בתיווך CRISPR הגנום עריכה של פטריות פתוגניות קנדידה אלביקנס

* These authors contributed equally
Genetics
 

Summary

הנדסה יעיל הגנום של קנדידה אלביקנס חיוני להבנת הפתוגנזה של התפתחות הרפוי. כאן, אנחנו תיאר נוהל לעריכת במהירות ובדייקנות את הגנום אלביקנס ג באמצעות CRISPR. הפרוטוקול מאפשר חוקרים כדי להציג מגוון רחב של שינויים גנטיים כולל מוטציות נקודה, הוספות ומחיקות.

Cite this Article

Copy Citation | Download Citations

Evans, B. A., Pickerill, E. S., Vyas, V. K., Bernstein, D. A. CRISPR-mediated Genome Editing of the Human Fungal Pathogen Candida albicans. J. Vis. Exp. (141), e58764, doi:10.3791/58764 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

שיטה זו מתארת את יעילות CRISPR מתווכת הגנום עריכת דיפלואידי פתוגניות ופטריות קנדידה אלביקנס. הגנום בתיווך CRISPR עריכה בג אלביקנס דורש Cas9, מדריך RNA, ותיקון תבנית. פלסמיד לבטא codon שמרים של אופטימיזציה Cas9 (CaCas9) נוצרה. מדריך רצפים ישירות נגד הזרם של פאם האתר (הגולה) הם משובטים לתוך הווקטור ביטוי Cas9. תבנית תיקון ואז נעשית על ידי פריימר הרחבה במבחנה. Cotransformation של תיקון תבנית, וקטור לתוך אלביקנס ג מובילה לעריכת הגנום. בהתאם לתבנית תיקון בשימוש, החוקר יכול להציג שינויים נוקלאוטיד, הוספות או מחיקות. כמו ג אלביקנס דיפלואידי, מוטציות נעשים שני אללים של גנים, ובלבד אללים A ו- B לא הנמל SNPs להפריע מדריך מיקוד או תיקון תבנית ההתאגדות. ניתן לערוך משפחות גנים multimember במקביל אם מתאים שנשמרת רצפים קיימים כל בני המשפחה. מערכת CRISPR אלביקנס ג תיאר והשפלתם אתרי משני צדדיה, מקודד flippase. על אינדוקציה של flippase, סמן לאנטיביוטיקה (CaCas9) ואת מדריך RNA יוסרו מן הגנום. פעולה זו מאפשרת את החוקר לבצע עריכות עוקבות הגנום. ג אלביקנס CRISPR הוא כלי רב עוצמה הנדסה גנטית פטרייתי, שינוי קטן לפרוטוקולים המתואר אישור השינוי של מינים פטרייתיים אחרים כולל glabrata ג, (ש ע) castellii, cerevisiae ס.

Introduction

קנדידה אלביקנס הוא הנפוץ ביותר פטריות פתוגניות1,2,3. הבנת ההבדלים בין אלביקנס ג בתרבית של ביולוגיה מולקולרית הינה קריטית לפיתוח הדור הבא של פטריות הרפוי. פעולה זו דורשת חוקרים כדי להיות מסוגל לתמרן במהירות ובאופן מדויק גנטית אלביקנס ג.

הנדסה גנטית של אלביקנס ג והיסטורית היה מאתגר. אלביקנס ג אינו שומר על פלסמידים, וכך בונה כל מעוגנת לתוך הגנום. יתר על כן, ג אלביקנס הוא דיפלואידי; לכן, כאשר לדפוק הגן או היכרות עם מוטציה, חשוב להבטיח כי בשני עותקים כבר השתנה4. בנוסף, יש לוקוסים אלביקנס ג הם משפחתית ולא משפחתית הטרוזיגוטיים, שמסבך עוד יותר את החקירה גנטי5. לתמרן גנטית אלביקנס ג, זה אופייני לבצע סיבובים מרובים של רקומבינציה הומולוגית6. עם זאת, הטבע דיפלואידי של הגנום ופיתוח לבנות מפרך הפכו את זה תהליך שעשוי להיות מייגע, במיוחד אם נדרשים שינויים מרובים. מגבלות אלה ואת החשיבות הרפואית של אלביקנס ג דורשים הפיתוח של טכנולוגיות חדשות, המאפשרות חוקרים לתמרן ביתר קלות את הגנום אלביקנס ג .

מקובצים באשכולות חזרה palindromic קצר באופן קבוע interspaced (CRISPR)-הגנום בתיווך עריכה הוא כלי רב עוצמה המאפשר חוקרים לשנות את רצף הגנום. CRISPR דורש שלושה מרכיבים: 1) נוקלאז Cas9 זה cleaves את המטרה דנ א, 2) 20 לבסס RNA מדריך מטרות Cas9 רצף של עניין, ותיקון 3) DNA תבנית ותיקונים באתר המחשוף, משלבת את השינוי המיועד7, 8. ברגע המדריך מביא Cas9 רצף הגנום היעד, Cas9 דורש רצף מוטיב סמוכים (פאם) protospacer (הגולה) ישירות נגד הזרם של הרצף מדריך כדי לדבוק דנ א9. הדרישה עבור 20 מדריך בסיסי והן פאם רצפים מספק רמה גבוהה של פילוח ירידה לפרטים ומגביל את המטרה המחשוף.

CRISPR מערכות שנועדו להתמודד עם מגוון רחב של בעיות10ולערוך הגנום של קבוצה מגוונת של אורגניזמים. המתוארים כאן הוא פרוטוקול CRISPR גמיש, יעיל לעריכה גן אלביקנס ג עניין. הניסוי מציג stop codon אל הגן, גורם להפסקת התרגום. עריכה אחרים יכולים להתבצע בהתאם לתבנית תיקון שהוצגה. קטע המסומנים nourseothricin (Natr) המכילים שמרים codon ממוטב Cas9 (CaCas9), מדריך ה-RNA הוא שולב הגנום אלביקנס ג באתר נייטרלי. Cotransformation עם התבנית לתיקון הקידוד הרצוי המוטציה מוביל תיקון המחשוף ע י רקומבינציה הומולוגית הגנום יעיל עריכה. המתוארים להלן הוא עריכה של TPK2, אבל כל אלביקנס ג פתח קריאת מסגרות ניתן לפלח מספר פעמים על-ידי CRISPR. מערכת CRISPR אתרים והשפלתם משני צדדיה, ניתן להסיר מן הגנום אלביקנס ג באמצעות אינדוקציה של flippase מקודד על פלסמיד הביטוי CaCas9. המערכת CRISPR אלביקנס ג מאפשרת חוקרים בדייקנות ובמהירות לערוך את הגנום אלביקנס ג 11,12.

Protocol

1. זיהוי, שיבוט של רצף מדריך ה-RNA

  1. זיהוי של מדריך רצף ה-RNA
    1. זיהוי של 5'-הגולה-3' פאם רצף קרוב שבו stop codon יתווסף. (איור 1 א') מתויג כל פאם רצף נמצאים זוגות הבסיס הראשון 100 של TPK2 (איור 1 א').
      הערה: רצפים מדריך מיקוד כל מסגרת קריאה פתוחה אלביקנס ג ניתן למצוא ב http://osf.io/ARDTX 11,12.
    2. לזהות את רצף קדימה מדריך Primer_3, אשר יהיה 20 בסיסים ישירות במעלה הזרם של פאם הגולה האתר, לא יכיל יותר מ 5 Ts ברציפות. שמאל לחץ על בסיס ישירות במעלה הזרם של הגולה וגרור הסמן 20 בסיסים, ואז לחיצה שמאלית על כרטיסיה פריימר כדי להוסיף את המפתח.
    3. לזהות את רצף Primer_3 מדריך הפוכה, אשר יהיה המשלים את הרצף קדימה מדריך.
      הערה: מוצגות מדריכים המשתמשות PAM_3 (איור 1B).
    4. לחץ לחיצה ימנית על פריימר ובחרו "העתק נתונים פריימר". להדביק את רצפי בתוכנית לעריכת טקסט.
  2. להוסיף הסככה רצפים oligos לפנים והמדריך הפוך כדי להקל על שיבוט (טבלה 1, איור 1B).
    1. להוסיף את רצף נוקלאוטיד ATTTG 5' סוף Primer_3 מדריך קדימה לפני הרכישה.
    2. להוסיף G 3' סוף Primer_3 מדריך קדימה לפני הרכישה.
    3. להוסיף את רצף נוקלאוטיד AAAAC 5' בסוף Primer_3 מדריך הפוך לפני הרכישה.
    4. הוסף C 3' בסוף Primer_3 מדריך הפוך לפני הרכישה.
  3. תקציר CaCas9 ביטוי וקטור pV1524 עם BsmBI.
    הערה: pV1524 מכיל של אמפיצילין (Ampr) וסמנים nourseothricin (Natr). Cas9 כבר codon ממוטב עבור ג אלביקנס.
    1. לעכל את פלסמיד על-ידי הוספת: μg 2 של pv1524, 5 μL של 10 x מאגר, 1 μL של BsmBI, ו- H2O ל- 50 μL צינור 1.5 מ ל. דגירה ב 55 מעלות צלזיוס במשך 20 דקות (לחלופין, לעכל pv1524 למשך 15 דקות עם Esp3I, isoschizomer של BsmBI, ב 37 º C)
    2. מגניב בטמפרטורת החדר (RT), ספין בשביל 30 s ב x 2,348 g להביא עיבוי לתחתית הצינור. . המשך לצעוד 1.4 או לאחסן את פלסמיד מתעכל ב-20 ° C.
  4. פוספטאז-פינוק עמוד השדרה מעוכל.
    1. להוסיף 1 μL של עגל פוספטאז במעי (CIP) לתערובת עיכול, דגירה ב 37 ° C עבור 1 h.
    2. לטהר את פלסמיד מתעכל באמצעות ערכת טיהור תגובת שרשרת (PCR) זמינים מסחרית פולימראז (ההוראות שסופקו עם קיט), elute אותו בμl 30 מאגר • תנאי (EB).
  5. Phosphorylate, anneal קדימה-מדריך Primer_3 ו- Primer_3 מדריך הפוכה.
    1. להוסיף 0.5 μL של 100 μM קדימה מדריך Primer_3, 0.5 μL של 100 μM הפוכה Primer_3 מדריך, μL 5 10 מאגר ליגאז x T4, 1 μL של T4 polynucleotide קינאז, μL 43 של H2O לרכבת התחתית PCR.
    2. להוסיף 5 μL 10 x T4 ליגאז מאגר μL 1 של T4 polynucleotide קינאז, μL 44 של ביולוגיה מולקולרית-כיתה ח2O בשפופרת PCR השני.
      הערה: זה ישמש הפקד שלילי.
    3. דגירה של תערובות התגובה ב thermocycler ב 37 מעלות צלזיוס למשך 30 דקות, ואז ב 95 מעלות צלזיוס במשך 5 דקות.
    4. מגניב את התערובת בקצב הרמפה הכי איטית עד 16 ° C כדי anneal, oligos. ואז למקם את התערובת annealed oligo ב 4 º C.
  6. מאתרים ומפסיקים את oligos annealed לתוך pv1524 מתעכל מהשלב 1.4.3.
    1. להוסיף את הבא צינור ה-PCR: 1 μL של המאגר ליגאז x T4 10, 0.5 μL של T4 DNA ליגאז, 0.5 μL של מיקס annealed oligo, מתעכל שטופלו CIP מטוהרים פלסמיד (20-40 ng), ו- H2O כדי הנפח הכולל 10 μL.
    2. להוסיף את הבא צינור ה-PCR: 1 μL 10 x T4 ליגאז מאגר, 0.5 μL של T4 DNA ליגאז, מתעכל שטופלו CIP מטוהרים וקטור (20-40 ng), μL 1 של תערובת שליטה שלילי, ו- H2O עד הנפח הכולל 10 μL.
    3. דגירה שני צינורות thermocycler ב 16 מעלות צלזיוס למשך 30 דקות, ולאחר מכן ב 65 מעלות צלזיוס למשך 10 דקות, ואז צנני את 25 º C.
  7. להפוך μL 5 תערובות מצדו כשיר מבחינה כימית Escherichia coli DH5α באמצעות פרוטוקול טרנספורמציה של הלם חום רגיל. בחר המדיה Amp ליברות/Nat (200 μg/mL המגבר, 50 μg/mL Nat).
    הערה: כשל לבחירת pV1524 ונגזרותיו במדיה בחירה כפולה תגרום לאובדן של מודול Nat/CaCas9/מדריך מאת FLP/והשפלתם כריתה של חיידקים.
  8. לטהר פלסמידים של ארבעה transformants על ידי miniprep, רצף את רצף הכניסה עם רצף פריימר (טבלה 1).
    הערה: רוב הזמן, קביעת רצף 4 transformants מספיקה לזהות לפחות 1 לשכפול הנכון.
  9. שמור פלסמידים בעלי רצף הרנ א מדריך משובטים פעם אחת לתוך BsmBI לחתוך את האתר ב-20 ° C.

2. עיצוב הדור של תיקון תבנית

  1. הכנס stop codon על-ידי לחיצה שמאלית ברצף הגן והוספת נוקלאוטידים אשר קידוד stop codon והגבלה של עיכול אתר (1C איורטבלה 1).
    הערה: ההוספה ישבש את רצף פאם.
    הערה: אתר עיכול הגבלה ייכללו ברצף תבנית תיקון כדי להקל על סינון יעיל של שיבוטים (איור 1C).
  2. שמאל 10 בסיסים downstream של איפה המוטציה ייעשה וגרור שהסמן 60 בסיסים במעלה הזרם. לחיצה שמאלית על כרטיסיה פריימר כדי להוסיף את המפתח. פעולה זו תוסיף את תיקון תבנית Forward_3. שמאל 10 בסיסים במעלה הזרם של איפה המוטציה ייעשה וגרור שהסמן 60 בסיסים במורד הזרם. לחיצה שמאלית על כרטיסיה פריימר כדי להוסיף את המפתח. פעולה זו תוסיף את תבנית תיקון הפוך 3. (איור 1C)
  3. לבצע הארכת תחל לייצר את תבנית תיקון.
    1. להוסיף μL 1.2 של 100 μm תיקון תבנית פריימר לפנים, μL 1.2 של 100 μm תיקון תבנית פריימר הפוכה, 6 μL של deoxynucleotide triphosphates (dNTPs) (סה כ ריכוז 40 מ מ), 6 μL של המאגר, 0.6 μL של אנזימים (3 יחידות) μL 45 של H2O לכל אחד ה-PCR 4 צינורות.
    2. לבצע הארכת תחל על ידי הפעלת בין 20 ל 30 סיבובים של ה-PCR. דוגמה סיומת תנאים: 2 דקות ב 95 ° C, (30 s ב 95 ° C, 1 דקות ב- 50 ° C, 1 דקות ב 68 מעלות צלזיוס) x 34, 10 דקות ב- 68 מעלות צלזיוס.
    3. לשלב את התוכן של כל המבחנות 4 צינור 1.5 mL ולהשתמש ערכת טיהור PCR לטהר את המוצרים ב- 50 μL של H2O.
    4. Quantitate את המוצרים סיומת פריימר כדי להבטיח מספיק דנ א על-ידי קביעת את ספיגת ב-260 ננומטר.
      הערה: טיפוסי הריכוז הסופי של המוצר פריימר סיומת הוא ~ 200 – 300 ng/µL.

3. שינוי של אלביקנס ג עם תיקון תבנית, פלסמיד

  1. להפוך טה/ליתיום אצטט.
    1. מיקס 10 מ"מ טריס-Cl EDTA 1 מ מ, 100 מ מ ליתיום אצטט, H2O (כל פתרון מניות pH 7.5) כדי להשיג את הנפח הכולל 50 מ.
  2. לגרום הלוחית
    1. מערבבים 40% 3350. פג, אצטט ליתיום 100 מ מ, 10 מ מ טריס-Cl, 1 מ"מ EDTA ו- H2O (כל פתרון מניות pH 7.5) כדי להשיג את הנפח הכולל 50 מ.
  3. לעכל פלסמידים לשכפל בצורה נכונה מהצעד 1.9.
    1. להוסיף 10 μg פלסמיד, µL 4 10 x המאגר, µL 0.4 של 10 מ"ג/מ"ל אלבומין שור (BSA), 0.5 µL של KpnI, 0.5 µL של SacI ו H20-40 µL סה כ נפח צינור 1.5 מ. דגירה ב 37 מעלות צלזיוס למשך הלילה (איור 1D).
  4. לגדול תרבות לילה של אלביקנס ג SC5314, prototroph פראי-סוג, 25 ° c ב- dextrose peptone שמרים בתוספת 0.27 מ"מ Uridine (YPD + אורי), ממוקם באופן אידיאלי כדי OD600 פחות מ 6.
    1. גלולה 5 יחידות600 יתר של תאים לכל שינוי על ידי ספינינג למשך 5 דקות ב 2,348 x g , להשעות את יתר 5600 של מגורען תאים ב- 100 µL טה/ליתיום אצטט.
  5. להוסיף את הבא צינור 1.5 mL בסדר המפורט: 1) 100 µL של תאים מהשלב 3.4.1, µL 2) 40 של ההרתיחה מקורר מהיר זרע סלמון DNA (10 mg/mL), µg 3) 10 פלסמיד העיכול מהשלב 3.3.1, 4) 6 µg של תבנית תיקון מטוהרים ו- 5) 1 מ"ל של צלחת.
  6. להוסיף את הבא צינור 1.5 mL בסדר המפורט: 1) 100 µL של תאים, µL 2) 40 של ההרתיחה מקורר מהיר זרע סלמון DNA (10 mg/mL), כרך2O 3) H שווה לזה של שינוי ה-DNA שלב 3.5, 4) 1 מ"ל של צלחת.
    הערה: זה ישמש פקד שלילי.
  7. לערבב את המרות בעדינות על ידי pipetting ותנו דגירה 25 ° c בלילה.
  8. חום לזעזע את התאים על-ידי הצבתם באמבט מים 44 מעלות במשך 25 דקות.
  9. ספין למשך 5 דקות ב x 2,348 g ומפרידה benchtop ולהסיר את התערובת צלחת supernatant. לשטוף פעם אחת על-ידי הוספת 1 מ"ל של YPD + אורי, צנטריפוגה שוב למשך 5 דקות ב 2,348 x g.
  10. להשעות את התאים ב- 0.1 מ"ל של YPD + אורי, דגירה על רולר תוף או שאכר 25 ° c בלילה.
  11. צלחת YPD + אורי עם 200 nourseothricin μg/mL. מושבות יופיעו 2-5 ימים.

4. פסים על מושבות יחיד

  1. לחלק של 100 מ"מ x 15 מ"מ פטרי לרבעים, תווית כל רביע.
    1. נגיעה אחת של המושבות מהצלחת טרנספורמציה עם קיסם סטרילי או המוליך, פס לרוחב הצד הארוך של הרביע.
    2. פסים על מושבות יחיד באמצעות הטכניקה aseptic ולאפשר את המושבות לגדול ב 30 מעלות צלזיוס במשך יומיים.

5. המושבה PCR

  1. עיצוב סימון קדימה פריימר (FCP) ~ 200 בסיס זוגות במעלה הזרם של אתר ההגבלה אשר הוצג ואת הסימון הפוך פריימר (RCP) ~ 300 בסיס זוגות במורד הזרם.
    1. להוסיף μL 0.3 של FCP, μL 0.3 RCP, μL 0.3 של thermostable פולימראז (ExTaq 1.5 יחידות), μL 3 של dNTPs (סה כ ריכוז 40 מ מ), 3 μL של מאגר ExTaq, μL 23 H2O לרכבת התחתית 1.5 mL.
      הערה: תוספת של μL-תגובה 0.5 דימתיל סולפוקסיד (דימתיל סולפוקסיד) יכול לשפר את יעילות ה-PCR.
    2. הוסף μL 0.25 של מושבה בודדת שמרים משלב 4.1.2 לתערובת מהשלב 5.1.1, באמצעות טיפ פיפטה P10 ודואג שלא להפריע את אגר.
    3. להגביר את ה-DNA על ידי ה-PCR ולהפעיל 5 μL של ה-PCR ג'ל כדי להבטיח הגברה יהיה מוצלח, דואגת שלא להפריע בגדר תא בתחתית הצינורית.

6. הגבלת העיכול של המושבה PCR

  1. להוסיף 10 μL של PCR המוצר (מטפל לא כדי לא להפריע בגדר תא בתחתית הצינורית), 3 μL של המאגר, 1 μL של אנזים הגבלה μL 16 של H2O, ואז דגירה על פי הוראות היצרן ולפתור ב ג'ל agarose לזיהוי הנכ ct הגנום עריכות.
    הערה: אנזים הגבלה בשימוש כאן הוא אתר מקודד בתבנית תיקון מסוים של TPK2 .

7. שמירת זנים

  1. לגדול תרבות לילה מן המושבות אושרו על ידי עיכול הגבלה YPD + אורי ב 30 º C.
  2. להוסיף 1 מ"ל של תרבות ושל 1 מ"ל של 50% גליצרול (מביא את הריכוז הסופי של גליצרול 25%) צינור מתאים לאחסון ב-80 מעלות צלזיוס.
  3. לאחסן שיבוטים הנכון ב- 80 ° c
    הערה: זנים נכונה ניתן לאחסן ב-80 מעלות צלזיוס במשך שנים רבות.

8. הסרה של Natr סמן

  1. פס transformant נכונה על גבי שמרים peptone מלטוז (YPMaltose) (2% מלטוז).
  2. לאסוף מושבה מהצלחת מרוחים ואת התרבות השמרים במשך 48 שעות ב 30 ° C במלטוז 20 g/L YPMaltose נוזלי.
  3. צלחת 200-400 לתאים YPMaltose 20 g/L מלטוז, דגירה ב 30 מעלות צלזיוס במשך 24 שעות ביממה.
  4. לשכפל את הצלחת אל YPMaltose ל- YPMaltose 200 μg/mL nat.
  5. דגירה ב 30 מעלות צלזיוס במשך 24 שעות ביממה.
    הערה: מושבות זה כבר לא גדלים על YPMaltose 200 μg/mL nourseothricin אבל לגדול על YPMaltose איבדו את סמןr Nat (CaCAS9) , מדריך ה-RNA.
  6. לשמור על זנים שאיבדה את Natr סמן (CaCAS9) , מדריך RNA כפי שנעשה צעדים 7.1-7.3.
    הערה: פלסמיד דומה, pV1393, משתמשת את SAP2 לעומת promotor MAL2 . גידול על YCB – BSA יניעו flippase והסרה של Natr אם pV1393 משמש לעריכת ג'ין.

Representative Results

רצפים של מדריך RNAs ותבניות תיקון שכוונו אלביקנס ג TPK2, יחידת משנה קטליטי של קינאז c-AMP, עוצבו על פי ההנחיות שהוצעו לעיל. רצפים מוצגים (טבלה 1, איור 1). מדריך RNAs משובטים לתוך CaCas9 ביטוי וקטורים, cotransformed עם תיקון תבנית בפראי-סוג ג אלביקנס. אתר עיכול הגבלה לסביבהרי ו stop codons בתבנית תיקון לשבש את האתר פאם ולהקל ואיתור המוטציות הנכון (איור 1). Transformants היו קווצות שער עבור אחת המושבות, הוקרן על ידי המושבה PCR והגבלה לעיכול עבור התאגדות של תבנית תיקון (איור 2). עיכול הגבלה במהירות מבדיל פראי-סוג של מוטציה רצפים.

Oligonucleotide השם Oligonucleotide הרצף
מדריך קדמי Primer_3 ATTTGgggtgaactatttgttcgccG
מדריך הפוכה Primer_3 AAAACggcgaacaaatagttcacccג
תיקון תבנית Forward_3 tcagcaatatcagcaacaatttcaacaaccgcagcaacaactttatTAAGAATTCggcga
תיקון תבנית Reverse_3 attttgtccagtttgggctgcagcagggtgaactatttgttcgccGAATTCTTAataaag
פריימר לפנים סימון ttaaagaaacttcacatcaccaag
פריימר הסימון הפוך actttgatagcataatatctaccat
רצף פריימר ggcatagctgaaacttcggccc

טבלה 1: רשימת נוקלאוטידים oligo נעשה שימוש במחקר זה. אתרי הוסיף כי השיבוט למטרות הם מהוונות, מודגשים ברצף פריימר מדריך. רצפים בתבנית תיקון זה מוטציה של הדנ א הם מהוונות, מודגשים.

Figure 1
איור 1 : תרשים של מדריך עיצוב תבנית הרנ א ותיקון. Labeling (א) על כל רצפי פאם נוקלאוטידים הראשון 100 של TPK2. פאם רצף 3 (PAM_3) מודגשת, כפי שהוא הרצף השתמשו במחקר זה. (B) מדריך RNA עיצוב באמצעות PAM_3. 20 תחל הבסיס מעוצבת באמצעות SnapGene הם באותיות קטנות וכחול. בסיסים נוספים הדרושים עבור שכפול הם אותיות רישיות וירוק שמוצג היסט. (ג) תיקון תחל תבנית להוסיף TAA stop codon ואתר לסביבהRI מוכנסים לתוך TPK2 קריאה מסגרת. DNA השונה מזה של הרצף פראי-סוג הוא אדום, אותיות רישיות. (ד) דוגמה איך מדריך מיועד לחוף חיובית עם ה-DNA באמצעות PAM_4. (E) תרשים סכמטי של pV1524 לאחר שיבוט של מדריך RNA, מערכת העיכול עם KpnI ו- SacI. Neut5L-5' ו- Neut5L-3' כוון וקטור לאתר Neut5L הגנום אלביקנס ג . CaENO1p הוא promotor שמניע ביטוי ממוטב שמרים CaCas9. Natr הוא בקלטת ההתנגדות nourseothricin. CaSNR52p הוא promotor נהיגה מדריך RNA ביטוי (sgRNA). אתרי והשפלתם ביקע, משולבות מחדש של-ידי flippase (FLP) להסיר את הקלטת CRISPR על ביטוי flippase. שרטוט דומה (E) פורסם על ידי וייאס et al. 11. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 2
איור 2 : מבוא ואישור של stop codon ו EcoRI הגבלת לאתר TPK2. תחל המשמש עבור הגברה מפורטים בטבלה 1. רצפים פראי-סוג של מוטציה מוצגים להלן הג'ל. איור זה השתנה מ וייאס et al.11. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 3
איור 3 : קריקטורה תיאור של תבניות תיקון שתפיק (א) למחיקות והוספות (ב). גריי מקפים (לה) מתארים לא נוכח תחל תבנית תיקון להתערב רצפים. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Discussion

ג אלביקנס CRISPR עריכות ביעילות את הגנום אלביקנס ג . pV1524 מקודד שמרים codon ממוטבים לקריאה Cas9, והוא מתוכנן כך חוקרים יכולים בקלות לשבט מדריך RNA רצפים במורד הזרם של ה CaSNR52 יזם (איור 1)11. והקפדה כי רק עותק אחד של הרצף מדריך נשלטה לתוך וקטורים ביטוי CaCas9 על ידי רצף, כפי עותקים נוספים לעכב הגנום עריכה. אם עותקים מרובים של המדריך הציג באופן עקבי, אחד צריך להנמיך את הריכוז של המדריך annealed בשימוש מצדו. וקטור של פרוטוקול המתואר לאפשר פילוח של כל גן ג אלביקנס . למרות אלביקנס ג דיפלואידי, רק שינוי אחד נדרש כדי למקד שני אללים של גנים. יתר על כן, הטבע תהליכית של עריכה הגנום CRISPR-CaCas9 מאפשר לחוקרים למקד חברים מרובים משפחות גנים. משפחות גנים רבים כגון aspartyl מופרשים פרוטאזות (לטמבלים) ו agglutinin כמו רצף חלבונים (ALS) חשובים עבור אלביקנס ג התקפה אלימה. עריכת הגנום CRISPR יקל על חקירה של משפחות גנים אלה.

הפרוטוקולים שתוארו לעיל להציג stop codon מסגרת קריאה פתוחה, והתוצאה היא המקבילה פנוטיפי של null (איור 2). מגוון רחב של מסעה גנטיים יכולים להתבצע על ידי שינוי התבנית תיקון. שטויות missense, מוטציות שקטות יכול להיות מוכנס דרך רקומבינציה עם תבנית תיקון המתאים. התאגדות של אתר ההגבלה מייעל את ההקרנה transformant, כמו אלה ללא חייב להיות מוקרן על ידי קביעת רצף12,13. בנוסף, CRISPR אלביקנס ג מאפשר החוקרים להפיק הוספות ומחיקות, שהופך אותו מערכת אידיאלית כדי להוסיף תגיות זיקה, לבצע חילופי promotor ולהפיק הסתרה (איור 3). הקרנה של transformants הנכון עבור מוטציות אלה היא יותר מפרך, כפי שנדרש רצף את פעולות העריכה כדי לאשר ההתאגדות הנכון של תבניות תיקון. יתר על כן, תספיג דנ א עשוי להיות נחוץ להבטיח עותקים נוספים של הגן לא מוכנס במקומות נוספים הגנום. הדרישה של אתר הגולה פאם מציב מגבלות קלה על האזורים בגנום זה ניתן לפלח. ההתפתחות של מערכות CRISPR אלטרנטיביות המשתמשות nucleases אלטרנטיביות כגון Cpf1 או וריאציות על Cas9 המערכת יש/רצון להקל הרבה מגבלות אלה14. לידע החוקרים בשלב זה, מערכות אלו לא טרם הוחלו על ג אלביקנס.

מערכת CRISPR תיאר בפרוטוקול לעיל פותחה כזה כי זה יכול להיות מיושם במגוון רחב של מינים, כולל האפייה, Naumouozyma castellii, פתוגניות קנדידה glabrata11 . שינוי ועריכה יעיל של אלה שמרים דורשת שינויים קלים בפרוטוקול המתוארים, אך המסגרת לעריכה אלה הגנום החלופי דומה לזה שתואר אלביקנס ג12. יתר על כן, שמרים מספקים מנגנון מצוין לפתח הגנום עריכת נהלים. בשמרים, כאשר ADE2 הוא מוטציה, הקדמה מסלול ביוסינטזה אדנין מצטבר, מפנה את התאים האדומים. פנוטיפ בקלות הנצפה הזה מאפשר חוקרים כדי לזהות תאים הערוך ולפתור במהירות הגנום עריכת פרוטוקולים. בשילוב עם הכלים ביולוגיה מולקולרית נרחב זמין עבור פטריות, פרוטוקולים עבור עריכת לאינספור מינים שמרים כבר מפותחת15,16. יישום רחב טכנולוגי העריכה הגנום פטריות יש פוטנציאל לפגיעה משמעותית מגוון רחב של דיסציפלינות מדעיות.

CRISPR השתפרה באופן משמעותי את היעילות של הגנום הנדסה ב ג אלביקנס, אך עד היום CRISPR לא שימש לביצוע מסכים רחב הגנום ב ג אלביקנס. פרוטוקולים הנוכחי דורש תבנית תיקון להציג מוטציות, כמו הסוף nonhomologous מצטרף אלביקנס ג מסלול יעילה12. הדור של תיקון תבנית oligos עבור כל ג'ין הוא חסם משמעותי ביצוע של מסכי הגנום כולו. המפגש של עלויות קיטון לסינתזת DNA התקדמויות טכנולוגיות CRISPR יגרום להתפתחות של מחיקת ספריות יותר ריאלי. למשל, הביטוי של תבנית תיקון של וקטור CaCas9 סוללת את הדרך לפיתוח של ספריות בר-קיימא פלסמיד המכוונות לכל ג'ין11. יתר על כן, ארעית פרוטוקולים CRISPR קנדידה שאינם מצריכים CaCas9 ביטוי וקטור לשלב לתוך הגנום אלביקנס ג כבר מפותחת17. בנוסף, עלה מדריך ביטוי בעליות הגנום עריכת יעילות18. אלה אחרים התקדמויות טכנולוגיות CRISPR, הם חיוניים להתפתחות של הגנום כולו מסכי אלביקנס ג19,20,21,22.

הגנום אלביקנס ג דיפלואידי, אבל A ו B אללים אינם תמיד זהים5. כזה heterozygosity מספקת אתגרים והזדמנויות. אם אדם מכוון למטרה שני אללים, יש להשתמש באתר פאם, מדריך רצף, לבין תבנית תיקון אשר יפעל על שני עותקים של הגן. עם זאת, בהתאם פולימורפיזמים נוקלאוטיד יחיד נוכח הגן, C.albicans CRISPR המערכת מאפשרת חוקרים למטרה של אלל יחיד. דיוק כזה יש הפוטנציאל לאפשר חוקרים לבחון הבדלים תפקודיים בין אללים. מיקוד מסוים אללים חייב להיעשות בזהירות, כמו אובדן הטרוזיגוטיות (LOH)-אלל או של כרומוזום שלם נצפתה. בשעת עריכת יחיד אלביקנס ג אללים, חייבים לבחון רצפי דנ א סמוכים כדי לקבוע אם שיבוט שמרה על פרופיל הסנ פ דיפלואידי. בנוסף, את המטרה תופעות נמוכה למדי עבור CRISPR אלביקנס ג , אך רצף הגנום כולו יכול להיחשב עבור זנים מפתח.

Disclosures

המחברים אין לחשוף.

Acknowledgments

המחברים תודה ד ר מר הנרי Mager קריאה והערות מועילות על כתב היד. עבודה זו נתמכה על ידי אוניברסיטת המדינה של הכדור מעבדה הפעלה קרנות, NIH-1R15AI130950-01 כדי D.A.B.

Materials

Name Company Catalog Number Comments
Chemicals
Agar BD Bacto 214010
agarose amresco 0710-500G
Ampicillan Sigma-Aldrich A9518
Bacto Peptone BD Bacto 211677
Bsmb1 New England Biolabs R0580L
Calf intestinal phosphatase (CIP) New England Biolabs M0290L
Cut Smart Buffer New England Biolabs B7204S
Dimethyl Sulfoxide (DMSO) Sigma-Aldrich D8418
dNTPs New England Biolabs N0447L
Ethylenediaminetetraacetic acid (EDTA) Sigma-Aldrich 3609
Glacial Acetic Acid Sigma-Aldrich 2810000ACS
Glucose BDH VWR analytical BDH9230
Glycerol Sigma-Aldrich 49767
Kpn1 New England Biolabs R3142L
LB-Medium MP 3002-032
Lithium Acetate Sigma-Aldrich 517992
L-Tryptophan Sigma-Aldrich T0254
Maltose Sigma-Aldrich M5885
Molecular Biology Water Sigma-Aldrich W4502
NEB3.1 Buffer New England Biolabs B7203S
Nourseothricin Werner Bioagents 74667
Poly(ethylene glycol) PEG 3350 Sigma-Aldrich P4338
Sac1 New England Biolabs R3156L
Salmon Sperm DNA Invitrogen AM9680
T4 Polynucleotide kinase New England Biolabs M0201S
T4 DNA ligase New England Biolabs M0202L
Taq polymerase New England Biolabs M0267X
Tris HCl Sigma-Aldrich T3253
uridine Sigma-Aldrich U3750
Yeast Extract BD Bacto 212750
Equipment
Electrophoresis Appartus
Incubator
Microcentifuge
PCR machine
Replica Plating Apparatus
Rollerdrum or shaker
Spectrophotometer
Waterbath

DOWNLOAD MATERIALS LIST

References

  1. Pfaller, M. A., Diekema, D. J. Epidemiology of invasive candidiasis: a persistent public health problem. Clinincal Microbiology Review. 20, (1), 133-163 (2007).
  2. Magill, S. S., et al. Multistate point-prevalence survey of health care-associated infections. New England Journal of Medicine. 370, (13), 1198-1208 (2014).
  3. Wisplinghoff, H., et al. Nosocomial bloodstream infections in US hospitals: analysis of 24,179 cases from a prospective nationwide surveillance study. Clinical Infectious Disease. 39, (3), 309-317 (2004).
  4. Jones, T., et al. The diploid genome sequence of Candida albicans. Proceedings of the National Academy of Science USA. 101, (19), 7329-7334 (2004).
  5. Muzzey, D., Schwartz, K., Weissman, J. S., Sherlock, G. Assembly of a phased diploid Candida albicans genome facilitates allele-specific measurements and provides a simple model for repeat and indel structure. Genome Biology. 14, (9), (2013).
  6. Morschhauser, J., Michel, S., Staib, P. Sequential gene disruption in Candida albicans by FLP-mediated site-specific recombination. Molecular Microbiololgy. 32, (3), 547-556 (1999).
  7. Lau, V., Davie, J. R. The discovery and development of the CRISPR system in applications in genome manipulation. Biochemistry and Cell Biology. 95, (2), 203-210 (2017).
  8. Doudna, J. A., Charpentier, E. Genome editing. The new frontier of genome engineering with CRISPR-Cas9. Science. 346, (6213), 1258096 (2014).
  9. Anders, C., Niewoehner, O., Duerst, A., Jinek, M. Structural basis of PAM-dependent target DNA recognition by the Cas9 endonuclease. Nature. 513, (7519), 569-573 (2014).
  10. Reardon, S. Welcome to the CRISPR zoo. Nature. 531, (7593), 160-163 (2016).
  11. Vyas, V. K., et al. New CRISPR Mutagenesis Strategies Reveal Variation in Repair Mechanisms among Fungi. mSphere. 3, (2), (2018).
  12. Vyas, V. K., Barrasa, M. I., Fink, G. R. A Candida albicans CRISPR system permits genetic engineering of essential genes and gene families. Science Advances. 1, (3), e1500248 (2015).
  13. Evans, B. A., et al. Restriction digest screening facilitates efficient detection of site-directed mutations introduced by CRISPR in C. albicans UME6. PeerJ. 6, e4920 (2018).
  14. Kim, D., et al. Genome-wide analysis reveals specificities of Cpf1 endonucleases in human cells. Nature Biotechnology. 34, (8), 863-868 (2016).
  15. Tarasava, K., Oh, E. J., Eckert, C. A., Gill, R. T. CRISPR-enabled tools for engineering microbial genomes and phenotypes. Biotechnology Journal. e1700586 (2018).
  16. Raschmanova, H., Weninger, A., Glieder, A., Kovar, K., Vogl, T. Implementing CRISPR-Cas technologies in conventional and non-conventional yeasts: Current state and future prospects. Biotechnology Advances. 36, (3), 641-665 (2018).
  17. Min, K., Ichikawa, Y., Woolford, C. A., Mitchell, A. P. Candida albicans Gene Deletion with a Transient CRISPR-Cas9 System. mSphere. 1, (3), (2016).
  18. Ng, H., Dean, N. Dramatic Improvement of CRISPR/Cas9 Editing in Candida albicans by Increased Single Guide RNA Expression. mSphere. 2, (2), (2017).
  19. Huang, M. Y., Woolford, C. A., Mitchell, A. P. Rapid Gene Concatenation for Genetic Rescue of Multigene Mutants in Candida albicans. mSphere. 3, (2), (2018).
  20. Shapiro, R. S., et al. A CRISPR-Cas9-based gene drive platform for genetic interaction analysis in Candida albicans. Nature Microbiology. 3, (1), 73-82 (2018).
  21. Grahl, N., Demers, E. G., Crocker, A. W., Hogan, D. A. Use of RNA-Protein Complexes for Genome Editing in Non-albicans Candida Species. mSphere. 2, (3), (2017).
  22. Nguyen, N., Quail, M. M. F., Hernday, A. D. An Efficient, Rapid, and Recyclable System for CRISPR-Mediated Genome Editing in Candida albicans. mSphere. 2, (2), (2017).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics