प्रोटीन और Ribonucleoprotein कॉंप्लेक्स के 3d पृष्ठ के लिए ब्रेसिका napus से फ्लोएम एसएपी नमूना

Biology
 

Summary

यहां हम एक प्रोटोकॉल वर्तमान में प्रोटीन संरचना का विश्लेषण करने के लिए बड़े देशी प्रोटीन: प्रोटीन और प्रोटीन: न्यूक्लिक एसिड परिसरों से तिलहन बलात्कार (B. napus) फ्लोएम रिसाव का उपयोग कर एक 3 डी polyacrylamide जेल ट्रो (पृष्ठ) दृष्टिकोण ब्लू के संयोजन देशी (बीएन) दो denaturing सामूहिक spectrometric पहचान के बाद पृष्ठों के साथ ।

Cite this Article

Copy Citation | Download Citations

Pahlow, S., Ostendorp, A., Krüßel, L., Kehr, J. Phloem Sap Sampling from Brassica napus for 3D-PAGE of Protein and Ribonucleoprotein Complexes. J. Vis. Exp. (131), e57097, doi:10.3791/57097 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

नमूना उच्च पौधों की फ्लोएम अक्सर श्रमसाध्य और काफी संयंत्र प्रजातियों पर निर्भर है । हालांकि, denaturing शर्तों के तहत proteome अध्ययन विभिंन प्रजातियों के पौधे में प्राप्त किया जा सकता है । देशी प्रोटीन: प्रोटीन और प्रोटीन: फ्लोएम नमूनों से न्यूक्लिक एसिड परिसरों के रूप में अभी तक शायद ही विश्लेषण किया गया है, हालांकि वे इस विशेष डिब्बे के रखरखाव में महत्वपूर्ण भूमिका निभा सकता है या लंबी दूरी के संकेत में । बड़े आणविक विधानसभाओं एक नीली देशी जेल ट्रो (बीएन-पृष्ठ) का उपयोग कर पृथक किया जा सकता है । उनके प्रोटीन अवयव एक बाद सोडियम dodecyl सल्फेट पृष्ठ (एसडीएस-पृष्ठ) द्वारा अलग किया जा सकता है । हालांकि, इसी तरह आणविक भार सह प्रवास के साथ प्रोटीन, क्या जन स्पेक्ट्रोमेट्री द्वारा प्रोटीन की पहचान में बाधा कर सकते हैं । दो अलग denaturing जेल ट्रो कदम, अर्थात् Tris-Tricine-यूरिया और एसडीएस-पृष्ठ के साथ बीएन-पृष्ठ के संयोजन, प्रोटीन की अतिरिक्त जुदाई उनके hydrophilicity के अनुसार सक्षम बनाता है/hydrophobicity और इस तरह बढ़ता है संकल्प और सफलता प्रोटीन की पहचान । यह भी है कि केवल उनके posttranslational संशोधनों में अलग प्रोटीन भेद की अनुमति देता है । इसके अतिरिक्त, macromolecular परिसरों में आरएनए अवयव पहचानने के लिए नीला देशी उत्तरी सोख्ता लागू किया जा सकता है । हम बताते हैं कि हमारे प्रोटोकॉल देशी प्रोटीन के प्रोटीन और आरएनए घटकों को खंडित करने के लिए उपयुक्त है: प्रोटीन और ribonucleoprotein (RNP) फ्लोएम नमूनों में होने वाली कॉम्प्लेक्स. दो अलग denaturing पृष्ठ कदम के साथ एक नीला देशी पृष्ठ के संयोजन के लिए बड़े प्रोटीन परिसरों के विभिंन प्रकार अलग मदद कर सकते हैं, और भी जन स्पेक्ट्रोमेट्री द्वारा अपने घटकों के एक वृद्धि की पहचान की दर में सक्षम बनाता है । इसके अलावा, प्रोटोकॉल काफी मजबूत एक साथ एक प्रोटीन परिसरों के भीतर संभावित बाध्य न्यूक्लिक एसिड का पता लगाने के लिए है ।

Introduction

फ्लोएम की लंबी दूरी के नाली उच्च संयंत्रों में कार्बनिक पोषक तत्वों के आवंटन के लिए आवश्यक हैं, लेकिन यह भी कई अलग विकास और विकास के लिए महत्वपूर्ण प्रक्रियाओं को विनियमित करने में शामिल हैं, रोगज़नक़ रक्षा, और प्रतिकूल करने के लिए अनुकूलन पर्यावरण की स्थिति । आयनों, phytohormones, या खुद चयापचयों जैसे छोटे प्रभाव के अलावा, प्रोटीन और RNAs की तरह अणुओं हाल ही में संभावित संकेतों के रूप में उभरा है ।

अध्ययनों से पता चला है कि प्रोटीन के फ्लोएम लदान आकार निर्भर है और आकार बहिष्करण सीमा (चयन) ताकना-plasmodesmal साथी कोशिकाओं (CC) और चलनी तत्वों (एसई) है कि आम तौर पर 10 की सीमा में है जोड़ने इकाइयों के द्वारा नियंत्रित करने के लिए > 67 केडीए1 , 2 , 3. हालांकि, इन आकार सीमाओं के बावजूद बड़ा प्रोटीन और प्रोटीन परिसरों फ्लोएम आकार अपवर्जन के विचार को चुनौती देने की प्रणाली के भीतर पाया गया है4, और यहां तक कि सीसी से प्रोटीन की विशिष्ट हानि एसई को सुझाव दिया गया है5 .

Multiprotein के रूप में अच्छी तरह के रूप में बड़े ribonucleoprotein परिसरों में एक निर्णायक भूमिका निभाते हैं, और कोशिका के संरचनात्मक अखंडता को बनाए रखने6। वहां सबूत है कि फ्लोएम-मोबाइल प्रोटीन प्रोटीन और ribonucleoprotein परिसरों4,7मौजूद है, लेकिन उनके समारोह के बारे में थोड़ा तारीख को जाना जाता है । फ्लोएम चलनी तत्वों में प्रोटीन: प्रोटीन और RNP परिसरों में लंबी दूरी के परिवहन और/या संकेतन8,9के साथ फंसाया गया है । translocated परिसरों के कार्यों को जानने, पर्यावरण या तनाव की स्थिति में बदलती के तहत उनकी संरचना का अध्ययन करने की आवश्यकता है । इस लक्ष्य को प्राप्त करने के लिए, मूल परिसरों को अलग करना होगा और उनके घटकों को पर्याप्त संकल्प के साथ अलग करना होगा ।

फ्लोएम से उच्च आणविक-भार परिसरों को अलग करने के लिए, यह सबसे पहले पर्याप्त गुणवत्ता और मात्रा में एसएपी नमूने प्राप्त करने के लिए आवश्यक है । तकनीक है कि फ्लोएम नमूने के लिए इस्तेमाल किया जा सकता है ब्याज की प्रजातियों के पौधे पर निर्भर करता है । फ्लोएम एसएपी प्राप्त करने के लिए तीन मुख्य तरीकों में 10मौजूद: कीट stylectomy11, EDTA-12, और सहज13इंग्लैण्ड की सुविधा ।

Arabidopsis थालियाना (ए. थालियाना) से फ्लोएम नमूनों, दुनिया भर में प्रयोगशालाओं में प्रमुख मॉडल संयंत्र, केवल EDTA-सोल्यूशन इंग्लैण्ड या एफ़िड stylectomy14,15द्वारा प्राप्त किया जा सकता है. दोनों तरीकों को या तो अत्यधिक पतला फ्लोएम एसएपी या बहुत कम नमूना मात्रा का नेतृत्व । EDTA-सोल्यूशन इंग्लैण्ड भी संदूषण से ग्रस्त है और हो सकता है कि वास्तविक फ्लोएम रचना16का प्रतिनिधित्व न करे । सहज फ्लोएम इंग्लैण्ड, आलू, वृक या युक्का जैसे पादप प्रजातियों तक सीमित है, जहां संयंत्र के भागों को काटने से फ्लोएम एसएपी का सहज उत्सर्जन होता है जिसे आसानी से13,17,18एकत्र किया जा सकता है, 19. हम हाल ही में फ्लोएम विश्लेषण के लिए एक उपयुक्त मॉडल प्रणाली के रूप में तिलहन बलात्कार (ब्रेसिका napus) की स्थापना की है, क्योंकि यह ए. थालियाना के एक करीबी रिश्तेदार है और microliters एसएपी के कई फ्लोएम छोटे चीरा कि दिखाया गया है से प्राप्त किया जा सकता है उच्च शुद्धता4,8,20के हो । इसके अलावा, napus जीनोम अनुक्रम २०१४21में जारी किया गया था ।

एफ़िड stylectomy के अलावा, सभी फ्लोएम संग्रह तरीकों नमूने की साइट पर आसपास के ऊतकों के हानिकारक शामिल है, और फ्लोएम एसएपी की संरचना चोट के जवाब में बदल सकते हैं । इसलिए यह फ्लोएम नमूनों की गुणवत्ता की जांच करने के लिए आवश्यक है, नमूना विधि लागू की परवाह किए बिना. एकत्र फ्लोएम एसएपी के गुणवत्ता नियंत्रण के लिए विभिंन तरीके हैं, जैसे RNase गतिविधि के निर्धारण के द्वारा22,23, आरटी-Rubisco के खिलाफ प्राइमरों के साथ पीसीआर8,24, या चीनी के विश्लेषण रचना8.

अलग और अलग करने के लिए विभिंन तरीकों प्रोटीन परिसरों, आकार अपवर्जन क्रोमैटोग्राफी, सुक्रोज घनत्व ultracentrifugation, या अलग आणविक वजन कट नापसंद के साथ झिल्ली के माध्यम से नमूना निस्पंदन सहित लागू किया जा सकता है । हालांकि, इन approaches उच्च रिज़ॉल्यूशन की अनुमति नहीं है । तकनीक ब्लू देशी पृष्ठ (बीएन-पृष्ठ), पहले Schägger एट अलद्वारा वर्णित बुलाया । 25, संकल्प की दृष्टि से श्रेष्ठ है । यह सफलतापूर्वक विभिंन organelles से या सेलुलर lysates और उनके सापेक्ष बहुतायत से बड़े देशी प्रोटीन परिसरों के आणविक भार निर्धारित करने के लिए इस्तेमाल किया गया था26,27

आगे के लिए प्रोटीन परिसरों की जटिल संरचना स्पष्ट, यह आवश्यक है अलग अलग घटकों denaturing शर्तों के तहत, जटिल घटकों के पूरे विधानसभा के लिए अग्रणी । यह एसडीएस के एक दूसरे आयाम द्वारा प्राप्त किया जा सकता है-पृष्ठ 28,29 या, उच्च संकल्प प्राप्त करने के लिए, isoelectric के एक दूसरे आयाम द्वारा ध्यान केंद्रित (आईईएफ) एसडीएस के एक तिहाई आयाम के बाद-पृष्ठ30 और बाद की पहचान मास स्पेक्ट्रोमेट्री का उपयोग प्रोटीन ।

इस प्रोटोकॉल में, हम B. napus संयंत्रों से शुद्ध फ्लोएम एसएपी के नमूने का वर्णन और इस तरह के फ्लोएम नमूनों से प्रोटीन परिसरों के विश्लेषण एक 3 डी electrophoretic Tris-Tricine-यूरिया पृष्ठ और एसडीएस-पृष्ठ के साथ बीएन पृष्ठ के संयोजन दृष्टिकोण का उपयोग कर । अलग प्रोटीन जटिल घटक बाद में सामूहिक स्पेक्ट्रोमेट्री का उपयोग कर की पहचान कर रहे हैं । इसके अलावा, हम एक बड़ी RNP परिसरों में RNAs का पता लगाने की अनुमति विधि के रूप में ब्लू मूल उत्तरी सोख्ता परिचय4, दृष्टिकोण की प्रयोज्यता का विस्तार ।

Protocol

1. napus संयंत्रों से फ्लोएम एसएपी की नमूना और तैयारी 4,8,20

  1. फ्लोएम एसएपी नमूना के लिए, अच्छी तरह से पानी 8 सप्ताह पुराने napus पौधों है कि केवल प्रारंभिक फूल पराग दूषण को रोकने के लिए दिखाने का उपयोग करें ।
  2. एक hypodermic सुई (Ø ०.८ मिमी) का उपयोग करें और कबरा कई बार फूलना स्टेम. कई अंय फूलना पर दोहराएं उपजा है और अंय पौधों पर पर्याप्त फ्लोएम एसएपी (चित्रा 2a) प्राप्त करने के लिए ।
    नोट: जटिल विश्लेषण के लिए, यह फ्लोएम एसएपी के कम से ६०० µ एल के साथ शुरू करने के लिए सिफारिश की है । फ्लोएम एसएपी के २०० और ७०० µ एल के बीच 4 से 5 पौधे की प्राप्ति होगी ।
  3. फिल्टर कागज के साथ घायल साइटों से पहली बूंद पोंछ । इन बूंदों मुख्य रूप से घायल ऊतक आसपास से अत्यधिक दूषित सामग्री होते है और खारिज कर दिया जाना चाहिए ।
  4. pipetting द्वारा निम्नलिखित बूँदें एकत्र करें और एक बर्फ मुक्त शीतलन प्रणाली का उपयोग कर-20 डिग्री सेल्सियस पर एक पूर्व ठंडा शंकु १.५ मिलीलीटर प्रतिक्रिया ट्यूब में एकत्र रिसाव की दुकान ।
  5. कोई आगे ड्रॉप गठन तक एकत्रित जारी रखने के लिए, लेकिन नहीं रह 1 एच से । इस प्रक्रिया को एकत्र फ्लोएम एसएपी के महत्वपूर्ण नुकसान के बिना दो दिनों के बाद दोहराया जा सकता है ।
    नोट: एकत्र फ्लोएम एसएपी तुरंत इस्तेमाल किया जा सकता है या भविष्य के विश्लेषण के लिए-८० डिग्री सेल्सियस पर संग्रहीत । के लिए-८० ° c भंडारण, सदमे से तरल नाइट्रोजन में प्रतिक्रिया ट्यूब फ्रीज ।
  6. प्रारंभिक मात्रा के लगभग 1/6वें फ्लोएम नमूना ध्यान केंद्रित एक आणविक वजन के साथ केंद्रापसारक संकेंद्रों का उपयोग कर (MWCO) १०,००० Daltons (डीए) की कटौती । 4 ° c पर केंद्रित नमूना केंद्रापसारक और २०,००० x g कम से 15 मिनट के लिए धूल कणों को हटाने के लिए ।
    नोट: फ्लोएम एसएपी एकाग्रता प्रोटीन का एक महत्वपूर्ण नुकसान के लिए नेतृत्व नहीं करता है ।
  7. बाद के जटिल विश्लेषण के लिए, चरण ३.१ के साथ आगे बढ़ें ।

2. फ्लोएम एसएपी शुद्धता नियंत्रण का उपयोग रिवर्स transcriptase पीसीआर (आरटी-पीसीआर) 4,8,20

  1. तरल सामग्री के लिए एक मानक आरएनए निष्कर्षण विधि का उपयोग कर फ्लोएम एसएपी से कुल आरएनए को अलग करें (जैसे TRIzol या phenol-क्लोरोफॉर्म निष्कर्षण के बाद जलीय चरण और इथेनॉल धुलाई चरणों से isopropanol वर्षण के अनुसार निर्माता के प्रोटोकॉल) ।
    सावधानी: Phenol-क्लोरोफॉर्म विषाक्त है । उचित व्यक्तिगत सुरक्षा उपकरण के साथ एक हुड के तहत काम करते हैं । निकाली आरएनए छह महीने तक के लिए-८० डिग्री सेल्सियस पर इथेनॉल में संग्रहित किया जा सकता है ।
  2. DNase मैं (1 u/µ g) के साथ पाचन द्वारा डीएनए के संक्रमण को दूर ३७ डिग्री सेल्सियस पर ४५ मिनट के लिए और 5 मिमी की एक अंतिम एकाग्रता के लिए EDTA जोड़कर एंजाइम को निष्क्रिय और ७५ डिग्री सेल्सियस पर 10 मिनट के लिए नमूना मशीन ।
  3. शुद्ध आरएनए प्राप्त करने के लिए, शुद्ध और एक और शुद्धि कदम (जैसे आरएनए सफाई किट का उपयोग कर, निर्माता के निर्देशों के अनुसार) द्वारा नमूना ध्यान केंद्रित ।
  4. निर्माता के प्रोटोकॉल द्वारा वर्णित के रूप में शुद्ध आरएनए के १५० एनजी का उपयोग कर एक सीडीएनए संश्लेषण किट के साथ सीडीएनए के संश्लेषण के लिए एक रिवर्स transcriptase पीसीआर (आरटी-पीसीआर) का प्रदर्शन ।
    नोट: सीडीएनए को आगे उपयोग तक-20 डिग्री सेल्सियस पर संग्रहित किया जा सकता है ।
  5. एक मानक पीसीआर प्रतिक्रिया के रूप में निर्माता द्वारा निर्दिष्ट के लिए एक टेंपलेट के रूप में सीडीएनए के 5 µ एल का प्रयोग करें, डिब्बे-विशिष्ट टेप बढ़ाना और agarose जेल ट्रो द्वारा जांच करें । rubisco छोटे उपइकाई, thioredoxin एच, और पराग कोट प्रोटीन (चित्र 1b, तालिका 1) के लिए प्राइमरों का उपयोग करके फ्लोएम नमूनों की शुद्धता की पुष्टि करें ।

3. ब्लू देशी पेज 4,25,26,31

  1. या तो स्व-घनघोर मूल ग्रैडिएंट जैल का उपयोग करें जैसा कि कहीं भी वर्णित है27 या वाणिज्यिक बीआईएस-Tris ग्रेडिएंट जैल ।
  2. लोड 20 करने के लिए 30 µ g प्रति अच्छी तरह से कम triplicates में जेल पर केंद्रित प्रोटीन का नमूना ।
  3. 4 डिग्री सेल्सियस और १५० V पर जेल भागो डार्क ब्लू कैथोड बफर बी और anode बफर (तालिका 2) का उपयोग करने तक नमूना जेल (ca. 20 से 30 मिनट के 1/3rd पारित, आंकड़ा 3ए) ।
    नोट: उत्तरी सोख्ता के लिए, एक भी जेल लेन पर्याप्त है, जबकि 3 डी पृष्ठ और मास स्पेक्ट्रोमेट्री द्वारा प्रोटीन संरचना के विश्लेषण के लिए यह दस जेल गलियों से एक ही बैंड गठबंधन करने के लिए कम प्रचुर मात्रा में प्रोटीन ध्यान देने की सिफारिश की है ।
  4. भागो और विनिमय डार्क ब्लू कैथोड बफर बी प्रकाश नीले कैथोड बफर b/10 (तालिका 2) के साथ रोकें और रन जारी रखें । जेल रन समाप्त जब ब्लू फ्रंट जेल से बाहर elute करने के लिए शुरू होता है (ca. १२० १८० मिनट के लिए, चित्रा 3).
    नोट: समाप्त नीला देशी जेल 4 डिग्री सेल्सियस से कम एक सप्ताह के लिए संग्रहित किया जा सकता है । लंबे समय तक भंडारण के लिए बैंड फैलाना नेतृत्व कर सकते है और बचा जाना चाहिए । गहरा नीला बफ़र B का उपयोग किया जा सकता है ।

4. वैकल्पिक: आरएनए का पता लगाने नीला देशी उत्तरी सोख्ता का उपयोग कर 4

  1. अलग बैंड कट या ब्लू देशी जेल से पूरे जेल लेन का उपयोग करें और उंहें एक नायलॉन झिल्ली पर अर्द्ध शुष्क सोख्ता द्वारा ३.५ mA/६० मिनट के लिए और ऊपरी और निचली जेल की सीमा पर एक पेंसिल के साथ झिल्ली पर स्थानांतरण ( चित्रा 4a) ।
  2. सोख्ता के बाद, DEPC-इलाज पानी के साथ झिल्ली धोने और दो फिल्टर कागज के बीच सूखी ।
  3. १२०,००० µJ/cm2 (८५ s के साथ blotted झिल्ली के यूवी-crosslinking प्रदर्शन यदि सामग्री की तालिकामें Crosslinker का उपयोग कर) ।
  4. संकरण बफर के 6 मिलीलीटर (वाणिज्यिक या स्वयं) के साथ झिल्ली संकरण पूर्व एक संकरण ओवन (चित्रा 4a) में ६८ डिग्री सेल्सियस पर ६० मिनट के लिए ।
  5. 4 µ एल के 3 '-biotinylated जांच (१०० एनएम) युक्त संकरण बफर की एक अतिरिक्त 1 मिलीलीटर जोड़ें ।
  6. रात भर की जांच के साथ झिल्ली गर्मी, जबकि ६८ डिग्री सेल्सियस से ३७ डिग्री सेल्सियस के लिए ओवन ठंडा ।
  7. 2x एसएससी और ०.१% एसडीएस युक्त बफर के साथ झिल्ली धोने, कमरे के तापमान पर 5 मिनट के लिए विशेष रूप से बंधे जांच को दूर करने के लिए ।
    सावधानी: एसडीएस के कारण जलन हो सकती है । एसडीएस और एसडीएस युक्त समाधान के साथ काम करते समय दस्ताने और लैब कोट पहनते हैं ।
  8. एक Streptavidin-एचआरपी-संयुग्म और luminol सहिजन (peroxidase) सब्सट्रेट, एक संवेदनशील एचआरपी प्रतिक्रिया ( चित्रा 4a) के रूप में जिसके परिणामस्वरूप के साथ झिल्ली पर 3 '-biotinylated जांच का पता लगाने का प्रदर्शन ।

5. दूसरा आयाम: Tris-Tricine-यूरिया पेज 4,28

  1. ब्लू देशी जेल से एकल बैंड एक्साइज । जटिल प्रोटीन की एक और एकाग्रता प्राप्त करने के लिए समानांतर गलियों में चलाने के नमूनों से बैंड गठबंधन (चित्रा 5).
    नोट: एक्साइज बैंड्स एक प्रतिक्रिया ट्यूबों में संग्रहित किया जा सकता है जब तक कि 4 डिग्री सेल्सियस पर आगे का उपयोग करें ।
  2. एक 12% Tris-Tricine-यूरिया जेल डालो (1 मिमी की मोटाई, 6.8 cm x ८.६ cm (चौड़ाई x लंबाई)) । जेल समाधान की 10 मिलीलीटर तैयार अलग जेल (तालिका 2) के लिए, isopropanol के साथ दो ग्लास प्लेटें और ओवरले के बीच डालना । बहुलकीकरण समाप्त होने के बाद isopropanol निकालें और जेल समाधान बी के 4 मिलीलीटर (तालिका 2) gel पर स्टैकिंग जेल के लिए स्थानांतरण और एक 10 अच्छी तरह से कंघी डालें ।
    चेतावनी: unपॉलीमरेड acrylamide neurotoxic किया जा सकता है और TEMED अगर सांस हानिकारक है । हमेशा व्यक्तिगत सुरक्षा उपकरण पहनते है और एक हुड के नीचे काम करते हैं ।
  3. एक १.५ मिलीलीटर प्रतिक्रिया ट्यूब में एक्साइज जेल बैंड स्थानांतरण और जेल टुकड़े (चित्रा 5, तालिका 2) के equilibration के लिए 2x एसडीएस नमूना बफर के 1 मिलीलीटर जोड़ें ।
    1. कमरे के तापमान पर 10 मिनट के लिए नमूनों की मशीन, एक हीटिंग ब्लॉक (९५ ° c) में उबलते करने से पहले या एक माइक्रोवेव में और एक और 15 मिनट के लिए कमरे के तापमान पर फिर से नमूनों की मशीन ।
    2. कई equilibrated जेल एक ही जेल जेब में एक ही परिसर का प्रतिनिधित्व टुकड़े ढेर ।
    3. ट्रो का उपयोग कर anode और कैथोड चल रहे थें १५० V पर ४५ ६० मिनट के लिए और पूरे जेल लेन एक्साइज ।
  4. अंलीय बफर में 20 मिनट के लिए कट लेन मशीन (१०० mm Tris, १०० mm एसिटिक एसिड) और equilibrate १२५ mm Tris-एचसीएल में, एक और 20 मिनट के लिए पीएच ६.८ (चित्रा 5) ।

6. तीसरा आयाम: एसडीएस-पेज 4,३२

  1. Laemmli३२ (मोटाई: १.५ mm, 6.8 cm x ८.६ cm (चौड़ाई x लंबाई)) (तालिका 2) के अनुसार जेल को अलग करने के लिए एक 15% एसडीएस डालो और ऊपर एक 4% स्टैकिंग जेल की एक पतली परत जोड़ें ।
    सावधानी: एसडीएस, acrylamide और TEMED विषैले और हानिकारक होते हैं । एक डाकू के तहत काम करते है और व्यक्तिगत सुरक्षा उपकरण पहनते हैं ।
  2. एसडीएस जेल पर equilibrated जेल लेन स्थानांतरण और ०.५% (डब्ल्यू/डब्ल्यू) agarose में 1x एसडीएस चल बफर के साथ जेल कवर bromophenol नीला (चित्रा 5) का पता लगाने के साथ पूरक ।
  3. माइक्रोवेव में agarose के साथ जेल पर लोड करने से पहले एसडीएस चल बफर फोड़ा ।
  4. एक प्रोटीन मार्कर चलाने के लिए एक घटक के आणविक भार का अनुमान लगाने के लिए, जेल के एक छोर पर फिल्टर कागज का एक टुकड़ा डालने जब तक agarose जम या एक विशेष आम तौर पर IPG जैल के लिए इस्तेमाल किया कंघी का उपयोग करें ।
  5. ६० मिनट के लिए १५० वी पर जेल भागो और या तो कोलाइडयन Coomassie, चांदी के दाग या किसी अंय धुंधला बाद मास spectrometric विश्लेषण के लिए उपयुक्त विधि के साथ जेल दाग ।
  6. मैट्रिक्स की तरह जन spectrometric दृष्टिकोण का उपयोग कर दिखाई प्रोटीन धब्बे का विश्लेषण-असिस्टेड लेजर desorption/ionization समय की उड़ान (मालदी-तोफ) या नियंत्रण रेखा के एमएस/
    नोट: हम पहले से ही वर्णित३३के रूप में कोलाइडयन Coomassie धुंधला का उपयोग करने की सलाह देते हैं । हमारे हाथों में भी कम प्रचुर मात्रा में प्रोटीन पर्याप्त रूप से दाग हो सकता है और उचित डेटा की गुणवत्ता के साथ एक बड़े पैमाने पर spectrometric विश्लेषण की अनुमति देता है ।

Representative Results

यहां हम एक प्रोटोकॉल है कि प्रोटीन के विश्लेषण की अनुमति देता है वर्तमान: प्रोटीन के रूप में के रूप में अच्छी तरह से प्रोटीन: आरएनए परिसरों फ्लोएम नमूनों में से ब्रेसिका napus। वर्कफ़्लो आरेख 1में सचित्र है । अंय मॉडल जीवों पर बी napus का एक प्रमुख लाभ फूलना स्टेम में छोटे पंचर से अपेक्षाकृत आसान फ्लोएम नमूना संग्रह की संभावना है । यह तुलना में बड़ी मात्रा में शुद्ध फ्लोएम नमूने प्राप्त करने के लिए अनुमति देता है । जब नमूना फ्लोएम, यह हमेशा के लिए आर टी द्वारा उदाहरण के लिए, संदूषण के लिए जांच करने के लिए सलाह दी जाती है-पीसीआर8। एक शुद्ध फ्लोएम नमूना से प्राप्त एक प्रतिनिधि परिणाम चित्रा 2में दिखाया गया है । गैर दूषित फ्लोएम नमूने thioredoxin एच के लिए एक दृश्य बैंड दिखाना चाहिए, जबकि rubisco के लिए कोई संकेत और पराग कोट प्रोटीन प्रकट करना चाहिए । rubisco छोटे उपइकाई पत्तियों, फूलना उपजी या पराग से नमूनों में एक नियंत्रण के रूप में सेवा कर सकते हैं । Thioredoxin एच सभी नमूनों में detectable होना चाहिए, क्योंकि इसके mRNA अलग प्रजातियों के फ्लोएम में पाया गया है, जबकि पराग कोट प्रोटीन प्रतिलिपि केवल फूल कली के नमूनों में दिखाई जानी चाहिए । जब फ्लोएम नमूना पूरी तरह से फूल पौधों (पराग कोट प्रोटीन) पर किया जाता है या जब फ्लोएम नमूना पंचर से पहली बूंदों ठीक से खारिज नहीं कर रहे है (rubisco) संदूषण हो सकता है ।

बीएन से पहले-पृष्ठ यह फ्लोएम एसएपी ध्यान केंद्रित करने के लिए अनिवार्य है । अच्छी तरह से प्रति प्रोटीन के 20 से 30 µ जी का उपयोग करना, कम से कम चार प्रमुख प्रोटीन जटिल बैंड बीएन के बाद दिखाई देते हैं-B. napus फ्लोएम एसएपी के पृष्ठ, बहुत कम या बहुत उच्च सांद्रता परिसरों की एक स्पष्ट जुदाई (चित्रा 3) की अनुमति नहीं है । यह कई जेल दूसरे आयाम जेल के एक ही जेब में एक ही परिसर का प्रतिनिधित्व करने के लिए आगे बहाव प्रसंस्करण और बाद में बड़े पैमाने पर spectrometric पहचान के लिए एक ही परिसर से प्रोटीन केंद्रित करने के बैंड लोड करने की सिफारिश की है ।

फ्लोएम macromolecular परिसरों के व्यक्तिगत घटकों की पहचान करने के लिए, हम एक दूसरे आयाम Tris-Tricine-यूरिया और एक तिहाई आयाम एसडीएस-पृष्ठ के साथ प्रारंभिक बीएन-पृष्ठ संयुक्त एकल प्रोटीन की एक जुदाई को प्राप्त करने के लिए । यहां, उच्च संकल्प के साथ एक जुदाई यूरिया और एसडीएस में विभिंन प्रोटीन प्रवासन व्यवहार के कारण देखा जा सकता है-पृष्ठ जैल । आमतौर पर, एक एकल परिसर से संबंधित प्रोटीन जेल में एक तिरछी रेखा के रूप में दिखाई देगा । इस लाइन के ऊपर प्रोटीन एक वृद्धि हुई hydrophobicity है, जबकि रेखा से नीचे प्रोटीन अधिक हाइड्रोफिलिक वाले28 (चित्रा 5, चित्रा 6) का प्रतिनिधित्व करते हैं ।

RNP परिसरों के लक्षण वर्णन के लिए, हम बीएन उत्तरी सोख्ता प्रदर्शन करने के लिए एक बीएन-पृष्ठ जेल के एक भाग का इस्तेमाल किया । यूवी विकिरण द्वारा एक नायलॉन झिल्ली और crosslinking पर एक पूरी लेन के सोख्ता के बाद, आरएनए चित्रा 4में सचित्र के रूप में आरएनए-विशिष्ट जांच का उपयोग कर visualized किया जा सकता है । यहां यह दिखाया गया है कि एक विशिष्ट tRNA केवल एक विशिष्ट परिसर में मौजूद है । इस tRNA के प्रोटीन घटक-बाध्यकारी परिसर आगे 3 डी जेल दृष्टिकोण का उपयोग कर जांच की जा सकती है ऊपर वर्णित है । जन spectrometric विश्लेषण से पता चला है कि इस परिसर में मुख्य रूप से tRNA-ligases क्या tRNA बंधन बीएन उत्तरी सोख्ता द्वारा पाया गतिविधि की पुष्टि करता है ।

Figure 1
चित्रा 1: तिलहन बलात्कार के फ्लोएम एसएपी में ribonucleoprotein परिसरों के विश्लेषण का काम प्रवाह । नमूना और फ्लोएम नमूनों की तैयारी के बाद, बीएन-पृष्ठ अलग मूल परिसरों के लिए किया जाता है । ऐसे बीएन-पेज जैल बीएन उत्तरी सोख्ता और जन स्पेक्ट्रोमेट्री द्वारा परिसरों के प्रोटीन घटकों की पहचान द्वारा न्यूक्लिक एसिड के समानांतर विश्लेषण की अनुमति देते हैं । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 2
चित्रा 2: napusके फ्लोएम एसएपी के नमूने और शुद्धता नियंत्रण । एक बाँझ hypodermic सुई के साथ 8-10 सप्ताह पुराने तिलहन बलात्कार संयंत्रों के फूलना स्टेम puncturing के बाद, रिसाव एक पिपेट के साथ एकत्र किया और एक बर्फ ठंडा प्रतिक्रिया ट्यूब (ए) को हस्तांतरित करने के लिए फ्लोएम नमूने आरटी-पीसीआर की शुद्धता की पुष्टि करने के लिए किया जाता है, thioredoxin एच, rubisco छोटे उपइकाई, और ऊतक-विशिष्ट नमूनों में पराग कोट प्रोटीन की टेप बढ़ाना (b) RT-रिवर्स transcriptase के बिना पीसीआर नियंत्रण के रूप में किया गया था (-) । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 3
चित्रा 3: बीएन-पृष्ठ । बी napus के केंद्रित फ्लोएम नमूनों के साथ नीले देशी पृष्ठ के योजनाबद्ध प्रतिनिधित्व । (a) 15-20 µ के साथ ढाल प्रोटीन जेल लोड करने के बाद केंद्रित फ्लोएम एसएपी के एल, बी एन-पृष्ठ १५० V पर 1x डार्क ब्लू कैथोड बफर बी के साथ 20-30 मिनट के लिए एक ठंडे कमरे में किया जाता है । फिर बफर 1x लाइट ब्लू कैथोड बफर B/10 के खिलाफ विमर्श किया है और पृष्ठ १५० वी पर १२०-१८० मिनट के लिए समाप्त हो गया है जब तक डार्क ब्लू रनिंग सामने जेल से बाहर चलाता है । बीएन-पृष्ठ जैल चार अलग उच्च आणविक-वजन वाले परिसरों का प्रतिनिधित्व करने वाले विभिन्न बैंड दिखाएँ । (ख) बहुत कम लोड हो रहा है (ग) या बहुत ज्यादा (घ) फ्लोएम प्रोटीन व्यक्तिगत परिसरों की दृश्यता कम कर देता है । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 4
चित्रा 4: बीएन उत्तरी सोख्ता. बीएन उत्तरी सोख्ता पद्धति का योजनाबद्ध प्रस्तुतिकरण । (क) बी एन के एक लेन-पृष्ठ अर्द्ध शुष्क सोख्ता द्वारा एक नायलॉन झिल्ली पर स्थानांतरित कर रहा है । यूवी crosslinking और पूर्व संकरण के बाद, झिल्ली आरएनए विशिष्ट जांच (यहां एक मिथीयोनाईन tRNA-विशिष्ट जांच) है, जो रात में एक biotinylated ओवन में 3 '-अंत में संकरण रहे हैं के साथ मशीन है । नि: शुल्क जांच धोने कदम द्वारा निकाल दिया जाता है और आरएनए का पता लगाने के एक streptavidin-एचआरपी संयुग्म और luminol द्वारा किया जाता है । इस दृष्टिकोण का उपयोग करना, हम बीएन-पृष्ठ से जटिल चतुर्थ मिथीयोनाईन tRNA शामिल है कि मनाया । (ख) Coomassie दाग जेल और tRNA दाग दो अलग जेल की गलियों के समान प्रवास मतभेदों से बचने के समानांतर में चला रहे हैं । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 5
चित्र 5:3d पृष्ठ. 3 डी पृष्ठ दृष्टिकोण के योजनाबद्ध प्रतिनिधित्व । एक ही परिसर से कई बैंड एक बीएन-पृष्ठ जेल, बफर लोडिंग में गर्मी और दूसरा आयाम Tris-Tricine-यूरिया पृष्ठ के एक अच्छी तरह से स्थानांतरित कर रहे हैं । ट्रो के बाद, पूरे जेल गलियों में काट रहे हैं, अंलीय एसिड बफर, equilibrated में धोया, और एक 15% एसडीएस पृष्ठ जेल पर रखा । तीसरा आयाम पृष्ठ के बाद, अलग प्रोटीन Coomassie दाग और बड़े पैमाने पर स्पेक्ट्रोमेट्री द्वारा विश्लेषण कर रहे हैं । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 6
चित्रा 6:3 डी पेज के बाद प्रतिनिधि परिणाम । पहले आयाम बीएन-पृष्ठ के भीतर कई परिसरों दिखाई दिया । उनके प्रोटीन घटकों को आगे दो बाद denaturing पृष्ठों से अलग किया जा सकता है, एक तिरछे स्थान पैटर्न में जिसके परिणामस्वरूप । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

जांच अनुक्रम
Thioredoxin ज
फॉरवर्ड: CTCAAGGCAGCCAAAGAATC
रिवर्स: ATGGCCTGAACATCGAACTC
Rubisco छोटी चेन
फॉरवर्ड: TTCACCGGCTTGAAGTCATC
रिवर्स: CCGGGTACTCCTTCTTGCAT
पराग कोट प्रोटीन BRU77666
फॉरवर्ड: TCAGAACTGGAGCTTCAACG
रिवर्स: TTCCTTAATGGCCTCAGTGG

तालिका 1: फ्लोएम नमूना शुद्धता नियंत्रण के लिए इस्तेमाल किया प्राइमरों । rubisco छोटे चेन, thioredoxin एच के लिए विशिष्ट फ्लोएम नमूना शुद्धता प्राइमरों की पुष्टि करने के लिए, और पराग कोट प्रोटीन सीडीएनए प्रवर्धन के लिए इस्तेमाल किया जा सकता है ।

बफ़र्स और समाधान सामग्री टिप्पणी
डार्क ब्लू कैथोड बफर बी 15 एमएम भा-Tris पीएच ७.०
५० मिमी Tricine
०.०२% (w/v) Coomassie blue G250
नुस्खा Fiala एट अल से अनुकूलित है 17
पीएच ७.० के लिए समायोजित किया जाना चाहिए
बफर एक 10x शेयर के रूप में किया जा सकता है
हल्का नीला कैथोड बफ़र B/ 15 एमएम भा-Tris पीएच ७.०
५० मिमी Tricine
०.००२% (w/v) Coomassie blue G250
बफर Coomassie बिना कैथोड बफर के साथ कमजोर कैथोड बफर बी द्वारा तैयार किया जा सकता है
anode बफर
५० मिमी बीआईएस-Tris पीएच ७.०
बफर एक 10x स्टॉक समाधान के रूप में तैयार किया जा सकता है
2x एसडीएस नमूना बफर
१२५ mM Tris-एचसीएल नं० ६.८
4% एसडीएस
20% ग्लिसरॉल
०.२ एम डीटीटी
०.०२% (w/v) bromophenol नीला
स्थानांतरण बफर 1x TBE बफर
८९ मिमी Tris पीएच ७.६
८९ mM बोरिक एसिड
2 मिमी EDTA
TBE बफर बनाया और 5x या 10x के शेयरों के रूप में संग्रहीत किया जा सकता है । RNase-रहित जल का उपयोग करना जरूरी है ।
2x एसएससी बफर
३०० मिमी NaCl
30 मिमी ना3साइट्रेट पीएच ७.०
3x जेल बफर
३ मीटर Tris
1 मीटर एचसीएल
०.३% एसडीएस

पीएच ८.४५
नुस्खा Schägger 19 से अनुकूलित
Tris-Tricine जेल समाधान एक
10 मिलीलीटर के लिए:
30% acrylamide-bisacrylamide (29:1) ३.३४ mL
6 मीटर यूरिया
3x जेल बफर ३.३४ एमएल
७०% ग्लिसरॉल १.४ mL
ddH2O से 10 मिलीलीटर जोड़ें
10% अनुप ४० µ l
TEMED 4 µ l
वजन 6 एम यूरिया और 3x जेल बफर, acrylamide-bisacrylamide समाधान और ७०% gycerol जोड़ें । ६० ° c करने के लिए गर्मी एक पानी में स्नान करने के लिए यूरिया solubilize । ddH2O को 10 मिलीलीटर, 10% अनुप और अंत में TEMED बहुलकीकरण के लिए जोड़ें ।
Tris-Tricine जेल समाधान B
6 मिलीलीटर के लिए:
30% acrylamide-bisacrylamide (29:1) ०.८ mL
6 मीटर यूरिया
3x जेल बफर १.५ एमएल
ddH2O से 6 मिलीलीटर जोड़ें
10% अनुप ४५ µ l
TEMED ४.५ µ l
वजन 6 एम यूरिया और 3x जेल बफर और acrylamide-bisacrylamide समाधान जोड़ें । ६० ° c करने के लिए गर्मी एक पानी में स्नान करने के लिए यूरिया solubilize । ddH2O को 10 मिलीलीटर, 10% अनुप और अंत में TEMED बहुलकीकरण के लिए जोड़ें ।
1x Tris-Tricine रनिंग बफर (anode)
१०० मिमी Tris
२२.५ मिमी एचसीएल

पीएच ८.९
नुस्खा Schägger 19 से अनुकूलित
1x Tris-Tricine चल रहे बफर (कैथोड)
१०० मिमी Tris
१०० मिमी Tricine
1% एसडीएस


पीएच ८.२५
नुस्खा Schägger 19 से अनुकूलित
अम्लीय बफर
१०० मिमी Tris
१०० एमएम एसिटिक एसिड
4% एसडीएस स्टैकिंग जेल
2 मिलीलीटर के लिए:
ddHO १.४ मिलि
30% acrylamide-bisacrylamide (37.5:1) ०.३३ मिलीलीटर
1 मीटर Tris पीएच ६.८ ०.२५ एमएल
10% एसडीएस 20 µ l
10% अनुप 20 µ l
TEMED 2 µ l
15% एसडीएस अलगाववादी जेल
10 मिलीलीटर के लिए:
ddHO २.३ मिलि
30% acrylamide-bisacrylamide (37.5:1) 5 मिलीलीटर
1 .5 M Tris पीएच ८.८ २.५ mL
10% एसडीएस १०० µ l
10% अनुप १०० µ l
TEMED 4 µ l
1x एसडीएस चल रहा बफर
25 एमएम Tris
१९२ मिमी glycine
०.१% एसडीएस
Coomassie धुंधला समाधान
5% (डब्ल्यू/वी) एल्यूमिनियम सल्फेट-(14-18)-हाइड्रेट
10% (v/v) इथेनॉल (९६%)
2% (v/v) orthophosphoric अम्ल (८५%)
०.०२% (डब्ल्यू/वी) Coomassie शानदार ब्लू जी-२५०
 
ULTRAhyb Ultrasensitive संकरण बफर Ambion, जीवन प्रौद्योगिकियों

तालिका 2: समाधान और बफ़र रेसिपी. सभी बफ़र्स और 3d पृष्ठ विश्लेषण के लिए आवश्यक समाधानों की सूची ।

स्पॉट नं. मव obs. [केडीए] पहचान जीव सेस नं. मेगावाट [केडीए] शुभंकर स्कोर
CIV_1 १३० ख्यात रोग प्रतिरोधक प्रोटीन At4g19050 B. napus CDX78917 १३१.१ ११०
CIV_2 १३० ख्यात रोग प्रतिरोधक प्रोटीन At4g19050 B. napus CDX78917 १३१.१ ८९
CIV_3 १०० हीट शॉक ७० केडीए का प्रोटीन 14 लाइक B. napus XP_013748865 ८९.९ ११३
CIV_4 ९० युकेरियोटिक बढ़ाव फैक्टर 2
सेल डिविजन कंट्रोल प्रोटीन ४८ homolog ए
B. napus
B. napus
CDX90241
cdy 41316.1
८९.५
८९.५
१११
१९७
CIV_5 ८५ हीट शॉक प्रोटीन 90-2-जैसे B. रॅप XP_009132342 ७९.८ १७२
CIV_6 ८० Threonine--tRNA ligase
Glycine--tRNA ligase
B. oleracea
B. napus
XP_013599115
CDY43195
८१.५
८०.८
११०
८८
CIV_7 ७० हीट शॉक प्रोटीन ७० केडीए
Lysine--tRNA ligase-like
B. oleracea
B. napus
XP_013685267
XP_013747530
६७.८
६९.९
२३०
१५०
CIV_8 ६५ Myrosinase
Aspartate--tRNA ligase 2
Asparagine--tRNA ligase 1
B. napus
B. napus
B. napus
ABQ42337
XP_013670803
XP_013729126
६०.६
६१.६
६३.५
१८३
१४१
१५३
CIV_9 ६० Myrosinase B. napus ABQ42337 ६०.६ १६४
CIV_10 ५५ Adenosylhomocysteinase 2-जैसे B. रॅप XP_009135865 ५३.१ १३९
CIV_11 ५५ बढ़ाव फैक्टर 1-अल्फा 1-की तरह B. oleracea XP_013586115 ५१.९ १६१
CIV_12 ५० Cystine lyase CORI3-like B. napus XP_013653143 ४८.१ २३७
CIV_13 ४४ Cystine lyase CORI3-like B. रॅप XP_009108611 ४८.३ २१३
CIV_14 ३८ फ्रुक्टोज-bisphosphate aldolase B. रॅप XP_009115993 ३८.४ २२६
CIV_15 ४५ Cystine lyase CORI3-like B. रॅप XP_009108611 ४८.३ २१९
CIV_16 ४५ Cystine lyase CORI3 B. रॅप CDY69765 ४६.९ २०९
CIV_17 ३८ फ्रुक्टोज-bisphosphate aldolase B. रॅप XP_009115993 ३८.४ १२४
CIV_18 18 Peptidyl-prolyl सीआईएस-ट्रांस isomerase CYP18-3-की तरह B. napus XP_009101932 १८.३ १२८
CIV_19 ४५ Cystine lyase CORI3-like B. रॅप XP_009108611 ४८.३ १७७

तालिका 3: जटिल चतुर्थ से प्रोटीन घटकों की पहचान की । 3डी पेज के बाद मालदी-तोफ मास spectrometric एनालिसिस का उपयोग करते हुए कई tRNA ligases और आगे प्रोटीन को tRNA बाइंडिंग कॉम्प्लेक्स के भीतर पाया गया है ।

Discussion

फ्लोएम उच्च ब्याज का एक डिब्बा है, क्योंकि यह photoassimilates के लिए प्रमुख परिवहन मार्ग का गठन किया है, और यह भी लंबी दूरी के लिए विभिंन संयंत्र भागों के बीच संकेत करना जरूरी है9,20,३४, ३५. छोटे अणुओं के अलावा प्रोटीन और RNAs जैसे अणुओं को फ्लोएम मेंटेनेंस और सिग्नलिंग4,7,8के साथ फंसाया गया है । फ्लोएम संरचना के विश्लेषण के लिए सीमित पहुंच से ज्यादातर प्रजातियों के संयंत्र में फ्लोएम नमूनों को प्रतिबंधित है । कीट stylet तकनीक व्यापक रूप से लागू है, लेकिन प्रयोग की मांग और फ्लोएम नमूनों की बहुत कम मात्रा में परिणाम11। फ्लोएम नमूना के लिए इस्तेमाल एक आसान तकनीक EDTA-सोल्यूशन12है । EDTA कैल्शियम की तरह चिलेट्स divalent आयनों और इस तरह पी-प्रोटीन और callose द्वारा चलनी प्लेट के समापन रोकता है । यह उपयोग करने के लिए आसान है, लेकिन क्षतिग्रस्त कोशिकाओं और नमूनों द्वारा दूषित करने के लिए प्रवण है पतला कर रहे हैं । EDTA द्वारा divalent आयनों घट भी मौजूदा परिसरों के टूटने का कारण बन सकता है । हालांकि, यह मॉडल संयंत्र ए थालियाना15सहित प्रजातियों की एक विस्तृत श्रृंखला से नमूने की अनुमति देता है । फ्लोएम एसएपी के सहज इंग्लैण्ड केवल संयंत्र प्रजातियों में से एक छोटी संख्या में होता है । यह एक इनवेसिव तरीका है कि संयंत्र के ऊतकों की महत्वपूर्ण चोट10शामिल है । हम हाल ही में लंबी दूरी की परिवहन4,8,20के अध्ययन के लिए एक मॉडल प्रजातियों के रूप में बी napus की स्थापना की । यहां, फ्लोएम एसएपी छोटे चीरा से नमूना किया जा सकता है, जो घाव प्रभाव और संदूषण के स्रोतों को कम कर देता है ।

विभिन्न नमूना तकनीक का उपयोग कर, विभिन्न प्रजातियों के पौधों से फ्लोएम नमूनों की proteome हाल के वर्षों में जांच की गई है7,8,17,३६,३७, ३८,३९. इन proteome अध्ययनों के लिए, प्रोटीन निकाले गए और denaturing शर्तों के तहत उपजी और इसलिए प्रोटीन के बारे में निष्कर्ष की अनुमति नहीं है: प्रोटीन और प्रोटीन: न्यूक्लिक एसिड बातचीत देशी शर्तों के तहत मौजूद । सह immunoprecipitation (CoIP) और ओवरले परख संकेत दिया कि एक प्रमुख ribonucleoprotein परिसर फ्लोएम में कद्दू से मौजूद हो सकता है४०, लेकिन यह नहीं दिखाया गया है कि किसी भी macromolecular परिसरों के भीतर देशी परिस्थितियों में मौजूद फ्लोएम व्यवस्था.

ब्लू देशी पृष्ठ, Schägger एट अल द्वारा शुरू की । 26, बाद में उच्च संकल्प जेल ट्रो कदम के साथ संयोजन में बड़े प्रोटीन परिसरों के व्यक्तिगत घटकों के पृथक्करण सक्षम करें । देशी बी napus फ्लोएम रिसाव के 3 डी पृष्ठ का विश्लेषण का उपयोग करना, हम हाल ही में प्रदर्शित कर सकता है कि कई उच्च आणविक वजन प्रोटीन: प्रोटीन और RNP परिसरों फ्लोएम नमूनों में मौजूद है और सक्रिय4enzymatically हैं । वैकल्पिक तरीकों प्रोटीन कॉंप्लेक्स को अलग करने के साथ ही आकार अपवर्जन क्रोमैटोग्राफी की तरह RNPs मौजूद हो सकता है, लेकिन संकल्प के मामले में असफल जब बीएन-पृष्ठ की तुलना में । इसके अलावा, जटिल जुदाई की एक उचित गुणवत्ता के लिए, आकार अपवर्जन कॉलम मैट्रिक्स समग्र जटिल आणविक भार के अनुसार अनुकूलित किया जा रहा है की जांच की जा रही है । विभिंन आकार के परिसरों का विश्लेषण इसलिए कॉलम के विभिंन प्रकार की मांग है जो गहन लागत है और एक बीएन के रूप में उच्च ध्यान केंद्रित शक्ति के रूप में पृष्ठ की अनुमति नहीं है ।

B. napus से परिसरों का विश्लेषण करने के लिए महत्वपूर्ण चरणों में फ्लोएम sap की कुल मात्रा को प्रारंभ सामग्री के रूप में उपयोग किया जाता है । फ्लोएम नमूना के कम से ६०० µ एल आवश्यक हैं और पांच अच्छी तरह से पानी वाले पौधों से प्राप्त किया जा सकता है । 3 डी के लिए पृष्ठ और बीएन उत्तरी सोख्ता यह फ्लोएम नमूनों की पर्याप्त मात्रा के साथ प्रारंभिक बीएन जेल शुरू करने के लिए आवश्यक है । इस लक्ष्य को प्राप्त करने के लिए, फ्लोएम नमूनों 20 से 30 µ ग्राम प्रोटीन के प्रत्येक अच्छी तरह से लोड किया जा सकता है और एक ही नमूना के कम से triplicates समानांतर में चला रहे हैं जब तक केंद्रित कर रहे हैं । बहुत कम या बहुत उच्च सांद्रता परिसरों का पता लगाने को कम (चित्र 3) । फ्लोएम नमूनों की जरूरत है बर्फ पर प्रतिक्रिया ट्यूबों में एकत्र किया जाना चाहिए और बाद में उपयोग के लिए जमे हुए प्रोटीन क्षरण और कारोबार से बचने के लिए संग्रहीत किया जाना चाहिए । सभी फ्लोएम proteomes में विश्लेषण अवरोधकों पाया गया है, लेकिन यह भी एक पूरी तरह से सक्रिय proteasome बी napus4के फ्लोएम में वर्णित किया गया था । इसके अलावा, मात्रा और फ्लोएम नमूनों की संरचना नमूना समय बिंदु और पर्यावरण की स्थिति10पर निर्भर करते हैं । इसलिए देखभाल इसी तरह की स्थितियों के तहत दिन के एक ही समय में एकत्र करने के लिए लिया जाना चाहिए । तनाव उपचार (जैसे सूखा) फ्लोएम की मात्रा को कम कर सकते हैं जो एकत्र किया जा सकता है । मास स्पेक्ट्रोमेट्री द्वारा एकल प्रोटीन की पहचान करने के लिए, यह हर समय दस्ताने पहन कर संभव केरातिन संदूषणों को सीमित करने के लिए अनिवार्य है । केरातिन बड़े पैमाने पर कल्पना विश्लेषण के दौरान अतिरिक्त संकेतों की ओर जाता है और प्रोटीन की पहचान में बाधा । एक उच्च वोल्टेज या परिवेश के तापमान पर बीएन-पृष्ठ रनिंग जेल कि नाजुक परिसरों के विधानसभा में परिणाम हो सकता है की हीटिंग के लिए नेतृत्व कर सकते हैं ।

यहां प्रस्तुत प्रोटोकॉल प्रोटीन के विश्लेषण के लिए उपयुक्त है: प्रोटीन परिसरों । हम यह भी बताते है कि यह विशिष्ट समानांतर में परिसरों में निहित RNAs का पता लगाने के लिए इस्तेमाल किया जा सकता है । इस लक्ष्य को हासिल करने के लिए, हम हाल ही में बीएन उत्तरी सोख्ता4के लिए एक प्रोटोकॉल शुरू किया । RNAs RNAse संदूषणों द्वारा क्षरण होने की आशंका है । ऐसे क्षरण को सीमित करने के लिए DEPC-स्वास्थ्यकर्मी, पानी का उपयोग करना चाहिए.

प्रस्तुत विधि की मुख्य सीमाएं प्रोटीन बीएन द्वारा अलग परिसरों के आणविक वजन का आकलन-पृष्ठ शामिल हैं, के बाद से प्रवास व्यवहार आकार, आकार पर निर्भर करता है और यहां तक कि परिसरों के posttranslational संशोधनों पर31, ४१. RNP परिसरों का आकार अनुमान और भी अधिक जटिल माइग्रेशन व्यवहार पर न्यूक्लिक एसिड के प्रभाव के कारण है । यह भी एक ही आकार सह के परिसरों एक एकल बैंड में माइग्रेट नहीं रोका जा सकता है. यह जटिल रचनाओं की गलत भविष्यवाणी करने के लिए नेतृत्व कर सकते हैं । इसलिए पूरक तकनीकों के साथ मनाया बातचीत की पुष्टि, कार्यात्मक परख4द्वारा उदा , आवश्यक हो सकता है । इसके अलावा प्रोटीन केवल कमजोर या क्षणिक एक macromolecular परिसर में जुड़े बीएन बफर इस्तेमाल में खो सकता है । इससे बचने के लिए, नमूनों crosslinked हो सकता है, क्या भी कलाकृतियों के लिए नेतृत्व कर सकते हैं या प्रोटीन की पहचान को रोकने कर सकते हैं, या बफर शर्तों अनुकूलित किया जा सकता.

शास्त्रीय 2d के विपरीत पृष्ठ, यूरिया का संयोजन-और एसडीएस-पृष्ठ hydrophobicity और आणविक वजन के बजाय isoelectric बिंदु (pI) और आणविक वजन 28के अनुसार जुदाई की अनुमति देता है, और एक के प्रोटीन के लिए जुदाई की सीमा नहीं है विशिष्ट pI श्रेणी । शास्त्रीय 2d-पृष्ठ के समान, अलग प्रोटीन एकल धब्बे के रूप में दिखाई दे रहे हैं, लेकिन एक तिरछी लाइन 4,28 (चित्रा 5, चित्रा 6) । अधिक hydrophobic प्रोटीन इस विकर्ण के ऊपर धब्बे में दिखाई देते हैं, जबकि अधिक हाइड्रोफिलिक प्रोटीन रेखा के नीचे पाए जाते हैं28. इस प्रोटोकॉल में इस्तेमाल होने polyacrylamide सांद्रता 25 से ८० केडीए के बीच प्रोटीन को अलग से अच्छी तरह लेगा. छोटे या बड़े प्रोटीन की जुदाई की अनुमति के लिए polyacrylamide एकाग्रता अलग किया जा सकता है या ढाल जैल तीसरे आयाम में इस्तेमाल किया जा सकता है । जटिल IV (चित्रा 3) 3 डी द्वारा अलग-पृष्ठ (चित्रा 6) के घटक बाहर काट रहे थे, trypsin पचा, और बड़े पैमाने पर स्पेक्ट्रोमेट्री द्वारा विश्लेषण किया । इसका परिणाम कई tRNA ligases की पहचान में आया । अंय परिसरों के घटकों को हाल ही में 4प्रकाशित किया गया है । हमारे 3 डी पृष्ठ अलग ligases, अर्थात् aspartate, asparagine, threonine, lysine और glycine ligases, समान आणविक भार (तालिका 3) के साथ जुदाई सक्षम होना चाहिए । एक मिथीयोनाईन tRNA-विशिष्ट जांच का उपयोग करना, हम जटिल चतुर्थ के भीतर संभावित बाध्य tRNA का पता लगाने में सक्षम थे, लेकिन यदि पूर्ण लंबाई tRNA या tRNA टुकड़े जटिल में है जांच इस्तेमाल के साथ भेदभाव नहीं किया जा सकता है । जांच करने के लिए अगर न्यूक्लिक एसिड वास्तव में जटिल के भीतर ही बंधे है और नहीं सह पलायन, पचा फ्लोएम एसएपी नमूने उपयुक्त प्रवास नियंत्रण के रूप में सेवा कर सकते हैं ।

यह पहले अटकलें है कि प्रोटीन अनुवाद फ्लोएम चलनी ट्यूबों के भीतर हो सकता है, के बाद से लगभग पूरे ribosome के अधिकांश घटकों के रूप में के रूप में अच्छी तरह से बढ़ाव कारकों फ्लोएम नमूनों में पाया गया है4,7। tRNA और tRNA ligases की हमारी खोज के लिए इस विचार का समर्थन लगता है । हालांकि, कद्दू से फ्लोएम नमूनों में मौजूद tRNA अंशों को अनुवाद के प्रबल अवरोधक४२ दिखाया गया है और कार्यात्मक ribosomes को4अनुपस्थित होने के लिए प्रतीत होता है, सुझाव है कि अनुवाद जगह नहीं ले सकता ।

एक साथ ले लिया, यहां प्रस्तुत प्रोटोकॉल देशी प्रोटीन की जुदाई: प्रोटीन और फ्लोएम नमूनों और जुदाई और उच्च संकल्प के साथ अपने व्यक्तिगत घटकों की पहचान से भी RNP परिसरों की अनुमति देता है । इस विधि के आवेदन फ्लोएम नमूनों में उपंयास प्रोटीन और RNP परिसरों की खोज में सक्षम बनाता है और इसलिए इस अत्यधिक विशेष संयंत्र डिब्बे में नए कार्य स्पष्ट कर सकते हैं ।

Disclosures

लेखकों का खुलासा करने के लिए कुछ नहीं है ।

Acknowledgments

हम उनके वैज्ञानिक समर्थन के लिए जेनिफर देके और Urszula Zarzenska को धन्यवाद देते हैं । इस कार्य को यूरोपीय आयोग द्वारा 7वें फ्रेमवर्क प्रोग्राम के अंतर्गत करियर इंटीग्रेशन ग्रांट (CIG, PCIG14-GA-2013-63 0734) द्वारा वित्तीय रूप से समर्थित किया गया, अनुदान LFF-GK06 ' DELIGRAH ' (Landesforschungsförderung हैम्बर्ग), और DFG अनुदान (DFG KE 856_6-1) जेके को सम्मानित किया ।

Materials

Name Company Catalog Number Comments
1.5 mL reaction tubes Eppendorf 30120086
10 well comb for SDS PAGE, thickness 1 mm BioRad 1653359
2-Propanol AppliChem 131090
30 % Acrylamide-bisacrylamide solution (29:1) solution BioRad 1610156
30 % Acrylamide-bisacrylamide solution (37.5:1) solution BioRad 1610158
96 % Ethanol Carl Roth P075
Acetic acid Carl Roth 6755
Agarose Lonza 50004
Aluminum sulfate-(14-18)-hydrate AppliChem 141101
Ammonium peroxodisulfate (APS) Carl Roth 9592.3
Bis-Tris AppliChem A3992
Boric acid AppliChem A2940
Bromophenol blue AppliChem A2331
Centrifugal concentrators e.g. Vivaspin 500 (Mwco 10 kDa) Sartorius VS0102
Chemiluminescent Nucleic Acid Detection Module Kit Thermo Fisher Scientific 89880
Chromatography papers e.g. 3 mm CHR Whatman 3030-153
CoolBox M30 System Biocision BCS-133
Coomassie brilliant Blue G-250 AppliChem A3480
Diethyl pyrocarbonate (DEPC) AppliChem A0881
Dithiothreitol (DTT) AppliChem A1101
DNase I AppliChem A3778
Ethanol abs. AppliChem A3693
Ethylenediaminetetraacetic acid (EDTA) AppliChem A1103
Gel Imaging system e.g. Chemidoc Touch BioRad 1708370
GeneRuler 1kb plus Thermo Fisher Scientific SM1331
Glycerol AppliChem 141339
Glycine AppliChem 131340
Heating block TS1 Biometra 846-051-500
Hybridization oven e.g. GFL Hybridization Incubator 7601 GFL 7601
Hypodermic needle (0.8 mm) B Braun 4658309
IPG gel comb, thickness 1 mm BioRad 1653367
Labeling of RNA e.g.Biotin 3'end DNA Labeling Kit Thermo Fisher Scientific 89818
Native gradient gel e.g. Novex NativePAGE 4–16% Bis-Tris protein gel Invitrogen BN1002BOX
Nylon membrane e.g. Hybond-N+ Amersham Pharmacia RPN203B
Ortho-phosphoric acid Carl Roth 6366.1
PageRuler prestained protein ladder Thermo Fisher Scientific 26616
Power supply for Gel electrophoresis EPS Amersham Pharmacia 18-1130-01 available from GE Healthcare
RNA Cleanup Kit Qiagen 74204
Semi dry blot e.g. Fastblot 43B semi dry Blot Biometra 846-015-100
Sodium chloride (NaCl) AppliChem A1149
Sodium dodecyl sulfate (SDS) AppliChem 142363
Synthesis of cDNA e.g. RevertAid First Strand cDNA Synthesis Kit Thermo Fisher Scientific K1621
Tetramethylethylenediamine (TEMED) AppliChem A1148
Tricine AppliChem A3954
Tris AppliChem A1086
Tri-sodium citrate dihydrate AppliChem A3901
TRIzol Reagent Thermo Fisher Scientific 15596026
ULTRAhyb Ultrasensitive Hybridization Buffer Thermo Fisher Scientific AM8670
Urea AppliChem A1360
UV Crosslinker e.g. Stratalinker 2400 Agilent NC0477671 from Fisher Scientific
Vertical electrophoresis apparatus e.g.The XCell SureLock Mini-Cell or Mini-Protean III System Thermo Fisher Scientific or BioRad EI0001 or 1658004
Wipers e.g. KIMWIPES Delicate Task Wipers Kimberly-Clark 34120

DOWNLOAD MATERIALS LIST

References

  1. Kempers, R., van Bel, A. J. E. Symplasmic connections between sieve element and companion cell in the stem phloem ofVicia faba L. have a molecular exclusion limit of at least 10 kDa. Planta. 201, (2), 195-201 (1997).
  2. Stadler, R., et al. Expression of GFP-fusions in Arabidopsis companion cells reveals non-specific protein trafficking into sieve elements and identifies a novel post-phloem domain in roots. Plant J. 41, (2), 319-331 (2005).
  3. Imlau, A., Truernit, E., Sauer, N. Cell-to-cell and long-distance trafficking of the green fluorescent protein in the phloem and symplastic unloading of the protein into sink tissues. Plant Cell. 11, (3), 309-322 (1999).
  4. Ostendorp, A., et al. Functional analysis of Brassica napus phloem protein and ribonucleoprotein complexes. New Phytol. 214, (3), 1188-1197 (2017).
  5. Paultre, D. S. G., Gustin, M. -P., Molnar, A., Oparka, K. J. Lost in Transit: Long-Distance Trafficking and Phloem Unloading of Protein Signals in Arabidopsis Homografts. Plant Cell. 28, (9), 2016-2025 (2016).
  6. Sali, A., Glaeser, R., Earnest, T., Baumeister, W. From words to literature in structural proteomics. Nature. 422, (6928), 216-225 (2003).
  7. Lin, M. -K., Lee, Y. -J., Lough, T. J., Phinney, B. S., Lucas, W. J. Analysis of the Pumpkin Phloem Proteome Provides Insights into Angiosperm Sieve Tube Function. Mol. Cell. Proteomics. 8, (2), 343-356 (2008).
  8. Giavalisco, P., Kapitza, K., Kolasa, A., Buhtz, A., Kehr, J. Towards the proteome of Brassica napus phloem sap. Proteomics. 6, (3), 896-909 (2006).
  9. Lucas, W. J., Yoo, B. C., Kragler, F. RNA as a long-distance information macromolecule in plants. Nat. Rev. Mol. Cell. Bio. 2, (11), 849-857 (2001).
  10. Dinant, S., Kehr, J. Sampling and Analysis of Phloem Sap. Plant Mineral Nutrients. 953, 185-194 (2013).
  11. Kennedy, J. S., Mittler, T. E. A Method of obtaining Phloem Sap via the Mouth-parts of Aphids. Nature. 171, (4351), 528 (1953).
  12. King, R. W., Zeevaart, J. A. Enhancement of Phloem exudation from cut petioles by chelating agents. Plant Physiol. 53, (1), 96-103 (1974).
  13. Alosi, M. C., Melroy, D. L., Park, R. B. The regulation of gelation of Phloem exudate from cucurbita fruit by dilution, glutathione, and glutathione reductase. Plant Physiol. 86, (4), 1089-1094 (1988).
  14. Dinant, S., Bonnemain, J. -L., Girousse, C., Kehr, J. Phloem sap intricacy and interplay with aphid feeding. Comptes rendus biologies. 333, (6-7), 504-515 (2010).
  15. Tetyuk, O., Benning, U. F., Hoffmann-Benning, S. Collection and analysis of Arabidopsis phloem exudates using the EDTA-facilitated Method. J Vis Exp. (80), e51111 (2013).
  16. Kovalskaya, N., Owens, R., Baker, C. J., Deahl, K., Hammond, R. W. Application of a modified EDTA-mediated exudation technique and guttation fluid analysis for Potato spindle tuber viroid RNA detection in tomato plants (Solanum lycopersicum). J. Virol. Methods. 198, 75-81 (2014).
  17. Rodriguez-Medina, C., Atkins, C. A., Mann, A. J., Jordan, M. E., Smith, P. M. Macromolecular composition of phloem exudate from white lupin (Lupinus albus L). BMC Plant Biol. 11, (1), 36 (2011).
  18. Taylor, J. S., Thompson, B., Pate, J. S., Atkins, C. A., Pharis, R. P. Cytokinins in the Phloem Sap of White Lupin (Lupinus albus L.). Plant Physiol. 94, (4), 1714-1720 (1990).
  19. Yoo, B., et al. A Systemic Small RNA Signaling System in Plants. Plant Cell. 16, (8), 1979-2000 (2004).
  20. Buhtz, A., Springer, F., Chappell, L., Baulcombe, D. C., Kehr, J. Identification and characterization of small RNAs from the phloem of Brassica napus. Plant J. 53, (5), 739-749 (2008).
  21. Chalhoub, B., et al. Plant genetics. Early allopolyploid evolution in the post-Neolithic Brassica napus oilseed genome. Science. 345, (6199), 950-953 (2014).
  22. Sasaki, T., Chino, M., Hayashi, H., Fujiwara, T. Detection of several mRNA species in rice phloem sap. Plant Cell Phys. 39, (8), 895-897 (1998).
  23. Doering-Saad, C., Newbury, H. J., Bale, J. S., Pritchard, J. Use of aphid stylectomy and RT-PCR for the detection of transporter mRNAs in sieve elements. J Exp. Bot. 53, (369), 631-637 (2002).
  24. Ruiz-Medrano, R., Xoconostle-Cázares, B., Lucas, W. J. Phloem long-distance transport of CmNACP mRNA: implications for supracellular regulation in plants. Dev. 126, (20), 4405-4419 (1999).
  25. Schägger, H., Cramer, W. A., von Jagow, G. Analysis of molecular masses and oligomeric states of protein complexes by blue native electrophoresis and isolation of membrane protein complexes by two-dimensional native electrophoresis. Anal. Biochem. 217, (2), 220-230 (1994).
  26. Schägger, H., von Jagow, G. Blue native electrophoresis for isolation of membrane protein complexes in enzymatically active form. Anal. Biochem. 199, (2), 223-231 (1991).
  27. Fiala, G. J., Schamel, W. W. A., Blumenthal, B. Blue native polyacrylamide gel electrophoresis (BN-PAGE) for analysis of multiprotein complexes from cellular lysates. J Vis Exp. (48), e2164 (2011).
  28. Rais, I., Karas, M., Schägger, H. Two-dimensional electrophoresis for the isolation of integral membrane proteins and mass spectrometric identification. Proteomics. 4, (9), 2567-2571 (2004).
  29. Schägger, H. Tricine-SDS-PAGE. Nature protocols. 1, (1), 16-22 (2006).
  30. Wittig, I., Braun, H. -P., Schägger, H. Blue native PAGE. Nat Protoc. 1, (1), 418-428 (2006).
  31. Eubel, H., Braun, H. -P., Millar, A. H. Blue-native PAGE in plants: a tool in analysis of protein-protein interactions. Plant Methods. 1, (1), 11 (2005).
  32. Laemmli, U. K. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature. 227, (5259), 680-685 (1970).
  33. Dyballa, N., Metzger, S. Fast and sensitive colloidal coomassie G-250 staining for proteins in polyacrylamide gels. J Vis Exp. (30), (2009).
  34. Turnbull, C. G. N., Lopez-Cobollo, R. M. Heavy traffic in the fast lane: long-distance signalling by macromolecules. New Phytol. 198, (1), 33-51 (2013).
  35. Hall, S. M., Baker, D. A. The chemical composition of Ricinus phloem exudate. Planta. 106, (2), 131-140 (1972).
  36. Barnes, A., Bale, J., Constantinidou, C., Ashton, P., Jones, A., Pritchard, J. Determining protein identity from sieve element sap in Ricinus communis L. by quadrupole time of flight (Q-TOF) mass spectrometry. J. Exp. Bot. 55, (402), 1473-1481 (2004).
  37. Walz, C., Giavalisco, P., Schad, M., Juenger, M., Klose, J., Kehr, J. Proteomics of curcurbit phloem exudate reveals a network of defence proteins. Phytochemistry. 65, (12), 1795-1804 (2004).
  38. Walz, C., Juenger, M., Schad, M., Kehr, J. Evidence for the presence and activity of a complete antioxidant defence system in mature sieve tubes. Plant J. 31, (2), 189-197 (2002).
  39. Kehr, J. Phloem sap proteins: their identities and potential roles in the interaction between plants and phloem-feeding insects. J Exp. Bot. 57, (4), 767-774 (2006).
  40. Ham, B. -K., Brandom, J. L., Xoconostle-Cázares, B., Ringgold, V., Lough, T. J., Lucas, W. J. A polypyrimidine tract binding protein, pumpkin RBP50, forms the basis of a phloem-mobile ribonucleoprotein complex. Plant Cell. 21, (1), 197-215 (2009).
  41. Schamel, W. W. Biotinylation of protein complexes may lead to aggregation as well as to loss of subunits as revealed by Blue Native PAGE. J. Immunol. Methods. 252, (1-2), 171-174 (2001).
  42. Zhang, S., Sun, L., Kragler, F. The phloem-delivered RNA pool contains small noncoding RNAs and interferes with translation. Plant Physiol. 150, (1), 378-387 (2009).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics