Generatie van eerste hart veld-achtige cardiale progenitoren en ventriculaire-achtige Cardiomyocytes van menselijke pluripotente stamcellen

* These authors contributed equally
Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Hier beschrijven we een schaalbare methode, met behulp van een eenvoudige combinatie van Activin A en lentivirus-gemedieerde Id1-overexpressie, voor het genereren van eerste hart veld-achtige cardiale progenitoren en ventriculaire-achtige cardiomyocytes van menselijke pluripotente stamcellen.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Yu, M. S., Spiering, S., Colas, A. R. Generation of First Heart Field-like Cardiac Progenitors and Ventricular-like Cardiomyocytes from Human Pluripotent Stem Cells. J. Vis. Exp. (136), e57688, doi:10.3791/57688 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

De generatie van grote hoeveelheden van functionele menselijke pluripotente stamcellen cardiale voorlopercellen en cardiomyocytes van gedefinieerde hart veld oorsprong is een vereiste voor cel-gebaseerde cardiale therapieën en modellering van de ziekte. We hebben onlangs aangetoond dat Id genen zowel noodzakelijk zijn en voldoende om aan te geven van de eerste veld voorlopercellen van het hart tijdens de ontwikkeling van de gewervelde. Deze differentiatie-protocol maakt gebruik van deze bevindingen en Id1 overexpressie gebruikt in combinatie met Activin A potent opgeven signalen te produceren eerste hart veld-achtige (FHF-L) progenitoren. Bovenal differentiëren resulterende progenitoren efficiënt (~ 70-90%) in ventriculaire-achtige cardiomyocytes. Hier beschrijven we een gedetailleerde methode 1) worden gegenereerd Id1-overexpressing hPSCs en 2) schaalbare hoeveelheden cryopreservable FHF-L progenitoren en ventriculaire-achtige cardiomyocytes onderscheiden.

Introduction

Grootschalige productie van menselijke pluripotente stamcellen (hPSCs)-afgeleide cardiale progenitoren en cardiomyocytes is een eerste vereiste voor stamcel gebaseerde therapieën1, modelleren van2,3 en de snelle karakterisering van ziekte nieuwe trajecten regulering van de cardiale differentiatie4,5,6 en fysiologie7,8. Hoewel een aantal studies9,10,11,12,13,14hebben,15 eerder beschreven hoogefficiënte de protocollen van de cardiale differentiatie van hPSCs, geen heeft gericht de hart veld oorsprong van resulterende cardiomyocytes, ondanks de identificatie van moleculaire verschillen tussen links (eerste hart veld) en rechts (tweede hart-veld) ventriculaire cardiomyocytes16 en het bestaan van hart veld-specifieke aangeboren hartziekten; dat wil zeggen, hypoplastic linker hart syndroom17 of arrhythmogenic recht ventriculaire dysplasie18. Dus, de generatie van cardiale voorlopercellen en cardiomyocytes van gedefinieerde hart veld oorsprong van hPSCs wordt steeds een noodzaak teneinde hun relevantie als therapeutische en ziekte modeling tools.

Dit protocol is gebaseerd op de constitutieve overexpressie van Id1, een onlangs geïdentificeerde5 eerste hart veld-opgeven cue thats in combinatie met Activin A, noodzakelijk en voldoende zijn om te starten van cardiogenesis in hPSCs. Met name Cunningham et al. (2017) 5 Toon dat Id1-geïnduceerde progenitoren specifiek express eerste hart-veld (HCN4, TBX5) maar niet het tweede hart veld markeringen (SIX2, ISL1) als ze cardiale differentiatie ondergaan. Bovendien, tonen de auteurs ook dat transgene muis embryo's ontbreekt de hele Id familie van genen (Id1-4), zonder dat zij eerste hart veld cardiale progenitorcellen, terwijl meer mediaal en posterieure cardiale progenitoren (vormen ontwikkelen tweede hart-veld) kan nog steeds vormen, waardoor suggereren dat Id eiwitten essentieel zijn voor het eerste hart veld cardiogenesis geactiveerd in vivo. Gunstig, Id1-geïnduceerde progenitoren kunnen worden cryopreserved en spontaan onderscheiden in cardiomyocytes ventriculaire-achtige kenmerken, met inbegrip van ventriculaire-specifieke markeringen (IRX4, MYL2) expressie weer te geven en ventriculaire-achtige actie potentieel.

Hier beschrijven we een eenvoudige en schaalbare methode voor het genereren van eerste hart veld-achtige (FHF-L) cardiale progenitoren en ventriculaire-achtige cardiomyocytes van Id1 overexpressing hPSCs. Een belangrijk kenmerk van dit protocol is de mogelijkheid om het afkoppelen van cardiale voorlopercellen generatie van latere cardiomyocyte productie met behulp van een handige cryopreservatie stap. Kortom, dit protocol gegevens de nodige maatregelen om (1) genereren Id1-overexpressing hPSCs, (2) genereren FHF-L cardiale progenitoren uit hPSCs (3) cryopreserve van de resulterende progenitoren en (4) hervatten FHF-L cardiale voorlopercellen differentiatie en genereren hoogverrijkt (> 70-90%) ventriculaire-achtige cardiomyocytes gewonnen.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Id1 Virus voorbereiding en infectie

  1. De overexpressing lentivirus Id1 door co transfecting pCMVDR8.74, pMD2.G en pCDH-EF1-Id1-PGK-PuroR genereren (Addgene: plasmide #107735) in HEK293T cellen. Virale deeltjes verzamelen, filtraat zuiveren van het supernatant en opslaan bij-80 ° C zoals Kitamura et al. (2003) 19. als alternatief, produceren Id1 lentivirus commercieel door pCDH-EF1-Id1-PGK-PuroR te sturen naar een lentivirus-producerende leverancier.
    Let op: Volg lentivirale veiligheidsvoorschriften en standaardwerking protocollen.
    Opmerking: Belangrijk: optimale virus titer moet ten minste 108 tot 109 Transducing eenheden/mL (TU/mL).
  2. Jas voorafgaand aan infectie, één putje van een 96 goed plaat met 50 µl van coating reagens, meestal een gelatine-achtige eiwitten mengsel uitgescheiden door Engelbreth-Holm-Swarm muis Sarcoom cellen (Zie Tabel van materialen).
  3. Een putje van pluripotente stamcellen gekweekt in een 6 goed plaat door toevoeging van 1 mL PBS zonder Ca2 + en Mg2 + en met 0,5 mM EDTA distantiëren.
    Opmerking: Dissociatie tijd varieert van 3 – 10 min. Wanneer meer dan 80% van de cellen zijn losgekoppeld van de onderkant van de plaat, verder voor volgende trede.
  4. Celsuspensie met steriele Pipetteer in 15 mL kunststof centrifugebuis verzamelen.
  5. Neutraliseer dissociatie reagens met 5 mL PBS-bevattende Ca2 + en Mg2 +.
  6. Pellet cellen door middel van centrifugeren (200 x g gedurende 3 minuten).
  7. Verwijder de bovendrijvende vloeistof en zachtjes flick de buis om te verjagen van de pellet.
  8. Resuspendeer de cellen in 1 mL van de media van de cel van de stam.
  9. Cellen met behulp van een geautomatiseerde cel teller na instructies van de leverancier te tellen.
  10. Plaat 20.000 levensvatbare cellen per well (96-wells-plaat) gecoat in 50 µL van stamcel media, aangevuld met 2 µM RHO/ROCK traject remmer (Zie tabellen 1 en 2).
  11. Na 24u, controleren voor bevestiging van de cel en media te vervangen door 100 µl stamcel media aangevuld met 2 µM RHO/ROCK traject remmer en 6 ng/mL hexadimethrine bromide (Zie tabellen 1 en 2), één h vóór lentivirale infectie.
    Opmerking: Cellen moeten stevig worden gekoppeld aan de onderkant van de plaat.
  12. Ontdooi Id1-lentivirus op ijs.
  13. Voeg 3 µL van gezuiverde lentivirus per putje (virus titer moet tussen 108 tot 109 TU/mL), en breng de plaat terug naar cel cultuur incubator (5% CO2, 37 ° C, 20% O2).
  14. 24u na virale infectie, voeg 100 µL van de cel van de stam van de nieuwe media aan de geïnfecteerde cellen.
  15. 48 h na lentivirale infectie, vervangen virus met media met 200 µL van de cel van de stam van de verse media aangevuld met 1 µg/mL puromycin.
  16. Refresh media dagelijks met 200 µL van stamcel media aangevuld met 1 µg/mL puromycin.
  17. Wanneer culturen 80% confluentie bereikt, distantiëren cellen met behulp van 200 µL van PBS zonder Ca2 + en Mg2 + + 0.5 mM EDTA (voor een put van een 96-wells-plaat).
  18. Celsuspensie in een centrifugebuis verzamelen.
  19. Neutraliseer dissociatie reagens met 5 mL PBS-bevattende Ca2 + en Mg2 +.
  20. Pellet cellen door middel van centrifugeren (200 x g gedurende 3 minuten).
  21. Verwijder de bovendrijvende vloeistof en zachtjes flick de buis om te verjagen van de pellet.
  22. Resuspendeer de cellen in 1 mL van de stamcel media, aangevuld met 2 µM RHO/ROCK traject remmer.
  23. Alle cellen (1 mL) overbrengen in een gecoate goed van een 12-well-plaat.
  24. Na 24u, monitor voor cel gehechtheid aan de media van het goed en vervangen met 1 mL van stamcel media aangevuld met 2 µM RHO/ROCK traject remmer en 6 ng/mL hexadimethrine bromide, één h vóór transductie.
  25. Ontdooi Id1-lentivirus op ijs.
  26. Voeg 5 µL van gezuiverde virus per putje (12-well plaat).
  27. 24u na lentivirale infectie, vervangen virus met media met 1 mL van de cel van de stam van de nieuwe media, aangevuld met 3 µg/mL puromycin.
  28. 48 h post lentivirale infectie, virus met media met 1 mL van de cel van de stam van de verse media aangevuld met 6 µg/mL puromycin vervangen.
  29. Wanneer culturen 80% confluentie bereikt, distantiëren cellen met behulp van 500 µL van PBS zonder Ca2 + en Mg2 + en met 0,5 mM EDTA (voor één putje van de plaat van een 12-well).
  30. Overdracht van de helft (250 µL) van de celsuspensie aan één putje van een coating reagens gecoat 6-well plaat met 2 mL stamcel media, aangevuld met 2 µM RHO/ROCK traject remmer.
  31. Gebruik de andere helft (250 µL) van het monster voor RNA extractie en qRT-PCR om te bepalen lentivirale-gemedieerde Id1 expressie niveaus, zoals Colas et al. (2012) 4.
    Opmerking: Belangrijk: als Id1 mRNA uitdrukking niveaus lager zijn dan 0,005 vouw van GAPDH expressie niveau (Zie tabel 3 voor qRT-PCR inleidingen), herhaal infectie proces zoals hierboven beschreven totdat Id1 expressie niveaus hoger zijn dan de drempel.

2. hPSCsId1 onderhoud

  1. Cultuur hPSCsId1 in gecoate 6 goed-platen en groeien in 3 mL per putje van stamcel media aangevuld met 6 µg/mL puromycin.
  2. Wanneer hPSCsId1 80% confluentie bereikt, passage van de cellen als aggregaten (1:6 splitsingsverhouding) met behulp van enzym-vrije dissociatie reagens volgens richtlijnen van de leverancier en groeien in 3 mL per putje van stamcel media aangevuld met 6 µg/mL puromycin.

3. bereiding van hPSCsId1 differentiatie

  1. Jas van een 12-well plaat met 500 µL per putje coating reagens.
  2. Wanneer hPSCsId1 90% confluentie bereiken cellen distantiëren door toevoeging van 1 mL PBS zonder Ca2 + en Mg2 + en met 0,5 mM EDTA per putje voor 5-10 min. dissociatie proces elke minuut, en eens 80% van de cellen zijn losgekoppeld van de plaat , gaat u verder met de volgende stap.
  3. Celsuspensie in een centrifugebuis verzamelen.
  4. Neutraliseer dissociatie reagens met 5 mL PBS-bevattende Ca2 + en Mg2 +.
  5. Pellet cellen door middel van centrifugeren (200 x g gedurende 3 minuten).
  6. Verwijder de bovendrijvende vloeistof en zachtjes flick de buis om te verjagen van de pellet.
  7. Resuspendeer de cellen in 2 mL zuiver stamcel media, aangevuld met 2 µM RHO/ROCK traject remmer.
  8. Cellen tellen met behulp van een geautomatiseerde cel counter.
  9. De cellen van de plaat 300.000 per putje in 1 mL van de stamcel media, aangevuld met 2 µM RHO/ROCK traject remmer en 6 µg/mL puromycin en overdracht plaat in weefselkweek incubator.
  10. Refresh media dagelijks met 2 mL stamcel media aangevuld met 6 µg/mL puromycin culturen tot 90% confluentie. Op dit punt, het initiëren van cardiale differentiatie (volgende stap).

4. differentiatie van hPSCsId1 in eerste hart veld-achtige cardiale progenitoren (FHF-L CPs)

  1. Voor 12-well plaat formaat, starten differentiatie (dag 0) door vervanging van de stamcel media met 1,5 mL inductie media (tabel 1) aangevuld met Activin een (100 ng/mL) (Zie tabel 2 voor aanbevolen volumes en Activin A concentraties voor verschillende plaat formaten).
  2. Op dag 1 (24 h na differentiatie wordt gestart), door media te vervangen door 2 mL inductie media zonder Activin A (per putje van de plaat van een 12-well).
  3. Op dag 3, door media te vervangen door 2 mL inductie media zonder Activin A (per putje van de plaat van een 12-well).
  4. Op dag 5, verzamelen FHF-L CPs voor cryopreservatie (volgende stap).
    Opmerking: Belangrijk: Cryopreservatie heeft de voorkeur op dit punt, omdat het in staat stelt om het afkoppelen van de cardiale voorlopercellen generatie van latere cardiomyocyte productie en biobank grote batches van cellen. Opmerking dat ook dag 5 FHF-L CPs kan worden doorgegeven aan een vers beklede plaat voort te zetten van differentiatie, gelieve te verwijzen naar stap 5.1-5.5 naar passFHF-L CPs en gaat u verder met stap 6.5 voor differentiatie.

5. cryopreservatie van FHF-L CPs

  1. Alle media uit putten met dag 5 gecombineerd FHF-L CPs en snel Voeg 1 mL warm (37 ° C) 1 x enzym-bevattende dissociatie reagens (Zie Tabel van materialen). Plaats de plaat in de weefselkweek incubator.
  2. Na 1 minuut, schud het plaat van links naar rechts in de incubator.
  3. Na 2 min (totaal tijd), verwijder plaat uit de incubator en voeg 1 mL 10% FBS media.
  4. Zachtjes Pipetteer cellen op en neer met een 5 mL-pipet om mobiele-detachement van de plaat.
  5. Verzamelen van celsuspensie naar een centrifuge buis en pellet cellen door centrifugeren bij 200 x g gedurende 3 min
  6. Resuspendeer de pellet cel in 2 mL zuiver cryopreservatie reagens.
  7. Cellen tellen met behulp van een geautomatiseerde cel counter.
  8. Cryopreservatie reagens toevoegen (Zie Tabel van materialen) op een voldoende volume aan het cryopreserve van de cellen op de gewenste concentratie (gewoonlijk 5-10 x 106 cellen/mL).
  9. Overbrengen van cellen naar cryopreservatie flesjes en plaats van flesjes in koeling apparaat (1 ° C/min) en plaats koeling apparaat in de vriezer-80 ° C's nachts.
  10. Na 24u, door bevroren flesjes te overbrengen in vloeibare stikstof voor lange termijn opslag.
    Opmerking: Het protocol kan hier worden gepauzeerd.

6. FHF-L CP differentiatie in ventriculaire-achtige Cardiomyocytes

  1. Pipetteer dag 5 FHF-L CPs bevroren flesjes uit de opslag van vloeibare stikstof in droog ijs container.
  2. Plaats flesjes in het waterbad 37 ° C gedurende 2 à 3 minuten, tot celsuspensie is volledig ontdooid.
    Opmerking: Belangrijk: het ontdooien proces is tijdgevoelig. Cellen tot de cryopreservatie media bloot voor een buitensporige hoeveelheid tijd (dat wil zeggen, 10 min) levensvatbaarheid van de cellen zal afnemen.
  3. Cellen naar 15 of 50 mL centrifugebuis, afhankelijk van het aantal ontdooide flesjes overbrengen.
  4. Afzien van dropwise (5 druppels elke 30 seconden) voorverwarmde (37 ° C) cardiogeen media (tabel 1) tot de oplossing van de cel. Herhaal dit proces tot een 1:3 cryopreservatie media: cardiogeen media verhouding wordt bereikt. Op dit punt, de cardiogeen media toevoeging tarief te verhogen tot een 1:10 cryopreservatie media: cardiogeen media verhouding wordt bereikt.
    Opmerking: Belangrijk: snelle osmolariteit wijzigingen zal toenemen celdood tijdens het ontdooien; Daarom, dropwise toevoeging van cardiogeen media zoals hierboven beschreven wordt sterk aanbevolen.
  5. Centrifugeer cel schorsing en pellet cellen door middel van centrifugeren (200 x g gedurende 3 minuten).
  6. Verwijder de bovendrijvende vloeistof en zachtjes flick centrifugebuis te verjagen cel pellet.
  7. Resuspendeer de cellen met cardiogeen media, aangevuld met 2 µM RHO/ROCK traject remmer.
    Opmerking: Levensvatbaarheid van de cellen kan variëren van dooi te ontdooien, en in het algemeen, > 65% levensvatbaarheid voorspelt goed plating efficiëntie.
  8. Verdunde geconcentreerd celsuspensie met cardiogeen media, aangevuld met 2 µM RHO/ROCK traject-remmer te verkrijgen van de gewenste cel concentratie voor beplating (Zie tabel 2 voor verschillende plaat formaten).
    Opmerking: Belangrijk: cardiale differentiatie efficiëntie kan weigeren als cellen worden overgeënt te dun.
  9. Zaad-cellen op plaat.
  10. Houd plaat in de kap van de weefselcultuur voor 20 min alvorens over te dragen aan weefselkweek incubator.
  11. Controleren op dag 6 van differentiatie, cel bijlage.
    Opmerking: Cardiac progenitoren zijn cryopreserved op dag 5 van de differentiatie. 24 h na het ontdooien van de cellen wordt vastgesteld op dag 6 van de differentiatie.
    Opmerking: De aanwezigheid van zwevende (dode) cellen is gemeenschappelijk.
  12. Op dag 7, gecombineerd van 50% van de media en vervangen met een gelijke hoeveelheid verse cardiogeen media.
    Opmerking: De toevoeging van RHO/ROCK traject remmer aan de cardiogeen media is niet nodig na dit punt.
  13. Vervangen door 50% van de media cardiogeen media om de andere dag.
  14. Opmerking spontane verslaan die wordt weergegeven tussen dag 11 en dag 13.
  15. Op dag 15, cardiale differentiatie efficiëntie te kwantificeren met immunofluorescentie met behulp van de DAPI (nucleus vlek) en ACTC1 (pan-cardiale marker).

7. passeren en het onderhoud van ventriculaire-achtige Cardiomyocytes

Opmerking: Door de dag 14 – 16: een monolayer van spontaan aanbestedende ventriculaire-achtige cardiomyocytes moet worden verkregen. Op dit punt wordt voorgesteld te distantiëren en opnieuw cardiomyocytes Meng de cultuur te voorkomen dat cellen loskoppelen van de plaat plaat.

  1. Alle media uit putten gecombineerd en snel Voeg 1 mL voorverwarmde (37 ° C) 1 x enzym-bevattende dissociatie reagens.
    Opmerking: 1 x enzym-bevattende dissociatie reagens volumes variëren, afhankelijk van de indeling van de plaat, maar moet volledig bedekt de bodem van het goed oppervlak.
  2. Pipetteer plaat in een incubator weefselkweek.
  3. Voorzichtig schudden plaat links naar rechts om de 2 min binnen de incubator te versnellen detachement.
  4. Na 5 – 15 min, wanneer 80% tot 100% van de cellen zijn losgekoppeld van de onderkant van de plaat, verwijderen de plaat uit de incubator en 1 x enzym-bevattende dissociatie reagens activiteit remmen door een gelijk volume van 10% FBS media toe te voegen.
    Opmerking: Incubatietijd met 1 x enzym-bevattende dissociatie voor dit proces zal variëren van batch tot batch.
  5. Verzamelen celsuspensie een centrifugebuis.
  6. Meng celsuspensie met pipet en het aantal cellen met behulp van een geautomatiseerde cel counter.
  7. Verdun celsuspensie gewenste cel concentratie (Zie tabel 2 voor verschillende plaat formaten) met onderhoud media, aangevuld met 2 µM RHO/ROCK traject remmer.
  8. Na het zaaien cardiomyocytes op het bord, de cellen verdelen en laat de cellen koppelen voor 10 – 20 min vóór de overbrenging van plaat tot weefselkweek incubator.
  9. 24 h na opnieuw plating, controleren cel gehechtheid en herstel.
    Opmerking: De aanwezigheid van zwevende (dode) cellen is gemeenschappelijk. 48-72 uur na het opnieuw plating, cardiomyocyte moet hervatten spontane contractie.
  10. Als u wilt behouden cardiomyocyte cultuur, vervangen door 50% van de media de media onderhoud om de andere dag tot gebruik van ventriculaire-achtige cardiomyocytes voor latere experimenten.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Generatie van hPSCs Id1 lijnen
hPSCs zijn besmet met een lentivirus bemiddelen Id1 overexpressie(Figuur 1). Zodra hPSCId1 worden gegenereerd, wordt transgenic expressie gekwantificeerd door qRT-PCR (Figuur 1B). Alleen hPSCId1 regels uitdrukken Id1 mRNA niveau groter is dan 0,005 vouw die van GAPDH moeten worden gebruikt voor differentiatie.

hPSCs Id1 Onderhoud en voorbereiding van D ifferentiation
Optimale cultuur voorwaarden zijn noodzakelijk en cruciaal voor succesvolle eerste hart veld-achtige cardiale voorlopercellen differentiatie(Figuur 2). hPSCId1 culturen moeten dagelijks worden gecontroleerd op stam morfologie onderhoud en continue verspreiding. Differentiatie moet worden gestart wanneer de cel van de stam van de opeengepakte kolonies bij > 90% confluentie (Figuur 2B). Als differentiatie wordt geïnitieerd voorafgaand aan optimale confluentie, celdood wordt verbeterd en efficiëntie van de differentiatie kan weigeren (Figuur 2C). Evenzo zal overwoekerd culturen presteren slecht (Figuur 2D).

Generatie van eerste hart veld-achtige cardiale progenitoren (FHF-L CPs) van hPSCs Id1
Op dag 1 (24 h post differentiatie initiatie), moeten cellen worden gecontroleerd om te zien hoe verlies van de morfologie van de stamcellen (cellen verschijnen platter en donkerder dan stamcellen). Merk op dat celdood gebruikelijk tijdens de eerste dag van differentiatie is, maar cel confluence moet worden gehandhaafd op > 75%(Figuur 2). Als na 24 h van differentiatie, 50% of meer van de overdekte oppervlakte verloren is gegaan, moeten cellen worden weggegooid.

Op dag 3, onderscheidende cellen moeten blijven geclusterde en lacunes gemaakt tijdens de eerste 24 h periode (Figuur 2F) hebben ingevuld. Platte cellen groeien onafhankelijk zijn indicatief voor suboptimaal differentiatie voorwaarden.

Op dag 4, moet optimale differentiatie Toon voortdurende uitbreiding en dekking van de plaat.

Op dag 5, worden de cellen geoogst en cryopreserved. Optimale differentiatie moeten resulteren in strak aangesloten cel clusters met homogene morfologie verschijning (Figuur 2G). Er rekening mee dat clusters van de lage dichtheid van platte cellen een suboptimaal differentiatie resultaat markeren. Zie tabel 2 voor de gemiddelde opbrengst van dag 5 cardiale progenitoren per putje in diverse formaten cultuur.

Generatie van ventriculaire-achtige Cardiomyocytes van FHF-L CPs
Dag 5 FHF-L CPs worden ontdooid op plaat formaat-afhankelijke dichtheden beschreven in tabel 2, om het maximaliseren van hun potentiële cardiale differentiatie (Figuur 3A en tabel 2). De levensvatbaarheid na het ontdooien moet worden gecontroleerd. In het algemeen varieert de levensvatbaarheid van 70-80%. Als de levensvatbaarheid lager is dan 60%, zou de opbrengst van cardiomyocytes worden beïnvloed.

Op dag 6 (24u na het hervatten van differentiatie), dient de FHF-L CPs > 90% van de beschikbare oppervlakte en worden weergegeven als een homogene één laag van cellen (Figuur 3B). Lage samenvloeiing op dag 6 zal FHF-L CPs differentiatie in cardiomyocytes verminderen.

Resulterende cardiomyocytes beginnen te verslaan door dag 11-13 van differentiatie (Figuur 3C en film 1). Tijdens de dag 14 – 16 replating, Zie tabel 2 voor de gemiddelde opbrengst van cardiomyocytes per putje in verschillende formaten van de cultuur. Differentiatie efficiëntie wordt meestal beoordeeld door immunofluorescentie voor cardiale (ACTC1), fibroblast (TAGLN) en vasculaire endothelial markeringen (CDH5) en kernenergie (DAPI)-markeringen. Kwantificering van de afstamming wordt uitgevoerd met behulp van geautomatiseerde beeldvorming en fluorescentie kwantificering, zoals Cunningham et al. (2017) 5 (Figuur 3D-E). Subtype karakterisering van resulterende cardiomyocytes wordt uitgevoerd door qRT-PCR (Figuur 3F) en actiepotentiaal transiënt analyse met behulp van kinetische beeldvorming en spanning sensing sondes (Figuur 3G en Movie 2). Fluorescentie kwantificering voor de sonde van de spanning en de resulterende actiepotentiaal trace analyse (Figuur 3H) wordt uitgevoerd zoals beschreven in McKeithan et al. (2017) 7.

Figure 1
Figuur 1: generatie hPSCId1 lijnen. (A) schematische weergave van het hPSCs protocol voor het genereren vanId1 . (B) voorbeelden van qRT-PCR-resultaten tonen van representatieve Id1 mRNA niveaus gegenereerd door lentivirale-gemedieerde expressie van verschillende lijnen van hPSCId1 met inbegrip van één hESC regel en twee regels van hPSC lijnen. Onderbroken lijn vertegenwoordigt Id1 expressie drempel, onder welke hPSCId1 lijnen moeten ondergaan een extra cyclus van Id1-lentivirus infectie. "p" geeft het nummer van de passage. Het getal in de haakjes geeft het aantal rondes van Id1-lentivirale infectie. Foutbalken vertegenwoordigen standaarddeviatie van experimenten in drievoud. Klik hier voor een grotere versie van dit cijfer.

Figure 2
Figuur 2: Generatie van eerste hart Field-Like cardiale progenitoren (FHF-L CPs) differentiatie van hPSCId1. (A) schematische weergave van het protocol voor het genereren van FHF-L CP. Representatieve helder veld foto's van hPSCId1 (dag 0) bij optimale (B), sub heuvels (gele pijlpunten geven de vervallen gebieden tussen cellen) (C) en overmatige heuvels (D) dichtheden. Representatieve helder-veld-foto's van hPSCId1 differentiëren op dag 1, 3 en 5 respectievelijk (E), (F), (G). Schaal bar = 100 µm. Klik hier voor een grotere versie van dit cijfer.

Figure 3
Figuur 3: generatie ventriculaire-achtige Cardiomyocyte van FHF-L CPs. (A) Schematische weergave van het protocol voor het genereren van ventriculaire-achtige cardiomyocyte. (B) helder veld afbeelding van dag 6 differentiatie cellen (één dag na ontdooien). (C) helder veld afbeelding van een dag 12 kloppend cultuur. (D) vertegenwoordiger immunofluorescentie afbeelding van dag 15 culturen (384-well plaat formaat). ACTC1 markeert cardiomyocytes, TAGLN: fibroblasten/glad spierweefsel, CDH5: vasculaire endotheliale cellen en DAPI: kernen (getoond in de inzet). (E) Lineage kwantificering van dag 15 culturen. (F) qRT-PCR gegevens tijd cursus expressie vanaf dag 5 tot dag 25 van ventriculaire-specifieke markers (IRX4 en MYL2) en pan-cardiale marker (MYL7). (G) vertegenwoordiger actiepotentiaal trace van ventriculaire-achtige cardiomyocytes op dag 25 van differentiatie. (H) actiepotentiaal duur metingen (APD50 en APD90) van de resulterende ventriculaire-achtige cardiomyocytes (n = 12). Foutbalken vertegenwoordigen standaarddeviatie van experimenten in viervoud (tenzij anders vermeld). Schaal bars = 100 µm. RFU, relatieve fluorescentie eenheid. Klik hier voor een grotere versie van dit cijfer.

Medium Basis medium Additief
Stamcel Media mTesR1 n/b
Inductie Media RPMI 1640 Medium B-27 serumvrij Supplement zonder insuline, 1 x
Inductie Media RPMI 1640 Medium Puromycin, 6 µg Mo/ml
Inductie Media RPMI 1640 Medium Penicilline-streptomycine, 1 x
Cardiogeen Media RPMI 1640 Medium B-27 serumvrij Supplement, 1 x
Cardiogeen Media RPMI 1640 Medium Penicilline-streptomycine, 1 x
Onderhoud Media RPMI 1640 Medium B-27 serumvrij Supplement, 1 x
Onderhoud Media RPMI 1640 Medium De vervanging van de Serum van knock-out, 2%
Onderhoud Media RPMI 1640 Medium Penicilline-streptomycine, 1 x

Tabel 1: Media-onderdelen (zie tabel van materialen voor base media en additieven).

384 goed 96 goed 12 goed 6 goed 100 mm 150 mm
Coating volume (per putje) 10 ΜL 50 ΜL 500 ΜL 1 mL 5 mL 10 mL
Mediuminhoud
(per putje)
100 ΜL 300 ΜL 2 mL 5 mL 12 mL 30 mL
Differentiatie dag 0 activin een concentratie (ng/mL) 100 100 100 300
Cardiale voorlopercellen
dag 5-opbrengst
(cellen per putje)
1.0-1.2 x 105 2.5-3.0 x 105 1.0-1.5 x 107 2.0 – 3.0 x 107
Cardiale voorlopercellen dag 5 replating of ontdooien dichtheid (cellen per putje) 2.0 x 104 7.5 x 105 4.5 x 106 8.0 x 106 2.2 x 107
Ventriculaire-achtige cardiomyocyte
dag 14-16 opbrengst
(cellen per putje)
2.0 – 5.0 x 104 0,8-1,2 x 106 3.5 – 5.0 x 106 0,8-1,2 x 107 1.8-2.5 x 107
Ventriculaire-achtige cardiomyocyte dichtheid replating
(cellen per putje)
2.5 x 104 1.0 x 106 4.5 x 106 1.0 x 107 2.2 x 107

Tabel 2: Schaalbare differentiatie parameters (coating volume Mediuminhoud, Activin-A-concentratie, opbrengsten, dichtheden replating).

Gene naam Genenbank toetreding Volgorde
GAPDH NM_001256799 F: GGAGCGAGATCCCTCCAAAAT
R: GGCTGTTGTCATACTTCTCATGG
muis Id1 NM_010495 F: CCTAGCTGTTCGCTGAAGGC
R: CTCCGACAGACCAAGTACCAC
IRX4 NM_016358 F: GGCTCCCCAGTTCTTGATGG
R: TAGACCGGGCAGTAGACCG
MYL2 NM_000432 F: TTGGGCGAGTGAACGTGAAAA
R: CCGAACGTAATCAGCCTTCAG
MYL7 NM_021223 F: GCCCAACGTGGTTCTTCCAA
R: CTCCTCCTCTGGGACACTC

Tabel 3: qRT-PCR primer sequenties.

Movie 1
Film 1: helder veld opnemen (100 frames/s) van dag 15 cardiomyocytes waar spontane weeën kunnen worden waargenomen. Gelieve Klik hier om deze video te bekijken. (Klik met de rechtermuisknop om te downloaden.)

Movie 2
Movie 2: kinetische beeldvorming (100 frames/s) van spanning-gevoelige fluorescente sonde in dag 25 id1-geïnduceerde ventriculaire-achtige cardiomyocytes. Gelieve Klik hier om deze video te bekijken. (Klik met de rechtermuisknop om te downloaden.)

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Voor succesvolle differentiaties, zorg ervoor dat instructies boven op de voet volgen. Bovendien, markeren we hier sleutelparameters die differentiatie resultaten sterk te beïnvloeden. Voordat u begint een differentiatie, de volgende drie morfologische parameters moeten worden nageleefd: de morfologie van een stam van hPSCsId1, een hoge cellulaire verdichting en een hoge samenloop (> 90%) van de cultuur op dag 0. In dat opzicht optimale differentiatie voorwaarden zijn beste gemaakt door beplating los gezien hPSCsId1 als afzonderlijke cellen en waardoor ze strak aan formulier geclusterd monolayers die groeien tot ~ 90% samenkomst in de loop van 2 tot 3 dagen. Omgekeerd, als hPSCId1 culturen show arme cel kolonie morfologie, lage kolonie verdichting en de aanwezigheid van grote gebieden van differentiatie binnen de cultuur, succesvolle FHF-L CP differentiatie zijn onwaarschijnlijk.

Media volume en Activin A concentraties zijn kritische parameters van FHF-L CP differentiatie en plaat formaat-afhankelijke (Zie tabel 2). Merk ook op dat optimale Activin A concentraties afhankelijk van gebruikte hPSC lijn variëren kunnen en concentratie optimalisatie kunnen vereisen.

Id1 mRNA niveaus in hPSCs zijn cruciaal om efficiënt FHF-L CP. suboptimaal Id1 niveaus zal zakken voor het produceren van robuuste FHF-L CP differentiatie en massale celdood op dag 1 van differentiatie zal worden waargenomen. De verhouding tussen de relatieve expressie Id1- aan -GAPDH mag 0.005 ter bevordering van de efficiënte differentiatie. Voortdurende selectie gebruik van hogere doseringen van puromycin (6-10 µg/mL) wordt aanbevolen om te hoge niveaus van lentivirale-gemedieerde Id1 meningsuiting behouden. Een evaluatie van Id1 mRNA niveaus elke 10 passages wordt aanbevolen.

Plating dichtheden van dag 5 FHF-L CPsis ook een kritieke parameter voor cardiale differentiatie-efficiëntie. Als dag 5 FHF-L CPs zijn uitplaten aan lage dichtheden, de relatieve cardiale opbrengst zal afnemen. Optimale plating dichtheden zijn vermeld in tabel 2 en plaat formaat-afhankelijk zijn.

De belangrijkste beperking voor dit protocol is het gebruik van lentivirale-gemedieerde Id1 overexpressie aan promoteFHF-L CP differentiatie die het therapeutisch gebruik van de resulterende progenitoren en ventriculaire-achtige cardiomyocytes beperken kan. Ook, aangezien lentivirussen op sites integreren kunnen dat kon potentieel beïnvloeden hPSC onderhoud en/of ontwikkelingsstoornissen potentieel, stemness van hPSCsId1 kolonies moeten worden gecontroleerd door de beoordeling van stengelgroenten genexpressie en observeren van morfologische tekenen van differentiatie. Merk op dat overexpressing Id1 met behulp van niet-integratieve vectoren deze beperking ondervangen zou en momenteel in ons laboratorium onderzocht wordt.

Een handige functie voor deze methode is de eenvoud van het differentiatie-protocol als het vereist alleen een cytokine, Activin A, voor het genereren van FHF-L CPs uit hPSCsId1. In vergelijking, vereisen andere protocollen 9,10,11,12,13,14,15 complexe sequenties van combinaties van cytokines en/of kleine moleculen te bevorderen en te handhaven van cardiale differentiatie. Bovendien, dit protocol uniek een handige cryopreservatie worden de stappen beschreven waarmee afkoppelen FHF-L CP generatie van latere cardiomyocyte productie. Deze functie kunt biobank grote partijen van FHF-L CPs en snel genereren cardiomyocytes uit bevroren progenitorcellen, als cardiale differentiatie hervat vanaf dag 5 na het ontdooien. Deze strategie kunt krijgen van 1 tot 2 weken tijd in vergelijking met cardiale differentiatie vanaf hPSCs. Bovendien, en dit is het belangrijkst, is dit protocol het eerste protocol tot nu toe voor het genereren van cardiale progenitorcellen van gedefinieerde hart veld oorsprong, terwijl andere protocollen9,10,11,12 ,13,14,15 blijven ongedefinieerd is in dat opzicht.

Kortom, dit protocol beschrijft een robuuste en schaalbare methode voor de productie van grote hoeveelheden (> 108–109) van ontwikkelingsachterstand relevante FHF-L CPs en ventriculaire-achtige cardiomyocytes. Op zijn beurt, resulterende cellen kunnen worden gebruikt voor het identificeren van nieuwe regelgevende trajecten cardiale differentiatie en fysiologie, controle en voor regeneratieve en ziekte modelleren doeleinden.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

De auteurs hebben niets te onthullen.

Acknowledgments

Wij danken de leden van de lab Colas voor nuttige discussies en kritieken van het manuscript. Deze studie werd ondersteund door de NIH/NIEHS R44ES023521-02 en CIRM DISC2-10110 verleent aan Dr. Colas.

Materials

Name Company Catalog Number Comments
ACTC1 antibody Sigma A7811
Activin A Stem Cell Technologies Hu Recom Activin A
Antibiotic Antimycotic (Anti-Anti) Thermo Fisher Scientific 15240062
B27 supplement Thermo Fisher Scientific 17504044
B27 supplement w/o - insulin Thermo Fisher Scientific A1895601
B27 supplement w/o - vitamin A Thermo Fisher Scientific 12587001
CDH5 antibody R&D Systems AF938
CryoStor CS10 Stem Cell Technologies 7930 Cryopreservation reagent
DMEM high Glucose Mediatech 10-013-CV 
DPBS w/ Ca & Mg Corning 21-030-CV
EDTA Thermo Fisher Scientific 15575-038
FBS VWR 89510-186
FluoVolt membrane potential kit   Thermo Fisher Scientific F10488 For optical action potential acquisition, please refer to McKeithan et al. 2017
KnockOut Serum Replacement Gibco 10828010
Matrigel, Growth Factor Reduced Corning 356231 Coating reagent
mTeSR1 media kit Stem Cell Technologies 5850
PBS w/o Ca & Mg Corning 21-040-CV
Penicillin-Streptomycin Gibco
Puromycin  Acros 227422500
ReLeSR Stem Cell Technologies 5872 Enzyme-free dissociation reagent
RPMI 1640 Thermo Fisher Scientific 11875-093
TAGLN antibody Abcam ab14106
Thiazovivin Stem Cell Technologies 72254 RHO/ROCK pathway inhibitor
TrypLE Express Thermo Fisher Scientific 12605 -010 1X enzyme-containing dissociation reagent
Tyrodes solution mix packets   Sigma T2145-10X1L (For optical action potential acquisition, please refer to McKeithan et al. 2017)

DOWNLOAD MATERIALS LIST

References

  1. Chong, J. J., et al. Human embryonic-stem-cell-derived cardiomyocytes regenerate non-human primate hearts. Nature. 510, 273-277 (2014).
  2. Kodo, K., et al. iPSC-derived cardiomyocytes reveal abnormal TGF-beta signalling in left ventricular non-compaction cardiomyopathy. Nature cell biology. 18, 1031-1042 (2016).
  3. Kim, C., et al. Studying arrhythmogenic right ventricular dysplasia with patient-specific iPSCs. Nature. 494, 105-110 (2013).
  4. Colas, A. R., et al. Whole-genome microRNA screening identifies let-7 and mir-18 as regulators of germ layer formation during early embryogenesis. Genes & development. 26, 2567-2579 (2012).
  5. Cunningham, T. J., et al. Id genes are essential for early heart formation. Genes & development. (2017).
  6. McKeithan, W. L., Colas, A. R., Bushway, P. J., Ray, S., Mercola, M. Serum-free generation of multipotent mesoderm (Kdr+) progenitor cells in mouse embryonic stem cells for functional genomics screening. Current protocols in stem cell biology. Chapter 1, Unit 1F 13 (2012).
  7. McKeithan, W. L., et al. An automated platform for assessment of congenital and drug-induced arrhythmia with hipsc-derived cardiomyocytes. Frontiers in physiology. 8, 766 (2017).
  8. Sharma, A., et al. High-throughput screening of tyrosine kinase inhibitor cardiotoxicity with human induced pluripotent stem cells. Science translational medicine. 9, (2017).
  9. Burridge, P. W., et al. Chemically defined generation of human cardiomyocytes. Nature methods. 11, 855-860 (2014).
  10. Kattman, S. J., et al. Stage-specific optimization of activin/nodal and BMP signaling promotes cardiac differentiation of mouse and human pluripotent stem cell lines. Cell stem cell. 8, 228-240 (2011).
  11. Laflamme, M. A., et al. Cardiomyocytes derived from human embryonic stem cells in pro-survival factors enhance function of infarcted rat hearts. Nature biotechnology. 25, 1015-1024 (2007).
  12. Lian, X., et al. Robust cardiomyocyte differentiation from human pluripotent stem cells via temporal modulation of canonical Wnt signaling. Proceedings of the National Academy of Sciences of the United States of America. 109, 1848-1857 (2012).
  13. Willems, E., et al. Small molecule-mediated TGF-beta type II receptor degradation promotes cardiomyogenesis in embryonic stem cells. Cell stem cell. 11, 242-252 (2012).
  14. Yang, L., et al. Human cardiovascular progenitor cells develop from a KDR+ embryonic-stem-cell-derived population. Nature. 453, 524-528 (2008).
  15. Palpant, N. J., et al. Generating high-purity cardiac and endothelial derivatives from patterned mesoderm using human pluripotent stem cells. Nature protocols. 12, 15-31 (2017).
  16. DeLaughter, D. M., et al. Single-cell resolution of temporal gene expression during heart development. Developmental cell. 39, 480-490 (2016).
  17. Liu, X., et al. The complex genetics of hypoplastic left heart syndrome. Nature genetics. 49, 1152-1159 (2017).
  18. Corrado, D., Link, M. S., Calkins, H. Arrhythmogenic right ventricular cardiomyopathy. New England journal of medicine. 376, 1489-1490 (2017).
  19. Kitamura, T., et al. Retrovirus-mediated gene transfer and expression cloning: powerful tools in functional genomics. Experimental hematology. 31, 1007-1014 (2003).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics