Paramyxoviruses para inmunomodulación Tumor objetivo: diseño y evaluación Ex Vivo

Cancer Research

Your institution must subscribe to JoVE's Cancer Research section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

Este protocolo describe un flujo de trabajo detallado para la generación y ex vivo de caracterización de virus oncolíticos para expresión de inmunomoduladores, usando virus de sarampión codificación tienen células T actores como ejemplo. Aplicación y adaptación a otras plataformas de vector y los transgenes acelerarán el desarrollo de nuevos immunovirotherapeutics para la traducción clínica.

Cite this Article

Copy Citation | Download Citations

Heidbuechel, J. P., Engeland, C. E. Paramyxoviruses for Tumor-targeted Immunomodulation: Design and Evaluation Ex Vivo. J. Vis. Exp. (143), e58651, doi:10.3791/58651 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Inmunoterapia de cáncer exitoso tiene el potencial para lograr un control tumoral a largo plazo. A pesar de los éxitos clínicos recientes, sigue siendo una necesidad urgente de terapias seguras y eficaces, adaptadas a perfiles inmune individuales del tumor. Virus oncolíticos permiten la inducción de la respuesta inmune antitumoral así como expresión génica restringidos por el tumor. Este protocolo describe la generación y ex vivo análisis de vectores oncolíticos de inmunomoduladores. Centrándose en el virus de la vacuna de sarampión codificación tienen actores de células T como ejemplo, la metodología general se puede adaptar a otras especies de virus y los transgenes. El actual flujo de trabajo incluye el diseño, reproducción, rescate y propagación de virus recombinantes. Ensayos para analizar la cinética de replicación y la actividad lítica del vector, así como funcionalidad de la aislada inmunomodulador ex vivo se incluyen, facilitando la generación de nuevos agentes para el desarrollo adicional en modelos preclínicos y en última instancia traducción clínica.

Introduction

Virus oncolíticos (OVs) se están desarrollando como terapéutica contra el cáncer que específicamente replicar dentro y matar a las células del tumor dejando intactos los tejidos sanos. Ahora se ha vuelto común comprensión que viroterapia oncolíticos (OVT), en la mayoría de los casos, no depender sólo de lisis completa del tumor por la eficiente replicación y propagación del virus, pero requiere de mecanismos adicionales de acción para el éxito del tratamiento, incluyendo vascular y estromal orientación y estimulación inmune1,2,3,4. Mientras que muchos estudios tempranos de OV virus sin modificar, la investigación actual se ha beneficiado de un biológico mejor comprensión, biobancos de virus que potencialmente contienen novela OVs y las posibilidades ofrecidas por ingeniería genética para crear avanzado OV plataformas5,6,7.

Dado el reciente éxito de la inmunoterapia, los transgenes de inmunomoduladores son de particular interés con respecto a la ingeniería genética de OVs. Expresión específica de estos productos génicos por las células tumorales infectadas por OV reduce la toxicidad en comparación con la administración sistémica. Objetivo se logra mediante el uso de virus con oncoselectivity inherente o de tropismo viral8. Inmunomodulación local mejora los mecanismos antitumorales multi-faceteados de OVT. Además, esta estrategia es fundamental interrogar a la interacción entre virus, células tumorales y el sistema de inmune del anfitrión. Para ello, este protocolo proporciona un flujo de trabajo aplicable y ajustable para diseñar, clonar, rescatar, difundir y validar oncolíticos vectores de paramixovirus (específicamente el virus del sarampión) codificación tales transgenes.

Modulación de la respuesta inmune puede lograrse por una variedad de transgenes productos dirigidos a diferentes etapas del cáncer-inmunidad ciclo9, incluyendo mejorar el reconocimiento del antígeno del tumor [por ejemplo, antígenos asociados a tumor (TAAs) o inductores de complejo principal de histocompatibilidad (MHC) clase I moléculas] sobre la maduración de células dendríticas de apoyo para la presentación de antígeno eficientes (citocinas); reclutamiento y activación de células inmunes deseadas como citotóxicas y helper T cells [quimiocinas tienen actores de la célula de T (BTE)]; dirigidos a la prevencion células tales como células T reguladoras, células supresoras mieloides derivados, tumor-asociados macrófagos y fibroblastos asociada al cáncer (anticuerpos, BTE, citocinas); y prevención de la inhibición de células efectoras y agotamiento (inhibidores de checkpoint). Por lo tanto, existe una plétora de agentes biológicos. Evaluación de tales inmunomoduladores virus-codificado en cuanto a eficacia terapéutica y posibles sinergias, así como la comprensión de los mecanismos respectivos de es necesario mejorar la terapia del cáncer.

Virus de ARN monocatenario de sentido negativo de la familia Paramyxoviridae son caracterizados por varias características propicias para su uso como vectores oncolíticos. Estos incluyen un oncotropism natural, gran capacidad genómica de transgenes (más de 5 kb)10,11, eficiente que se separa como formación de sincicios, alta inmunogenicidad12. Por lo tanto, plataformas OV basadas en virus de moquillo canino13, paperas virus14, enfermedad de Newcastle virus15, Sendai virus16,17, virus de los simios 518y Tupaia paramyxovirus19 se han desarrollado. Vivir más prominente, vacuna de virus de sarampión atenuados cepas (MV) han progresado en el desarrollo preclínico y clínico20,21. Estas cepas de virus se han utilizado por décadas para la inmunización sistemática con un récord de seguridad excelente22. Además, no hay ningún riesgo de mutagénesis de insertional debido a la replicación estrictamente citosólica de paramyxoviruses. Un sistema de genética reversa versátil basado en cDNA de la genómico que permite la inserción de transgenes en unidades adicionales de la transcripción (ATUs) está disponible de11,23,24. Vectores de MV codificación symporter del yoduro de sodio (MV-NIS) para la proyección de imagen y radioterapia o antígeno carcinoembrionario soluble (MV-CEA) como un marcador sustituto para expresión génica viral actualmente están siendo evaluados en ensayos clínicos (NCT02962167, NCT02068794, NCT02192775, NCT01846091, NCT02364713, NCT00450814, NCT02700230, NCT03456908, NCT00408590 y NCT00408590). Administración segura ha sido confirmada y se han divulgado casos de la eficacia antitumoral en anteriores estudios25,26,27,28,29, 30 (revisado por Msaouel et otros.31), allanando el camino para los virus de sarampión oncolíticos adicionales que han sido desarrollados y probados preclínico. MV codificación inmunomoduladores moléculas dirigidas a diversos pasos del ciclo del cáncer-inmunidad han demostrado retrasar el crecimiento del tumor y prolongar la supervivencia en ratones, con pruebas de eficacia inmune-mediado y a largo plazo memoria inmune protectora en syngeneic modelos de ratón. Los transgenes codificada en Vector incluyen Colonia del granulocyte-macrófago estimula factor (GM-CSF)32,33, proteína activadora de neutrófilos por el H. pylori 34, checkpoint inmune inhibidores35, Interleucina-12 (IL-12)36TAAs37y BTE38, que enlazará el antígeno de superficie de un tumor con CD3 y así inducir la actividad antitumoral de células T policlonales, independientemente de la célula de T del receptor especificidad y estimulación Co ( Figura 1). Los resultados preclínicos prometedores obtienen para estas construcciones más esfuerzos traslacional demanda.

Talimogene laherparepvec (T-VEC), un tipo el virus herpes simple codificación de GM-CSF, es la única oncolíticos terapéutico aprobado por la Agencia Europea de medicamentos (EMA) y alimentos y Drug Administration (FDA). El estudio de fase III conduce a aprobaciones en 2015 finales sólo no ha demostrado eficacia en el sitio de inyección intra tumoral, sino también efectos abscopal (es decir, remisiones de no lesiones) en melanoma avanzado39. T-VEC desde entonces ha entrado en ensayos adicionales para el uso en otros tumores (por ejemplo cáncer de piel no melanoma de, , NCT03458117, cáncer pancreático, NCT03086642) y para la evaluación de terapias combinadas, especialmente con control inmune inhibidores (NCT02978625, NCT03256344, NCT02509507, NCT02263508, NCT02965716, NCT02626000, NCT03069378, NCT01740297 y Ribas et otros.40).

Esto demuestra no sólo el potencial de inmunoterapia oncolíticos, sino también la necesidad de más investigación identificar combinaciones superiores de OVT e inmunomodulación. Diseño racional de vectores adicionales y su desarrollo para ensayos preclínicos es clave para esta empresa. Esto también avanzarán la comprensión de los mecanismos subyacentes y tiene implicaciones para la progresión hacia el tratamiento personalizado del cáncer. Para ello, esta publicación presenta la metodología para la modificación y el desarrollo de paramyxoviruses inmunoterapia de cáncer específicas y, más concretamente, de los virus de sarampión oncolíticos codificación anticuerpos participación de células T (figura 2).

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Nota: [O], [P] y [M] indican subdivisiones aplicables a: OVs en general, paramyxoviruses (la mayoría) o MV, respectivamente. [B] indica secciones específicas para los transgenes BTE.

1 clonación de Transgenes codificación inmunomodulador en vectores de Virus de sarampión

  1. [O] diseño insertar secuencia.
    1. [O] decidir inmunomodulador de interés basados en la investigación de la literatura o en datos exploratorios como pantallas genéticas41 y derivar la secuencia de cDNA correspondientes adecuadas bases de datos como GenBank, el archivo europeo del nucleótido, o la sistema internacional de información inmunogenética (IMGT).
    2. [O] agregar características adicionales a la secuencia del transgén (figura 3). Un anterior secuencia Kozak y específicos codón optimización pueden mejorar la expresión. Secuencias de la señal se requieren para la secreción. Incluyen secuencias de codificación de etiquetas de la proteína N - y c-terminal para detección y purificación de42. Incluyen sitios de restricción para la inserción en el vector.
      Nota: [M] unidades de transcripción adicional (ATUs) albergando gen polimerasa de MV comience y señales de parada son necesarias para la expresión del transgen de genomas recombinantes de MV. Vectores de cDNA anti-genomic adecuados, controlados por promotores de CMV y que contienen ATUs con sitios de restricción únicos para la introducción de transgenes de sentido positivo en posiciones definidas, se han desarrollado previamente11. [P] adecuado posicionamiento del transgén es crucial, ya que afecta a la expresión transgénica y replicación viral debido al gradiente de expresión típico de paramyxoviruses43. Introducción en una ATU cerca del extremo 3' del genoma contra (es decir., en la posición de líder o corriente abajo del gen P ) generalmente resulta en la expresión de transgenes alta a costa de la replicación viral reducida. Mayor replicación y niveles de expresión del transgen pueden esperarse al usar el ATU corriente abajo del gen H . Del genoma de varios paramyxoviruses, incluyendo el virus del sarampión, requiere unión de seis nucleótidos por cada proteína de nucleocápside44. La inserción de transgenes en esos virus, asegúrese de que el número de nucleótidos del genoma completo será divisible por seis. Esto también se conoce como "regla de seis"45,46. Si es necesario, incluir nucleótidos adicionales en el inserto (aguas arriba de la secuencia de Kozak o aguas abajo del codón de parada) sin la introducción de cambios de estructura o codones de parada prematura. [M] evitar secuencias particulares en el transgén que son similares al inicio del gen de MV (AGGRNCMARGW) y detener las señales (RTTAWANAAAA) y el ARN editar secuencias (AAAAAGGG). Tales secuencias de consenso se han publicado (por ejemplo, véase parques et al.47).
    3. [O] compra de oligonucleótidos de secuencia deseada o ensamble de secuencias disponibles mediante clonación molecular estándar48.
      Nota: [O] para amplificación por PCR del transgén, diseño un primer avance incluyendo el sitio de la restricción por aguas arriba y los primera 15-20 nucleótidos de la estufa y un primer revés incluyendo los últimos 15-20 nucleótidos del fragmento de inserción seguidos por la restricción de aguas abajo sitio.
  2. [O] insert clon en el ADN que codifican el genoma viral (anti-).
    1. [O] clonar el inserto en vectores de ADN o anti-genoma ADN de virus de ARN por estándar molecular clonación técnicas48 (es decir,, enzimática restricción seguida de ligadura de ADN).
      1. [O] evitar la ligadura del vector mediante el uso de sitios de restricción no compatibles o por fosforilación de antes de la ligadura.
      2. [O] aislar el producto de la ligadura por electroforesis en gel de agarosa y posterior gel purificación usando kits disponibles en el mercado. En general, se logra eficiencia óptima de la ligadura en una proporción molar 3:1 de insertar a vector.
    2. [O] transforma el producto de la ligadura en bacterias competentes adecuado para la recuperación eficiente de grandes plásmidos (es decir,, realizar el choque térmico de e. coli49) e identificar los clones bacterianos que la DNA correcta por Colonia PCR50 .
    3. [O] el aislamiento amplificó la DNA de una sola copia bacteriana utilizando kits de preparación de ADN disponibles en el mercado. Confirmar la integridad genómica por digest control con enzimas de restricción apropiadas (por ejemplo,, HindIII para genomas MV [M]). Confirmar la inserción correcta y la integridad del transgén por la secuencia.
      Nota: [M] para los transgenes insertados en el MV H- ATU, realizar Sanger secuenciación con los siguientes primers: H-9018 [primer avance, se une a la MV genoma posición 9018 H abierto de lectura (ORF) de marco]: 5' GTGTGCTTGCGGACTCAGAATC 3'; L-9249 + (reverse primer, se une a la posición del genoma de MV 9249 en el ORF L ): 5' CAGATAGCGAGTCCATAACGG 3'.

2. rescatar a las partículas del Virus del sarampión recombinante codificación inmunomoduladores

  1. [O] generar partículas de virus recombinantes de (anti-) genomic ADN mediante transfección de células de virus productor según el protocolo estándar para los respectivos virus. Siga las pautas para trabajar en condiciones estériles. Realizar cultivos celulares bajo las capillas, en particular todos los pasos que involucran virus en gabinetes de seguridad biológica de clase II.
    1. [M] para el rescate de los virus de sarampión del cDNA23,24, placa productora de MV (mono verde africano renales derivados de Vero) células uniformemente en una placa de 6 pozos 24 h antes de transfección. Semilla 2 x 105 células en 2 mL Medium (DMEM modificado Eagle de Dulbecco) que contiene 10% de suero bovino fetal (FBS) por pozo para lograr la confluencia de 65 – 75% en el momento de la transfección.
      Nota: [P] reducir el número de celular si las células cubran antes de la formación de sincicios inducidos por virus.
    2. [P] transfectar las células con ADN de la plásmidos virales del genoma, requiere ayudante, de codificación y, si lo desea, un plásmido de codificación un reportero fluorescente para evaluar eficiencia de transfección.
      1. [M] Mix 5 μg de ADN recombinante que codifican el genoma contra del virus del sarampión, 500 ng de plásmidos de expresión mamífero codificación N el virus del sarampión y L proteínas y 100 ng de plásmidos que codifican la proteína P y un reportero fluorescente en un volumen total de 200 μL DMEM.
      2. Agregar 18.6 μl de reactivo de transfección liposómica, inmediatamente mezcle agitando el tubo e incubar durante 25 min a temperatura ambiente (RT).
      3. [P] reemplazar el medio con 1,8 mL de DMEM, 2% FBS, 50 kanamicina μg/mL (o de otros antibióticos para prevenir la contaminación) por pozo, añada la mezcla de transfección gota a gota al pozo y agitar cuidadosamente. Incube las células durante la noche a 37 ° C, 5% CO2. Reemplazar el medio con 2 mL de DMEM fresco 2% FBS y kanamicina 50 μg/mL al día siguiente; repetir este proceso al medio se convierte en ácido.
        PRECAUCIÓN: [O] manejar células y materiales según normas de bioseguridad, ya que pueden existir virus de transfección a través de los siguientes pasos. Disponer de los residuos (potencialmente) infeccioso apropiadamente.
  2. [P] recogen y propagan las partículas del virus.
    1. [P] observar células diariamente por microscopia para reportero gene expresión y sincicios formación (figura 4). Virus de la cosecha cuando grandes sincicios, consisten en 20 o más células, son visibles, o cuando las células se vuelven demasiado densas (es decir., cuando empiezan a crecer en varias capas, normalmente después de 7 a 9 días).
      Nota: [P] si no sincicios se observan para la construcción de un vector dado, esto no significa necesariamente que el rescate ha fracasado. Como virus infeccioso sin embargo pueden estar presentes en la muestra, la transferencia a las células frescas productor para pases.
    2. [P] semilla de aproximadamente 1.5 x 106 células de productor en 12 mL de DMEM con 10% FBS, sobre 10 cm platos 24 h antes de la cosecha esperada, o de 2.5 x 106 células por placa de 4 – 6 h antes de pases del virus para lograr la confluencia de 65-75% en el momento de virus inoculat ion.
    3. [P] para recoger progenie de virus, raspar las células adherentes del productor de la placa usando un raspador celular y transferir el sobrenadante que contiene las células en un tubo de centrífuga. Eliminar restos celulares por centrifugación durante 5 minutos a 2.500 x g y 4 ° C.
      Nota: Raspado de las células pueden ser transferidas directamente sin centrifugación para maximizar la transferencia del virus a costa de las condiciones de cultivo subóptima y posibles artefactos de microscopía.
      PRECAUCIÓN: Evite [O] derramar medios cuando el raspado de las células. Minimizar la formación de aerosoles.
    4. [P] preparar el inóculo mezclando el sobrenadante libre de células de paso 2.2.3 con medio libre de suero a un volumen final de 4 mL. Vuelva a colocar el medio en las células del productor el inóculo e incubar células por al menos 2 h a 37 ° C y 5% CO2. Añadir 6 mL de DMEM con 10% FBS e incubar las células durante la noche antes de cambiar el medio a 12 mL de DMEM fresco con 10% FBS.
    5. [P] observa las células al menos dos veces al día y virus de la cosecha antes de la explosión de sincicios (es decir,, cuando la interrupción de la membrana llega a ser visible). Para cosechar el primer paso del virus, retirar el sobrenadante de la placa, añadir 600 μl de medio sin suero, raspar las células con un levantador de celular y transferir a un tubo limpio.
      Nota: [M] dependiendo de la cepa de virus51,52 y progresión de la infección, transferir las placas con células infectadas a 32 ° C para facilitar la difusión y replicación viral. En general, MV Schwarz cepas se propagan bien a 37 ° C, mientras que la transferencia de células infectadas con el virus de cepa Edmonston B a 32 ° C resulta en la formación de sincicios más lento pero más títulos.
      Nota: [P] no permita que la capa de células que se seque durante la cosecha, ya que ello en menor infectividad de las partículas virales. Aunque algunos virus se pierde cuando descartando el sobrenadante de células infectadas, se pueden obtener títulos más altos de la capa de células.
    6. [P] inmediatamente congelar la suspensión de virus en nitrógeno líquido. Tienda a-80 ° C durante al menos 24 h asegurar la completa congelación. Extenderse a varios días para interrumpir el procedimiento, si es necesario.
    7. Liberación de partículas virales por descongelación a 37 ° C. Homogeneizar por Vortex y centrifugar durante 5 min a 2.500 x g a 4 ° C. Transferir el sobrenadante a criotubos etiquetados y almacenar a-80 ° C.
      Nota: [O] almacenar virus en tamaños alícuotas adecuados para experimentos posteriores, ya que son preferentemente descongelados una sola vez y utilizados inmediatamente. [P] hielo-deshielo ciclos o almacenamiento a 4 ° C durante varios días dan como resultado una reducción significativa de títulos virales.
    8. [P] semilla de un día antes más pases para lograr la cantidad requerida y título, 4 x 106 células de productor en 12 mL de DMEM con 10% FBS en platos de 15 cm. Inocular con el virus en una multiplicidad de infección (MOI) de 0.03. Infectan en 8 mL de medio sin suero por placa y tomar medio DMEM con 10% FBS después incubando células de al menos 2 h. escala hacia arriba mediante el uso de varios platos.
    9. Cosecha como se describe en paso 2.2.5, cuando sincicios se han extendido a través de la capa de células enteras. Piscina las suspensiones obtenidas en tubos de 50 mL y el proceso como se describe en pasos 2.2.6–2.2.7.
      Nota: [O] es crucial comprobar todas las placas visualmente para la contaminación bacteriana y fúngica antes de la cosecha. En general, revise todas las líneas celulares regularmente para la contaminación con micoplasma o virus adventicios por PCR múltiplex.
  3. [P] evaluar los títulos virales. Determinar los títulos de las poblaciones de virus en octuplicates por alícuota mediante placas de 96 pocillos. Titulación de tres alícuotas individuales por rescate de virus y el valor promedio para calcular la cantidad de virus de la suspensión para ser utilizado en los experimentos.
    1. [P] piscina el productor de las células, recuento y ajustar a 1.5 x 105 células por mL de DMEM con 10% FBS.
    2. [P] pipeta 90 μl de DMEM con 10% FBS en cada pocillo de una placa de 96 pocillos.
    3. [P] añadir 10 μl de una alícuota de las acciones de virus a todos los pozos de 8 de la primera columna de la placa y homogeneizar mediante pipeteo arriba y abajo por lo menos 10 veces.
    4. [P] realizar diluciones seriadas de 10 veces del virus. Transferir 10 μl de cada pocillo de la primera a la segunda columna utilizando una pipeta multicanal. Mezclar bien mediante pipeteo arriba y abajo y usar puntas de pipeta nueva para cada paso de dilución. Deseche el 10 μl de cada pocillo de la última columna.
      Nota: Cada placa de 96 pocillos permite 12 pasos de dilución seriada. [M] para vectores de MV, 8 pasos de diluciones 10 veces son normalmente suficientes, como títulos sobre unidades infecciosas de 1 x 109 células/ml (ciu) rara vez se obtienen por el método de propagación se describe en el paso 2.2. [P] control pozos sin virus pueden utilizarse para la comparación y para controlar la contaminación.
    5. [P] añadir 100 μl de la suspensión celular en cada pocillo e incubar a 37 ° C, 5% CO2 para 48 h. asegurarse de la ausencia de grupos de células en la suspensión para lograr una distribución homogénea de las células.
    6. [P] Compruebe sincicios usando un microscopio de luz. Cuenta sincicios en cada pocillo de la columna con el mayor factor de dilución que contiene sincicios visibles.
    7. [P] calcula el número promedio de sincicios por pocillo de la columna dividiendo el número total de sincicios por ocho. Multiplicar este promedio con el factor de dilución de la columna respectiva, a partir de las 10 de2 de ciu por mL para la primera columna53 (vea la figura 5 como un ejemplo).

3. determinación de capacidad replicativa y citotóxica de vectores virales codificación inmunomoduladores

  1. [O] comparar la cinética de la replicación del virus recombinantes generados y el vector sin modificar con las curvas de crecimiento de un paso o varios pasos (GCs). De un solo paso GCs, progenie viral se evalúan después de la infección simultánea de todas las células (teóricamente, 100% de infección). Inicio de GCs de varios paso en un porcentaje bajo de las células infectadas para seguir varias rondas de replicación del virus.
    1. [M] para el análisis de la cinética de replicación de virus de sarampión, de la semilla 1 x 105 células Vero en 1 mL de DMEM con 10% FBS por pozo en placas 12-bien un día antes de la infección. Placa al menos dos pozos para cada punto de interés como repeticiones técnicas.
    2. [O] infectar las células con virus en MOI bajo de pasos múltiples o en MOI alta para un solo paso GCs [M] (0.03 y 3 para la replicación de MV en Vero células, respectivamente). Reemplazar el medio con 300 μL de medio libre de suero que contiene la respectiva cantidad de virus e incubar a 37 ° C y 5% CO2 para por lo menos 2 h. eliminar inóculo, añadir 1 mL de DMEM con 10% FBS y continuar la incubación.
    3. [P] en los puntos de tiempo relevantes como 12, 24, 36, 48, 72 y 96 h después de la infección, la cosecha progenie viral raspando directamente las células en el medio. Transferir el contenido de cada pocillo a un tubo individual, snap-congelación en nitrógeno líquido y guardar a-80 ° C hasta la titulación.
      Nota: [P] replicadas muestras pueden combinarse en este paso para el análisis de títulos promedio.
    4. [P] recoger muestras de todos puntos de tiempo. Descongelar al mismo tiempo a 37 ° C para la evaluación de la progenie viral. Vórtice de pellet y de restos celulares por centrifugación durante 5 min a 2.500 x g a 4 ° C.
    5. [P] calcular títulos promedio de cada constructo y punto como se describió anteriormente. Trama de títulos con el tiempo. Comparar las curvas de crecimiento de vectores con y sin los transgenes insertados, con transgenes diferentes, o con los transgenes insertados en diferentes posiciones (véase la figura 6A).
  2. [O] comparar actividades líticas de virus codifican inmunomodulador y sin modificar.
    1. [O] selección de metodologías posibles incluyendo las mediciones de impedancia, lactato deshidrogenasa (LDH) libere el ensayo o ensayos de viabilidad celular colorimétrico basado en metabolismo [por ejemplo,, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium (MTT ) y 2,3-bis-(2-methoxy-4-nitro-5-sulfophenyl)-2H-tetrazolium-5-carboxanilide (XTT) ensayos].
      1. [M] para analizar la citotoxicidad del sarampión análisis de vectores de virus con XTT, células Vero de semilla tal como se describe en el paso 3.1.1. Son repeticiones de un control no infectado para cada punto.
        Nota: [O] realizar ensayo XTT en diferentes puntos de tiempo en la misma muestra puede limitar errores técnicos, pero lavado repetido y la exposición al reactivo XTT afecta a un número de células viables. Impedancia proporciona una lectura alternativa para mediciones continuas.
    2. [M] infectar células Vero en una MOI de 1 tal como se describe en el paso 3.1.2.
      Nota: [M] para la infección de células de blanco menos permisivas como algunas líneas de células tumorales murinas, un MOI superior de 3 o 5 puede ser necesario.
    3. [O] en puntos de tiempo de interés (por ejemplo., 12, 24, 36, 48, 72 y 96 h después de la infección) preparar la cantidad necesaria del reactivo XTT (es decir., 300 μL por pozo más el 10% de exceso). Evitar la exposición a la luz.
    4. [M] en cada punto, quite medio de pocillos respectivos. Sustituir por 300 μL del reactivo XTT e incubar a 37 ° C en la oscuridad. Recoger sobrenadante cuando el reactivo en los pocillos de control ha vuelto rojo intenso, que por lo general toma entre 15 min y 2 h, y congelar a-20 ° C.
      Nota: [O] tiempos de incubación dependen de la construcción de virus, tipo de células, densidad y efecto citopático.
    5. [O] después de recoger todas las muestras, descongelar simultáneamente. Transferir 100 μl de cada muestra a una placa de 96 pocillos y medir absorbancia óptica a 450 nm con 630 nm como una longitud de onda de referencia.
    6. [O] represente los puntos de tiempo (eje x) vs. absorbancia óptica de muestras en relación con los controles, indicando actividad metabólica como un sustituto para la viabilidad celular (eje y). Disminución de absorbancia relativa en el tiempo implica citotoxicidad viral (ver figura 6B).

4. analizar la actividad de Virus-codificado inmunomoduladores secretados desde las células infectadas

  1. [O] aislante transgen secretado productos expresados por las células diana infectadas por virus.
    1. [P] que productor de virus las células crecen a confluencia de 70% en frascos T175.
    2. [P] quitar medio de células y lavar dos veces con 12 mL de PBS para eliminar el suero. Inocular las células con virus en una MOI de 0.03 en 12 mL de medio sin suero e incubar a 37 ° C y 5% CO2 durante la noche. Reemplazar el medio con 12 mL de medio fresco libre de suero.
      1. [M] para virus de Edmonston B, transferencia de células de 37 a 32 ° C después de 40 h por otro 24 h de incubación para facilitar la infección y evitar el estallido prematuro de sincicios. Dependiendo de la cepa del virus se pueden ajustar para pureza y rendimiento de proteína óptima progresión52 y sincicios51,, temperaturas de incubación y tiempos.
    3. [P] cuidadosamente recoger sobrenadante sin desprendimiento de las células antes de explosión de sincicios. Óptimamente, sincicios se han propagado a través de la capa de célula entera. Piscina de sobrenadantes en tubos de 50 mL.
      Nota: [P] para la purificación eficiente del producto transgénico, evitar estallido de sincicios y minimizar restos celulares cuando cosecha los sobrenadantes de las células infectadas.
    4. [P] Retire restos celulares el sobrenadante por centrifugación durante 5 minutos a 2.500 x g y 4 ° C y pasa a través de 0,22 μm filtros. Según el volumen total de filtrado, esto puede realizarse utilizando una jeringa o una bomba de vacío.
    5. [O] aislar el producto del transgen utilizando un método de purificación adecuado. Purificar proteínas con una etiqueta de hexa-histidina (His) por cromatografía de intercambio de afinidad utilizando Ni-NTA spin mini columnas38 como se describe aquí en breve (medidas 4.1.5.1–4.1.5.4).
      Nota: [O] realice todos los pasos rápidamente y el hielo. Enfriado previamente los amortiguadores y el fresco centrifugar a 4 ° C.
      1. [O] preparar 100 mL de buffer PBS y cloruro de sodio 200 mM imidazol en concentraciones finales de 10 mM (tampón de lavado 1, WB1), 20 mM (lavado Tampón 2, WB2) y 500 mM (tampón de elución, EB). Ajustar el pH de WB1 y WB2 a 8.0 y de EB a 7.0. Dependiendo de la proteína purificada, imidazol las concentraciones pueden tener que ajustarse.
      2. [O] equilibrar columnas con 600 μl de WB1 y centrifugar a 800 x g durante 2 min con una tapa abierta.
      3. [O] carga 600 μl de sobrenadante filtrado en columnas. Permite a Unión de proteínas con su etiqueta a la matriz columna por centrifugación a 200 x g durante 5 minutos con una tapa cerrada. Carga y vinculante puede repetirse hasta un total de 300 μg proteína su etiqueta por columna.
      4. [O] lavar tres veces con WB1 y una vez con WB2, o hasta que el flujo a través es incoloro. Añadir 600 μl de tampón y centrifugado a 800 x g durante 2 min con la tapa abierta.
      5. [O] eluir la proteína en un tubo fresco realizando dos pasos de elución con 300 μL de EB y centrifugación por 2 min a 800 x g.
      6. [O] desalar y concentrar el producto que utiliza filtros centrífugos según tamaño del producto. Añadir PBS a un volumen de 15 mL y el filtro por centrifugación 10 min a 4.000 x g. Repita hasta que la pureza deseada y se logra la concentración. Para aumentar la concentración de proteínas, reducir el volumen final a aproximadamente 200 μL por centrifugación durante 40 min a 4.000 x g.
  2. [O] confirman la pureza y la identidad del producto.
    1. [O] cuantificar la cantidad de proteína total en los aislamientos usando análisis colorimétricos estándar como el ácido bicinchoninic (BCA) o ensayo de Bradford54,55. [M] valores típicos pueden oscilar entre 1-3 μg transgen producto por sobrenadante mL de las células infectadas.
    2. [O] para la cuantificación relativa de los aislados de proteína, separada por medio de sodio dodecil sulfato poliacrilamida gel electroforesis (SDS-PAGE) y realizar56de tinción de Coomassie.
    3. [O] confirman la identidad de los productos purificados por inmunotransferencia utilizando anticuerpos específicos contra la proteína o un péptido asociado etiqueta57.
    4. [O] analizar la especificidad de unión de la proteína mediante técnicas apropiadas que pueden incluir análisis enzima-ligado del inmunosorbente (ELISA) o citometría de flujo (ver figura 7). Enlace celular puede confirmarse mediante un ensayo de desconexión magnética recientemente descrita38.
      Nota: [O] utilizar los controles adecuados. En los ensayos de Unión celular, incluyen controles negativos con las células que no expresan la molécula específica (como en la figura 9) y no dirigidos a sustitutos de proteína (figura 8). En experimentos de citometría de flujo, son positivos, controles negativos y el isotipo (figura 7).
      1. [O] incubar Co el objetivo de aislar a las células y proteínas para permitir la encuadernación. [B] para el obligatorio análisis de BTE a sangre periférica células mononucleares (PBMCs) aisladas de sangre humana58, incubar 2.5 x 106 células con 200 ng de BTE en 100 μl de PBS con 1% FBS (tampón de Unión, BB) durante 1 hora en hielo.
      2. [B] células de lavado con 1 mL de BB para eliminar proteínas no Unidas. Centrifugar a 300 x g durante 5 min, descartar el sobrenadante y resuspender el pellet en 100 μl de BB. Añadir el anticuerpo biotinilado dirigidos a la proteína de interés o una etiqueta de péptido asociado e incubar en hielo durante 30 minutos. Para BTE con la etiqueta de la gripe hemaglutinina (HA), uso 100 ng de anti-HA-biotina (clon 3F10).
      3. [B] lavar las células dos veces con 1 mL de BB y resuspender en 80 μl de BB. Añadir 20 μl de microesferas magnéticas estreptavidina acoplado e incubar por 15 min a 4 ° C.
      4. [B] lavado de una vez para quitar los cordones de exceso y resuspender el precipitado en 500 μl de BB suplementado con 2 mM EDTA (tampón de columna, CB).
      5. [B] aislar células con columnas y un soporte magnético según el manual del proveedor.
        1. [B] equilibrar permitiendo 500 μl de CB para pasar a través de la columna por gravedad.
          Nota: [B] la columna nunca debe funcionar en seca. Pipetee cuidadosamente y desgasificar los buffers para evitar burbujas.
        2. [B] poner un tubo limpio debajo de la columna y la suspensión de la célula/grano se aplica a la columna. Lavar la columna tres veces con 500 μl de CB por lavado. Recoger muestras de flujo a través de la suspensión y de al menos el primer paso de lavado en el tubo, luego almacenar en hielo.
        3. [B] eluir grano-limite las células retenidas por el campo magnético. Para ello, quitar la columna de soporte magnético, colóquelo sobre un tubo limpio, añadir 1 mL de CB y rápidamente introducir el tampón a través de la columna en el tubo utilizando un émbolo. Mantenga el tubo en hielo.
      6. [B] centrifugar los tubos que contienen las muestras a través de flujo y la elución por 20 min a 16.000 x g y 4 ° C para que sedimenten las células. Deseche el sobrenadante y lyse las células en un búfer de radioinmunoprecipitación (RIPA) del ensayo (sugerida: 75 μL). Realizar SDS-PAGE56.
      7. [B] realizar immunoblotting usando un anticuerpo primario adecuado. Anticuerpos pueden atacar el producto transgénico o una proteína celular (por ejemplo., β-actina, figura 8) para evaluar atascamiento de BTE-cell.
  3. [O] evaluar funcionalidad inmunológica de inmunomoduladores aislados.
    1. [O] identificar ensayos pertinentes según las características del inmunomodulador codificado. Sobre la actividad inmunomoduladora esperados, métodos de evaluación de la proliferación celular, migración, maduración, activación y citotoxicidad puede aplicarse.
      Nota: [O] proliferación celular puede ser analizada por la CFSE59 etiquetado o tinción de Ki6760. Transwell o cero experimentos están disponibles para analizar la migración de la célula61. Maduración y activación de las células pueden ser evaluadas utilizando protocolos de tinción apropiados para los marcadores respectivos. [B] disponibles técnicas para evaluar la citotoxicidad celular mediada por BTE incluyen impedancia mediciones y cromo ensayo de liberación. Si optar por el ensayo de liberación de cromo, observar las medidas de seguridad adecuadas al manipular material radiactivo.
    2. [B] como una alternativa no-radiactivo, se describe en detalle cómo evaluar citotoxicidad inducida por el BTE, mediada por células por ensayo de liberación LDH (descrito anteriormente en breve38).
      1. [B] deciden sobre las condiciones de ser probado durante el experimento (vea figura 9 por ejemplo). Los puntos de tiempo concentraciones de (horas a días), del inmunomodulador (pg/mL a μg/mL) y efectoras a ratios de (e: t) de la célula blanco (entre 1:50 y 50: 1, por ejemplo) pueden ser variado. Siempre preparar muestras en triplicado.
      2. [B] incluyen muestras sin proteínas y sin células efectoras, controles para LDH espontánea liberación de los tipos de célula (Tsp y Esp), un control de máxima lisis de células blanco (Tmax) con detergente antes de lectura, un medio sólo control y un control de volumen para Tmax.
        Nota: [B] requiere un número de las células diana y tiempos de incubación puede variar. Llevar a cabo las ejecuciones de prueba inicial sin células efectoras e inmunomoduladores para identificar los parámetros óptimos. Incluye Tsp y Tmax muestras y controles correspondientes para determinar los puntos de tiempo y número de células diferentes.
      3. [B] aislar las células efectoras inmunes por ejemplo, (centrifugación gradiente de densidad de la sangre humana para obtener PBMCs58 ) o selección negativa de células murinas de T de esplenocitos de ratón62.
      4. [B] semilla apuntar células según paso 4.3.2 (e.g., 5 x 10³ por pozo) en una placa de fondo U 96 pocillos.
      5. [B] agregar la proteína aislada en las concentraciones deseadas a las respectivas muestras. Añadir las células efectoras inmunes en la proporción deseada. Añadir medio a un volumen total de 100 μl por pocillo.
      6. [B] incubar para el período de tiempo determinado en paso 4.3.2, típicamente entre 4 y 48 horas (24 h de PBMCs sin estimular y 48 h para las células T murinas recién aisladas; tiempos de incubación más cortos pueden solicitar prestimulated células inmunes), a 37 ° C y 5% CO2.
      7. [B] 45 minutos antes de recoger las muestras, añadir 10 μl de solución de lisis de x 10 para pozos que contienen Tmax muestras y los controles correspondientes del medio. Continuar la incubación.
      8. [B] desactivación de células en 250 x g durante 4 minutos transferir 50 μl de cada sobrenadante a una placa de 96 pocillos de fondo plano. No transferir a las células para evitar el limite celular LDH.
      9. [B] preparar la solución de sustrato según el fabricante. Añadir 50 μl a cada pozo e incubar a RT en la oscuridad durante 30 minutos o hasta muestrasmax T rojo intenso.
      10. [B] añadir 50 μl de solución de parada a cada pocillo. Eliminar burbujas de aire por centrifugación durante 1 min a 4.000 x gy manualmente con una aguja hueca. Medir la absorbancia óptica a 490 nm.
      11. [B] calcular % lisis específica valores para cada muestra.
        1. [B] calcular promedios de repeticiones de medianos controles con y sin solución de lisis. Restar valores obtenidos de las muestras experimentales y de Tmax y espontánea liberación controles, respectivamente. Utilice estos valores de corrección de fondo para cálculos posteriores.
        2. [B] calcular promedios para corregir de fondo Tmax, Tspy Esp controles. Usando estos valores promedio, la ecuación siguiente da el porcentaje de lisis específica para cada muestra:

          Equation 1
        3. [B] parcela % lisis específica valores vs concentración de proteína o e: t relación y comparar a las muestras control no metas.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

La figura 1 ilustra el mecanismo de acción de los virus de sarampión oncolíticos tienen células T actores de codificación. Un diagrama de flujo que representa el flujo de trabajo de este protocolo se presenta en la figura 2. La figura 3 muestra un ejemplo de un genoma del virus del sarampión modificado oncolíticos. Esto proporciona una representación visual de los cambios específicos que se aplican a las características sarampión virus anti- genoma y en particular de los transgenes insertados. Sincicios inducidos por el virus de sarampión típico se muestran en la figura 4. Tenga en cuenta la alta densidad celular en el punto de cosecha el rescate (A, B), lo que indica que el número de células puede reducirse al repetir el experimento. Veces y - temperaturas de incubación pueden ser optimizadas para pases en células Vero (C, D) para lograr mayor difusión de sincicios en la placa. Figura 5 representa los resultados de un ensayo de valoración típico. En la figura 6, las curvas de crecimiento de un solo paso (A) y viabilidad de las células relativa (B) después de la inoculación con sin modificar (MV) y la codificación de BTE se muestran oncolíticos virus de sarampión (MV-H-mCD3xhCD20). Mientras que las curvas de crecimiento de los vectores en comparación con células Vero parecen similares, la actividad lítica del virus codifican transgenes rezagada en la línea de celular del tumor murino. Citometría de flujo de datos de destino expresando antígeno las células que se incubaron con BTE a cinco diferentes diluciones se proporciona en la figura 7, que indica enlace BTE por las células de una manera dependiente de la concentración. Figura 8 representa un immunoblot ejemplar después de desconexión magnética de las células asociadas con BTE. Jalones Dorsales con metas no BTE (n1, n2) no dió cantidades detectables de las células, mientras que se observaron bandas en la fracción de elución, indicativa de células encuadernadas, para apuntar las muestras BTE (t1, t2). BTE-mediada, citotoxicidad específica de antígeno y dependiente de la concentración blanco de células T murinas se indica mediante un ensayo de liberación LDH representativo en la figura 9.

Figure 1
Figura 1 : Mecanismo de acción de los virus de sarampión oncolíticos codificación un tienen células T engager (MV-BTE). Infección de una célula tumoral (infectados: gris, no infectada: azul claro) con MV-BTE es seguido por la replicación viral y la propagación a través del tumor, dando por resultado la estimulación lisis e inmune celular del tumor. Simultáneamente, BTE [que consiste en dos cadenas individuales derivadas de anticuerpos dirigidos a CD3 en linfocitos T (amarillos) y un antígeno de tumor superficial (azul)] es producidas y secretadas localmente por las células infectadas por virus. BTE-mediada del cross-linking con células tumorales induce la activación de reposo, las células de T policlonales, dando por resultado la matanza de células de tumor más. Haga clic aquí para ver una versión más grande de esta figura.

Figure 2
Figura 2 : Diagrama de flujo que describe el flujo de trabajo de diseñar, generar y evaluar nuevos vectores virales codifican transgenes inmunomodulador. Pasos 1 a 4 reflejan las respectivas secciones del protocolo. Puntos indican pasos y consideraciones pertinentes. Debido a la naturaleza empírica del procedimiento, ajustes o mejoras pueden ser necesarios en cualquier paso del flujo de trabajo. Además, los resultados experimentales pueden conducir a nuevas hipótesis e inspirar el desarrollo de vectores adicionales o tratamientos combinados. Haga clic aquí para ver una versión más grande de esta figura.

Figure 3
Figura 3 : Representación esquemática de un genoma del virus del sarampión. Mayor proteína verde fluorescente (eGFP) está codificada en una unidad de transcripción adicional aguas abajo de la secuencia líder (ld). N, P, M, F, H y L designan los genes que codifican la nucleoproteína de proteínas estructurales de virus de sarampión, P proteína, proteína de la matriz, proteína de fusión, hemaglutinina proteína y proteína grande (polimerasa), respectivamente, que se expresan diferencialmente como visualizar por encima de. Un transgen de engager (BTE) tienen la célula de T se inserta en una unidad de transcripción adicional (ATU) aguas abajo del marco de lectura abierto del H . El transgen codifica un péptido líder de Igκ para secreción eficiente así como hemaglutinina de influenza (HA) y hexa-histidina (His) proteína etiquetas para detección y purificación. Genes que codifican para pesados variable (VH) y cadena ligera de dominios (VL) de anticuerpos dirigidos a CD3 y CD20, respectivamente, están conectados a través de secuencias vinculador péptido que contiene residuos de serina (S) y glicina (G). La secuencia del transgén es precedida por una secuencia de Kozak. Aguas abajo de la codificación de región, nucleótidos adicionales han incluido exemplarily para cumplir con la norma de seis. El casete de inserción está flanqueado por dos sitios de restricción, permitiendo la inserción en el ATU respectivo. Haga clic aquí para ver una versión más grande de esta figura.

Figure 4
Figura 4 : Sincicios inducidos por el virus sarampión. (A, B) Vero células fueron transfectadas con cDNA para el rescate de los virus de sarampión recombinante codificación mayor proteína verde fluorescente (eGFP) y un tienen células T engager (BTE) dirigidos a murino CD3 y CD20 humano. Presencia de un sincitio fluorescente (flechas blancas) indica el exitoso rescate de virus infeccioso. (C, D) Virus del sarampión se cosechan después de rescate y propagados en células Vero (paso 1). Sincicios grandes han formado y están empezando ya a ráfaga (flechas amarillas). Se adquirieron imágenes por microscopia de fluorescencia y contraste de fase (B, D) después de la excitación (A) de 80 ms y 100 ms (C). Haga clic aquí para ver una versión más grande de esta figura.

Figure 5
Figura 5 : Representante resultado de un análisis de valoración. Valoración de un lote de tercer pasaje de MV-H-mCD3xhCD20, un codificación de BTE oncolíticos virus sarampión en células Vero. Se realizó una dilución seriada 10 veces en una placa de 96 pocillos, a partir de 10 μl de la suspensión de virus en cada pocillo de la columna 1 No sincicios eran visibles en la columna 7, según lo indicado por ceros. La dilución más baja siguiente de la suspensión de virus en la columna 6, se observó un promedio de seis sincicios por pozo, resultando en un título final de aproximadamente 6 x 107 unidades infecciosas de la célula (ciu) por suspensión de virus de mL. Haga clic aquí para ver una versión más grande de esta figura.

Figure 6
Figura 6 : Cinética de replicación y la actividad lítica del virus de sarampión recombinante. Un paso (A) las curvas de crecimiento se generaron después de la infección de células Vero con oncolíticos sin modificar el virus del sarampión (MV) o el virus del sarampión codificación un tienen células T engager (MV-H-mCD3xhCD20) en una MOI de 1. Títulos de la progenie viral fueron evaluados en los puntos designados de tiempo después de la infección, indicando que la cinética de replicación de virus similares. Se muestran las medias y desviaciones estándar de las muestras de ocho (cuatro técnicas Replica cada uno de dos réplicas biológicas por punto). (B) la célula se evaluó viabilidad en carcinoma de colon murino MC38 células estable expresan antígeno carcinoembrionario humano y el receptor CD46 del MV (MC38-CEA-CD46) después de la inoculación con virus indicados en una MOI de 1 o medio único (mock). Análisis de viabilidad de la célula XTT fue realizada en los puntos de tiempo indicados. Se observó reducción en la viabilidad celular en los puntos anteriores de tiempo para el vector sin modificar. Valores de 100%, calculado para MV-H-mCD3xhCD20 en punto de las 12 h, se observan con frecuencia poco después de la infección, que puede ser debido a estrés celular o factores derivados de células presentan en la suspensión de virus. Valores promedio y desviaciones estándar de tres repeticiones técnicas se muestran para cada punto. Haga clic aquí para ver una versión más grande de esta figura.

Figure 7
Figura 7 : Enlace de célula blanco por tienen actores de la célula de T (BTE) expresado por sarampión células infectadas por virus. Las células de linfoma de manto humano endógeno expresan CD20 (Granta-519) se incubaron con inmunoglobulina humana G para bloquear los receptores de Fc, seguidos por la incubación con 2, 4, 6, 8 o 10 μl (A) de la solución BTE mCD3xhCD20 purificada, respectivamente. Se detectan células de BTE-limite con ficoeritrina (PE)-anticuerpo conjugado dirigido a asociados de BTE HA-tag. Porcentajes de células correlacionadas con las concentraciones de BTE. (B) controles para la selectividad y la especificidad de Unión. Se muestra aquí son los controles de un experimento independiente, no incluyendo una muestra de células incubadas con BTE pero con metas de BTE anticuerpo sólo (control Unión inespecífica de anticuerpos a las células) o con un BTE que se sabe que se unen a las células de interés , seguido por la incubación con el anticuerpo dirigido a BTE (control positivo) o un isotipo de anticuerpo. Si está disponible, las células isogénicas no expresan el antígeno de la blanco de la opción pueden utilizarse para verificar más selectividad obligatoria. Haga clic aquí para ver una versión más grande de esta figura.

Figure 8
Figura 8 : Desconexión magnética de periférico humano la sangre las células mononucleares (PBMCs) obligadas por sarampión virus-codificado BTE. Las células se incubaron con dos lotes diferentes de humano T cell-targeting (t1, t2) o no metas control BTE (n1, n2), respectivamente. BTE-limite las células fueron retenidas en columnas usando bolas magnéticas, peleteadas y lisis. Se detectó β-actina en los lysates de immunoblotting. Intensidades de las bandas en las muestras de elución indican Unión de BTE-celda relativa. A través de flujo de muestras confirman presencia de células en todas las muestras. Haga clic aquí para ver una versión más grande de esta figura.

Figure 9
Figura 9 : Actividad citotóxica de sarampión virus-codificado BTE. Objetivo tumor células (5 x 10³ B16-CD20-CD46 por pozo) se incubaron con células murinas de T en una proporción de 1:50. BTE previamente purificado del sobrenadante de células infectadas de mCD3xhCD20 H MV fueron agregados en las concentraciones indicadas. Relativa lisis de las células diana se evaluaron por análisis de liberación LDH después de 48 h. células carece el BTE blanco antígeno (B16-CD46) sirve como referencia para evaluar la citotoxicidad específica de antígeno. Medios y desviaciones estándar de tres repeticiones técnicas por ejemplo se muestran. Las células expresan el antígeno Diana fueron específicamente lisis de una manera dependiente de la concentración de BTE. Pureza de la expresión del antígeno de producto y destino BTE niveles de muerte celular de influencia. En el presente ejemplo, muerte de células específicas de 15% se logró en una concentración relativamente alta de BTE de 1 μg/mL. Este es un valor típico para una configuración de experimental con tiempos de incubación Co y condiciones de cultivo óptima T cell. En otros ámbitos, hasta 60% homicidio específico fue alcanzada usando BTE purificada a partir de sobrenadantes de MV-infectados, alcanzando una meseta a concentraciones de BTE de 100 ng/mL y mayores de38. Esto indica que, intuitivamente, el límite de este ensayo es inferior al 100% homicidio específico, que puede explicarse por la cinética de crecimiento en Tmax controles en comparación con las muestras de la cultura. Haga clic aquí para ver una versión más grande de esta figura.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Oncolíticos inmunoterapia (es decir., OVT en combinación con inmunomodulación) es muy prometedor para el tratamiento del cáncer, exigiendo más desarrollo y optimización de virus oncolíticos que codifican las proteínas inmunomoduladoras. Este protocolo describe métodos para generar y validar tales vectores de pruebas posteriores en modelos preclínicos relevantes y potenciales futuros traducción clínica en nuevas terapias contra el cáncer.

Numerosas plataformas de virus oncolíticos diferentes con distintas ventajas están disponibles63. Además de especificidad cáncer vector seguridad, requisitos para la fabricación, eficacia en la lisis de la célula del tumor y la inducción de respuestas inmunitarias, capacidad de clonación es clave para éxito vectorización de inmunomoduladores usando un específico oncolíticos. Desafortunadamente, las comparaciones directas de diferentes OVs carecen actualmente y deben ser perseguidas con el fin de identificar opciones de tratamiento óptimo para los pacientes individuales. Esto puede facilitarse por promover el desarrollo racional y prueba de nuevos vectores codificación transgen, ejemplificado aquí para MV-BTE. Dadas las propiedades beneficiosas del MV (es decir, oncotropism, , seguridad, fusogenicity, inmunogenicidad, viabilidad de la modificación genética) este protocolo se centra en este vector oncolíticos, que puede ser generalizado para otros OV, especialmente paramyxoviruses .

Para una elección racional de inmunomoduladores potencialmente relevantes como candidato los transgenes (paso 1.1.1), un conocimiento profundo del ciclo cáncer inmunidad es esencial, hacer investigaciones sistemáticas de la literatura indispensable. Además, pantallas a gran escala, aunque costosas, pueden resultar valiosas para identificar nuevas dianas (véase p. ej., Patel et al.41).

Para el diseño de la OVs recombinante, debe considerarse expresión deseada. En el caso de los virus ARN, expresión génica está controlada a nivel de RNA por la polimerasa correspondiente. Al diseñar el transgen casetes para la inserción en los genomas de MV (paso 1.1.2), evitar secuencias que parecen señales de arranque/parada de MV polimerasa gene y ARN editar sitios y siguiendo la regla de seis es crucial para desarrollo acertado vector. Por otra parte, niveles de expresión de gene de paramixovirus corresponden a la posición dentro del genoma, como resultado de un gradiente de expresión43. En general, posicionamiento del transgén en posición aguas arriba aumenta la expresión a expensas de replicación reducida. Sin embargo, estos parámetros también dependen del tamaño, estructura y secuencia del transgén respectivo. En consecuencia, una limitación de la metodología descrita en el presente Protocolo es la necesidad de pruebas empíricas de diseños de nuevos vectores. En casos específicos, ajustes a la secuencia del transgén o posicionamiento sean necesario para lograr las características de vector deseado (figura 2). Comparación sistemática de posiciones para el anticuerpo de control inserta mostró resultados óptimos para el H- ATU (datos no publicados). Como insertos BTE tienen propiedades comparables (tamaño e inmunoglobulina dominios), vectores de MV-BTE se clonaron análogamente38.

Rescate de las partículas infecciosas del virus cDNA (paso 2.1) puede requerir varios intentos para algunas construcciones. Ajuste de número de células puede optimizar la densidad de la célula para la formación de sincicios. Mientras que una cierta densidad es necesario para la eficiente diseminación de célula a célula y la fusión de las membranas celulares, inhibición de contacto reduce la replicación viral. Además, el número de partículas infecciosas no puede ser suficiente para inducir la fusión celular visible. Sin embargo, como virus pueden estar presentes en ausencia de sincicios, muestras de rescate pueden sin embargo ser cosechadas y transferidas a células frescas productor potencial propagación. Transfección ineficiente debido a la mala calidad de ADN o reactivos de transfección inadecuados o degradados representan problemas típicos que son relativamente fáciles de evaluar y remediar generando nuevas preparaciones de ADN y pruebas de diferentes reactivos, respectivamente.

Propagación de virus de éxito (paso 2.2) es crucialmente dependiente de las condiciones de determinación de la replicación viral y lisis celular. Se recomienda usar números de paso bajo de células de productor, y las células infectadas deben comprobar regularmente para la progresión de sincicios. Ajustar el número de células, las temperaturas y tiempos de incubación deberá equilibrar la proliferación celular de propagación viral vs. .

Una limitación fundamental del método descrito de la producción de virus es la preparación de las suspensiones de virus de lysates de la célula crudo. Los investigadores deben ser conscientes del hecho de que la suspensión de virus contiene factores celulares. Las partículas del virus pueden ser concentrada a través de densidad gradiente/sacarosa amortiguador ultracentrifugación a expensas de la número total de partículas infecciosas y también potencialmente crecientes concentraciones de restos celulares. Virus puede también ser concentrado de sobrenadantes de célula infectada, aumento de pureza pero reducir el rendimiento general. GMP y a gran escala producción de paramyxoviruses se realiza típicamente usando múltiples capas de productor de células sembrada sobre un filamento neto en biorreactores para título mayor rendimiento63. Control preciso, intercambio de medios continuos, condiciones libres de suero y posterior filtración pasos aseguran de alta pureza de virus producidos.

Evaluación de títulos virales (pasos 2.3 y 3.1) a través de sincicios descritos método no es exacto, pero es fácil de realizar y replica lo suficientemente precisa cuando se utiliza un número adecuado de técnica. Al evaluar la citotoxicidad mediada por el OV (paso 3.2), limitaciones de los análisis disponibles necesitan ser considerados. Ensayos metabólicos no distinguen entre los efectos citostáticos y citolíticos de tratamientos experimentales. Para medir la citólisis, puede realizarse un ensayo de liberación LDH. Sin embargo, ambos tipos de análisis pueden ser afectados por el contenido de las preparaciones de virus de lysates de la célula crudo (figura 6).

Aislamiento de las proteínas expresadas por células infectadas por virus (paso 4.1) puede variar mucho en el rendimiento y pureza, según el transgen respectivo y virus utilizado, así como en precisión técnica. Por lo tanto, es crucial para la evaluación de resultados experimentales relacionados con control de calidad de purificación de proteínas.

Como una descripción exhaustiva de posibles ensayos funcionales que cubren la amplia variedad de posibles inmunomoduladores está fuera del alcance de esta publicación, este protocolo se centra en ex vivo metodología para medir la citotoxicidad celular (paso 4.3). Citotoxicidad celular, especialmente por las células T CD8 +, es un mediador importante del control inmunológico del tumor en inmunoterapias éxito64. Esto tiene implicaciones importantes para los enfoques actuales de la inmunoterapia con anticuerpos para mejorar la respuesta inmune antitumoral en general y actores de la célula de T tienen en particular. Expresión local de BTE por vectores oncolíticos ha rendido resultados prometedores en varios estudios preclínicos, incluyendo38 de RNA y DNA virus65,66,67,68.

Debido a las complejas interacciones del tumor, virus, producto del transgen y host sistema inmunológico en los organismos vivos, validación de codificación inmunomodulador oncolíticos vectores en cultivo celular como se muestra aquí no es suficiente para predecir los resultados terapéuticos. Lo importante, la evaluación propuesta aislada de funciones vectoriales e inmunomodulador, respectivamente, es esencial para la prueba de concepto pero no describir posibles sinergias y complejas interacciones en el microambiente tumoral. Pruebas de toxicidad y eficacia en modelos in vivo relevantes es crucial para más desarrollo de vector recombinante novela construye pero no se logra fácilmente. Seguridad inmunológica se controla regularmente en primates no humanos como macacos y modelos de ratón se utilizan para la biodistribución y eficacia analiza20,69. Sin embargo, muchos de estos modelos tienen limitaciones en cuanto a la expresión de receptores de virus en los tejidos del huésped y la permisividad de host, y algunos solamente escaso mímico la compleja interacción de OV, tumorales y el microambiente inmunológico. Por lo tanto, una cuidadosa consideración de los modelos apropiados es obligatoria.

Tratamiento de MV-BTE ha sido evaluado previamente en xenoinjertos humanos y modelos de ratón syngeneic. No transgénica BTE productos eran perceptibles en suero de ratones tratados con MV codificación BTE38, indicando incluso sin éxito prevención de exposición sistémica más atenuación de la natural oncotropic vacuna contra virus de la tensión. Expresión local es crucial para inmunomoduladores OV-codificados que son tóxicos cuando se administra sistémicamente. Si es necesario, especificidad tumoral puede ser mejorada por retargeting para marcadores de superficie de elección70,71,72 y base de microARN-targeting ()74 73,mayor oncotropism de la célula revisados por Ruiz y Russell75). Pueden introducir modificaciones para optimizar vectores para determinados usos terapéuticos (revisados por Miest y Cattaneo76), incluyendo la inserción de transgenes para propósitos de diagnóstico77,78 o profármaco conversión a minimizar los efectos secundarios de la quimioterapia79,80, introducción de seguridad interruptores de81y el señalamiento de estroma del tumor o de la vasculatura (por ejemplo, a través de anticuerpos tienen82).

Aparte de la modificación genética de los vectores virales, los regímenes de combinación con el antígeno quimérico del receptor (CAR) la célula de T transfieren83, quimioterapia84,85,86o radioterapia87, 88 , 89 además aumentar el repertorio de la OVT. Como inmunidad de MV es altamente prevalente, se han desarrollado estrategias para evadir la neutralización de anticuerpos, incluyendo intercambio de glicoproteínas de envoltura para los paramyxoviruses relacionados con90, recubrimiento de polímero de partículas con portadores de la célula a entregar el virus y la immunosupresión transitoria (revisado por Russell et al.6). Desarrollo de pautas de inmunoterapia OV avanzadas requiere pruebas de seguridad y eficacia terapéutica en modelos animales apropiados, con material de paciente y, en última instancia, en ensayos clínicos controlados.

Dada la gran cantidad de combinaciones posibles, prueba completa no es factible. Modelación matemática puede ayudar en la priorización de posibles regímenes de combinación, así como su respectiva dosificación y programación por predecir los resultados del tratamiento en silico (revisado por Santiago et al91). Cuando eficacias de novela, racionalmente diseñados vectores, sonido que acompaña a la investigación traslacional es fundamental para una comprensión más profunda de los procesos subyacentes de virológicos e inmunológicos. Esto es crucial para la generación de modelos apropiados, información sobre otros posibles objetivos y avance en el campo en general. En conclusión, primera mano información sobre métodos de diseño vectorial, la generación y caracterización en esta línea de trabajo será acelerar el desarrollo y exploración de la novedosa terapéutica de apoyo para futura traducción clínica.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Engeland C.E. se cotizan como co-inventor de una patente con respecto a los virus ARN Immunovirotherapy de cáncer de la Universidad de Heidelberg. J.P.W. Heidbuechel no tiene nada que revelar.

Acknowledgments

Estos métodos fueron establecidos en el grupo de Viroterapia dirigido por el Prof. Dr. Dr. Guy Ungerechts en el centro nacional para enfermedades tumorales en Heidelberg. Estamos agradecidos a él y a todos los miembros del equipo de laboratorio, especialmente el Dr. Tobias Speck, Dr. Rūta Veinalde, Judith Förster, Birgit Hoyler y Jessica Albert. Este trabajo fue apoyado por el Else Kröner-Fresenius-Stiftung (beca 2015_A78 a Engeland C.E.) y la Fundación de ciencia nacional alemana (DFG, conceder EN 1119/2-1 a Engeland C.E.). J.P.W. Heidbuechel recibe un estipendio por la escuela de posgrado Helmholtz para la investigación del cáncer.

Materials

Name Company Catalog Number Comments
Rapid DNA Dephos & Ligation Kit Roche Life Science, Mannheim, Germany 4898117001
CloneJET PCR Cloning Kit Thermo Fisher Scientific, St. Leon-Rot K1231
Agarose Sigma-Aldrich, Taufkirchen, Germany A9539-500G
QIAquick Gel Extraction Kit QIAGEN, Hilden, Germany 28704
NEB 10-beta Competent E. coli New England Biolabs (NEB), Frankfurt/Main, Germany C3019I
LB medium after Lennox Carl Roth, Karlsruhe, Germany X964.1
Ampicillin Carl Roth, Karlsruhe, Germany HP62.1
QIAquick Miniprep Kit QIAGEN, Hilden, Germany 27104
Restriction enzyme HindIII-HF New England Biolabs (NEB), Frankfurt/Main, Germany R3104S
Dulbecco's Modified Eagle's Medium (DMEM) Invitrogen, Darmstadt, Germany 31966-021
Fetal bovine serum (FBS) Biosera, Boussens, France FB-1280/500
FugeneHD Promega, Mannheim, Germany E2311 may be replaced by transfection reagent of choice
Kanamycin Sigma-Aldrich, Taufkirchen, Germany K0129
Vero cells ATCC, Manassas, VA, USA CCL81
B16-CD46/ B16-CD20-CD46 J. Heidbuechel, DKFZ Heidelberg available upon request
Granta-519 DSMZ, Braunschweig, Germany ACC 342
Opti-MEM (serum-free medium) Gibco Life Technologies, Darmstadt, Germany 31985070
Colorimetric Cell Viability Kit III (XTT) PromoKine, Heidelberg, Germany PK-CA20-300-1000 includes XTT reagent
Dulbecco's Phosphate-Buffered Saline (PBS) Gibco Life Technologies, Darmstadt, Germany 14190-094
QIAquick Ni-NTA Spin Columns QIAGEN, Hilden, Germany 31014
Sodium chloride Carl Roth, Karlsruhe, Germany 3957.3
Imidazole Carl Roth, Karlsruhe, Germany I5513-25G
Amicon Ultra-15, PLGC Ultracel-PL Membran, 10 kDa Merck, Darmstadt, Germany UFC901024
BCA Protein Assay Kit Merck Milipore 71285-3
IgG from human serum Sigma-Aldrich, Taufkirchen, Germany I4506
Anti-HA-PE Miltenyi Biotech, Bergisch Gladbach, Germany 130-092-257 RRID: AB_871939
Mouse IgG1, kappa Isotype Control, Phycoerythrin Conjugated, Clone MOPC-21 antibody BD Biosciences, Heidelberg, Germany 555749 RRID: AB_396091
Anti-HA-biotin antibody, clone 3F10 Sigma-Aldrich, Taufkirchen, Germany 12158167001 RRID: AB_390915
Anti-Biotin MicroBeads Miltenyi Biotech, Bergisch Gladbach, Germany 130-090-485
MS Columns Miltenyi Biotech, Bergisch Gladbach, Germany 130-042-201
MiniMACS Separator Miltenyi Biotech, Bergisch Gladbach, Germany 130-042-102
MACS MultiStand Miltenyi Biotech, Bergisch Gladbach, Germany 130-042-303
RIPA buffer Rockland Immunochemicals, Gilbertsville, PA, USA MB-030-0050
CytoTox 96 Non-Radioactive Cytotoxicity Assay Promega, Mannheim, Germany G1780 includes 10x lysis solution, substrate solution (substrate mix and assay buffer), and stop solution
Cell lifter Corning, Reynosa, Mexico 3008
10 cm dishes Corning, Oneonta, NY, USA 430167
15 cm dishes Greiner Bio-One, Frickenhausen, Germany 639160
96-well plates, U-bottom TPP, Trasadingen, Switzerland 92097
96-well plates, flat bottom Neolab, Heidelberg, Germany 353072
6-well plates Neolab, Heidelberg, Germany 353046
12-well plates Neolab, Heidelberg, Germany 353043
50 mL tubes nerbe plus, Winsen/Luhe, Germany 02-572-3001
T175 cell culture flasks Thermo Fisher Scientific, St. Leon-Rot 159910
0.22 µm filters Merck, Darmstadt, Germany SLGPM33RS

DOWNLOAD MATERIALS LIST

References

  1. Lichty, B. D., Breitbach, C. J., Stojdl, D. F., Bell, J. C. Going viral with cancer immunotherapy. Nature Reviews Cancer. 14, (8), 559-567 (2014).
  2. Cassady, K. A., Haworth, K. B., Jackson, J., Markert, J. M., Cripe, T. P. To Infection and Beyond: The Multi-Pronged Anti-Cancer Mechanisms of Oncolytic Viruses. Viruses. 8, (2), (2016).
  3. Twumasi-Boateng, K., Pettigrew, J. L., Kwok, Y. Y. E., Bell, J. C. Oncolytic viruses as engineering platforms for combination immunotherapy. Nature Reviews Cancer. (2018).
  4. Achard, C., et al. Lighting a Fire in the Tumor Microenvironment Using Oncolytic Immunotherapy. EBioMedicine. 31, 17-24 (2018).
  5. Kelly, E., Russell, S. J. History of oncolytic viruses: genesis to genetic engineering. Molecular Therapy. The Journal of the American Society of Gene Therapy. 15, (4), 651-659 (2007).
  6. Russell, S. J., Peng, K. W., Bell, J. C. Oncolytic virotherapy. Nature Biotechnology. 30, (7), 658-670 (2012).
  7. Russell, S. J., Peng, K. W. Oncolytic Virotherapy: A Contest between Apples and Oranges. Molecular Therapy: The Journal of the American Society of Gene Therapy. 25, (5), 1107-1116 (2017).
  8. Seymour, L. W., Fisher, K. D. Oncolytic viruses: finally delivering. British Journal of Cancer. 114, (4), 357-361 (2016).
  9. Chen, D. S., Mellman, I. Oncology meets immunology: the cancer-immunity cycle. Immunity. 39, (1), 1-10 (2013).
  10. Gao, Q., Park, M. S., Palese, P. Expression of transgenes from newcastle disease virus with a segmented genome. Journal of Virology. 82, (6), 2692-2698 (2008).
  11. Billeter, M. A., Naim, H. Y., Udem, S. A. Reverse genetics of measles virus and resulting multivalent recombinant vaccines: applications of recombinant measles viruses. Current Topics in Microbiology and Immunology. 329, 129-162 (2009).
  12. Matveeva, O. V., Guo, Z. S., Shabalina, S. A., Chumakov, P. M. Oncolysis by paramyxoviruses: multiple mechanisms contribute to therapeutic efficiency. Molecular Therapy Oncolytics. 2, (2015).
  13. Suter, S. E., et al. In vitro canine distemper virus infection of canine lymphoid cells: a prelude to oncolytic therapy for lymphoma. Clinical Cancer Research. 11, (4), 1579-1587 (2005).
  14. Ammayappan, A., Russell, S. J., Federspiel, M. J. Recombinant mumps virus as a cancer therapeutic agent. Molecular Therapy Oncolytics. 3, 16019 (2016).
  15. Schirrmacher, V. Oncolytic Newcastle disease virus as a prospective anti-cancer therapy. A biologic agent with potential to break therapy resistance. Expert Opinion on Biological Therapy. 15, (12), 1757-1771 (2015).
  16. Saga, K., Kaneda, Y. Oncolytic Sendai virus-based virotherapy for cancer: recent advances. Oncolytic Virotherapy. 4, 141-147 (2015).
  17. Matveeva, O. V., Kochneva, G. V., Netesov, S. V., Onikienko, S. B., Chumakov, P. M. Mechanisms of Oncolysis by Paramyxovirus Sendai. Acta Naturae. 7, (2), 6-16 (2015).
  18. Gainey, M. D., Manuse, M. J., Parks, G. D. A hyperfusogenic F protein enhances the oncolytic potency of a paramyxovirus simian virus 5 P/V mutant without compromising sensitivity to type I interferon. Journal of Virology. 82, (19), 9369-9380 (2008).
  19. Engeland, C. E., et al. A Tupaia paramyxovirus vector system for targeting and transgene expression. The Journal of General Virology. 98, (9), 2248-2257 (2017).
  20. Russell, S. J., Peng, K. W. Measles virus for cancer therapy. Current Topics in Microbiology and Immunology. 330, 213-241 (2009).
  21. Aref, S., Bailey, K., Fielding, A. Measles to the Rescue: A Review of Oncolytic Measles Virus. Viruses. 8, (10), (2016).
  22. Demicheli, V., Rivetti, A., Debalini, M. G., Di Pietrantonj, C. Vaccines for measles, mumps and rubella in children. The Cochrane Database of Systematic Reviews. (2), 004407 (2012).
  23. Radecke, F., et al. Rescue of measles viruses from cloned DNA. The EMBO Journal. 14, (23), 5773-5784 (1995).
  24. Martin, A., Staeheli, P., Schneider, U. RNA polymerase II-controlled expression of antigenomic RNA enhances the rescue efficacies of two different members of the Mononegavirales independently of the site of viral genome replication. Journal of Virology. 80, (12), 5708-5715 (2006).
  25. Russell, S. J., et al. Remission of disseminated cancer after systemic oncolytic virotherapy. Mayo Clinic Proceedings. 89, (7), 926-933 (2014).
  26. Hardcastle, J., et al. Immunovirotherapy with measles virus strains in combination with anti-PD-1 antibody blockade enhances antitumor activity in glioblastoma treatment. Neuro-Oncology. 19, (4), 493-502 (2017).
  27. Dispenzieri, A., et al. Phase I trial of systemic administration of Edmonston strain of measles virus genetically engineered to express the sodium iodide symporter in patients with recurrent or refractory multiple myeloma. Leukemia. 31, (12), 2791-2798 (2017).
  28. Galanis, E., et al. Phase I trial of intraperitoneal administration of an oncolytic measles virus strain engineered to express carcinoembryonic antigen for recurrent ovarian cancer. Cancer Research. 70, (3), 875-882 (2010).
  29. Galanis, E., et al. Oncolytic measles virus expressing the sodium iodide symporter to treat drug-resistant ovarian cancer. Cancer Research. 75, (1), 22-30 (2015).
  30. Kurokawa, C., et al. Constitutive Interferon Pathway Activation in Tumors as an Efficacy Determinant Following Oncolytic Virotherapy. Journal of the National Cancer Institute. (2018).
  31. Msaouel, P., et al. Clinical Trials with Oncolytic Measles Virus: Current Status and Future Prospects. Current Cancer Drug Targets. 18, (2), 177-187 (2018).
  32. Grote, D., Cattaneo, R., Fielding, A. K. Neutrophils contribute to the measles virus-induced antitumor effect: enhancement by granulocyte macrophage colony-stimulating factor expression. Cancer Research. 63, (19), 6463-6468 (2003).
  33. Grossardt, C., et al. Granulocyte-macrophage colony-stimulating factor-armed oncolytic measles virus is an effective therapeutic cancer vaccine. Human Gene Therapy. 24, (7), 644-654 (2013).
  34. Iankov, I. D., et al. Expression of immunomodulatory neutrophil-activating protein of Helicobacter pylori enhances the antitumor activity of oncolytic measles virus. Molecular Therapy: The Journal of the American Society of Gene Therapy. 20, (6), 1139-1147 (2012).
  35. Engeland, C. E., et al. CTLA-4 and PD-L1 Checkpoint Blockade Enhances Oncolytic Measles Virus Therapy. Molecular Therapy: The Journal of the American Society of Gene Therapy. 22, (11), 1949-1959 (2014).
  36. Veinalde, R., et al. Oncolytic measles virus encoding interleukin-12 mediates potent antitumor effects through T cell activation. Oncoimmunology. 6, (4), 1285992 (2017).
  37. Hutzler, S., et al. Antigen-specific oncolytic MV-based tumor vaccines through presentation of selected tumor-associated antigens on infected cells or virus-like particles. Scientific Reports. 7, (1), 16892 (2017).
  38. Speck, T., et al. Targeted BiTE expression by an oncolytic vector augments therapeutic efficacy against solid tumors. Clinical Cancer Research. (2018).
  39. Andtbacka, R. H., et al. Talimogene Laherparepvec Improves Durable Response Rate in Patients With Advanced Melanoma. Journal of Clinical Oncology: Official Journal of the American Society of Clinical Oncology. 33, (25), 2780-2788 (2015).
  40. Ribas, A., et al. Oncolytic Virotherapy Promotes Intratumoral T Cell Infiltration and Improves Anti-PD-1 Immunotherapy. Cell. 170, (6), 1109-1119 (2017).
  41. Patel, S. J., et al. Identification of essential genes for cancer immunotherapy. Nature. 548, (7669), 537-542 (2017).
  42. Kimple, M. E., Brill, A. L., Pasker, R. L. Overview of affinity tags for protein purification. Current Protocols in Protein Science. 73, Unit 9.9 (2013).
  43. Cattaneo, R., Rebmann, G., Baczko, K., ter Meulen, V., Billeter, M. A. Altered ratios of measles virus transcripts in diseased human brains. Virology. 160, (2), 523-526 (1987).
  44. Gutsche, I., et al. Structural virology. Near-atomic cryo-EM structure of the helical measles virus nucleocapsid. Science. 348, (6235), New York, N.Y. 704-707 (2015).
  45. Kolakofsky, D., et al. Paramyxovirus RNA synthesis and the requirement for hexamer genome length: the rule of six revisited. Journal of Virology. 72, (2), 891-899 (1998).
  46. Kolakofsky, D., Roux, L., Garcin, D., Ruigrok, R. W. Paramyxovirus mRNA editing, the "rule of six" and error catastrophe: a hypothesis. The Journal of General Virology. 86, Pt 7 1869-1877 (2005).
  47. Parks, C. L., et al. Analysis of the noncoding regions of measles virus strains in the Edmonston vaccine lineage. Journal of Virology. 75, (2), 921-933 (2001).
  48. JoVE Science Education Database. Molecular Cloning. JoVE Science Education Database. JoVE. Cambridge, MA. JoVE Science Education Database: Basic Methods in Cellular and Molecular Biology (2018).
  49. JoVE Science Education Database. Bacterial Transformation: The Heat Shock Method. JoVE Science Education Database. JoVE. Cambridge, MA. JoVE Science Education Database: Basic Methods in Cellular and Molecular Biology (2018).
  50. Bergkessel, M., Guthrie, C. Colony PCR. Methods in Enzymology. 529, 299-309 (2013).
  51. Rota, J. S., Wang, Z. D., Rota, P. A., Bellini, W. J. Comparison of sequences of the H, F, and N coding genes of measles virus vaccine strains. Virus Research. 31, (3), 317-330 (1994).
  52. Bankamp, B., Takeda, M., Zhang, Y., Xu, W., Rota, P. A. Genetic characterization of measles vaccine strains. The Journal of Infectious Diseases. 204, Suppl 1 533-548 (2011).
  53. Dulbecco, R., Vogt, M. Plaque formation and isolation of pure lines with poliomyelitis viruses. The Journal of Experimental Medicine. 99, (2), 167-182 (1954).
  54. Smith, P. K., et al. Measurement of protein using bicinchoninic acid. Analytical Biochemistry. 150, (1), 76-85 (1985).
  55. Bradford, M. M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Analytical Biochemistry. 72, 248-254 (1976).
  56. JoVE Science Education Database. Separating Protein with SDS-PAGE. JoVE Science Education Database. JoVE. Cambridge, MA. JoVE Science Education Database: Basic Methods in Cellular and Molecular Biology (2018).
  57. JoVE Science Education Database. The Western Blot. JoVE Science Education Database. JoVE. Cambridge, MA. JoVE Science Education Database: Basic Methods in Cellular and Molecular Biology (2018).
  58. Menck, K., et al. Isolation of human monocytes by double gradient centrifugation and their differentiation to macrophages in teflon-coated cell culture bags. Journal of Visualized Experiments. (91), e51554 (2014).
  59. Quah, B. J., Parish, C. R. The use of carboxyfluorescein diacetate succinimidyl ester (CFSE) to monitor lymphocyte proliferation. Journal of Visualized Experiments. (44), (2010).
  60. Gerdes, J. Ki-67 and other proliferation markers useful for immunohistological diagnostic and prognostic evaluations in human malignancies. Seminars in Cancer Biology. 1, (3), 199-206 (1990).
  61. JoVE Science Education Database. The Transwell Migration Assay. JoVE Science Education Database. JoVE. Cambridge, MA. JoVE Science Education Database: Basic Methods in Cellular and Molecular Biology (2018).
  62. Lim, J. F., Berger, H., Su, I. H. Isolation and Activation of Murine Lymphocytes. Journal of Visualized Experiments. (116), e54596 (2016).
  63. Ungerechts, G., et al. Moving oncolytic viruses into the clinic: clinical-grade production, purification, and characterization of diverse oncolytic viruses. Molecular Therapy Methods & Clinical Development. 3, 16018 (2016).
  64. Fridman, W. H., Zitvogel, L., Sautes-Fridman, C., Kroemer, G. The immune contexture in cancer prognosis and treatment. Nature Reviews Clinical Oncology. 14, (12), 717-734 (2017).
  65. Yu, F., et al. T-cell engager-armed oncolytic vaccinia virus significantly enhances antitumor therapy. Molecular Therapy: The Journal of the American Society of Gene Therapy. 22, (1), 102-111 (2014).
  66. Fajardo, C. A., et al. Oncolytic Adenoviral Delivery of an EGFR-Targeting T-cell Engager Improves Antitumor Efficacy. Cancer Research. 77, (8), 2052-2063 (2017).
  67. Freedman, J. D., et al. Oncolytic adenovirus expressing bispecific antibody targets T-cell cytotoxicity in cancer biopsies. EMBO Molecular Medicine. 9, (8), 1067-1087 (2017).
  68. Wing, A., et al. Improving CART-Cell Therapy of Solid Tumors with Oncolytic Virus-Driven Production of a Bispecific T-cell Engager. Cancer Immunology Research. 6, (5), 605-616 (2018).
  69. Myers, R. M., et al. Preclinical pharmacology and toxicology of intravenous MV-NIS, an oncolytic measles virus administered with or without cyclophosphamide. Clinical Pharmacology and Therapeutics. 82, (6), 700-710 (2007).
  70. Rittner, K., Schreiber, V., Erbs, P., Lusky, M. Targeting of adenovirus vectors carrying a tumor cell-specific peptide: in vitro and in vivo studies. Cancer Gene Therapy. 14, (5), 509-518 (2007).
  71. Nakamura, T., et al. Rescue and propagation of fully retargeted oncolytic measles viruses. Nature Biotechnology. 23, (2), 209-214 (2005).
  72. Campadelli-Fiume, G., et al. Retargeting Strategies for Oncolytic Herpes Simplex Viruses. Viruses. 8, (3), 63 (2016).
  73. Leber, M. F., et al. MicroRNA-sensitive oncolytic measles viruses for cancer-specific vector tropism. Molecular Therapy: The Journal of the American Society of Gene Therapy. 19, (6), 1097-1106 (2011).
  74. Baertsch, M. A., et al. MicroRNA-mediated multi-tissue detargeting of oncolytic measles virus. Cancer Gene Therapy. 21, (9), 373-380 (2014).
  75. Ruiz, A. J., Russell, S. J. MicroRNAs and oncolytic viruses. Current Opinion in Virology. 13, 40-48 (2015).
  76. Miest, T. S., Cattaneo, R. New viruses for cancer therapy: meeting clinical needs. Nature Reviews Microbiology. 12, (1), 23-34 (2014).
  77. Phuong, L. K., et al. Use of a vaccine strain of measles virus genetically engineered to produce carcinoembryonic antigen as a novel therapeutic agent against glioblastoma multiforme. Cancer Research. 63, (10), 2462-2469 (2003).
  78. Dingli, D., et al. Image-guided radiovirotherapy for multiple myeloma using a recombinant measles virus expressing the thyroidal sodium iodide symporter. Blood. 103, (5), 1641-1646 (2004).
  79. Abate-Daga, D., et al. Oncolytic adenoviruses armed with thymidine kinase can be traced by PET imaging and show potent antitumoural effects by ganciclovir dosing. PLoS One. 6, (10), 26142 (2011).
  80. Ungerechts, G., et al. Lymphoma chemovirotherapy: CD20-targeted and convertase-armed measles virus can synergize with fludarabine. Cancer Research. 67, (22), 10939-10947 (2007).
  81. Ketzer, P., et al. Artificial riboswitches for gene expression and replication control of DNA and RNA viruses. Proceedings of the National Academy of Sciences of the United States of America. 111, (5), 554-562 (2014).
  82. Freedman, J., et al. Targeting T-cells to human cancer associated fibroblasts using an oncolytic virus expressing a FAP-specific T-cell engager. Keystone Symposia & Digitell, Inc. (2018).
  83. Nishio, N., et al. Armed oncolytic virus enhances immune functions of chimeric antigen receptor-modified T cells in solid tumors. Cancer Research. 74, (18), 5195-5205 (2014).
  84. Bressy, C., Benihoud, K. Association of oncolytic adenoviruses with chemotherapies: an overview and future directions. Biochemical Pharmacology. 90, (2), 97-106 (2014).
  85. Wennier, S. T., Liu, J., McFadden, G. Bugs and drugs: oncolytic virotherapy in combination with chemotherapy. Current Pharmaceutical Biotechnology. 13, (9), 1817-1833 (2012).
  86. Fillat, C., Maliandi, M. V., Mato-Berciano, A., Alemany, R. Combining oncolytic virotherapy and cytotoxic therapies to fight cancer. Current Pharmaceutical Design. 20, (42), 6513-6521 (2014).
  87. Li, H., Peng, K. W., Russell, S. J. Oncolytic measles virus encoding thyroidal sodium iodide symporter for squamous cell cancer of the head and neck radiovirotherapy. Human Gene Therapy. 23, (3), 295-301 (2012).
  88. Opyrchal, M., et al. Effective radiovirotherapy for malignant gliomas by using oncolytic measles virus strains encoding the sodium iodide symporter (MV-NIS). Human Gene Therapy. 23, (4), 419-427 (2012).
  89. Mansfield, D., et al. Oncolytic Vaccinia virus and radiotherapy in head and neck cancer. Oral Oncology. 49, (2), 108-118 (2013).
  90. Miest, T. S., et al. Envelope-chimeric entry-targeted measles virus escapes neutralization and achieves oncolysis. Molecular Therapy: The Journal of the American Society of Gene Therapy. 19, (10), 1813-1820 (2011).
  91. Santiago, D. N., et al. Fighting Cancer with Mathematics and Viruses. Viruses. 9, (9), (2017).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics