CRISPR-mediated génome édition du champignon pathogène humain Candida albicans

* These authors contributed equally
Genetics
 

Summary

Ingénierie efficace génome de Candida albicans est essentielle à la compréhension de la pathogenèse et le développement d’agents thérapeutiques. Ici, nous avons décrit un protocole pour rapidement et avec précision, modifier le génome de c. albicans en utilisant CRISPR. Le protocole permet aux enquêteurs d’introduire une grande variété de modifications génétiques, y compris les mutations ponctuelles, les insertions et suppressions.

Cite this Article

Copy Citation | Download Citations

Evans, B. A., Pickerill, E. S., Vyas, V. K., Bernstein, D. A. CRISPR-mediated Genome Editing of the Human Fungal Pathogen Candida albicans. J. Vis. Exp. (141), e58764, doi:10.3791/58764 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Cette méthode décrit le CRISPR médiée par génome un montage efficace du champignon pathogène humain diploïde Candida albicans. Génome induite par CRISPR édition chez c. albicans nécessite Cas9, guide RNA et modèle de rechange. Un plasmide exprimant un codon de levure optimisé Cas9 (CaCas9) a été généré. Guide des séquences directement en amont d’un PAM site (NGG) sont clonés dans le vecteur d’expression de Cas9. Un modèle de réparation puis fait par primer extension in vitro. Co-transformation de la modèle de la réparation et le vecteur en c. albicans conduit à la modification du génome. Selon le modèle de réparation utilisé, l’enquêteur peut introduire des modifications de nucléotides, les insertions ou les suppressions. Comme c. albicans est diploïde, les mutations sont faites dans les deux allèles d’un gène, pourvu que les allèles A et B héberger pas SNP qui interfère avec guide de ciblage ou réparer l’incorporation de modèle. Familles de gènes multimembre modifiables en parallèle si les séquences conservées appropriés existent dans tous les membres de la famille. Le système de c. albicans CRISPR décrit est flanqué de sites FRT et code flippase. Lors de l’induction de flippase, le marqueur antibiotique (CaCas9) et le guide RNA sont retirés du génome. Cela permet à l’enquêteur d’effectuer des modifications ultérieures dans le génome. C. albicans CRISPR est un outil puissant fongique le génie génétique, et des modifications mineures aux protocoles décrits permettent la modification des autres espèces de champignons dont c. glabrata, N. castellii et S. cerevisiae.

Introduction

Candida albicans est le plus répandu champignon pathogène humain1,2,3. Comprendre les différences entre c. albicans et de la biologie moléculaire chez les mammifères est essentielle au développement de la prochaine génération de médicaments antifongiques. Cela nécessite des enquêteurs pour pouvoir rapidement et avec précision génétiquement manipuler c. albicans.

La manipulation génétique de c. albicans a toujours été difficile. C. albicans ne maintient pas de plasmides, donc toutes les constructions doivent être incorporées dans le génome. En outre, c. albicans est diploïde ; par conséquent, lorsque assommant un gène ou présentant une mutation, il est important de veiller à ce que les deux copies ont été changé4. En outre, certains loci de c. albicans est hétérozygotes, complique encore interrogatoire génétique5. Pour manipuler génétiquement c. albicans, il est courant d’effectuer plusieurs tours de recombinaison homologue6. Toutefois, la nature diploïde du génome et du développement de la construction laborieuse ont fait cela un processus potentiellement pénible, surtout si plusieurs modifications sont nécessaires. Ces limitations et l’importance médicale de c. albicans exigent l’élaboration de nouvelles technologies qui permettent aux chercheurs de manipuler plus facilement le génome de c. albicans .

Cluster régulièrement dois‑je courtes palindromes répétitions (CRISPR)-édition de génome de médiation est un outil puissant qui permet aux chercheurs de modifier la séquence du génome. CRISPR nécessite trois éléments : 1) la nucléase Cas9 qui Clive l’ADN cible, 2) 20 guide RNA qui cible Cas9 à la séquence d’intérêt de base et 3) réparer l’ADN de modèle qui répare le site de clivage et intègre le changement prévu7, 8. Une fois le guide apporte Cas9 à la séquence du génome de cible, Cas9 nécessite une séquence de motif adjacent (PAM) de protospacer (NGG) directement en amont de la séquence de guide pour cliver l' ADN9. L’obligation pour le guide de base 20 et séquences de PAM offre un haut degré de spécificité de ciblage et limite le clivage hors cible.

CRISPR systèmes ont été conçus pour modifier le génome d’un ensemble diversifié d’organismes et de s’attaquer à une grande variété de problèmes10. Décrit ici est un protocole CRISPR souple et efficace pour l’édition d’un gène de c. albicans d’intérêt. L’expérience introduit un codon stop à un gène, provoquant la résiliation de la traduction. Autres modifications peuvent être effectuées selon le modèle de réparation qui est introduit. Un fragment marqué avec nourséothricine (Natr) contenant des levures codon optimisé Cas9 (CaCas9) et un guide RNA est intégré dans le génome de c. albicans dans une ville neutre. Co-transformation avec le modèle de réparation codant la mutation désirée conduit à réparer du clivage par recombinaison homologue et la modification du génome efficace. Décrites ci-dessous, c’est l’édition de TPK2, mais tous les c. albicans lecture trames peuvent être ciblés plusieurs fois par CRISPR ouvert. Le système CRISPR est flanqué des sites FRT et peut être enlevé du génome de c. albicans par induction de flippase codé sur le plasmide d’expression CaCas9. Le système de c. albicans CRISPR permet aux enquêteurs avec précision et rapidement modifier le c. albicans génome11,12.

Protocol

1. identification et le clonage de Guide RNA Sequence

  1. Identification du guide séquence d’ARN
    1. Identifier un 5'-NGG-3' séquence PAM proche où sera inséré le codon stop. (Figure 1 a) Étiqueté PAM séquences se trouvent tous dans les 100 premières paires de base d' TPK2 (Figure 1 a).
      Remarque : On trouvera des séquences Guide ciblant chaque cadre de lecture ouvert de c. albicans à http://osf.io/ARDTX 11,12.
    2. Identifier la séquence avant Guide Primer_3, qui sera la 20 bases directement en amont d’un PAM NGG du site et ne contiendra pas plus de 5 Ts de suite. Clic gauche sur la base directement en amont de la NGG et faites glisser le curseur 20 bases, puis cliquez sur l’onglet de l’apprêt pour ajouter l’apprêt.
    3. Identifier la séquence inverse Guide Primer_3, qui sera le complément de la séquence de Guide vers l’avant.
      Remarque : Montrés sont des guides qui utilisent PAM_3 (Figure 1 b).
    4. Faites un clic droit l’apprêt et sélectionnez « Copier les données d’apprêt ». Collez les séquences dans un programme d’édition de texte.
  2. Ajouter des séquences de surplomb d’oligos Forward et Reverse Guide afin de faciliter le clonage (tableau 1, Figure 1 b).
    1. Ajouter la séquence de nucléotides ATTTG à l’extrémité 5' de la Primer_3 de Guide vers l’avant avant d’acheter.
    2. Ajouter G à l’extrémité 3' de la Primer_3 de Guide vers l’avant avant d’acheter.
    3. Ajouter la séquence de nucléotides AAAAC à l’extrémité 5' de la Primer_3 Guide inverser avant d’acheter.
    4. Ajouter C à l’extrémité 3' de la Primer_3 Guide inverser avant d’acheter.
  3. CaCas9 Digest expression vector pV1524 avec BsmBI.
    Remarque : pV1524 contient l’ampicilline (Ampr) et marqueurs de nourséothricine (Natr). Cas9 a été optimisé pour c. albicanscodon.
    1. Digérer le plasmide en ajoutant : 2 μg de pv1524, 5 μL de mémoire tampon 10 x, 1 μL de BsmBI et H2O à 50 μL dans un tube de 1,5 mL. Incuber à 55 ° C pendant 20 min. (vous pouvez également digérer pv1524 pendant 15 min avec Esp3I, un isochizomère de BsmBI, à 37 ° C.)
    2. Refroidir à température ambiante (RT) et un essorage pendant 30 s à 2 348 x g faire condensation au fond du tube. Passez à l’étape 1.4 ou stocker le plasmide digéré à-20 ° C.
  4. La phosphatase-traiter l’épine dorsale digérée.
    1. Ajouter 1 μL de phosphatase intestinale de veau (CIP) au mélange digestion et incuber à 37 ° C pendant 1 h.
    2. Purifier le plasmide digéré à l’aide d’un kit de purification de réaction en chaîne (PCR) polymérase commercialement disponibles (instructions fournies avec le kit) et il éluer à 30 μL de tampon d’élution (EB).
  5. Phosphoryler et recuire avant Guide Primer_3 et Reverse Guide Primer_3.
    1. Ajouter 0,5 μL de 100 μM avant Guide Primer_3, 0,5 μL de 100 μM Reverse Guide Primer_3, 5 μL de tampon de ligase 10 x T4, 1 μL de T4 polynucléotide kinase et 43 μL de H2O dans un tube PCR.
    2. Ajouter 5 μl de tampon de ligase 10 x T4 1 μL de T4 polynucléotide kinase et 44 μL de la biologie moléculaire-grade H2O dans un deuxième tube PCR.
      Remarque : Cela servira de témoin négatif.
    3. Incuber les mélanges réactionnels dans un thermocycleur à 37 ° C pendant 30 min, puis à 95 ° C pendant 5 min.
    4. Laisser refroidir le mélange au plus faible taux de rampe à 16 ° C à recuire le, oligos. Puis placer le mélange de recuit oligo à 4 ° C.
  6. Ligaturer les oligos recuit en pv1524 digérée de l’étape 1.4.3.
    1. Ajoutez le code suivant dans un tube PCR : 1 μL de tampon de ligase 10 x T4, 0,5 μL de T4 DNA ligase, 0,5 μL de recuit oligo mix, digéré imprégnées de CIP purifiée plasmide (20 – 40 ng) et H2O pour un volume total de 10 μL.
    2. Ajoutez le code suivant dans un tube PCR : 1 μL de tampon de ligase 10 x T4, 0,5 μL de T4 DNA ligase, digéré imprégnées de CIP purifiée vector (20 – 40 ng), 1 μL de mélange témoin négatif et H2O jusqu'à un volume total de 10 μL.
    3. Incuber les tubes dans un thermocycleur à 16 ° C, pendant 30 min, puis à 65 ° C pendant 10 min, puis laisser refroidir à 25 ° C.
  7. 5 μL des mélanges ligature à transformer chimiquement compétent Escherichia coli DH5α à l’aide d’un protocole de transformation de choc thermique standard. Sélectionnez sur médias LB Amp/Nat (200 μg/mL Amp, Nat de 50 μg/mL).
    Remarque : Échec de sélectionner pV1524 et ses dérivés sur support double sélection entraînera la perte du module Nat/CaCas9/guide par excision FLP/FRT chez les bactéries.
  8. Purifier les plasmides de quatre transformants par miniprep et séquence de la séquence d’insertion d’amorce de séquençage (tableau 1).
    Remarque : La plupart du temps, séquençage des 4 transformants suffit à identifier au moins 1 clone correct.
  9. Enregistrer des plasmides qui ont la séquence d’ARN guide clonée une seule fois dans le BsmBI couper site à-20 ° C.

2. conception et génération du modèle de réparation

  1. Insérer un codon d’arrêt en cliquant dans la séquence du gène et en ajoutant les nucléotides codant un codon et restriction digestion site unique (Figure 1tableau 1).
    Remarque : L’insertion perturbera la séquence de PAM.
    Remarque : Un site de restriction digestion figureront dans la séquence de modèle de réparation afin de faciliter le dépistage efficace des clones (Figure 1).
  2. Faites un clic gauche 10 bases en aval d’où la mutation se fera et faites glisser que le curseur 60 bases en amont. Cliquez sur l’onglet de l’apprêt pour ajouter l’apprêt. Ceci ajoutera réparation modèle Forward_3. Faites un clic gauche 10 bases en amont du où la mutation se fera et faites glisser que le curseur 60 bases en aval. Cliquez sur l’onglet de l’apprêt pour ajouter l’apprêt. Ceci ajoutera réparation modèle Reverse 3. (Figure 1)
  3. Effectuer l’extension d’amorce pour générer le modèle de la réparation.
    1. Ajouter 1,2 μL de 100 μm réparation modèle avant l’apprêt, 1,2 μL de 100 μm réparation modèle inverse l’apprêt, 6 μL de désoxyribonucléosides triphosphate (dNTPs) (concentration totale 40 mM), 6 μL de tampon, 0,6 μL de la Taq polymérase (3 unités) et 45 μL d’H2O à chacun de la PCR 4 tubes.
    2. Effectuer extension d’amorce de la course entre 20 et 30 cycles de PCR. Conditions d’extension exemple : 2 min à 95 ° C, (30 s à 95 ° C, 1 min à 50 ° C, 1 min à 68 ° C) x 34, 10 min à 68 ° C.
    3. Combiner le contenu de tous les 4 tubes PCR dans un tube de 1,5 mL et une trousse de purification du PCR permet de purifier les produits dans 50 μL d’H2O.
    4. Doser les produits d’extension apprêt pour assurer suffisamment ADN en déterminant l’absorbance à 260 nm.
      Remarque : Concentration finale typique du produit extension amorce est ~ 200 à 300 ng/µL.

3. transformation c. albicans avec modèle de réparation et de plasmide

  1. Faire l’acétate TE/lithium.
    1. Mix 10 mM Tris-Cl, EDTA 1 mM, acétate de lithium de 100 mM et H2O (pH de solution-mère tous les 7,5) pour atteindre le volume total de 50 mL.
  2. Faire plaque
    1. Mélanger 40 % PEG 3350, acétate de lithium de 100 mM, 10 mM Tris-Cl, 1 mM EDTA et H2O (pH de solution-mère tous les 7,5) pour atteindre le volume total de 50 mL.
  3. Digérer les plasmides clonés correctement de l’étape 1.9.
    1. Ajouter 10 μg de plasmide, 4 µL de tampon de 10 x, 0,4 µL de 10 mg/mL d’albumine sérique bovine (BSA), 0,5 µL de KpnI 0,5 µL de SacI et H20 à 40 µL volume dans un tube de 1,5 mL total. Incuber à 37 ° C pendant la nuit (Figure 1).
  4. Développer une culture durant la nuit de c. albicans SC5314, prototroph sauvage, à 25 ° C en dextrose peptone de levure additionné de 0,27 mM Uridine (DPJ + Uri), idéalement à OD600 inférieure à 6.
    1. 5 unités de600 OD de cellules par transformation de granule par rotation pendant 5 min à 2 348 x g et suspendre les 5 OD600 cellules granulés en acétate de TE/lithium 100 µL.
  5. Ajoutez le code suivant dans un tube de 1,5 mL dans l’ordre indiqué : 1) 100 µL de cellules de l’étape 3.4.1, 2) 40 µL de sperme de saumon bouilli et refroidi à l’accès rapide 3) 10 µg de la digestion de plasmide d’étape 3.3.1, 4) 6 µg de modèle purifiée de réparation de l’ADN (10 mg/mL), et 5) 1 mL de plaque.
  6. Ajoutez le code suivant dans un tube de 1,5 mL dans l’ordre indiqué : 1) 100 µL de cellules, 2) 40 µL de sperme de saumon cuit et refroidi à l’accès rapide ADN (10 mg/mL), 3) H2O volume égale à celle de l’ADN transformant en étape 3.5 et 4) 1 mL de plaque.
    Note : Ceci servira de témoin négatif.
  7. Mélanger les transformations de pipetage et laisser incuber à 25 ° C durant la nuit.
  8. Chaleur de choc les cellules en les plaçant dans un bain-marie à 44 ° C pendant 25 min.
  9. Tournez pendant 5 min à 2 348 x g dans une centrifugeuse de paillasse et enlever la plaque du mélange surnageant. Laver une fois en ajoutant 1 mL de la DPJ + Uri et centrifuger à nouveau pendant 5 min à 2 348 x g.
  10. Suspendre les cellules de 0,1 mL de la DPJ + Uri et incuber pendant la nuit sur un tambour de rouleau ou le shaker à 25 ° C.
  11. Plaque sur la DPJ + Uri avec 200 μg/mL nourséothricine. Colonies apparaîtra dans 2 à 5 jours.

4. les stries des Colonies individuelles

  1. Diviser un 100 x 15 mm boîte de Pétri en quarts et étiqueter chaque quadrant.
    1. Appuyer sur l’une des colonies de la plaque de transformation avec un cure-dent stérile ou l’applicateur et l’ensemencer à travers le côté le plus long du quadrant.
    2. Ensemencer des colonies individuelles à l’aide d’une technique aseptique et laisser les colonies à se développer à 30 ° C pendant 2 jours.

5. PCR sur colonie

  1. Concevoir les chèque avant apprêt (PCF) ~ 200 paires de bases en amont du site de restriction qui a été introduit et les contre-vérification (RCP) ~ 300 base paires d’amorces en aval.
    1. Ajouter 0,3 μL du PCF, 0,3 μL de RCP, 0,3 μL de polymérase thermostable (ExTaq 1,5 unités), 3 μL des dNTPs (concentration totale 40 mM), 3 μL de tampon de ExTaq et 23 μL de H2O dans un tube de 1,5 mL.
      Remarque : Addition de 0,5 μL/réaction diméthylsulfoxyde (DMSO) peut améliorer l’efficacité PCR.
    2. Ajouter 0,25 μL d’une colonie de levures unique de l’étape 4.1.2 au mélange de l’étape 5.1.1, à l’aide d’une pointe de pipette P10 et prenant soin de ne pas pour déranger l’agar.
    3. Amplifier l’ADN par PCR et exécuter 5 μL de la PCR sur un gel pour amplification soit couronnée de succès, prenant soin de ne pas pour déranger le culot au fond du tube.

6. restriction Digestion des PCR sur colonie

  1. Ajouter 10 μL de PCR produit (veillant à ne pour ne pas déranger le culot au fond du tube), 3 μL de tampon, 1 μl d’enzyme de restriction et 16 μL de H2O, puis incuber conformément aux instructions du fabricant et résoudre sur gel d’agarose pour identifier le corre modifications du génome de CT.
    Remarque : L’enzyme de restriction utilisé ici est le site codé dans le modèle de réparation spécifique TPK2 .

7. enregistrement des souches

  1. Développer une culture d’une nuit ou plus des colonies, qui ont été confirmés par la digestion de restriction dans la DPJ + Uri à 30 ° C.
  2. Ajouter 1 mL de la culture et 1 mL de glycérol à 50 % (ce qui porte la concentration finale de glycérol à 25 %) dans un tube adapté pour le stockage à-80 ° C.
  3. Stocker les clones correctes à-80 ° C.
    Remarque : Souches correctes peuvent être stockées à-80 ° C pendant de nombreuses années.

8. suppression de Natr marqueur

  1. Strie transformant correct sur maltose de peptone de levure (YPMaltose) (2 % maltose).
  2. Prélever une colonie sur la plaque striée et la culture de la levure pendant 48 h à 30 ° C dans le liquide YPMaltose maltose de 20 g/L.
  3. Plaque 200 – 400 cellules maltose de 20 g/L de YPMaltose et incuber à 30 ° C pendant 24 h.
  4. Répliquer la plaque sur YPMaltose et YPMaltose 200 μg/mL NAT.
  5. Incuber à 30 ° C pendant 24 h.
    Remarque : Les colonies qui n’est plus poussent sur YPMaltose 200 μg/mL nourséothricine, mais poussent sur YPMaltose ont perdu le marqueur der Nat (CaCAS9) et guident RNA.
  6. Sauver les souches qui ont perdu la Natr marqueur (CaCAS9) et guide d’ARN comme fait par étapes 7.1 à 7.3.
    Remarque : Un plasmide similaire, pV1393, utilise le SAP2 par opposition à un promoteur MAL2 . Croissance sur YCB-BSA induira flippase et l’enlèvement des Natr si pV1393 est utilisé pour la modification des gènes.

Representative Results

Séquences de guide RNAs et réparation des modèles qui ciblent de c. albicans TPK2, une sous-unité catalytique de la kinase c-AMP, ont été conçus selon les lignes directrices suggérées ci-dessus. Séquences sont indiqués en (tableau 1, Figure 1). ARN guide ont été clonés dans des vecteurs d’expression CaCas9 et cotransformés avec modèle de réparation dans sauvage c. albicans. Un site de digestion de restriction EcoRI et codons stop dans le modèle de réparation perturbent le site PAM et facilitent le dépistage des mutants corrects (Figure 1). Transformants ont ensemence colonies individuelles et projeté par digestion PCR et restriction de colonie pour l’incorporation du modèle réparation (Figure 2). Digestion de restriction distingue rapidement sauvage des séquences de mutants.

Nom de l’oligonucléotide Séquence
Guide avant Primer_3 ATTTGgggtgaactatttgttcgccG
Inverser le Guide Primer_3 AAAACggcgaacaaatagttcacccC
Modèle Forward_3 de réparation tcagcaatatcagcaacaatttcaacaaccgcagcaacaactttatTAAGAATTCggcga
Modèle Reverse_3 de réparation attttgtccagtttgggctgcagcagggtgaactatttgttcgccGAATTCTTAataaag
Vérifiez avant l’apprêt ttaaagaaacttcacatcaccaag
Apprêt de contre-vérification actttgatagcataatatctaccat
Apprêt de séquençage ggcatagctgaaacttcggccc

Tableau 1 : liste des nucléotides oligo utilisés pour cette étude. Sites ajoutés pour le clonage à des fins commencent par une majuscule et en gras dans le guide guide des séquences. Les séquences dans le modèle de la réparation que l’ADN génomique de muter commencent par une majuscule et en gras.

Figure 1
Figure 1 : Diagramme du guide de conception de modèle ARN et réparation. Étiquetage des produits de toutes les séquences de PAM dans les 100 premiers nucléotides de TPK2(A). Séquence 3 (PAM_3) de la PAM est mis en évidence, car c’est la séquence utilisée dans cette étude. (B) l’ARN Guide de conception à l’aide de PAM_3. 20 base amorces conçues à l’aide de SnapGene sont en minuscules et bleu. Bases supplémentaires requis pour le clonage sont en majuscules et vert montré offset. (C) réparation des amorces de modèle qui insèrent un codon d’arrêt TAA et le site EcoRI sont insérées dans la TPK2 cadre de lecture. L’ADN qui diffère de la séquence de type sauvage est en majuscules et en rouge. (D) exemple de comment un guide a été conçu sur le brin positif de l’ADN à l’aide de PAM_4. (E) le diagramme schématique du pV1524 après le clonage du guide RNA et digestion avec KpnI et SacI. Neut5L-5' et Neut5L-3' cibler le vecteur vers le site de Neut5L dans le génome de c. albicans . CaENO1p est le promoteur qui anime l’expression de la levure-optimisé CaCas9. NAT,r est la cassette de résistance nourséothricine. CaSNR52p est le promoteur conduite guide RNA expression (sgRNA). FRT sites sont clivés et recombinées de flippase (FLP) enlever la cassette CRISPR une expression flippase. Un schéma similaire à (E) a été publié par Vyas et al. 11. s’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 2
Figure 2 : Introduction et confirmation d’un codon stop et un site de restriction EcoRI à TPK2. Amorces utilisées pour l’amplification sont énumérés au tableau 1. Les séquences de type sauvage et les mutants sont indiqués ci-dessous le gel. Ce chiffre a été modifié par Vyas et al.11. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 3
Figure 3 : Cartoon description des modèles de réparation qui va générer (A) les suppressions et les insertions de b. Gris tirets en (A) représentent des séquences intermédiaires non présents dans les amorces de modèle de réparation. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Discussion

C. albicans CRISPR efficacement modifie le génome de c. albicans . pV1524 code pour une levure Cas9 codon optimisé et est conçu de sorte que les enquêteurs peuvent facilement cloner guide RNA séquences en aval du promoteur (Figure 1) CaSNR52 11. Il faut s’assurer que qu’une seule copie de la séquence du guide a été clonée en vecteurs d’expression CaCas9 en séquençant, comme des copies supplémentaires n’entravera génome édition. Si plusieurs copies du guide sont introduits régulièrement, on devrait abaisser la concentration du recuit guide utilisé dans la ligature. Le vecteur et le protocole décrit permettent de cibler n’importe quel gène de c. albicans . Bien que c. albicans est diploïde, seulement une seule transformation est requise afin de cibler les deux allèles d’un gène. En outre, la nature processive de CRISPR-CaCas9 génome édition permet aux chercheurs de cibler plusieurs membres des familles de gènes. Plusieurs familles de gènes tels que les protéases aspartyl sécrétées (SAPS) et les protéines agglutinin-like sequence (ALS) sont importants pour la virulence de c. albicans . CRISPR génome modification facilitera l’investigation de ces familles de gènes.

Les protocoles décrits ci-dessus introduisent un codon d’arrêt à une trame de lecture ouverte, ce qui entraîne l’équivalent phénotypique d’une valeur null (Figure 2). Une grande variété d’alternances génétiques est possible en modifiant le modèle de la réparation. Non-sens, faux-sens et mutations silencieuses peuvent être insérées par recombinaison avec un modèle de réparation approprié. Incorporation d’un site de restriction rationalise le transformant du dépistage, que ceux sans doivent subir un dépistage en séquençant12,13. En outre, c. albicans CRISPR permet aux chercheurs de générer les insertions et suppressions, ce qui en fait un système idéal pour insérer des balises affinité, effectuer des échanges entre promoteurs et générer des débouchures (Figure 3). Dépistage des transformants correctes de ces mutations est plus laborieuse, comme il se doit séquencer les modifications afin de confirmer l’intégration correcte des modèles de réparation. En outre, Southern blot peut être nécessaire de s’assurer que des copies supplémentaires d’un gène n’ont pas été insérés autres collectivités dans le génome. L’exigence du site NGG PAM places limites légères sur les régions du génome qui peuvent être ciblés. Le développement de systèmes alternatifs de CRISPR qui utilisent des nucléases alternatives telles que Cpf1 ou variations sur le Cas9 système avoir/vouloir soulager bon nombre de ces limites14. À la connaissance des enquêteurs en ce moment, la ces systèmes n’ont pas encore été appliquées à c. albicans.

Le système CRISPR décrit dans le protocole ci-dessus a été développé telle qu’elle peut être appliquée dans une grande variété d’espèces dont l’agent pathogène humain Candida glabrata11, Naumouozyma castelliiet Saccharomyces cerevisiae . Transformation et un montage efficace de ces levures nécessite de légers changements au protocole décrit, mais le cadre pour le montage de ces génomes remplaçant est remarquablement similaire à celle décrite pour c. albicans12. En outre, levure fournissent un excellent mécanisme pour développer le génome procédures d’édition. Chez la levure, lorsque ADE2 subit une mutation, un précurseur de la voie de biosynthèse de l’adénine s’accumule, transformant les cellules rouges. Ce phénotype facilement observable permet aux enquêteurs pour identifier les cellules édités et dépanner rapidement génome édition des protocoles. Combiné avec la boîte à outils de la biologie moléculaire une vaste disponible pour les champignons, les protocoles pour l’édition de nombreuses espèces de levures ont été développés15,16. Telle une large application de technologie d’édition du génome chez les champignons a le potentiel d’impact significatif sur une grande variété de disciplines scientifiques.

CRISPR a grandement amélioré l’efficacité de l’ingénierie du génome chez c. albicans, mais à ce jour CRISPR n’a pas été utilisé pour effectuer des écrans larges de génome chez c. albicans. Les protocoles actuels exigent un modèle de réparation à introduire des mutations, comme la fin non-homologues rejoindre voie chez c. albicans est inefficace12. La génération de réparation modèle oligos pour chaque gène est un obstacle majeur à la réalisation d’écrans de génome. La confluence de la diminution des coûts de la synthèse d’ADN et avances aux technologies CRISPR fera développement de bibliothèques de suppression plus faisable. Par exemple, l’expression d’un modèle de réparation du vecteur CaCas9 ouvre la voie pour le développement de bibliothèques de plasmide durable qui ciblent chaque gène11. Par ailleurs, des protocoles CRISPR Candida transitoires qui ne nécessitent pas de vecteur d’expression CaCas9 intégrer dans le génome de c. albicans ont été développés17. En outre, augmenté guide expression augmentations génome édition efficacité18. Ceux-ci et autres avances aux technologies CRISPR, sont cruciaux pour le développement d’écrans tout le génome de c. albicans19,20,21,22.

Le génome de c. albicans est diploïde, mais A et allèles B ne sont pas toujours identiques5. Cette hétérozygotie fournit les défis et les opportunités. Si on veut cibler les deux allèles, un site PAM, séquence de guide et un modèle de réparation qui agit sur les deux copies du gène doivent être utilisés. Toutefois, selon polymorphismes présents dans un gène, le système CRISPR C.albicans permet enquêteurs de cibler un seul allèle. Cette précision a le potentiel pour permettre aux enquêteurs d’examiner les différences fonctionnelles entre les allèles. Ciblage des allèles spécifiques doit être fait soigneusement, car perte d’hétérozygotie (LOH) à un allèle ou d’un chromosome entier a été observée. Lors de l’édition unique de c. albicans allèles, il faut examiner des séquences d’ADN adjacentes afin de déterminer si un clone a maintenu un profil SNP diploïde. En outre, hors cible effets sont assez faibles pour c. albicans CRISPR, mais le séquençage du génome entier peut être envisagée pour les souches clés.

Disclosures

Les auteurs n’ont rien à divulguer.

Acknowledgments

Les auteurs remercient Dr Gennifer Mager pour lecture et commentaires utiles sur le manuscrit. Ce travail a été soutenu par le Fonds de démarrage pour le laboratoire Ball State University et NIH-1R15AI130950-01 à D.A.B.

Materials

Name Company Catalog Number Comments
Chemicals
Agar BD Bacto 214010
agarose amresco 0710-500G
Ampicillan Sigma-Aldrich A9518
Bacto Peptone BD Bacto 211677
Bsmb1 New England Biolabs R0580L
Calf intestinal phosphatase (CIP) New England Biolabs M0290L
Cut Smart Buffer New England Biolabs B7204S
Dimethyl Sulfoxide (DMSO) Sigma-Aldrich D8418
dNTPs New England Biolabs N0447L
Ethylenediaminetetraacetic acid (EDTA) Sigma-Aldrich 3609
Glacial Acetic Acid Sigma-Aldrich 2810000ACS
Glucose BDH VWR analytical BDH9230
Glycerol Sigma-Aldrich 49767
Kpn1 New England Biolabs R3142L
LB-Medium MP 3002-032
Lithium Acetate Sigma-Aldrich 517992
L-Tryptophan Sigma-Aldrich T0254
Maltose Sigma-Aldrich M5885
Molecular Biology Water Sigma-Aldrich W4502
NEB3.1 Buffer New England Biolabs B7203S
Nourseothricin Werner Bioagents 74667
Poly(ethylene glycol) PEG 3350 Sigma-Aldrich P4338
Sac1 New England Biolabs R3156L
Salmon Sperm DNA Invitrogen AM9680
T4 Polynucleotide kinase New England Biolabs M0201S
T4 DNA ligase New England Biolabs M0202L
Taq polymerase New England Biolabs M0267X
Tris HCl Sigma-Aldrich T3253
uridine Sigma-Aldrich U3750
Yeast Extract BD Bacto 212750
Equipment
Electrophoresis Appartus
Incubator
Microcentifuge
PCR machine
Replica Plating Apparatus
Rollerdrum or shaker
Spectrophotometer
Waterbath

DOWNLOAD MATERIALS LIST

References

  1. Pfaller, M. A., Diekema, D. J. Epidemiology of invasive candidiasis: a persistent public health problem. Clinincal Microbiology Review. 20, (1), 133-163 (2007).
  2. Magill, S. S., et al. Multistate point-prevalence survey of health care-associated infections. New England Journal of Medicine. 370, (13), 1198-1208 (2014).
  3. Wisplinghoff, H., et al. Nosocomial bloodstream infections in US hospitals: analysis of 24,179 cases from a prospective nationwide surveillance study. Clinical Infectious Disease. 39, (3), 309-317 (2004).
  4. Jones, T., et al. The diploid genome sequence of Candida albicans. Proceedings of the National Academy of Science USA. 101, (19), 7329-7334 (2004).
  5. Muzzey, D., Schwartz, K., Weissman, J. S., Sherlock, G. Assembly of a phased diploid Candida albicans genome facilitates allele-specific measurements and provides a simple model for repeat and indel structure. Genome Biology. 14, (9), (2013).
  6. Morschhauser, J., Michel, S., Staib, P. Sequential gene disruption in Candida albicans by FLP-mediated site-specific recombination. Molecular Microbiololgy. 32, (3), 547-556 (1999).
  7. Lau, V., Davie, J. R. The discovery and development of the CRISPR system in applications in genome manipulation. Biochemistry and Cell Biology. 95, (2), 203-210 (2017).
  8. Doudna, J. A., Charpentier, E. Genome editing. The new frontier of genome engineering with CRISPR-Cas9. Science. 346, (6213), 1258096 (2014).
  9. Anders, C., Niewoehner, O., Duerst, A., Jinek, M. Structural basis of PAM-dependent target DNA recognition by the Cas9 endonuclease. Nature. 513, (7519), 569-573 (2014).
  10. Reardon, S. Welcome to the CRISPR zoo. Nature. 531, (7593), 160-163 (2016).
  11. Vyas, V. K., et al. New CRISPR Mutagenesis Strategies Reveal Variation in Repair Mechanisms among Fungi. mSphere. 3, (2), (2018).
  12. Vyas, V. K., Barrasa, M. I., Fink, G. R. A Candida albicans CRISPR system permits genetic engineering of essential genes and gene families. Science Advances. 1, (3), e1500248 (2015).
  13. Evans, B. A., et al. Restriction digest screening facilitates efficient detection of site-directed mutations introduced by CRISPR in C. albicans UME6. PeerJ. 6, e4920 (2018).
  14. Kim, D., et al. Genome-wide analysis reveals specificities of Cpf1 endonucleases in human cells. Nature Biotechnology. 34, (8), 863-868 (2016).
  15. Tarasava, K., Oh, E. J., Eckert, C. A., Gill, R. T. CRISPR-enabled tools for engineering microbial genomes and phenotypes. Biotechnology Journal. e1700586 (2018).
  16. Raschmanova, H., Weninger, A., Glieder, A., Kovar, K., Vogl, T. Implementing CRISPR-Cas technologies in conventional and non-conventional yeasts: Current state and future prospects. Biotechnology Advances. 36, (3), 641-665 (2018).
  17. Min, K., Ichikawa, Y., Woolford, C. A., Mitchell, A. P. Candida albicans Gene Deletion with a Transient CRISPR-Cas9 System. mSphere. 1, (3), (2016).
  18. Ng, H., Dean, N. Dramatic Improvement of CRISPR/Cas9 Editing in Candida albicans by Increased Single Guide RNA Expression. mSphere. 2, (2), (2017).
  19. Huang, M. Y., Woolford, C. A., Mitchell, A. P. Rapid Gene Concatenation for Genetic Rescue of Multigene Mutants in Candida albicans. mSphere. 3, (2), (2018).
  20. Shapiro, R. S., et al. A CRISPR-Cas9-based gene drive platform for genetic interaction analysis in Candida albicans. Nature Microbiology. 3, (1), 73-82 (2018).
  21. Grahl, N., Demers, E. G., Crocker, A. W., Hogan, D. A. Use of RNA-Protein Complexes for Genome Editing in Non-albicans Candida Species. mSphere. 2, (3), (2017).
  22. Nguyen, N., Quail, M. M. F., Hernday, A. D. An Efficient, Rapid, and Recyclable System for CRISPR-Mediated Genome Editing in Candida albicans. mSphere. 2, (2), (2017).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics