CRISPR-medierad gen editering av den mänskliga svamp patogener Candida albicans

* These authors contributed equally
Genetics
 

Summary

Effektiv genomet engineering av Candida albicans är avgörande för att förstå patogenesen och utveckling av läkemedel. Vi beskrivit här, ett protokoll för att snabbt och korrekt redigera C. albicans genomet med CRISPR. Protokollet tillåter utredarna att införa en mängd olika genetiska modifieringar inklusive punktmutationer, infogningar och borttagningar.

Cite this Article

Copy Citation | Download Citations

Evans, B. A., Pickerill, E. S., Vyas, V. K., Bernstein, D. A. CRISPR-mediated Genome Editing of the Human Fungal Pathogen Candida albicans. J. Vis. Exp. (141), e58764, doi:10.3791/58764 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Denna metod beskriver den effektiva CRISPR medierad gen editering av diploida mänsklig svamp patogener Candida albicans. CRISPR-medierad gen editering i C. albicans kräver Cas9, vägleda RNA och reparera mall. En plasmid som uttrycker en jäst codon optimerad Cas9 (CaCas9) har genererats. Vägleda sekvenser direkt uppströms från en PAM webbplats (NGG) är klonade in Cas9 uttryck vektorn. En mall för reparation görs sedan av primer filändelsen i vitro. Cotransformation reparation mall och vektor till C. albicans leder till gen editering. Beroende på vilken reparation mall används, kan utredaren införa nukleotid förändringar, infogningar och borttagningar. C. albicans är en diploida, görs mutationer i båda alleler av en gen, förutsatt att de A och B allelerna inte harbor SNP som störa guide inriktning eller reparera mall inkorporering. Multimember gen familjer kan redigeras parallellt om lämplig bevarade sekvenser finns i alla familjemedlemmar. C. albicans CRISPR systemet beskrivs flankeras av FRT platser och kodar flippase. Vid induktion av flippase, tas den antibiotiska markör (CaCas9) och guide RNA bort från genomet. Detta tillåter utredaren att utföra efterföljande ändringar av genomet. C. albicans CRISPR är en kraftfull svamp gentekniska verktyg, och mindre ändringar beskrivs protokollen tillåter ändring av andra svamp arter inklusive C. glabrata, N. castellii, och S. cerevisiae.

Introduction

Candida albicans är den vanligast förekommande mänsklig svamp patogener1,2,3. Förstå skillnaderna mellan C. albicans och däggdjur molekylärbiologi är avgörande för utvecklingen av nästa generation av svampdödande therapeutics. Detta kräver utredare för att kunna snabbt och korrekt genetiskt manipulera C. albicans.

Genmanipulation av C. albicans har historiskt varit utmanande. C. albicans underhåller inte plasmider, således alla konstruktioner måste införlivas i genomet. C. albicans är dessutom diploida; Därför, när knackar ut en gen eller införa en mutation, det är viktigt att säkerställa att båda kopiorna har varit ändrade4. Dessutom är vissa C. albicans loci heterozygota, ytterligare komplicerar genetiska förhör5. För att genetiskt manipulera C. albicans, är det typiskt att utföra flera rundor av homolog rekombination6. Dock den diploida naturen av genomet och mödosamt konstruktion utveckling har gjort detta en potentiellt långtråkig process, särskilt om flera ändringar krävs. Dessa begränsningar och medicinska betydelsen av C. albicans kräver utvecklingen av ny teknik som gör att utredarna att enkelt manipulera C. albicans genomet.

Klustrade regelbundet mellanliggande kort palindromic repetitioner (CRISPR)-medierad gen editering är ett kraftfullt verktyg som tillåter forskare att ändra ordning på en arvsmassa. CRISPR kräver tre komponenter: (1) den Cas9 nuclease som klyver mål-DNA, 2) en 20 basera guide RNA som mål Cas9 att sekvensen av intresse, och 3) reparera mall DNA som reparerar webbplatsen klyvning och inlemmar den avsedda ändring7, 8. När guiden för Cas9 till målet genomet sekvensen, Cas9 kräver en protospacer intill motiv (PAM) sekvens (NGG) direkt uppströms sekvensen guide att klyva DNA9. Kravet på både 20 bas guide och PAM sekvenser ger en hög grad av inriktning specificitet och begränsar off-target klyvning.

CRISPR-system har utformats för att redigera genomen hos en rad olika organismer och ta itu med en mängd olika problem10. Beskrivs här är en flexibel och effektiv CRISPR protokoll för redigering en C. albicans gen av intresse. Experimentet introducerar ett stop-kodon till en gen, som orsakar översättning uppsägning. Andra redigeringar kan göras beroende på mallen reparation som införs. Ett fragment märkt med nourseothricin (Natr) som innehåller jäst kodon-optimerad Cas9 (CaCas9) och en guide RNA är införlivad med C. albicans genomet på en neutral plats. Cotransformation med mallen reparation kodning önskad mutationen leder till reparation av klyvning av homolog rekombination och effektiv gen editering. Beskrivs nedan är för redigering av TPK2, men alla C. albicans öppen läsning ramar kan riktas flera gånger av CRISPR. CRISPR systemet ligger flankerad av FRT platser och kan tas bort från genomet C. albicans genom induktion av flippase kodad på CaCas9 uttryck Plasmiden. C. albicans CRISPR systemet gör det möjligt för utredarna att noggrant och snabbt redigera C. albicans genomet11,12.

Protocol

1. identifiering och kloning av Guide RNA-sekvens

  1. Identifiering av guide RNA-sekvens
    1. Identifiera en 5'-NGG-3' PAM sekvens nära var det stop kodon infogas. (Figur 1A) Märkt finns alla PAM sekvenser i de första 100 baspar av TPK2 (figur 1A).
      Obs: Guide sekvenser inriktning varje C. albicans öppen läsning ram kan hittas på http://osf.io/ARDTX 11,12.
    2. Identifiera sekvensen framåt Guide Primer_3, som kommer att vara 20 baser direkt uppströms en NGG PAM webbplats och kommer inte att innehålla mer än 5 Ts i rad. Vänsterklick på basen direkt uppströms av NGG och dra markören 20 baser, sedan vänsterklicka på fliken primer att lägga primer.
    3. Identifiera sekvensen omvänd Guide Primer_3, som kommer att vara ett komplement till sekvensen framåt Guide.
      Obs: Visas är guider som använder PAM_3 (figur 1B).
    4. Högerklicka på primer och välj ”Kopiera primer data”. Klistra in sekvenser i ett textredigeringsprogram.
  2. Lägga till överhäng sekvenser i framåt och bakåt Guide oligos att underlätta kloning (tabell 1, figur 1B).
    1. Lägg till av nukleotidsekvensen ATTTG 5' ände den framåt Guide Primer_3 innan du köper.
    2. Tillsätt G 3' ände den framåt Guide Primer_3 innan du köper.
    3. Lägg till av nukleotidsekvensen AAAAC till 5' slutet av den omvända Guide Primer_3 innan du köper.
    4. Lägg till C 3' ände den omvänd Guide Primer_3 innan du köper.
  3. Digest CaCas9 uttryck vektor pV1524 med BsmBI.
    Obs: pV1524 innehåller en ampicillin (Ampr) och nourseothricin (Natr) markörer. Cas9 varit kodon-optimerad för C. albicans.
    1. Smälta plasmiden genom att lägga till: 2 μg av pv1524, 5 μL 10 x buffert, 1 μL av BsmBI och H2O till 50 μL i en 1,5 mL tub. Inkubera vid 55 ° C för 20 min. (alternativt smälta pv1524 för 15 min med Esp3I, en isoschizomer av BsmBI, vid 37 ° C.)
    2. Sval rumstemperatur (RT) och spin för 30 s vid 2,348 x g att få kondens till botten av röret. Fortsätt till steg 1.4 eller lagra smält plasmiden vid-20 ° C.
  4. Fosfatas-treat smält ryggraden.
    1. Tillsätt 1 μL av kalv intestinal fosfatas (CIP) till matsmältningen blandningen och inkubera vid 37 ° C i 1 h.
    2. Rena smält plasmiden använder en kommersiellt tillgänglig polymeras-kedjereaktion (PCR) rening kit (instruktioner medföljer kit) och eluera det i 30 μL av eluering buffert (EB).
  5. Fosforylera och glödga framåt Guide Primer_3 och omvänd Guide Primer_3.
    1. Tillsätt 0,5 μL av 100 μM framåt Guide Primer_3, 0,5 μL av 100 μM omvänd Guide Primer_3, 5 μL 10 x T4 ligase buffert, 1 μL av T4 polynucleotide kinase och 43 μL av H2O till en PCR-röret.
    2. Tillsätt 5 μl 10 x T4 ligase buffert, 1 μL av T4 polynucleotide kinase och 44 μL av molekylärbiologi-grade H2O i en andra PCR-röret.
      Obs: Detta kommer att fungera som den negativa kontrollen.
    3. Inkubera reaktion blandningar i en termocykler vid 37 ° C i 30 min, sedan vid 95 ° C i 5 min.
    4. Cool blandningen med den långsammaste ramp till 16 ° C att glödga, oligos. Placera sedan glödgat oligo blandningen vid 4 ° C.
  6. Ligera av glödgad oligos i smält pv1524 från steg 1.4.3.
    1. Lägg till följande till en PCR-röret: 1 μL 10 x T4 ligase buffert, 0,5 μL av T4 DNA-ligase, 0,5 μL av glödgad oligo mix, rötas CIP-behandlade renat plasmid (20 – 40 ng) och H2O 10 μL totala volym.
    2. Lägg till följande till en PCR-röret: 1 μL 10 x T4 ligase buffert, 0,5 μL av T4 DNA-ligase, rötas CIP-behandlade renat vektor (20 – 40 ng), 1 μL av negativ kontroll blandningen, och H2O upp till en 10 μL totala volym.
    3. Inkubera båda rören i en termocykler vid 16 ° C i 30 min, sedan vid 65 ° C i 10 min och sedan svalna till 25 ° C.
  7. Omvandla 5 μL av ligering blandningar till kemiskt behöriga Escherichia coli DH5α använder en standard värme chock omvandling protokoll. Välj på LB Amp/Nat media (200 Amp, 50 μg/mL Nat μg/mL).
    Obs: Underlåtenhet att välja pV1524 och dess derivat på dubbel urval media kommer att resultera i förlust av Nat/CaCas9/guide modul av FLP/FRT excision i bakterier.
  8. Rena plasmider från fyra transformants av miniprep och sekvens införande sekvensen med sekvensering primer (tabell 1).
    Obs: För det mesta, sekvensering 4 transformants är tillräcklig för att identifiera minst 1 rätt klon.
  9. Spara plasmider som har guide RNA sekvensen klonade en enda gång in den BsmBI som skär webbplats vid-20 ° C.

2. designa och generering av reparation mall

  1. Infoga ett stop-kodon genom att vänsterklicka på gensekvensen och lägga nukleotider som kodar en stop kodon och begränsning matsmältningen plats (figur 1 ctabell 1).
    Obs: Insättningspunkten kommer att störa PAM sekvensen.
    Obs: En begränsning matsmältningen plats kommer att finnas i sekvensen reparation mall för att underlätta effektiv screening av kloner (figur 1 c).
  2. Vänsterklicka på 10 baser nedströms av där mutationen kommer att göras och dra markören 60 baser uppströms. Vänsterklicka på fliken primer att lägga till primern. Detta kommer att lägga reparation mallen Forward_3. Vänsterklicka på 10 baser uppströms där mutationen kommer att göras och dra markören 60 baser nedströms. Vänsterklicka på fliken primer att lägga till primern. Detta kommer att lägga reparation mall omvänd 3. (Figur 1 c)
  3. Utföra primer förlängning för att skapa mallen för reparation.
    1. Tillsätt 1,2 μl av 100 μm reparation mall framåt primer, 1,2 μl av 100 μm reparation mall reverse primer, 6 μL deoxynucleotide trifosfater (dNTP) (total koncentration 40 mM), 6 μL buffert, 0.6 μl Taq-polymeras (3 enheter) och 45 μL av H2O till var och en av de 4 PCR rören.
    2. Utföra primer förlängning genom att köra mellan 20 och 30 rundor av PCR. Exempel förlängning villkor: 2 min vid 95 ° C, (30 s vid 95 ° C, 1 min vid 50 ° C, 1 min vid 68 ° C) x 34, 10 min vid 68 ° C.
    3. Kombinera innehållet i alla 4 PCR-rören i en 1,5 mL tub och använda ett PCR-rening kit för att rena produkter i 50 μL av H2O.
    4. Kvantifiera primer filändelsen produkterna för att säkerställa tillräcklig DNA genom att bestämma absorbansen vid 260 nm.
      Obs: Typiska slutlig koncentration av primer filändelsen produkten är ~ 200 – 300 ng/µL.

3. omvandling av C. albicans med reparation mall och Plasmid

  1. Gör TE/litium acetat.
    1. Blanda 10 mM Tris-Cl, 1 mM EDTA, 100 mM litium acetat och H2O (alla stamlösning pH 7,5) att uppnå 50 mL totalvolym.
  2. Gör plattan
    1. Blanda 40% PEG 3350, 100 mM litium acetat, 10 mM Tris-Cl, 1 mM EDTA och H2O (alla stamlösning pH 7,5) för att uppnå total volym 50 mL.
  3. Smälta korrekt klonade plasmider från steg 1,9.
    1. Lägg 10 μg plasmid, 4 µL 10 x buffert, 0.4 µL av 10 mg/mL bovint serum albumin (BSA), 0,5 µL av KpnI, 0,5 µL av SacI och H20 till 40 µL totala volym i en 1,5 mL tub. Inkubera vid 37 ° C över natten (figur 1 d).
  4. Växer en övernattning kultur av C. albicans SC5314, vilda prototroph, vid 25 ° C i jäst pepton dextros kompletteras med 0,27 mM uridin (YPD + Uri), idealiskt till OD600 mindre än 6.
    1. Pellets 5 OD600 enheter av celler per omvandling av spinning för 5 min vid 2,348 x g och avbryta OD 5600 av pelleterat celler i 100 µL TE/litium acetat.
  5. Lägg till följande i en 1,5 mL tub i angiven ordning: 1) 100 µL av celler från steg 3.4.1, 2) 40 µL av kokt och quick-cooled lax spermier DNA (10 mg/mL), 3) 10 µg av Plasmiden matsmältningen från steg 3.3.1, 4) 6 µg av renat reparation mall och 5) 1 mL av plattan.
  6. Lägg till följande i en 1,5 mL tub i angiven ordning: 1) 100 µL av celler, 2) 40 µL av kokt och quick-cooled lax spermier DNA (10 mg/mL), 3) H2O volym lika stor som omvandla DNA i steg 3.5 och 4) 1 mL av plattan.
    Obs: Detta fungerar som en negativ kontroll.
  7. Blanda omformningarna försiktigt genom pipettering och låt Inkubera vid 25 ° C under natten.
  8. Värme chock cellerna genom att placera dem i vattenbad 44 ° C i 25 min.
  9. Snurra för 5 min vid 2,348 x g i en bänkmonterade centrifug och ta bort plattan blandningen supernatant. Tvätta en gång genom att tillsätta 1 mL YPD + Uri och centrifugera igen för 5 min vid 2,348 x g.
  10. Avbryta cellerna i 0,1 mL av YPD + Uri och inkubera i en rulle trumma eller shaker vid 25 ° C under natten.
  11. Skylt om YPD + Uri med 200 μg/mL nourseothricin. Kolonierna visas i 2 – 5 dagar.

4. streck för enstaka kolonier

  1. Dela upp en 100 mm x 15 mm petriskål i fjärdedelar och etikett varje kvadrant.
    1. Tryck på en av kolonierna från omvandling plattan med en steril tandpetare eller en applikator och en strimma över den längsta sidan på kvadranten.
    2. Strimma för enstaka kolonier med en aseptisk teknik och tillåta kolonierna att växa vid 30 ° C i 2 dagar.

5. kolonin PCR

  1. Design de framåt kontrollera primer (FCP) ~ 200 baspar uppströms webbplatsen på begränsning som infördes och omvänd kontrollera primer (RCP) ~ 300 basparen nedströms.
    1. Tillsätt 0.3 μL av FCP, 0.3 μL av RCP, 0.3 μL termostabila polymeras (ExTaq 1,5 enheter), 3 μL av dNTP (total koncentration 40 mM), 3 μL ExTaq buffert och 23 μL av H2O i en 1,5 mL rör.
      Obs: Tillägg av 0,5 μL/reaktion dimetyl sulfoxid (DMSO) kan förbättra PCR effektivitet.
    2. Tillsätt 0,25 μL av en enda jäst koloni från steg 4.1.2 till blandningen från steg 5.1.1, använder en P10 pipettspetsen och noga med att inte störa agar.
    3. Förstärka DNA med PCR och kör 5 μl av PCR på en gel att säkerställa förstärkningen är framgångsrik, noga med att inte störa cellpelleten på botten av röret.

6. begränsning matsmältningen av kolonin PCR

  1. Tillsätt 10 μl av PCR-produkten (ta hand inte för att inte störa cellpelleten längst ned på röret), 3 μL buffert, 1 μL av restriktionsenzym och 16 μL av H2O, sedan Inkubera enligt tillverkarens anvisningar och lösa på en agarosgel att identifiera corre CT genomet redigeringar.
    Obs: Den restriktionsenzym som används här är kodade i mallen TPK2 specifika reparation.

7. Spara stammar

  1. Växer en övernattning kultur från kolonier som har bekräftats av begränsning matsmältningen i YPD + Uri vid 30 ° C.
  2. Tillsätt 1 mL av kulturen och 1 mL 50% glycerol (att få den slutliga koncentrationen av glycerol på 25%) till ett rör som är lämpliga för lagring vid-80 ° C.
  3. Lagra rätt klonerna vid-80 ° C.
    Obs: Rätt stammar kan lagras vid-80 ° C under många år.

8. avlägsnande av Natr markör

  1. Strimma rätt transformant på jäst pepton maltos (YPMaltose) (2% maltos).
  2. Plocka en koloni från strimmiga plattan och kultur jästen för 48 h vid 30 ° C i flytande YPMaltose 20 g/L maltos.
  3. Plåt 200 – 400 celler på YPMaltose 20 g/L maltos och inkubera vid 30 ° C under 24 h.
  4. Replikera plattan på YPMaltose och YPMaltose 200 μg/mL Nat.
  5. Inkubera vid 30 ° C under 24 h.
    Obs: Kolonier som inte längre växer på YPMaltose 200 μg/mL nourseothricin men växa på YPMaltose har förlorat den Natr markören (CaCAS9) och vägleda RNA.
  6. Spara de stammar som har förlorat Natr markör (CaCAS9) och guide RNA som gjort steg 7.1 – 7.3.
    Obs: En liknande plasmid, pV1393, använder den SAP2 i motsats till en MAL2 promotor. Tillväxt på YCB – BSA kommer inducera flippase och borttagning av Natr om pV1393 används för genen redigering.

Representative Results

Sekvenser av guide RNAs och reparation mallar som riktar C. albicans TPK2, en c-AMP-Kinas katalytisk subenhet, utformades enligt de riktlinjer som föreslås ovan. Sekvenser visas i (tabell 1, figur 1). Guide RNAs var klonade in CaCas9 uttryck vektorer och cotransformed med reparation mall i vildtyp C. albicans. En EcoRI begränsning matsmältningen plats och stop kodon i mallen reparation störa webbplatsen PAM och underlätta screening för rätt mutanter (figur 1). Transformants var strimmiga för enstaka kolonier och screening av kolonin PCR och begränsning matsmältning för iblandning av mallen för reparation (figur 2). Begränsning matsmältningen skiljer snabbt vildtyp från mutant sekvenser.

Oligonukleotid namn Oligonukleotid sekvens
Framåt Guide Primer_3 ATTTGgggtgaactatttgttcgccG
Omvänd Guide Primer_3 AAAACggcgaacaaatagttcacccC
Reparera mall Forward_3 tcagcaatatcagcaacaatttcaacaaccgcagcaacaactttatTAAGAATTCggcga
Reparera mall Reverse_3 attttgtccagtttgggctgcagcagggtgaactatttgttcgccGAATTCTTAataaag
Framåt kontrollera Primer ttaaagaaacttcacatcaccaag
Omvänd kontrollera Primer actttgatagcataatatctaccat
Sekvensering Primer ggcatagctgaaacttcggccc

Tabell 1: lista över oligo nukleotider används för denna studie. Webbplatser som lagts till för kloning ändamål kapitaliseras och fetstil i den guide primern sekvenser. Sekvenser i mallen reparation som mutera genomisk DNA aktiveras och fetstil.

Figure 1
Figur 1 : Diagram över guide RNA och reparation malldesign. (A) märkning av alla PAM sekvenser i de första 100 nucleotides av TPK2. PAM sekvens 3 (PAM_3) är markerat, eftersom det är den sekvens som används i denna studie. (B) Guide RNA design med PAM_3. 20 bas grundfärger utformade med SnapGene är gemener och blå. Ytterligare grunder krävs för kloning är versaler och gröna visas offset. (C) reparation mall primers som infogar en TAA stop kodon och EcoRI webbplats infogas i den TPK2 läsa frame. DNA som skiljer sig från den wild-type-sekvensen är röd och versaler. (D) exempel på hur en guide är utformad på den positiva delen av DNA med hjälp av PAM_4. (E) Schematisk bild av pV1524 efter kloning av guide RNA och matsmältningen med KpnI och SacI. Neut5L-5' och Neut5L-3' rikta vektorn till webbplatsen Neut5L i C. albicans genomet. CaENO1p är den promotor som driver uttryck för den jäst-optimerad CaCas9. NATr är nourseothricin motstånd kassett. CaSNR52p är den promotor körning guide RNA uttryck (sgRNA). FRT platser är klyvs och rekombinerat av flippase (FLP) ta bort CRISPR kassett på flippase uttryck. En schematisk liknar (E) publicerades av Vyas et al. 11. vänligen klicka här för att visa en större version av denna siffra.

Figure 2
Figur 2 : Introduktion och bekräftelse av en stop kodon och EcoRI begränsning webbplats till TPK2. Primers används för förstärkning är listade i tabell 1. Vildtyp och muterade sekvenser visas nedan gelen. Denna siffra har ändrats från Vyas et al.11. Klicka här för att se en större version av denna siffra.

Figure 3
Figur 3 : Tecknad Beskrivning av reparation mallar som kommer att generera a borttagningar och (B) infogningar. Grå streck (a) skildrar mellanliggande sekvenser inte närvarande i reparation mall primers. Klicka här för att se en större version av denna siffra.

Discussion

C. albicans CRISPR effektivt redigerar C. albicans genomet. pV1524 kodar en jäst kodon-optimerade Cas9 och är utformad så att utredarna kan enkelt klona guide RNA-sekvenser nedströms CaSNR52 arrangören (figur 1)11. Det måste säkerställas att endast en enda kopia av sekvensen guide har varit klonade in CaCas9 uttryck vektorer av sekvensering, som extra kopior kommer att hindra gen editering. Om flera kopior av guiden introduceras konsekvent, bör en lägre koncentration av glödgad guide används i ligering. Den vektor och protokollet beskrivs tillåta måltavlan av någon C. albicans -genen. Även om C. albicans är diploida, krävs bara en enkel omvandling att rikta båda alleler av en gen. Dessutom kan processive beskaffenhet CRISPR-CaCas9 gen editering forskare att rikta flera medlemmar i gen familjer. Många gen familjer såsom utsöndrade aspartyl proteaser (SAPS) och agglutinin-liknande sekvens proteiner (ALS) är viktiga för C. albicans virulens. CRISPR gen editering kommer att underlätta utredningen av dessa gen familjer.

De protokoll som beskrivs ovan införa ett stop-kodon till en öppen läsning ram, vilket resulterar i den fenotypiska motsvarigheten till ett null-värde (figur 2). En mängd olika genetiska växlingen kan göras genom att variera mallen reparation. Nonsens, missense och tysta mutationer kan infogas via rekombination med en lämplig reparation mall. Införlivandet av en begränsning webbplats effektiviserar transformant screening, som de utan ska säkerhetskontrolleras genom att sekvensera12,13. Dessutom möjliggör C. albicans CRISPR forskare att generera infogningar och borttagningar, vilket gör det ett idealiskt system att infoga affinitet taggar, utföra promotor swappar och generera knockouts (figur 3). Screening för rätta transformants för dessa mutationer är mer arbetskrävande, som det är nödvändigt att sekvensera redigeringar för att bekräfta korrekt införlivande av mallarna för reparation. Dessutom kan Southern blot vara nödvändiga för att säkerställa ytterligare kopior av en gen inte har satts in på ytterligare platser i genomet. Kravet på webbplatsen NGG PAM ställer smärre begränsningar på regionerna i genomet som kan riktas. Utvecklingen av alternativa CRISPR-system som använder alternativa nukleaser såsom Cpf1 eller variationer på den Cas9 system har/kommer att lindra många av dessa begränsningar14. Till utredarnas kunskap vid denna tid, har dessa system ännu inte har tillämpats till C. albicans.

CRISPR systemet beskrivs i ovanstående protokollet har utvecklats så att det kan tillämpas i en mängd olika arter, inklusive Saccharomyces cerevisiae, Naumouozyma castelliioch den mänskliga patogenen Candida glabrata11 . Omvandling och effektiv redigering av dessa jäst kräver smärre ändringar av beskrivna protokollet, men ramen för redigering dessa alternativa genomen är anmärkningsvärt liknande som anges för C. albicans12. Dessutom jäst ger en utmärkt mekanism att utveckla genomet redigering förfaranden. I jäst, när ADE2 är muterade, ackumuleras en föregångare till adenin biosyntes vägen, roterande cellerna rött. Denna lätt observerbara fenotypen kan utredarna att identifiera redigerade celler och snabbt felsöka genomet redigering protokoll. Kombinerat med omfattande molekylärbiologi verktygslådan tillgängliga för svampar, varit protokoll för redigering många jäst arter utvecklade15,16. En sådan bred tillämpning av genomet redigering teknik i svampar har potential att avsevärt påverka en mängd olika vetenskapliga discipliner.

CRISPR har kraftigt förbättrat effektiviteten i genomet engineering i C. albicans, men hittills CRISPR har inte använts för att utföra genome bred skärmar i C. albicans. Aktuella protokoll kräva en reparation mall att introducera mutationer, som nonhomologous slutet att gå vägen i C. albicans är ineffektiva12. Genereringen av reparation mall oligos för varje gen är en betydande hinder för genomförandet av genome-wide skärmar. Sammanflödet av minskade kostnader av DNA-syntes och förskott till CRISPR teknik kommer att göra utvecklingen av radering bibliotek mer genomförbart. Exempelvis banar uttryck för en reparation mall från CaCas9 vector väg för utvecklingen av hållbara plasmid bibliotek som riktar varje gen11. Dessutom har övergående Candida CRISPR protokoll som inte kräver CaCas9 uttryck vektor införliva in i C. albicans genomet varit utvecklade17. Dessutom ökade guide uttryck ökar genomet redigering effektivitet18. Dessa och andra förskott till CRISPR teknik, är avgörande för utvecklingen av genome-wide skärmar i C. albicans19,20,21,22.

C. albicans genomet är diploida, men A och B alleler är inte alltid identiska5. Sådana heterozygositet ger både utmaningar och möjligheter. Om man syftar till att rikta båda alleler, måste en PAM webbplats guide sekvens och reparera mall som kommer att agera på båda kopiorna av genen användas. Beroende på enda nukleotid polymorfismer i en gen, kan C.albicans CRISPR systemet utredarna att inrikta sig på en enda allel, dock. Sådan precision har potential att tillåta utredarna att undersöka funktionella skillnader mellan alleler. Inriktning på specifika alleler måste göras noggrant, som förlust av heterozygositet (LOH) i en allel eller av en hel kromosom har observerats. När du redigerar enda C. albicans alleler, måste man undersöka intilliggande DNA-sekvenser för att avgöra om en klon har bibehållit en diploida SNP-profil. Dessutom off-target effekter är ganska låg för C. albicans CRISPR, men hela Genomsekvensering kan övervägas för nyckel stammar.

Disclosures

Författarna har något att avslöja.

Acknowledgments

Författarna tacka Dr Gennifer Magers för läsning och bra synpunkter på manuskriptet. Detta arbete stöddes av Ball State University laboratorium start medel och NIH-1R15AI130950-01 till D.A.B.

Materials

Name Company Catalog Number Comments
Chemicals
Agar BD Bacto 214010
agarose amresco 0710-500G
Ampicillan Sigma-Aldrich A9518
Bacto Peptone BD Bacto 211677
Bsmb1 New England Biolabs R0580L
Calf intestinal phosphatase (CIP) New England Biolabs M0290L
Cut Smart Buffer New England Biolabs B7204S
Dimethyl Sulfoxide (DMSO) Sigma-Aldrich D8418
dNTPs New England Biolabs N0447L
Ethylenediaminetetraacetic acid (EDTA) Sigma-Aldrich 3609
Glacial Acetic Acid Sigma-Aldrich 2810000ACS
Glucose BDH VWR analytical BDH9230
Glycerol Sigma-Aldrich 49767
Kpn1 New England Biolabs R3142L
LB-Medium MP 3002-032
Lithium Acetate Sigma-Aldrich 517992
L-Tryptophan Sigma-Aldrich T0254
Maltose Sigma-Aldrich M5885
Molecular Biology Water Sigma-Aldrich W4502
NEB3.1 Buffer New England Biolabs B7203S
Nourseothricin Werner Bioagents 74667
Poly(ethylene glycol) PEG 3350 Sigma-Aldrich P4338
Sac1 New England Biolabs R3156L
Salmon Sperm DNA Invitrogen AM9680
T4 Polynucleotide kinase New England Biolabs M0201S
T4 DNA ligase New England Biolabs M0202L
Taq polymerase New England Biolabs M0267X
Tris HCl Sigma-Aldrich T3253
uridine Sigma-Aldrich U3750
Yeast Extract BD Bacto 212750
Equipment
Electrophoresis Appartus
Incubator
Microcentifuge
PCR machine
Replica Plating Apparatus
Rollerdrum or shaker
Spectrophotometer
Waterbath

DOWNLOAD MATERIALS LIST

References

  1. Pfaller, M. A., Diekema, D. J. Epidemiology of invasive candidiasis: a persistent public health problem. Clinincal Microbiology Review. 20, (1), 133-163 (2007).
  2. Magill, S. S., et al. Multistate point-prevalence survey of health care-associated infections. New England Journal of Medicine. 370, (13), 1198-1208 (2014).
  3. Wisplinghoff, H., et al. Nosocomial bloodstream infections in US hospitals: analysis of 24,179 cases from a prospective nationwide surveillance study. Clinical Infectious Disease. 39, (3), 309-317 (2004).
  4. Jones, T., et al. The diploid genome sequence of Candida albicans. Proceedings of the National Academy of Science USA. 101, (19), 7329-7334 (2004).
  5. Muzzey, D., Schwartz, K., Weissman, J. S., Sherlock, G. Assembly of a phased diploid Candida albicans genome facilitates allele-specific measurements and provides a simple model for repeat and indel structure. Genome Biology. 14, (9), (2013).
  6. Morschhauser, J., Michel, S., Staib, P. Sequential gene disruption in Candida albicans by FLP-mediated site-specific recombination. Molecular Microbiololgy. 32, (3), 547-556 (1999).
  7. Lau, V., Davie, J. R. The discovery and development of the CRISPR system in applications in genome manipulation. Biochemistry and Cell Biology. 95, (2), 203-210 (2017).
  8. Doudna, J. A., Charpentier, E. Genome editing. The new frontier of genome engineering with CRISPR-Cas9. Science. 346, (6213), 1258096 (2014).
  9. Anders, C., Niewoehner, O., Duerst, A., Jinek, M. Structural basis of PAM-dependent target DNA recognition by the Cas9 endonuclease. Nature. 513, (7519), 569-573 (2014).
  10. Reardon, S. Welcome to the CRISPR zoo. Nature. 531, (7593), 160-163 (2016).
  11. Vyas, V. K., et al. New CRISPR Mutagenesis Strategies Reveal Variation in Repair Mechanisms among Fungi. mSphere. 3, (2), (2018).
  12. Vyas, V. K., Barrasa, M. I., Fink, G. R. A Candida albicans CRISPR system permits genetic engineering of essential genes and gene families. Science Advances. 1, (3), e1500248 (2015).
  13. Evans, B. A., et al. Restriction digest screening facilitates efficient detection of site-directed mutations introduced by CRISPR in C. albicans UME6. PeerJ. 6, e4920 (2018).
  14. Kim, D., et al. Genome-wide analysis reveals specificities of Cpf1 endonucleases in human cells. Nature Biotechnology. 34, (8), 863-868 (2016).
  15. Tarasava, K., Oh, E. J., Eckert, C. A., Gill, R. T. CRISPR-enabled tools for engineering microbial genomes and phenotypes. Biotechnology Journal. e1700586 (2018).
  16. Raschmanova, H., Weninger, A., Glieder, A., Kovar, K., Vogl, T. Implementing CRISPR-Cas technologies in conventional and non-conventional yeasts: Current state and future prospects. Biotechnology Advances. 36, (3), 641-665 (2018).
  17. Min, K., Ichikawa, Y., Woolford, C. A., Mitchell, A. P. Candida albicans Gene Deletion with a Transient CRISPR-Cas9 System. mSphere. 1, (3), (2016).
  18. Ng, H., Dean, N. Dramatic Improvement of CRISPR/Cas9 Editing in Candida albicans by Increased Single Guide RNA Expression. mSphere. 2, (2), (2017).
  19. Huang, M. Y., Woolford, C. A., Mitchell, A. P. Rapid Gene Concatenation for Genetic Rescue of Multigene Mutants in Candida albicans. mSphere. 3, (2), (2018).
  20. Shapiro, R. S., et al. A CRISPR-Cas9-based gene drive platform for genetic interaction analysis in Candida albicans. Nature Microbiology. 3, (1), 73-82 (2018).
  21. Grahl, N., Demers, E. G., Crocker, A. W., Hogan, D. A. Use of RNA-Protein Complexes for Genome Editing in Non-albicans Candida Species. mSphere. 2, (3), (2017).
  22. Nguyen, N., Quail, M. M. F., Hernday, A. D. An Efficient, Rapid, and Recyclable System for CRISPR-Mediated Genome Editing in Candida albicans. mSphere. 2, (2), (2017).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics