Candida albicans 인간의 곰 팡이 병원 체 게놈 편집 CRISPR 중재

* These authors contributed equally
Genetics
 

Summary

Candida albicans 의 효율적인 게놈 엔지니어링 pathogenesis 및 치료제의 개발을 이해 하는 데 중요 하다. 여기, 우리는 신속 하 고 정확 하 게 편집 C. albicans 게놈 CRISPR를 사용 하 여 프로토콜을 설명. 프로토콜에는 다양 한 유전 수정 점 돌연변이, 삽입, 삭제 등을 소개 하는 조사 수 있습니다.

Cite this Article

Copy Citation | Download Citations

Evans, B. A., Pickerill, E. S., Vyas, V. K., Bernstein, D. A. CRISPR-mediated Genome Editing of the Human Fungal Pathogen Candida albicans. J. Vis. Exp. (141), e58764, doi:10.3791/58764 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

이 메서드는 2 중 인간 곰 팡이 병원 체의 효율적인 CRISPR 중재 게놈 편집에 대해 설명 합니다 Candida albicans. Cas9, 요구 한다 CRISPR 중재 게놈 C. albicans 에서 편집 RNA, 안내 및 서식 파일을 복구. 플라스 미드 표현 하는 효 모 코 돈 최적화 Cas9 (CaCas9)가 생성 되었습니다. 시퀀스를 안내는 팸에서 직접 본 사이트 (NGG) Cas9 식 벡터에 복제 됩니다. 복구 서식 파일 다음 뇌관 연장에서 시험관에의해 이루어집니다. C. albicans 에 복구 템플릿 및 벡터의 cotransformation 게놈 편집 이끌어 낸다. 사용 된 복구 서식 파일에 따라 조사 뉴클레오티드 변경, 삽입 또는 삭제를 발생할 수 있습니다. C. albicans 는 2 중으로 변이 만들어집니다, 유전자의 두 대립 유전자에는 A 및 B 대립 유전자에 Snp를 대상으로 가이드와 함께 방해 또는 복구 템플릿 법인 항구 하지 않습니다. 모든 가족 구성원에 적합 한 보존된 시퀀스 있으면 소스의 유전자 가족 동시에 편집할 수 있습니다. C. albicans CRISPR 시스템 설명 FRT 사이트에 의해 형벌 이다 고 flippase를 인코딩합니다. Flippase의 유도 따라 항생제 마커 (CaCas9) 및 가이드 RNA 게놈에서 제거 됩니다. 게놈을 연속을 편집을 수행 하기 위해 탐정 수 있습니다. C. albicans CRISPR 강력한 곰 팡이 유전 공학 도구 이며 사소한 변경 설명된 프로토콜에 다른 균 종 등 C. glabrata, N. castellii, S. cerevisiae의 수정을 허용 합니다.

Introduction

Candida albicans 는 가장 널리 퍼진 인간 곰 팡이 병원 체1,2,3. C. albicans 및 포유류 분자 생물학의 이해 차이 항진균 치료제의 다음 세대의 개발에 매우 중요 하다. 신속 하 고 정확 하 게 유전자 조작 C. albicans수를 조사 해야 합니다.

C. albicans 의 유전자 조작 역사적으로 도전 하고있다. C. albicans 플라스 미드를 유지 하지 않습니다, 그리고 따라서 모든 구조는 게놈으로 통합 되어야 합니다. 또한, C. albicans 는 2 중; 따라서, 유전자 밖으로 노크 하거나 소개 하는 돌연변이, 그것 중요 한 경우 되도록 복사본 모두 변경된4되었습니다. 또한, 일부 C. albicans loci heterozygous, 더 복잡 한 유전 심문5있습니다. C. albicans유전자 조작 동종 재결합6의 여러 라운드를 수행 하는 일반적입니다. 그러나, 게놈 및 힘 드는 구조 개발의 2 중 특성이 만들었습니다이 잠재적으로 지루한 과정을, 특히 여러 변경이 필요한 경우. 이러한 제한 및 C. albicans 의 의학 중요성 조사 C. albicans 게놈 보다 쉽게 조작할 수 있도록 새로운 기술 개발을 요구 한다.

정기적으로 interspaced 짧은 구조 반복 (CRISPR) 클러스터-중재 게놈 편집 연구자는 게놈의 순서를 변경할 수 있는 강력한 도구입니다. CRISPR 세 가지 구성 요소가 필요 합니다: 대상 DNA 앞 1) Cas9 nuclease 2) 20 시퀀스, 관심의 대상으로 Cas9 가이드 RNA를 기반 및 3) 복구 템플릿 DNA 분열 사이트를 복구 하 고 만들어진된 변경7, 통합 하는 8. 일단 가이드 제공 대상 게놈 시퀀스 Cas9, Cas9 protospacer 인접 한 모티브 (PAM) 시퀀스 (NGG) 필요 직접 DNA9다니엘 가이드 시퀀스의 업스트림. 모두 20 기본 가이드 및 팸 시퀀스 특이성을 표적으로 하기의 높은 학위를 제공 하 고 제한 대상에서 분열.

CRISPR 시스템은 다양 한 생물의 게놈 편집과 다양 한 문제10태 클을 설계 되었습니다. 여기에 설명 된 관심사의 C. albicans 유전자를 편집 하기 위해 유연 하 고 효율적인 CRISPR 프로토콜이입니다. 실험 번역 종료를 일으키는 원인이 되는 유전자를 정지 codon를 소개 합니다. 다른 편집 도입 수리 템플릿에 따라 만들 수 있습니다. 조각 nourseothricin (Natr)로 표시 된 효 모에 포함 된 코 돈 최적화 된 Cas9 (CaCas9)과 가이드 RNA 중립 사이트에서 C. albicans 게놈으로 통합 됩니다. Cotransformation 복구 서식 파일 인코딩을 원하는 돌연변이와 동종 재결합 하 고 효율적인 게놈 편집 분열의 복구 이끌어 낸다. 아래에서 설명 하는 것은 TPK2, 하지만 모든 C. albicans 오픈 프레임 대상으로 지정할 수 여러 번 CRISPR에 의해 읽기의 편집 이다. CRISPR 시스템 FRT 사이트에 의해 형벌 이다 고 flippase CaCas9 식 플라스 미드에 인코딩된의 유도 의해 C. albicans 게놈에서 제거할 수 있습니다. C. albicans CRISPR 시스템에는 정확 하 고 빠르게 편집 C. albicans 게놈11,12조사 수 있습니다.

Protocol

1. 식별 및 가이드 RNA 시퀀스의 복제

  1. 가이드 RNA 시퀀스의 식별
    1. 5'-NGG-3 식별 ' 정지 codon 삽입 되는 위치에 가까운 팸 시퀀스. (그림 1A) 표시 된 팸 시퀀스 모두에서 발견 된다 TPK2 (그림 1A)의 처음 100 기본적인 쌍.
      참고: Http://osf.io/ARDTX 11,12C. albicans 열려있는 독서 프레임을 대상으로 하는 가이드 시퀀스를 찾을 수 있습니다.
    2. 20 있을 것입니다 앞으로 가이드 Primer_3 시퀀스 식별 기지 직접 상류 NGG 팸의 사이트 및 5 개 이상 포함 되지 것입니다 연속에서 Ts. 직접 기초에 왼쪽 상류 끌어서 NGG의 커서 20 기초, 다음 추가 뇌관 뇌관 탭에 클릭.
    3. 앞으로 가이드 시퀀스에 보완 될 것입니다 반대로 가이드 Primer_3 시퀀스를 식별 합니다.
      참고: PAM_3를 사용 하는 가이드는 표시 (그림 1B).
    4. 뇌관을 마우스 오른쪽 단추로 클릭 하 고 "뇌관 데이터 복사" 선택 합니다. 텍스트 편집 프로그램에는 시퀀스를 붙여 넣습니다.
  2. (표 1, 그림 1B) 복제를 촉진 하기 위하여 앞으로 반전 가이드 oligos에 걸리다 시퀀스를 추가 합니다.
    1. 구입 하기 전에 앞으로 가이드 Primer_3의 5' 끝에 뉴클레오티드 순서 ATTTG를 추가 합니다.
    2. 구입 하기 전에 앞으로 가이드 Primer_3의 3' 끝에 G를 추가 합니다.
    3. 구입 하기 전에 반전 가이드 Primer_3의 5' 끝에 뉴클레오티드 순서 AAAAC를 추가 합니다.
    4. 구입 하기 전에 반전 가이드 Primer_3의 3' 끝에 C를 추가 합니다.
  3. BsmBI와 다이제스트 CaCas9 식 벡터 pV1524입니다.
    참고: pV1524 포함는 암 피 실린 (앰프r)과 nourseothricin (Natr). Cas9 C. albicans코 돈 최적화 되었습니다.
    1. 추가 하 여 플라스 미드를 소화: pv1524, 버퍼 x 10의 5 μ, BsmBI, 그리고 H의 1 μ의 2 μ g을 1.5 mL 튜브에 50 μ2O. 20 분 55 ° C에서 품 어 (또는, pv1524 Esp3I, 37 ° c.에 BsmBI의 isoschizomer와 함께 15 분 소화)
    2. 실내 온도 (RT) 고 스핀 30에 대 한 튜브의 하단에 응축을가지고 2,348 x g 에서 s. 1.4 단계로 진행 또는-20 ° c.에 소화 플라스 미드를 저장
  4. 인산 가수분해 효소 소화 등뼈를 취급 합니다.
    1. 종 아리 장 인산 가수분해 효소 (CIP)의 1 μ 소화 혼합물에 추가 하 고 1 시간 동안 37 ° C에서 품 어.
    2. 상업적으로 사용할 수 있는 중 합 효소 연쇄 반응 (PCR) 정화 키트 (키트와 함께 제공 하는 지침)를 사용 하 여 소화 플라스 미드 정화 하 고 차입 버퍼 (EB)의 30 μ에 elute.
  5. Phosphorylate 고 anneal 가이드 Primer_3 앞으로 반전 가이드 Primer_3.
    1. 추가 앞으로 100 μ M의 0.5 μ 가이드 Primer_3, 100 μ M의 0.5 μ 가이드 Primer_3 역, 10 x T4 리가 버퍼의 5 μ, T4 polynucleotide 키의 1 μ 및 H2O를 PCR 튜브의 43 μ.
    2. 두 번째 PCR 튜브에서 10 x T4 리가 버퍼의 5 μ, T4 polynucleotide 키의 1 μ 그리고 분자 생물학 급 H2O의 44 μ를 추가 합니다.
      참고: 이 부정적인 제어 될 것입니다.
    3. 다음 5 분 동안 95 ° C에서 30 분 동안 37 ° C에서 thermocycler에서 반응 혼합물을 품 어.
    4. Anneal에 16 ° C에 느린 경사로 속도에 혼합물을 냉각, oligos. 다음 4 ° c.에 단련 된 oligo 혼합물을 놓습니다
  6. 1.4.3 단계에서 소화 pv1524로 단련된 oligos를 선.
    1. PCR 튜브에 다음을 추가: 10 x T4 리가 버퍼, T4 DNA 리가의 0.5 μ, 단련된 올리고 믹스의 0.5 μ 1 μ CIP 처리 소화 플라스 미드 (20-40 ng) 및 H2O 10 μ 총 볼륨을 정화.
    2. PCR 튜브에 다음을 추가: 10 x T4 리가 버퍼, T4 DNA 리가의 0.5 μ의 1 μ 소화 CIP 처리 정화 벡터 (20-40 ng), 부정적인 컨트롤 혼합, 그리고 H2O 10 μ 총 볼륨 최대의 1 μ.
    3. 다음 10 분 동안 65 ° C에서 30 분, 16 ° C에서 thermocycler 두 튜브를 품 어 다음 25 ° c에 냉각
  7. 결 찰 혼합물의 5 μ를 화학적으로 유능한 병원 성 대장균 DH5α 표준 열 충격 변환 프로토콜을 사용 하 여 변환 합니다. LB 앰프/Nat 미디어 (200 μ g/mL 앰프, 50 μ g/mL Nat) 선택 합니다.
    참고: PV1524와 더블 선택 미디어에 파생 상품 선택 실패 Nat/CaCas9/가이드 모듈의 손실 FLP/FRT 절단 박테리아에 의해 발생 합니다.
  8. Miniprep에 의해 4 개의 transformants에서 플라스 미드를 정화 하 고 시퀀싱 뇌관 (표 1) 삽입 시퀀스를 시퀀스.
    참고: 4 transformants를 시퀀싱 하는 시간의 대부분 적어도 1 정확한 복제를 식별 하기 위해 충분 하다.
  9. 잘라-20 ° c.에 사이트 BsmBI에 한 번 복제 가이드 RNA 순서 있는 플라스 미드를 저장

2. 설계 및 수리 서식 파일의 생성

  1. 유전자 시퀀스에 정지 codon 및 제한 소화 사이트 (그림 1C표 1) 인코딩 뉴클레오티드를 추가 하 여 정지 codon를 삽입 합니다.
    참고: 삽입 팸 시퀀스를 중단 됩니다.
    참고: 제한 소화 사이트 클론 (그림 1C)의 효율적인 심사를 용이 하 게 복구 템플릿 순서로 포함 됩니다.
  2. 10 돌연변이 만들 수의 하류 기초 끌어서 커서 60 기초 상류 왼쪽 클릭 하십시오. 추가 뇌관 뇌관 탭에서 왼쪽 클릭 하십시오. 이 복구 템플릿 Forward_3을 추가 합니다. 10 돌연변이 만들 수의 상류 기초 끌어서 커서 60 기초 하류 왼쪽 클릭 하십시오. 추가 뇌관 뇌관 탭에서 왼쪽 클릭 하십시오. 복구 템플릿 리버스 3 추가 됩니다. (그림 1C)
  3. 뇌관 연장 수리 서식 파일 생성을 수행 합니다.
    1. 100 μ m 복구 템플릿 앞으로 뇌관, 100 μ m 복구 템플릿 리버스 뇌관의 1.2 μ, deoxynucleotide 된 (dNTPs)의 6 μ의 1.2 μ 추가 (총 농도 40 m m), 6 버퍼, Taq 중 합 효소 (3 단위)의 0.6 μ H2O 4 PCR의 각각의 45 μ의 μ 튜브입니다.
    2. 뇌관 연장 PCR의 20과 30 라운드 사이의 실행을 수행 합니다. 예제 확장 조건: 95 ° C에서 2 분 (30 s 95 ° C, 50 ° C, 68 ° C에서 1 분에 1 분에서) x 34, 68 ° c.에서 10 분
    3. 1.5 mL 튜브에 모든 4 PCR 튜브의 내용을 결합 하 고 PCR 정화 키트를 사용 하 여 H2o.의 50 μ에서 제품을 정화
    4. 뇌관 연장 제품 260에서 흡 광도 결정 하 여 충분 한 DNA를 확인을 quantitate nm.
      참고: 뇌관 연장 제품의 전형적인 마지막 농도 ~ 200-300 ng / µ L.

3. C. albicans 복구 템플릿 및 플라스 미드의 변화

  1. 테/리튬 아세테이트를 확인 합니다.
    1. 믹스 10 mM Tris Cl, 1 mM EDTA, 100 m m 리튬 아세테이트, 그리고 H2O (모든 재고 솔루션 pH 7.5) 50 mL 전체 볼륨을 달성 하기 위해.
  2. 플레이트 만들기
    1. 믹스 40% 말뚝 3350, 100 m m 리튬 아세테이트, 10 mM Tris Cl, 1 mM EDTA, H2O (모든 재고 솔루션 pH 7.5) 50 mL 전체 볼륨을 달성 하기 위해.
  3. 소화 단계 1.9에서에서 올바르게 복제는 플라스 미드.
    1. 플라스 미드, 10 x 버퍼의 4 µ L, 10 mg/mL 소 혈 청 알 부 민 (BSA)의 0.4 µ L의 10 μ g, 0.5 µ L KpnI의, SacI의 0.5 µ L 및 H20 ~ 40 µ L 총 1.5 mL 튜브에 볼륨. 37 ° C에서 하룻밤 (그림 1D) 품 어.
  4. C. albicans SC5314, 야생-타입 prototroph OD600 6 미만 이상적으로 0.27 m m Uridine (YPD + Uri), 보충 효 모 펩 포도 당에서 25 ° C에서의 숙박 문화를 성장.
    1. 2,348 x g 에 5 분 동안 회전 하 여 5 세600 단위 변환 당 세포의 작은 고 5 세600 100 µ L 테/리튬 아세테이트에 수송과 셀의 중단.
  5. 나열 된 순서로 1.5 mL 튜브에 다음을 추가: 단계 3.4.1, 삶은 고 빠른 냉각 연어 정자 DNA (10mg/mL), 플라스 미드 소화 단계의 3.3.1, 순화 된 복구 서식 4) 6 µ g의 3) 10 µ g의 2) 40 µ L에서에서 세포의 1) 100 µ L 및 5) 접시의 1 mL.
  6. 나열 된 순서로 1.5 mL 튜브에 다음을 추가: 셀의 1) 100 µ L, 삶은 고 빠른 냉각 연어 정자 DNA (10mg/mL), 3) H2O 볼륨 단계 3.5 판의 4) 1 mL에서 DNA 변형의 동등의 2) 40 µ L.
    참고:이 부정적인 제어 될 것입니다.
  7. Pipetting으로 변환을 부드럽게 혼합 하 고 하룻밤 25 ° C에서 품 어 보자.
  8. 열 44 ° C 물 목욕 25 분에 배치 하 여 세포를 충격.
  9. 벤치탑 원심 분리기에서 2,348 x g 에 5 분 동안 회전 시키십시오 하 고 표면에 뜨는 접시 혼합물을 제거 합니다. 2,348 x g에서 YPD + Uri와 다시 5 분 동안 원심 분리기의 1 mL을 추가 하 여 한 번 세척.
  10. 0.1 ml YPD + Uri의 세포를 중단 하 고 하룻밤 롤러 드럼 또는 25 ° C에서 셰이 커에 품 어.
  11. 플레이트와 200 μ g/mL nourseothricin YPD + Uri에. 식민지는 2-5 일에 표시 됩니다.

4입니다. 단일 식민지를 위한 줄무늬

  1. 분기에는 100 x 15 mm 페 트리 접시를 분할 하 고 각 사분면을 라벨.
    1. 사분면의 긴 측면에 걸쳐 메 마른이 쑤 시 게 또는 주걱와 행진 변환 접시에서 식민지 중 하나를 터치 합니다.
    2. 무 균 기술을 사용 하 여 단일 식민지를 위한 streak 고 30 ° C에서 2 일 동안 성장 식민지.

5입니다. 식민지 PCR

  1. 앞으로 체크 뇌관 (FCP) ~ 200 기지 상류의 쌍 도입 된 제한 사이트 및 역방향 체크 뇌관 (RCP) ~ 300 자료 쌍 하류 디자인.
    1. FCP, RCP, 내 중 합 효소 (ExTaq 1.5 단위)의 0.3 μ, dNTPs의 3 μ의 0.3 μ의 0.3 μ 추가 (총 농도 40 m m), 3 ExTaq 버퍼, 그리고 H2O 1.5 mL 튜브에의 23 μ의 μ.
      참고: 0.5 μ/반응 디 메 틸 sulfoxide (DMSO)의 추가 PCR 효율을 개선할 수 있습니다.
    2. 4.1.2 단계에서 단계 5.1.1, P10 피 펫 팁을 사용 하 고는 agar를 방해 하지 않도록 주의 복용에서 혼합물 단일 효 모 식민지의 0.25 μ를 추가 합니다.
    3. PCR에 의하여 DNA를 증폭 하 고 증폭 성공, 튜브의 아래쪽에 셀 펠 렛을 방해 하지 않도록 주의 복용 되도록 젤에 PCR의 5 μ를 실행 합니다.

6. 식민지 PCR의 제한 소화

  1. 추가 10 μ의 PCR 제품 (튜브의 아래쪽에 셀 펠 렛을 방해 하지 않기로 돌), 버퍼의 3 μ, 제한 효소, 1 μ H2O, 16 μ 그리고 제조업체의 지침에 따라 품 어 리를 식별 하는 agarose 젤에 해결 ct 게놈 편집입니다.
    참고: 여기에서 사용 하는 제한 효소 TPK2 특정 복구 서식 파일에 인코딩 하는 사이트입니다.

7. 종자 저장

  1. 성장 제한 소화 YPD + Uri에서 30 ° c.에 의해 확인 된 식민지에서 숙박 문화
  2. 스토리지-80 ° c.에 대 한 적합 한 튜브를 1 mL의 문화 및 (글리세롤의 최종 농도 25%를 데리고) 50% 글리세롤의 1 mL을 추가
  3. -80 ° c.에 정확한 복제품을 저장하시오
    참고: 올바른 종자 몇 년 동안-80 ° C에 저장할 수 있습니다.

8. Natr 마커 제거

  1. 효 모 펩 糖 (YPMaltose)에 올바른 transformant 행진 (2% 糖).
  2. 질주 된 접시에서 식민지를 선택 하 고 액체 YPMaltose 20 g/L 맥 아당에서 30 ° C에서 48 h에 대 한 효 모 문화.
  3. YPMaltose 20 g/L 맥 아당에 200-400 셀 접시 하 고 24 시간에 30 ° C에서 품 어.
  4. YPMaltose 및 YPMaltose 200 μ g/mL 자연과학에 접시를 복제
  5. 24 h 30 ° C에서 품 어.
    참고: 더 이상 YPMaltose 200 μ g/mL nourseothricin에 성장 하지만 YPMaltose에 성장 식민지 Natr 마커 (CaCAS9)을 잃 었 하 고 RNA를 안내 합니다.
  6. Natr 마커 (CaCAS9) 및 가이드 RNA 7.1-7.3 단계에서 다 잃은 긴장을 저장 합니다.
    참고: 유사한 플라스 미드, pV1393, SAP2 MAL2 promotor 반대로 사용합니다. YCB-BSA에 성장 pV1393 유전자 편집에 사용 되는 경우 flippase 및 Natr 의 제거를 유발 한다.

Representative Results

시퀀스의 가이드 C. albicans TPK2, 대상 복구 서식 파일 및 RNAs c 앰프 니 촉매 소 단위, 위에 제안한 지침에 따라 설계 되었습니다. 시퀀스 (표 1, 그림 1)에 표시 됩니다. 가이드 RNAs CaCas9 식 벡터에 복제 되었고 야생-타입 C. albicans서식 파일 복구 cotransformed. 에코리 제한 소화 사이트 복구 서식 파일에서 정지 codons 팸 사이트 중단 및 올바른 돌연변이 (그림 1)에 대 한 심사를 용이 하 게. Transformants 단일 식민지를 위한 줄무늬 그리고 복구 템플릿 (그림 2)의 설립에 대 한 식민지 PCR 및 제한 소화에 의해 상영. 제한 소화는 신속 하 게 돌연변이 시퀀스에서 야생-타입을 구분합니다.

Oligonucleotide 이름 Oligonucleotide 시퀀스
앞으로 가이드 Primer_3 ATTTGgggtgaactatttgttcgccG
역 가이드 Primer_3 AAAACggcgaacaaatagttcacccC
복구 템플릿 Forward_3 tcagcaatatcagcaacaatttcaacaaccgcagcaacaactttatTAAGAATTCggcga
복구 템플릿 Reverse_3 attttgtccagtttgggctgcagcagggtgaactatttgttcgccGAATTCTTAataaag
앞으로 체크 뇌관 ttaaagaaacttcacatcaccaag
역방향 확인 뇌관 actttgatagcataatatctaccat
시퀀싱 뇌관 ggcatagctgaaacttcggccc

표 1:이 연구에 사용 하는 올리고 뉴클레오티드의 목록. 사이트 목적 복제에 대 한 추가 대문자로 하 고 가이드 뇌관에 굵게 시퀀스. 게놈 DNA를 변형 복구 서식 파일에서 시퀀스는 대문자로 하 고 굵게.

Figure 1
그림 1 : 가이드 RNA 및 복구 템플릿 디자인의 다이어그램. (A)의 TPK2의 처음 100 개의 뉴클레오티드의 모든 PAM 시퀀스 표시. 이 연구에서 사용 하는 순서는 팸 시퀀스 3 (PAM_3) 강조 표시 됩니다. (B) 가이드 RNA PAM_3를 사용 하 여 디자인 합니다. SnapGene를 사용 하 여 디자인의 기본 뇌관 20 개는 소문자 파란색입니다. 복제에 필요한 추가 기지 오프셋 표시와 녹색 있습니다. (C) 수리 TAA 정지 codon 및 에코리 사이트 템플릿 뇌관 TPK2 독서 프레임에 삽입 됩니다. 야생-타입 시퀀스와 다른 DNA는 빨간색과 대문자. (D) 예 방법 가이드는 PAM_4를 사용 하 여 DNA의 긍정적인 물가에 설계 되었습니다. (E) 가이드 RNA와 KpnI와 SacI 소화의 복제 후 pV1524의 회로도. Neut5L-5'-Neut5L-3' C. albicans 게놈에 있는 Neut5L 사이트에 벡터를 대상. CaENO1p promotor를 누 룩에 최적화 된 CaCas9의 표현 이다. Natr nourseothricin 저항 카세트입니다. CaSNR52p promotor 운전 가이드 RNA 식 (sgRNA) 이다. FRT 사이트 죽 습 고 flippase (FLP) flippase 식 시 CRISPR 카세트를 제거 하 여 재결합. 회로도 (E)와 유사한 Vyas 에 의해 출판 되었다. 11. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 2
그림 2 : 소개 및 정지 codon 그리고 에코리 제한 사이트 TPK2를 확인. 뇌관 증폭에 사용 되는 표 1에 나열 됩니다. 야생-타입 및 돌연변이 시퀀스 젤 아래 표시 됩니다. 이 그림은 Vyas 외.11에서 수정 되었습니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 3
그림 3 : 삭제 (A) 및 (B) 삽입 생성 복구 템플릿 설명 만화. 회색 (A)에 대시 묘사 중간 시퀀스 복구 템플릿 뇌관에는 없음. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Discussion

C. albicans CRISPR C. albicans 게놈에 효율적으로 편집합니다. pV1524 인코딩 효 모 코 돈 최적화 Cas9 하 고 조사 쉽게 CaSNR52 발기인 (그림 1)11의 하류 가이드 RNA 시퀀스를 복제할 수 있다 그런 설계 되었습니다. 그것은 그 가이드 시퀀스의 단일 복사본만 복제 되었습니다 CaCas9 식 벡터에 시퀀싱에 의해 여분의 사본 게놈 편집 방해 것으로 보장 해야 합니다. 가이드의 여러 복사본을 지속적으로 도입 하는 경우 한 결 찰에 사용 된 단련된 가이드의 농도가 낮은 해야 합니다. 벡터 및 프로토콜 설명 어떤 C. albicans 유전자의 수 있습니다. C. albicans 는 2 중만 단일 변환은 유전자의 두 대립 유전자를 대상으로 필요 합니다. 또한, CRISPR-CaCas9 게놈 편집의 processive 자연 유전자 가족의 여러 구성원을 대상으로 연구를 수 있습니다. 분 비 aspartyl 프로 테아 제 (얼 간) 및 agglutinin와 같은 시퀀스 단백질 (ALS) 등 많은 유전자 가족은 C. albicans 독성에 대 한 중요 합니다. CRISPR를 편집 하는 게놈이 유전자 가족의 조사를 촉진할 것 이다.

위에서 설명한 프로토콜 null (그림 2)에 해당 하는 phenotypic 결과 열려있는 독서 프레임 정지 codon를 소개 합니다. 다양 한 유전 교대 복구 서식 파일을 변경 하 여 만들 수 있습니다. 넌센스, missense, 및 침묵 돌연변이 재결합 적절 한 수리 템플릿을 통해 삽입할 수 있습니다. 제한 사이트의 합리화 transformant 심사로 그 없이12,13시퀀싱 하 여 검사 해야 합니다. 또한, C. albicans CRISPR 선호도 태그를 삽입 하 고 promotor 스왑, 수행 하 고, 녹아웃 (그림 3)를 생성 하는 이상적인 시스템을 만드는 연구자를 삽입 및 삭제, 생성에 있습니다. 이 돌연변이 대 한 올바른 transformants에 대 한 심사 복구 서식 파일의 올바른 결합을 확인 하는 편집을 시퀀싱 하는 데 필요한 만큼 더 힘 드는입니다. 또한, 남부 오 유전자의 복사본을 추가로 게놈에 추가 위치에 삽입 되지 않습니다 보장 하기 위해 필요할 수 있습니다. NGG 팸 사이트의 요구 사항을 대상으로 지정할 수 있는 게놈의 지역에 약간의 제한 배치 합니다. 대체 nucleases Cpf1 등을 사용 하는 대체 CRISPR 시스템의 개발 또는 유사 시스템 가지고/지 Cas9에 많은 이러한 제한14경감. 이 이번에 수 사관의 지식, 이러한 시스템 하지 아직 적용 되었을 C. albicans에.

그런 종 Saccharomyces cerevisiae, 인간의 병원 체 Candida glabrata11, Naumouozyma castellii, 등의 다양 한 적용 될 수 있습니다 위의 프로토콜에서 설명 하는 CRISPR 시스템 개발 되었습니다. . 변환 및 효율적인 편집이 효 설명된 프로토콜에 약간의 변화를 필요 하지만 이러한 대체 게놈을 편집 하기 위해 프레임 워크는 C. albicans12에 대 한 설명에 비슷해. 또한, 효 모 게놈 편집 하는 절차를 개발 하는 우수한 메커니즘을 제공 합니다. 효 모, ADE2 돌연변이 때 아데닌 생 합성 통로에 전조 축적, 붉은 세포를 선회. 이 쉽게 관찰 표현 형 조사가 편집된 셀을 식별 하 고 신속 하 게 게놈 프로토콜 편집을 문제 해결을 수 있습니다. 버섯에 사용할 수 있는 광범위 한 분자 생물학 도구 상자와 함께, 수많은 효 모 종 편집에 대 한 프로토콜 개발된15,16되었습니다. 곰 팡이에 게놈 편집 기술의 광범위 한 응용 프로그램 다양 한 과학 분야에 큰 영향을 미칠 가능성이 있다.

CRISPR는 크게 C. albicans에 게놈 엔지니어링의 효율성 개선 하지만 CRISPR까지 사용 되지 않은 C. albicans의 게놈 넓은 스크린을 수행 하. C. albicans 에 통로 합류 nonhomologous 끝은 비효율적인12현재 프로토콜 변이 소개 하는 수리 서식 파일이 필요 합니다. 모든 유전자에 대 한 복구 템플릿 oligos의 세대는 게놈 넓은 스크린의 실행에 상당한 장벽이 다. DNA 합성 및 CRISPR 기술 발전의 감소 비용의 합류 더 실현 가능한 삭제 라이브러리의 개발을 하게된다. 예를 들어, CaCas9 벡터에서 복구 서식 파일의 표현 대상으로 모든 유전자11지속 가능한 플라스 미드 라이브러리의 개발에 대 한 방법을 포장 한다. 또한, CaCas9 식 벡터 C. albicans 게놈으로 통합을 요구 하지 않는 과도 Candida CRISPR 프로토콜 개발된17되었습니다. 또한, 증가 효율18편집 가이드 식 증가 게놈. 이들은, 그리고 CRISPR 기술, 다른 진보는 C. albicans19,20,,2122게놈 넓은 스크린의 발전에 중요 한.

C. albicans 게놈은 2 중, A 및 B 대립 유전자는 항상 동일한5. 이러한 heterozygosity 모두 도전과 기회를 제공합니다. 만약 한 두 대립 유전자를 대상 하는 것을 목표로, 팸 사이트, 가이드 시퀀스, 및 유전자의 두 복사본에 행동 한다 복구 서식 파일을 사용 해야 합니다. 그러나, C.albicans CRISPR 시스템 단일 대립 유전자를 대상으로 조사 수 있습니다 단 하나 뉴클레오티드 동 질 다 상 유전자에 존재에 따라. 이러한 정밀 검사 대립 유전자 사이의 기능적 차이를 조사 수 있도록 가능성이 있다. 특정 대립 유전자를 대상으로 수행 되어야 합니다 신중 하 게, 손실 heterozygosity (LOH) 대립 유전자 또는 전체 염색체의 관찰 되었습니다. 단일 C. albicans 편집할 때 대립 유전자, 하나의 클론은 2 중 SNP 프로필을 유지 하는 경우 확인 하려면 인접 한 DNA 시퀀스를 검사 해야 합니다. 또한, 오프 대상 효과 C. albicans CRISPR에 대 한 매우 낮은 하지만 전체 게놈 시퀀싱 주요 변종에 대 한 간주 될 수 있습니다.

Disclosures

저자는 공개 없다.

Acknowledgments

저자는 독서에 대 한 박사 Gennifer Mager 감사 및 원고에 대 한 유용한 의견. 이 작품 볼 주립 대학교 실험실 시작 자금 및 NIH-1R15AI130950-01 D.A.B.에 의해 지원 되었다

Materials

Name Company Catalog Number Comments
Chemicals
Agar BD Bacto 214010
agarose amresco 0710-500G
Ampicillan Sigma-Aldrich A9518
Bacto Peptone BD Bacto 211677
Bsmb1 New England Biolabs R0580L
Calf intestinal phosphatase (CIP) New England Biolabs M0290L
Cut Smart Buffer New England Biolabs B7204S
Dimethyl Sulfoxide (DMSO) Sigma-Aldrich D8418
dNTPs New England Biolabs N0447L
Ethylenediaminetetraacetic acid (EDTA) Sigma-Aldrich 3609
Glacial Acetic Acid Sigma-Aldrich 2810000ACS
Glucose BDH VWR analytical BDH9230
Glycerol Sigma-Aldrich 49767
Kpn1 New England Biolabs R3142L
LB-Medium MP 3002-032
Lithium Acetate Sigma-Aldrich 517992
L-Tryptophan Sigma-Aldrich T0254
Maltose Sigma-Aldrich M5885
Molecular Biology Water Sigma-Aldrich W4502
NEB3.1 Buffer New England Biolabs B7203S
Nourseothricin Werner Bioagents 74667
Poly(ethylene glycol) PEG 3350 Sigma-Aldrich P4338
Sac1 New England Biolabs R3156L
Salmon Sperm DNA Invitrogen AM9680
T4 Polynucleotide kinase New England Biolabs M0201S
T4 DNA ligase New England Biolabs M0202L
Taq polymerase New England Biolabs M0267X
Tris HCl Sigma-Aldrich T3253
uridine Sigma-Aldrich U3750
Yeast Extract BD Bacto 212750
Equipment
Electrophoresis Appartus
Incubator
Microcentifuge
PCR machine
Replica Plating Apparatus
Rollerdrum or shaker
Spectrophotometer
Waterbath

DOWNLOAD MATERIALS LIST

References

  1. Pfaller, M. A., Diekema, D. J. Epidemiology of invasive candidiasis: a persistent public health problem. Clinincal Microbiology Review. 20, (1), 133-163 (2007).
  2. Magill, S. S., et al. Multistate point-prevalence survey of health care-associated infections. New England Journal of Medicine. 370, (13), 1198-1208 (2014).
  3. Wisplinghoff, H., et al. Nosocomial bloodstream infections in US hospitals: analysis of 24,179 cases from a prospective nationwide surveillance study. Clinical Infectious Disease. 39, (3), 309-317 (2004).
  4. Jones, T., et al. The diploid genome sequence of Candida albicans. Proceedings of the National Academy of Science USA. 101, (19), 7329-7334 (2004).
  5. Muzzey, D., Schwartz, K., Weissman, J. S., Sherlock, G. Assembly of a phased diploid Candida albicans genome facilitates allele-specific measurements and provides a simple model for repeat and indel structure. Genome Biology. 14, (9), (2013).
  6. Morschhauser, J., Michel, S., Staib, P. Sequential gene disruption in Candida albicans by FLP-mediated site-specific recombination. Molecular Microbiololgy. 32, (3), 547-556 (1999).
  7. Lau, V., Davie, J. R. The discovery and development of the CRISPR system in applications in genome manipulation. Biochemistry and Cell Biology. 95, (2), 203-210 (2017).
  8. Doudna, J. A., Charpentier, E. Genome editing. The new frontier of genome engineering with CRISPR-Cas9. Science. 346, (6213), 1258096 (2014).
  9. Anders, C., Niewoehner, O., Duerst, A., Jinek, M. Structural basis of PAM-dependent target DNA recognition by the Cas9 endonuclease. Nature. 513, (7519), 569-573 (2014).
  10. Reardon, S. Welcome to the CRISPR zoo. Nature. 531, (7593), 160-163 (2016).
  11. Vyas, V. K., et al. New CRISPR Mutagenesis Strategies Reveal Variation in Repair Mechanisms among Fungi. mSphere. 3, (2), (2018).
  12. Vyas, V. K., Barrasa, M. I., Fink, G. R. A Candida albicans CRISPR system permits genetic engineering of essential genes and gene families. Science Advances. 1, (3), e1500248 (2015).
  13. Evans, B. A., et al. Restriction digest screening facilitates efficient detection of site-directed mutations introduced by CRISPR in C. albicans UME6. PeerJ. 6, e4920 (2018).
  14. Kim, D., et al. Genome-wide analysis reveals specificities of Cpf1 endonucleases in human cells. Nature Biotechnology. 34, (8), 863-868 (2016).
  15. Tarasava, K., Oh, E. J., Eckert, C. A., Gill, R. T. CRISPR-enabled tools for engineering microbial genomes and phenotypes. Biotechnology Journal. e1700586 (2018).
  16. Raschmanova, H., Weninger, A., Glieder, A., Kovar, K., Vogl, T. Implementing CRISPR-Cas technologies in conventional and non-conventional yeasts: Current state and future prospects. Biotechnology Advances. 36, (3), 641-665 (2018).
  17. Min, K., Ichikawa, Y., Woolford, C. A., Mitchell, A. P. Candida albicans Gene Deletion with a Transient CRISPR-Cas9 System. mSphere. 1, (3), (2016).
  18. Ng, H., Dean, N. Dramatic Improvement of CRISPR/Cas9 Editing in Candida albicans by Increased Single Guide RNA Expression. mSphere. 2, (2), (2017).
  19. Huang, M. Y., Woolford, C. A., Mitchell, A. P. Rapid Gene Concatenation for Genetic Rescue of Multigene Mutants in Candida albicans. mSphere. 3, (2), (2018).
  20. Shapiro, R. S., et al. A CRISPR-Cas9-based gene drive platform for genetic interaction analysis in Candida albicans. Nature Microbiology. 3, (1), 73-82 (2018).
  21. Grahl, N., Demers, E. G., Crocker, A. W., Hogan, D. A. Use of RNA-Protein Complexes for Genome Editing in Non-albicans Candida Species. mSphere. 2, (3), (2017).
  22. Nguyen, N., Quail, M. M. F., Hernday, A. D. An Efficient, Rapid, and Recyclable System for CRISPR-Mediated Genome Editing in Candida albicans. mSphere. 2, (2), (2017).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics