clones

  1. With the cDNA of the cell clones, obtained in step 5.6 and 5.7 and positive in the IgG ELISA in step 6, perform PCR with the primers listed in Table 1.
  2. Set up independent PCRs for each IgG heavy, kappa and lambda chain. Make a stock solution with forward and reverse primers in equal concentrations. Add them to the reaction at 0.4 µM final concentration.
  3. Use 1 µl of the cDNA synthesis to perform the 1ST PCR. Here, perform 20 µl reactions using Takara Taq manufacturer instructions. Alternatively, use other polymerases.
  4. Place the 1st PCR under the following cycle conditions: 94 °C for 5 min; (50 cycles of: 94 °C for 30 sec; 58 °C for 30 sec, and 72 °C for 45 sec; 72 °C for 7 min; let it cool down at 4 °C.Include a blank in the reaction, to detect possible contaminations.
  5. Prepare 1x TBE (89 mM Tris-borate and 2 mM EDTA). In a volume of 100 ml of 1x TBE add 1 g of agarose (1% agarose gel). Heat the solution in the microwave for approximately 1 min, until the agarose gets dissolved. Then add 4 µl of 10 mg/ml ethidium bromide (or equivalent DNA dye) and mix.
    1. Pour the content in a tray and wait until gets polymerized. Run 5 µl of the PCR mix in the gel to visualize the bands. Heavy chain fragments should be around 400 - 550 bp, while light chain should be around 300 - 400 bp. If the bands are not detected, proceed likewise to 2nd PCR.
  6. Use 1 µl of the first PCR mix to perform the 2nd PCR. Use the same reagents that in step 8.2 but using the suitable mix of primers (see Table 1). For the 2nd PCR use the following conditions: 94 °C for 5 min; (50 cycles of: 94 °C for 30 sec; 56.5 °C for 30 sec and 72 °C for 55 sec); 72 °C for 7 min; let it cool down at 4 °C. Include a blank in the reaction, to detect possible PCR contaminations.
  7. Prepare an agarose gel as described in 8.5. Run the gel to visualize the PCR product as in 8.5.1 Use the amplifications which contain the right size fragments for cloning in step 9 and produce the antibodies in step 10.
  8. Sequence the DNA, by using 10 µl reaction containing: 100 ng of the 2nd PCR, 0.2 µM of the primer or primer mix, 1 µl of the terminator and 1 µl of the buffer. Perform the sequencing reaction under these conditions: (25 cycles of: 96 °C for 10 sec; 50 °C for 5 sec; and to 60 °C for 4 min); 60 °C for 7 min; let it cool down at 4 °C.
  9. Purify the sequencing reactions with microspin G50 columns following manufacturer’s instructions. Evaluate the sequences of the ligation in an automatic sequence analyzer as described before18 . Electropherograms should be clean and correspond to a single immunoglobulin sequence.
    Note: If the PCR products show unclear or mixed immunoglobulin sequences, please consider to clone them using the TopoTA system, to obtain isolated sequences and then proceed to step 9.

9. Cloning and Sequencing of the Heavy and Light Chains of the Producing IgG clones

  1. Prepare 1 µg of DNA of vectors pFUSE2ss-CLIg-hk, pFUSE2ss-CLIg-hl2 and pFUSEss-CHIg-hG1.
  2. Digest these vectors with the appropriate restriction enzymes. Use EcoRI and BsiWI for pFUSE2ss-CLIg-hk, EcoRI and AvrII for pFUSE2ss-CLIg-hl2, and EcoRI and NheI for pFUSEss-CHIg-hG1. Use 3 units of each restriction enzyme for 1 µg of DNA of vector.
    1. Digest with one enzyme and purify the digested product with a PCR Purification Kit. Digest with the second enzyme and purify with a Gel Extraction Kit (according to manufacturer’s protocol). Cut the fragment of interest from the agarose gel. Prepare agarose gel as in step 8.5.
  3. Digest the 2nd PCR products of the producing IgG clone: EcoRI and BsiWI for kappa chain amplification, EcoRI and AvrII for lambda chain amplification, and EcoRI and NheI for heavy chain amplification. Digest with one enzyme and purify the digested product with a PCR Purification Kit. Digest with the second enzyme and purify the digested product with a PCR Purification Kit. Use same units of enzymes and DNA amount as in step 9.2.
  4. Ligate the PCR fragments inside of the vectors with T4 DNA ligase 16 °C O/N following manufacturer’s recommendations. The ratio used should be 1 : 2 (vector : insert).
  5. Use 1 µl of the ligation to transform DH5α bacteria. Follow DH5α manufacturer’ conditions for transformation. Spread bacteria in blasticidin or zeocin plates, depending on the type of vector used. Incubate the plates O/N at 37 °C.
  6. Grow single colonies, and extract DNA with a miniprep kit, following manufacturer’ instructions. Use for single colony grow and DNA extraction the manufacturer’s, recommendations from the DNA miniprep kit. Analyze them by digestion with the enzymes used for preparing vectors and inserts as in steps 9.2 and 9.3.
  7. Sequence the DNA, by using 100 ng of the vector as done in steps 8.8 and 8.9.

10. Production of Antibodies in HEK cells

  1. Grow HEK cells in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% fetal calf serum, 1% L-glucose, 1% penicillin/streptavidin (DMEM+) to a confluency of 75% in a 150 mm cell culture plate. Perform in a hood steps 10.1 to 10.7.
  2. Before transfection, exchange the medium to medium as before but without fetal calf serum.
  3. For each heavy, light chain transfection, prepare a transfection mix with 2.5 ml of the DMEM (without serum), 9 µg of the vector with the heavy chain , 6 µg of the vector with the light chain, and 100 µl of polyethylenimine (PEI) solution (from a 1 µg/µl stock). Incubate at RT for 15 min.
  4. Gently add 2.5 ml of the transfection mix prepared in step 10.3 to the HEK cells in the plate. Rock the plate to distribute homogeneously.
  5. Incubate the cells in the incubator at 37 °C with 5% CO2 for 24 hr.
  6. Change the culture medium to medium without fetal calf serum.
  7. Collect the medium from the plates 4 days later.
    Note: The antibodies in the media can be used to characterize their reactivity in vitro and in vivo.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

The sorting gating after staining CD22 and IgG positive cells is shown in Figure 1. In this image the area of the double positive cells – B cells producing IgG antibodies – is selected to sort all these cells in a separate tube. In the analysis, approximately 1% of the total PBMCs correspond to this double positive population. The number of sorted cells obtained will depend on the number of cells obtained in section 1.

The different outcomes after 5 weeks of EBV immortalization and CpG (ODN2006) stimuli are shown in Figure 2. The detection of the growing clones is easy; Wi38 feeder cells have a more elongated fibroblast shape, and the B cell clones appear as very small round cells growing clustered in the middle of the round bottom multi-well plate. At this stage, it is evident that some clones start growing. However, the growing speed can be variable and of course some of the wells containing immortalized cells may not have any cells growing at all.

The supernatant of the growing clones is tested in an ELISA for detecting IgG as shown in Table 2. In this ELISA a standard curve for IgG is tested, together with the supernatant of the clones and the blanks. A positive clone is considered when the value in the ELISA is 3 standard deviations over the blank value. Negative clones’ values are under the 3 standard deviations of the blank. For confirmation, positive clones should be positive in the ELISA at least three times in different supernatants of the same clone and if possible verified by an additional screening method.

The complete sequence of a human IgG antibody obtained applying the steps described in this manuscript is shown in Figure 3. This sequence has been obtained after cloning the immunoglobulin heavy and lambda chain pair from a clonally expanded B cell. Variable and constant regions of the heavy and light chain can be characterized with this technique. After obtaining the sequences, antibodies sequences can be cloned and produced in vitro in HEK cell cultures.

Figure 1
Figure 1. Flow cytometric analysis of CD22+ and IgG+ cells from human peripheral blood mononuclear cells. (A) Selection of the population of living cells is shown in P1. (B) Forward scatter plot. (C) Size scatter plot. (D) The Y axis shows cells separated by anti-CD22-PerCP and on the X axis separated by IgG-PE. P4 square indicates the cell fraction that has been sorted (CD22+, IgG+) and recovered for culture. Please click here to view a larger version of this figure.

Figure 2
Figure 2. Representative image of B cell immortalized clones in a 96 well-plate after 5 weeks of culture. (A) In this well no immortalization was observed after 5 weeks, but wi38 irradiated feeder cells can be observed. (B) A slowly growing clone was observed in this well, with tiny round aggregates in the middle. (C) Fast growing clone showing round aggregates of immortalized B cells. Please click here to view a larger version of this figure.

Figure 3
Figure 3. Human antibody sequences of heavy and light chain pair from a human immortalized B cell clone, F5.2, indicating V CDR1, CDR2 and CDR3 sequences. Please click here to view a larger version of this figure.

1st PCR primers
Forward (5’-3’) Reverse (3’-5’) 
IgG 5′ L-VH 1 ACAGGTGCCCACTCCCAGGTGCAG 3′ Cγ CH1 GGAAGGTGTGCACGCCGCTGGTC
5′ L-VH 3 AAGGTGTCCAGTGTGARGTGCAG
5′ L-VH 4/6 CCCAGATGGGTCCTGTCCCAGGTGCAG
5′ L-VH 5 CAAGGAGTCTGTTCCGAGGTGCAG
κ 5′ L Vκ 1/2 ATGAGGSTCCCYGCTCAGCTGCTGG 3′ Cκ 543 GTTTCTCGTAGTCTGCTTTGCTCA
5′ L Vκ 3 CTCTTCCTCCTGCTACTCTGGCTCCCAG 3′ Cκ 494 GTGCTGTCCTTGCTGTCCTGCT
5′ L Vκ 4 ATTTCTCTGTTGCTCTGGATCTCTG
5′ Pan Vκ ATGACCCAGWCTCCABYCWCCCTG
λ 5′ L Vλ 1 GGTCCTGGGCCCAGTCTGTGCTG 3′ Cλ CACCAGTGTGGCCTTGTTGGCTTG
5′ L Vλ 2 GGTCCTGGGCCCAGTCTGCCCTG
5′ L Vλ 3 GCTCTGTGACCTCCTATGAGCTG
5′ L Vλ 4/5 GGTCTCTCTCSCAGCYTGTGCTG
5′ L Vλ 6 GTTCTTGGGCCAATTTTATGCTG
5′ L Vλ 7 GGTCCAATTCYCAGGCTGTGGTG
5′ L Vλ 8 GAGTGGATTCTCAGACTGTGGTG
2nd PCR primers
Forward (5’-3’) Reverse (3’-5’) 
IgH 5′ EcoRI VH1 CAACCGGAATTCGCAGGTGCAGCTGG
TGCAG
3′ NheI JH 1,2,4,5 CTGCTAGCTAGCTGAGGAGACGGT
GACCAG
5′ EcoRI VH1 to 5 CAACCGGAATTCAGAGGTGCAGCTG
GTGCAG
3′ NheI JH 3 CTGCTAGCTAGCTGAGAGACGGTGA
CCATTG
5′ EcoRI VH3 CAACCGGAATTCAGAGGTGCAGCTG
GTGGAG
3′ NheI JH 6 CTGCTAGCTAGCTGAGGAGACGGTG
ACCGTG
5′ EcoRI VH3 23 CAACCGGAATTCAGAGGTGCAGCT
GTTGGAG
5′ EcoRI VH4 CAACCGGAATTCACAGGTGCAGCT
GCAGGAG
5′ EcoRI VH 4 34 CAACCGGAATTCACAGGTGCAGCTAC
AGCAGTG
5′ EcoRI VH 1 18 CTTCCGGAATTCACAGGTTCAGCT
GGTGCAG
5′ EcoRI VH 1 24 CTTCCGGAATTCACAGGTCCAGCT
GGTACAG
5′ EcoRI VH3 33 CTTCCGGAATTCACAGGTGCAGCT
GGTGGAG
5′ EcoRIVH 3 9 GATCCGGAATTCAGAAGTGCAGCT
GGTGGAG
5′ EcoRI VH4 39 GATCCGGAATTCACAGCTGCAGCT
GCAGGAG
5′ EcoRI VH 6 1 GATCCGGAATTCACAGGTACAGCT
GCAGCAG
κ 5′ EcoRI Vκ 1 5 CAACCGGAATTCAGACATCCAGATGA
CCCAGTC
3′ BsiWI Jκ 1 to 4 GCCACCGTACGTTTGATYTCCACCTTGGTC
5′ EcoR1 Vκ 1 9 CTTCCGGAATTCAGACATCCAGTTGAC
CCAGTCT
3′ BsiWI Jκ 2 GCCACCGTACGTTTGATCTCCAG
CTTGGTC
5′ EcoR1 Vκ 1D 43 CTTGGCGAATTCAGCCATCCGGATGA
CCCAGTC
3′ BsiWI Jκ 3 GCCACCGTACGTTTGATATCCACT
TTGGTC
5′ EcoR1 Vκ 2 24 CTTCCGGAATTCAGATATTGTGATGA
CCCAGAC
5′ EcoR1 Vκ 2 28 CTTCCGGAATTCAGATATTGTGATG
ACTCAGTC
5′ EcoR1 Vκ 2 30 CTTCCGGAATTCAGATGTTGTGATGA
CTCAGTC
5′ EcoR1 Vκ 3 11 CTTCCGGAATTCAGAAATTGTGTTG
ACACAGTC
5′ EcoR1 Vκ 3 15 CTTCCGGAATTCAGAAATAGTGATG
ACGCAGTC
5′ EcoR1 Vκ 3 20 CTTCCGGAATTCAGAAATTGTGTTGA
CGCAGTCT
5′ EcoR1 Vκ 4 1 CTTCCGGAATTCAGACATCGTGATG
ACCCAGTC
λ 5′ EcoR1 Vλ 1 CTTCCGGAATTCACAGTCTGTGCT
GACKCAG
3′ AvrII Jλ 1 to 3 CTGGTTACCTAGGAGGACGGTSACCT
TGGTCCC
5′ EcoR1 Vλ 2 CTTCCGGAATTCACAGTCTGCCC
TGACTCAG
3′ AvrII Jλ 4 CTGGTTACCTAGGAAAATGATCAGC
TGGGTTCC
5′ EcoR1 Vλ 3 CTTCCGGAATTCATCCTATGAGC
TGACWCAG
3′ AvrII Jλ 5 CTGGTTACCTAGGAGGACGGTCAGC
TCGGTCCC
5′ EcoR1 Vλ 4 to 5 CTTCCGGAATTCACAGCYTGTG
CTGACTCA
3′ AvrII Jλ 6 CTGGTTACCTAGGAGGACGGTCAGCT
GGGTGCC
5′ EcoR1 Vλ 6 CTTCCGGAATTCAAATTTTATGC
TGACTCAG
3′ AvrII Jλ 7 CTGGTTACCTAGGAGGACGGTCAC
TTGGTCCAT
5′ EcoR1 Vλ 7 to 8 CTTCCGGAATTCACAGRCTGTG
GTGACYCAG

Table 1. Primers used.

1 2 3 4 5 6 7 8 9 10 11 12
A 0.076 0.077 2.003 0.080 0.138 0.102 0.188 0.338 0.040 2.041 0.051 0.081
B 2.011 0.085 0.074 0.069 0.081 0.122 0.372 2.133 0.119 0.097 0.072 0.072
C 0.068 0.179 0.091 0.073 0.077 0.097 0.606 1.882 0.081 2.071 0.094 0.075
D 0.063 0.070 0.065 0.071 0.082 2.071 0.339 2.089 0.076 0.086 0.066 0.069
E 1.921 0.077 0.065 0.085 0.095 1.968 1.910 0.122 0.072 0.070 0.065 0.066
F 0.113 0.068 0.066 0.082 0.088 0.090 0.460 0.070 0.079 0.952 0.098 0.065
G 2.041 2.108 1.472 0.665 0.331 0.194 0.123 0.094 0.080 0.072 0.070 0.072
H 2.146 2.132 1.634 0.665 0.341 0.178 0.132 0.094 0.082 0.080 0.074 0.068
Standards ng/µl 1000 500 250 125 62.5 31.25 15.6 7.8 3.9 1.95 0.975 0

Table 2. Representative results of IgG screening by ELISA. Clone supernatants are in A1-A10, B1-B10, C1-C10, D1-D10, E1-E10, F1-F10. Blanks are in A11, B11, C11, D11, E11, F11, A12, B12, C12, D12, E12, F12.Standard curve is duplicated: G1-G12 and H1-H12. The corresponding concentration of immunoglobulins in each duplicate is shown below.Positive or IgG producing clones are shown in dark grey. Negative or non-IgG producing clones are shown in light grey

Subscription Required. Please recommend JoVE to your librarian.

Discussion

In this manuscript, all the steps for the generation of IgG antibodies from human PBMCs are presented in detail. This protocol includes some advantages over previously published techniques. One of the advantages is that the antibody produced keeps the heavy and light chains corresponding to the original pair in the B cell clone. The identification of IgG antibodies can be done in any type of human donor, and there is no need for exacerbation of the immune response due to vaccination5. The use of the fibroblast cell line wi38 as a feeder cell, allows a more rapid detection of the growing clones, since they are morphologically different and very easy to differentiate, compared to the PBMCs used as feeder cell in previously described works1,6-8. Moreover the use of wi38 as a feeder cell favors the freezing of big amounts of cell aliquots that can be easily thawed and cultured before every experiment.

One of the critical steps in this protocol is the starting material: the PBMCs. If the blood has been waiting too long for centrifugation, or after the extraction of the PBMCs, they are not stored in the appropriate freezing conditions; as such the number of viable cells will be reduced, along with the number of the B cell IgG producing clones obtained. For that reason, an early extraction and a good preservation of the PBMCs are recommended for a successful outcome. The number of IgG producing clones will be limited to the number of PBMCs at the beginning of the experiment. Higher numbers of PBMCs will give higher numbers of IgG producing clones and a diverse antibody production. Another critical step is the cloning of the PCR fragments of the light and heavy chains of the antibody. If the ligation is not successful after several attempts, an extra step of cloning the 2nd PCR product in a TopoTA system is recommended. The digestion of the insert with the appropriate enzymes can be easier in the TopoTA vector, for a subsequent ligation in the pFUSEss expression vectors.

This technique can be transferred to any type of human tissue in which human B cells are enriched3. It can also be applied to the study of other types of immunoglobulins, just by changing the labelled antibodies used for sorting (antibodies against IgM, IgE, IgA or IgD), the primer design for the PCR, and the expressing vectors. The studies of these immunoglobulins can be of interest to understand, initial immune responses, mucosa antibody secretion and allergy profiles, among others.

In conclusion, we have described a technique to produce human recombinant monoclonal IgG antibodies that leaves the heavy and light chains pairs of the human immunoglobulin intact. The technique is useful and easy to perform starting from a blood sample. The monoclonal antibodies obtained through this method are potentially useful in studies on human immune responses. Furthermore, monoclonal antibodies produced with this method might be a good starting point for the development of immuno-therapeutics for different pathological conditions.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

The authors declare that they have no competing financial interests.

Acknowledgments

Research contract Miguel Servet (ISCIII CD14/00032) to (G.N.-G.). Fellowship from the Netherlands Organization for Scientific Research “Graduate School of Translational Neuroscience Program” (022005019) to (C.H.).

Grants from the Prinses Beatrix Fonds (Project WAR08-12) and the Association Française contre les Myopathies to (P.M.-M.); as well as by a Veni Fellowship of the Netherlands Organization for Scientific Research (916.10.148) a fellowship of the Brain Foundation of the Netherlands (FS2008(1)-28) and the Prinses Beatrix Fonds (Project WAR08-12) (to M.L.).

We thank Jozien Jaspers for her help in the B-cell sorting by flow cytometry.

Materials

Name Company Catalog Number Comments
Histopaque-1077  Sigma-Aldrich 10771 solution containing polysucrose and sodium diatrizoate
FACSAria II cell sorter  BD Biosciences 
96 U-bottom micro well plates  Costar 3799
Advanced Roswell Park Memorial Institute (RPMI) 1640 medium  Gibco, Life Technologies 12633-020
30% v/v EBV-containing supernatant of the B95-8 cell line   ATCC CRL-1612 3.4 x 108 copies/ml
CpG2006  Invivogen ODN 7909
Wi38 cells  Sigma-Aldrich 90020107
Interleukin-2 Roche  10799068001
ELISA plates Greiner Bio-One, Microlon 655092
AffiniPure F(ab')2 Fragment Goat Anti-Human IgG, Fcγ Fragment Specific (unconjugated) Jackson ImmunoResearch 109-006-008
4% non-fat dry milk (Blotting Grade Blocker)  Biorad 170-6404
Human IgG  Sigma I 2511 HUMAN IgG purified Immunoglobulin, 5.6 mg/ml
Goat F(ab)2 antihuman IgG Fcγ (conjugated with peroxidase (PO)) Jackson ImmunoResearch 109-036-008
ELISA reader (Perkin Elmer 2030)  Perkin Elmer  2030-0050
Peroxidase-conjugated AffiniPure Rabbit Anti-Human IgM, Fc5µ  Jackson ImmunoResearch 309-035-095
SuperScript III Cells Direct cDNA Synthesis System  Invitrogen  18080-200
Applied Biosystems (ABI) GeneAm PCR System 2700 Applied Biosystems
High Pure RNA Isolation Kit  Roche 11828665001
Reverse transcription system kit  Promega A3500
Recombinant Taq DNA Polymerase TAKARA R001A
Primers (2 μl) Sigma
Ultrapure Agarose  Invitrogen 16500-500
100 bp ladder Invitrogen 15628-019
Quantity One 4.5.2 (Gel Doc 2000) Biorad 170-8100
QIAquick PCR purification kit QIAGEN 28106
BigDye Terminator v3.1 cycle sequencing kit  Applied Biosystems 4337455
0.1 ml reaction plate (MicroAMP Optical 96-well) Applied Biosystems 4346906
Genetic analyser ABI300  Applied Biosystems 4346906
DH5α competent cells (E. coli) Invitrogen 18263-012
pFUSEss-CHIg-hG1 (4,493 bp) Invivogen pfusess-hchg1
pFUSEss-CHIg-hG4 (4,484 bp)  Invivogen pfusess-hchg4
pFUSE2ss-CLIg-hk (3,875 bp) Invivogen pfuse2ss-hclk
pFUSE2ss-CLIg-hl2 (3,883 bp)  Invivogen pfuse2ss-hcll2
SOC medium Invitrogen 15544-034
LB-based agar medium supplemented with Zeocin (Fast-Media Zeo Agar) Invivogen fas-zn-s
Terrific Broth (TB)-based liquid medium supplemented with Zeocin (Fast-Media Zeo TB) Invivogen fas-zn-l
DNA Miniprep kit  Omega Bio Technology D6942-02
Nanodrop (ND1000 Spectrophotometer) Nanodrop
LB-based agar medium supplemented with Blasticidin (Fast-Media Blast Agar) Invivogen fas-bl-s
Terrific Broth (TB)-based liquid medium supplemented with Blasticidin (Fast-Media Blast TB) Invivogen fas-bl-l
EcoRI New England Biolabs R0101S 20,000 U/ml, in 10x NEBuffer EcoRI
NheI New England Biolabs R0131S 10,000 U/ml, in 10x NEBuffer 2.1
2-Log DNA ladder New England Biolabs N3200S 0.1-10.0 kb, 1,000 μg/ml
XmaI New England Biolabs R0180S 10,000 U/ml, in 10x CutSmart Buffer 
BsiWI New England Biolabs R0553S 10,000 U/ml, in 10x NEBuffer 3.1
AvrII New England Biolabs R0174S 5,000 U/ml, in 10x CutSmart Buffer 
FastAP Thermosensitive Alkaline Phosphatase Thermo Scientific EF0651 1 U/µl, in 10x FastAP Buffer
DH5α competent cells  Invitrogen 18263-012
PE Mouse Anti-Human IgG BD Pharmingen 555787
anti-CD22, PerCP-Cy5.5, Clone: HIB22 Fisher scientific BDB563942
QIAprep Spin Miniprep Kit  QIAGEN 27106
BigDye Terminator v3.1 Applied Biosystems 4337455

DOWNLOAD MATERIALS LIST

References

  1. Vrolix, K., et al. Clonal heterogeneity of thymic B cells from early-onset myasthenia gravis patients with antibodies against the acetylcholine receptor. J Autoimmun. 52, 101-112 (2014).
  2. Yamashita, M., Katakura, Y., Shirahata, S. Recent advances in the generation of human monoclonal antibody. Cytotechnology. 55, (2-3), 55-60 (2007).
  3. Pereira, K. M., Dellavance, A., Andrade, L. E. The challenge of identification of autoantibodies specific to systemic autoimmune rheumatic diseases in high throughput operation: Proposal of reliable and feasible strategies. Clin Chim Acta. 437, 403-410 (2014).
  4. Losen, M., et al. Treatment of myasthenia gravis by preventing acetylcholine receptor modulation. Ann N Y Acad Sci. 1132, 174-179 (2008).
  5. Smith, K., et al. Rapid generation of fully human monoclonal antibodies specific to a vaccinating antigen. Nat Protoc. 4, (3), 372-384 (2009).
  6. Fraussen, J., et al. A novel method for making human monoclonal antibodies. J Autoimmun. 35, (2), 130-134 (2010).
  7. Traggiai, E., et al. An efficient method to make human monoclonal antibodies from memory B cells: potent neutralization of SARS coronavirus. Nat Med. 10, (8), 871-875 (2004).
  8. Fraussen, J., et al. Autoantigen induced clonal expansion in immortalized B cells from the peripheral blood of multiple sclerosis patients. J Neuroimmunol. 261, (1-2), 98-107 (2013).
  9. Yamashita, M., et al. Different individual immune responses elicited by in vitro immunization. Cytotechnology. 40, (1-3), 161-165 (2002).
  10. Hui-Yuen, J., Koganti, S., Bhaduri-McIntosh, S. Human B cell immortalization for monoclonal antibody production. Methods Mol Biol. 1131, 183-189 (2014).
  11. Tiller, T., et al. Efficient generation of monoclonal antibodies from single human B cells by single cell RT-PCR and expression vector cloning. J Immunol Methods. 329, (1-2), 112-124 (2008).
  12. Lanzavecchia, A., Corti, D., Sallusto, F. Human monoclonal antibodies by immortalization of memory B cells. Curr Opin Biotechnol. 18, (6), 523-528 (2007).
  13. Traggiai, E. Immortalization of human B cells: analysis of B cell repertoire and production of human monoclonal antibodies. Methods Mol Biol. 901, 161-170 (2012).
  14. Strober, W., et al. Monitoring cell growth. Curr Protoc Immunol / edited by. John E. Coligan ... [et al.]. Appendix 3, Appendix 3A (2001).
  15. Ibrahim, S. F., van den Engh, G. Flow cytometry and cell sorting. Adv Biochem Eng Biotechnol. 106, 19-39 (2007).
  16. Leith, J. T., Padfield, G., Faulkner, L. E., Quinn, P., Michelson, S. Effects of feeder cells on the X-ray sensitivity of human colon cancer cells. Radiother Oncol. 21, (1), 53-59 (1991).
  17. Hui-Yuen, J., McAllister, S., Koganti, S., Hill, E., Bhaduri-McIntosh, S. Establishment of Epstein-Barr virus growth-transformed lymphoblastoid cell lines. J Vis Exp. (57), 3321 (2011).
  18. Smith, L. M., et al. Fluorescence detection in automated DNA sequence analysis. Nature. 321, (6071), 674-679 (1986).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics