Создание вирусной инфекции и анализа взаимодействия хост вирус в Drosophila Melanogaster

* These authors contributed equally
Immunology and Infection
 

Summary

Этот протокол описывает в Drosophila melanogaster с использованием нано инъекционный метод и основные методы для анализа взаимодействия вируса узла создать вирусной инфекции в естественных условиях .

Cite this Article

Copy Citation | Download Citations

Yang, S., Zhao, Y., Yu, J., Fan, Z., Gong, S. t., Tang, H., Pan, L. Establishment of Viral Infection and Analysis of Host-Virus Interaction in Drosophila Melanogaster. J. Vis. Exp. (145), e58845, doi:10.3791/58845 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Вирус распространяется является одной из основных причин эпидемических заболеваний. Таким образом понимание взаимодействия между вирусом и принимающей страны очень важно расширить наши знания о профилактики и лечения вирусной инфекции. Плодовой мушки Drosophila Меланаogaster оказался одним из наиболее эффективных и продуктивных модельных организмов экрана для противовирусное факторов и изучения взаимодействия вируса хост, из-за генетических мощные инструменты и высоко сохраняется врожденный иммунный сигнальные пути. Процедуру, описанную здесь демонстрирует метод нано инъекции для установления вирусной инфекции и побудить системных противовирусное ответы взрослых мух. Точный контроль вирусных инъекций доза в этот метод позволяет высокую воспроизводимость экспериментальной. Протоколы, описанные в данном исследовании включают подготовку мух и вирус, метод впрыска, выживание курс анализа, измерения нагрузки вирус, и противовирусное путь оценки. Влияние последствий вирусной инфекции на фоне мухи были упомянуты здесь. Этот метод инфекции легко выполнять и количественно повторяемости; Он может применяться для хост/вирусные факторы взаимодействия вируса хост и вскрыть перекрестных помех между врожденной иммунной сигнализации и другие биологические пути в ответ на вирусную инфекцию.

Introduction

Новые вирусные инфекции, особенно путем арбовирусов, таких, как вирус чикунгуньи1, вирус денге, желтой лихорадки вирус2 ивирусЗика3, были огромную угрозу для общественного здоровья, вызывая пандемий 4. Таким образом, более глубокого понимания взаимодействия вируса хост становится все более важным для эпидемического контроля и лечения вирусных заболеваний в организме человека. Для этой цели необходимо создать более адекватных и эффективных моделей для изучения механизмов лежащие в основе вирусной инфекции.

Плодовая муха, Drosophilamelanogaster (D. melanogaster), обеспечивает мощную систему для изучения вируса хост взаимодействия5,6 и оказался одним из наиболее эффективных моделей для изучения вирусных заболеваний человека7 , 8 , 9. высоко сохранены противовирусное, сигнальные пути и несравненный генетических инструменты делают мухи большой модели для получения существенных результатов с реальные последствия для человека антивирусных исследований. Кроме того мух, простой и недорогой для поддержания в лаборатории и удобны для крупномасштабных скрининг Роман регуляторные факторы6,10 вирус и принимающей во время инфекции.

Четыре основных высоко сохранены противовирусное пути (например., РНК интерференции (RNAi) путь11, Як-STAT путь12, NF-κB путь и путь autophagy13) хорошо изучены в дрозофила в последние лет6. Интерференции является широкий противовирусное механизмом, который может подавить большинства видов вирусной инфекции6,14. Нарушение этого пути, мутации в генах как Dicer-2 (Dcr-2) или Argonaute 2 (давности2) может привести к увеличению вирус титр и принимающих смертности15,16,17. Як-STAT путь был вовлечен в контроля инфекции вирусом из семьи Dicistroviridae и Flaviviridae семьи в насекомые, например., дрозофила C вирус (DCV) в16 мух и вирус Западного Нила (ВЗН) и вирус денге комаров18,19. Дрозофилы платных (гомологичных человека NF-κB путь) и иммунодефицит (IMD) тропы (похож на человеческий путь NF-κB и TNF) являются оба участвовали в защите вирусов вторжения20,21, 22. autophagy это еще сохраняется механизм, участвует в регуляции вирусной инфекции, которая характеризуется хорошо дрозофилы23,24. Таким образом, идентификация Роман регуляторные факторы этих путей и рассечения перекрестных помех между этими противовирусное сигнализации и другие биологические пути, таких как метаболизм, старение, нейронные реакции и так далее, можно легко настроить в дрозофилы системы.

Хотя наиболее устоявшихся вирусных инфекционных модели в дрозофилы индуцированных РНК-вирусов, инфекции, беспозвоночных радужные вирус 6I (IV-6) и Калифея вирусы продемонстрировали потенциал для исследования ДНК вирусов в мух25, 26. Кроме того вирус может также быть изменен инфекции дрозофилы, таких как вирус гриппа9. Это значительно расширил применение дрозофилы скрининг платформы. В этой процедуре мы используем DCV в качестве примера для описания как развивать систему вирусных инфекционных дрозофилы. DCV представляет собой положительный смысл единого мель РНК вирус примерно 9300 нуклеотидов, кодирование 9 белки27. Как естественный возбудитель D. melanogasterDCV считается подходящим вирус изучать физиологические, поведенческие и базальной иммунного ответа во время пребывания вирус взаимодействия и коэволюции28. Кроме того его быстрого смертности после инфицирования в дикого типа мух делает DCV полезным экран для устойчивостью или подверженных генов в принимающей29.

Однако есть несколько аспектов озабоченности при изучении вирусных инфекций у дрозофилы. К примеру симбиотические бактерии Wolbachia имеют способность ингибировать широкого спектра РНК вируса распространения дрозофилы и комаров30,,3132. Последние данные показывает возможный механизм, в котором Wolbachia блоков синдбис вирус (SINV) инфекции через upregulation метилтрансфераза Mt2 выражение в принимающей33. Кроме того генетический фон насекомых также имеет решающее значение для вирусной инфекции. К примеру, естественный полиморфизм гена pastrel (pst), определяет восприимчивость к инфекции DCV дрозофилы34,35, хотя локусов Ubc-E2H и CG8492 участвуют в крикет паралич вирус (CrPV) и стадо заражения вирусом (FHV) дом, соответственно36.

Конкретных способов установить вирус хост взаимодействия в мух, должны быть выбраны согласно научно-исследовательских целей, таких как экран высокой пропускной способностью для принимающей клетчатых компонентов в дрозофилы клеток линии37,38, устные -инфекции обучения гут конкретных противовирусное ответ22,39,40, иглы, покалывание41,42 или нано инъекции, передав эпителиальных барьеры для стимулирования системной иммунной ответы. Нано инъекции можно точно контролировать вирусный доза побудить контролируемых противовирусное реакции и физиологических поражения43, таким образом гарантируя высокую воспроизводимость экспериментальной44. В этом исследовании мы описываем метод нано инъекции для изучения взаимодействия вирус хост у дрозофилы, подчеркнув важность эффекты фона мух.

Protocol

Примечание: Перед началом эксперимента, клеточных линий и летать запасов используются должны не быть загрязнены патогенами, особенно для вирусов, таких как DCV, FHV, дрозофила X вирус (DXV) и вирус птичьего нефрит (ANV). В идеале РНК последовательности или простой идентификации на основе ПЦР используются для обнаружения загрязнения10,45. Если произошло загрязнение, клеточных линий и летать запасов не должны использоваться больше до тех пор, пока они полностью обеззараживания46.

1. вирус и летать подготовка

  1. Распространение вируса и коллекции
    Примечание: Дрозофилы S2 * клетки используются для распространения DCV и титрования. Клеточная линия S2 * является производным от основной культуры поздней стадии D. melanogaster эмбрионов. Эта линия клетки был хорошо описанные ранее47.
    1. Расти S2 * клеток в среде Шнейдера дрозофилы при 25 ° C без дополнительных CO2, как свободные, полу адэрентных монослоя в 10 см клетки культуры блюдо, на плотность составляет 1 x 107 жизнеспособных клеток/мл. Использование полного среднего для S2 * клетки: Шнейдера дрозофилы средства, содержащие 10% тепла инактивированная FBS, 100 единиц/мл пенициллина и стрептомицина 100 мкг/мл.
      Примечание: Здоровые клетки должны показать круглой формы и выставка однородных размер.
    2. Быстро разморозить DCV акций от-80 ° C в водяной бане 25 ° С. S2 * клетки с DCV в MOI = 0.01 сразу непосредственно добавив 1 мл раствора вируса к блюдам культуры клеток (область роста: 55 см2) с 10 мл полной среды для S2 * клеток.
    3. Инкубации клеток при 25 ° C для 3-5 дней. Когда вирус готова для коллекции, морфологию клеток является ненормальным (форма ячеек выглядит размытия) и питательной среды полна черные частицы свидетельствует о ячейке мусора.
    4. Сбор всей клеточной культуры в 15 мл, закупорить вверх и вниз и заморозить при температуре-80 ° C (на срок до одного года).
      Примечание: DCV может храниться длительное время при температуре-80 ° C с минимальными потерями инфективности, сроком до одного года.
    5. Оттепель клеточной культуры в водяной бане при постоянном встряхивании 25 ° C и затем центрифуги на 6000 x g, за 15 мин при 4 ° C. Соберите супернатант в стерильных 15 мл трубки и вихрь. Алиготе до 200 мкл раствора вирус на трубу.
      Примечание: Аликвоты вирус может храниться для коротких периодов до 3 дней при температуре 4 ° C и до 1 года-80 ° c. Следует избегать повторного замораживания оттаивания циклов. Это всегда лучше использовать сразу все Алиготе.
    6. Выбрать 5 случайных вирус содержащих трубок для определения среднего вирус культуры ткани инфекционный дозы (TCID50), пробирного цитопатического эффекта (CPE) (1 единица TCID50= 0,7 доска, блок [PFU]).
      Примечание: CPE относится к структурным изменениям в клетки хозяина, вызванные вирусного вторжения. Вируса вызывает лизис клетки-хозяина, или когда клетка умирает без лизис из-за неспособности воспроизвести48.
      1. В день 1 собирайте подготовленных S2 * клетки, закупорить. Подсчитать ячейки. Центрифуга клетки для 300 g x 4 мин и удалить супернатант. Разбавьте клетки к плотности 1 х 106 клеток/мл с полной средой для S2 * ячеек, как описано в шаге 1.1.1.
      2. Семян 1 х 105 S2 * клеток (100 мкл) на хорошо с плоским дном 96-хорошо пластины (~ 30% confluency).
      3. Выполните серийных разведений десятикратного DCV акций с полной средой для S2 * клеток. Добавьте 50 мкл разведений в колодец. 50 мкл питательной среды без вируса, хорошо, хорошо классифицированы как отрицательный контроль.
        Примечание: Для каждого расхода разрежающего, 8 скважин были использованы. Как типичный DCV урожайность около 108-109 ОРП/мл, разрежения по крайней мере должна охватывать ~ 10-5-10-10.
      4. День 4 наблюдать за CPE с микроскопом ярко поле с 20 X или 40 X цели. Классифицировать колодец, в котором клетки выглядят размытыми и среднего полна фрагментов «положительных» и колодец, в котором морфологию клеток нормальных как «негативные хорошо».
      5. Марк CPE положительный или отрицательный скважин с + или –, соответственно. Вычислить вирус TCID50 , Рид и Мюнх метод49.
    7. Утилизация всех загрязненных материалов и перчатки на сковороде обеззараживания. Если вирус не может достичь желаемого TCID50, концентрат 100 мл раствора вирус центрифугированием на 68000 x g за 1 час при 4 ° C.
      Примечание: в зависимости от цели эксперимента, диапазон доз от 102 в 106 TCID50 единицы могут быть использованы для вирусной инфекции. Как правило мы используем 3 х 106 TCID50 единиц.
    8. Отменить супернатант и вновь приостановить в 1 мл буфера Tris-HCl (10 мм, pH 7.2). Аликвота 20 мкл раствора вирус на трубку и хранить при температуре-80 ° C. Выберите 5 случайных трубы, чтобы определить средний вирус TCID50 снова.
  2. Fly подготовки для инфекции
    Примечание: Симбиотические бактерии Wolbachia может подавлять множество видов РНК вируса в насекомых30,,3132,,3341. Таким образом важно, чтобы очистить Wolbachia от мух до изучения хост вирусной инфекции в vivo33.
    1. Готовить летать содержащих тетрациклин, добавив 400 мкл 50 мкг/мл тетрациклина (на 70% этиловом спирте) 4 g свежие стандартных кукурузной муки летать пищи (1 Л еда содержит 77,7 г кукурузной муки, 32.19 г дрожжей, 10.6 g агар, 0,726 g CaCl2 31.62 г сахарозы, 63,3 г глюкозы, 2 g, сорбат калия и 15 мл 5% C8H8O3). Тщательно перемешать и выложите продукты на 4 ° C на ночь испарится этанола.
      Примечание: Высокие дозы этанола могут повлиять на fly фертильность, так что не пропустите этот шаг.
    2. Теплая пища до комнатной температуры и поставить вновь eclosed взрослых мух (20 женщин и 10 мужчин) во флаконе. Порода мух при 25 ° C, влажность 60% под нормальный цикл свет/темно.
      Примечание: Как правило, она занимает 3-4 дней для мухи откладывают яйца достаточно. Слишком много яиц тормозят развитие личинок и снизить эффективность тетрациклинов.
    3. Вновь Соберите eclosed взрослых мух (в течение 3 ~ 5 дней) под светового потока CO2, и повторите шаг ~ 1.2.1-1.2.2. Как правило по крайней мере 3 поколений требуются для ликвидации Wolbachiaполностью.
    4. После 3 поколений с тетрациклинов лечение собирают 5 летит под светового потока CO2 для испытания Wolbachia инфекции. Измельчить летит за 1 мин с 250 мкл двойной дистиллированной воды (ddH2O) и немного стерильной керамический бисер 0,5 мм в 1,5 мл трубки с использованием гомогенизатора. Добавить еще один 250 мкл 2 x буфера A (0,2 М трис-HCl, рН 9,0; 0,2 М ЭДТА; 2% SDS) образца и вихря.
      Примечание: Поскольку СДП будет препятствовать движению шарика, 1 x буфер A не может использоваться непосредственно для измельчения мух. Если мухи имеют красные глаза, удалите головы перед шлифованием, как это может влиять на цвет продукта ДНК.
    5. Замораживание образцов-80 ° C (держать на срок до одного года). Быстро разморозить образца от-80 ° C в 25 ° C водяной бане до растворения. Проинкубируйте образцы при 70 ° C за 30 мин.
    6. Добавить 190 мкл 5 М KOAc, вихрь и инкубировать на льду за 15 минут или дольше.
    7. Центрифугуйте образцы на 13 000 x g 5 мин при комнатной температуре, собирать супернатант и передавать их на новые трубы.
    8. Повторите шаг 1.2.7 для получения ДНК с лучшим качеством.
    9. Добавьте 750 мкл изопропанола для каждой выборки и осторожно перевернуть несколько раз вручную. Инкубации при комнатной температуре в течение 5 мин.
    10. Центрифугуйте образцы на 13 000 x g 5 мин при комнатной температуре и удалить супернатант. Белые гранулы геномной ДНК будет находиться в нижней части трубки.
    11. Добавить 1 мл 70% этанола в гранулы, центрифуги на 13 000 x g 5 минут и отбросить супернатант. Просушите ДНК, до тех пор, пока она становится прозрачным.
    12. Растворить в 100 мкл ddH2O ДНК, титровать концентрации ДНК, UV-Vis абсорбционной спектрофотометрии и разбавленных ДНК до 100 нг/мкл.
    13. Использование 200 нг ДНК для реакции PCR (в системе 20 мкл, см. Таблицу материалов). Выполнять ПЦР по следующей программе: 95 ° C 15 мин; 36 цикл 95 ° C на 45 s, 50 ° C для 45 s и 72 ° C в течение 1 мин; и окончательное расширение шаг (72 ° C за 1 мин) в тепловая велосипедист.
      Примечание: На основе Wolbachia 16S рРНК, используйте следующие грунты: 5' TGAGGAAGATAATGACGG 3' (вперед) и 5' CCTCTATCCTCTTTCAACC 3' (реверс). Для ПОБВ, были грунтовки 5' CATTGGTGTTGGTGTTGGTG 3' (вперед) и 5' ACCGAAATAACGAGCTCCAG 3' (реверс).
    14. Анализ продуктов ПЦР с электрофорез геля агарозы 1%. Размер продукта PCR Wolbachia 16S рРНК и wsp составляет около 200 bp и 600 bp, соответственно.
    15. Задние Wolbachia бесплатно летать запасов на стандартных кукурузной муки покупать продукты питания. Соберите 3-5 день вновь eclosed Самец мухи для инфекции.
      Примечание: Тетрациклинов лечение может также повлиять на кишечную микрофлору состав, который впоследствии влияет противовирусное ответы в узле. Мы рекомендуем, что все мухи должны получить же тетрациклинов лечение. Держите Wolbachia бесплатно мух, растущих в стандартных условиях для по крайней мере 3 поколений, чтобы восстанавливать микрофлору кишечника.
  3. Pastrel генотипирования
    Примечание: Наличие S или R аллель гена pst в генетический фон как сообщается, затрагивают DCV инфекции у дрозофилы34,35. Это необходимо для проверки pst генотип, особенно для DCV инфекции. Есть несколько ОНП в pst , который может повлиять на вирусной инфекции, майор SNP 512 C/т. Градиент температуры ПЦР является быстрый метод для определения генотипа pst .
    1. Экстракт летать геномной ДНК, как описано выше (шаг 1.2.4 - 1.2.15).
    2. Использование 100 нг ДНК как шаблон, 512C грунт, 5' CAGCATGGTGTCCATGAAGTC 3' (вперед) и 5' ACGTGATCAATGCTGAAAGT 3' (реверс) для обнаружения R аллеля, 512T грунт, 5' CAGCATGGTGTCCATGAAGTT 3' (вперед) и 5' ACGTGATCAATGCTGAAAGT 3' (реверс) для обнаружения S аллеля.
    3. Установите градиенты ТМ (температура плавления) следующим: 54 ° C, 54,7 ° C, 55.5 ° C, 58 ° C, 59.7 ° C, 62,2 ° C, 63.7 ° C и 64 ° C (45 s при каждой температуре).
      Примечание: 30 циклов PCR цепной реакции, рекомендуется (20 мкл системы).
    4. Визуализируйте 100-ВР ПЦР продукта на 2% геля агарозы.

2. вирусные инфекции у дрозофилы

  1. Заразить мух нано-инъекции и выполнять анализы выживания.
    1. Вытяните капилляров подготовить инъекций иглами, обратно заполните инъекции игла с маслом и собрать инжектор как описано выше50.
    2. Обезболивают мух на площадку под светового потока CO2. Прививать мух внутри грудной инъекции44 50,6 nL вирус раствора (100 ОРП, разбавляют буфера Tris-HCl, pH 7.2). Инъекционные флаконы по крайней мере 3 мух (20 мух на флакон).
      Примечание: Инъекции времени (обычно 100 мух в час) и DCV репликации очень быстро, поэтому очень важно записать точное время на трубе после окончания каждого флакона (20 мухи). Буфер только инъекция устанавливается как макет элемента управления. Как правило мужчины взрослых мух являются предпочтительными, как результаты являются более стабильными и воспроизводимость, чем при использовании самок, так как гормональные изменения во время спаривания и размножения могут влиять индикация женщин51.
    3. Растут вводят мух при 25 ° C, влажность 60% под нормальный цикл свет/темно. Поставка мух с свежие продукты ежедневно и записывать количество мертвых flies.
    4. Выполнить по крайней мере 3 биологических реплицирует и участок кривой выживания.
    5. Для статистического анализа данных выживания создаваемых Каплана-Мейера кривых выживания статистического программного обеспечения. Выполнение теста журнала ранг для вычисления значений P. В таблице выживания введите информацию для каждого предмета. Программное обеспечение затем вычисляет процент выживания в каждый момент и участки участок выживания Каплана-Мейера.
      Примечание: Не добавляйте дополнительные дрожжей в пробирку. По сравнению с макет элементов управления, DCV-инфицированной мухи иногда имеют асцит и неуклюжий, которые делают их уязвимыми к липкой дрожжей. Это лучше для записи больше времени пунктов в предварительный эксперимент, чтобы узнать сроки, на котором будет происходить массовые смерти для инфицированного мухи. Как правило инфицированного мухи редко умирают в течение первых двух дней, даже для мутантных линий Dcr-2 . Для Wolbachia инфицированных свободный w1118 (Блумингтон 5905) летать с 100 PFU DCV этот временной интервал равен примерно 3-5 дней после инфекции. Плодовых мух, которые умирают в течение 0,5 ч пост инъекции часов не должны учитываться как Фатальность потому, что они могут быть убиты иглы травмы не от вирусной инфекции.
  2. DCV загрузить мера, CPE пробирного
    Примечание: Вирусная нагрузка измеряется аналогично для титрования запасов вируса (шаг 1.1.6), но требует дополнительных пробоподготовки (шаг 2.2.1-2.2.4).
    1. День 1 заразить мужской мух, как описано в шаге 2.1.1-2.1.2. Группа вводят мух в группах по 20 и держать их выращивание на свежие покупать еду на требуемое время (обычно в течение 24 ч или 3 дней). Предоставить мух с свежие продукты ежедневно.
    2. На 2 день, семя дрозофилы S2 * клеток в клетки культуры блюдо 10 см Плотность около 5 x106 до 1 x 107 кл/мл как описано в шаге 1.1.1.
    3. День 3, собрать 5 мух (под светового потока CO2) и растереть их в пластиковых пробирок 1.5 мл за 30 сек с 200 мкл буфера Tris и керамический бисер с использованием гомогенизатора. Хранение образцов-80 ° C или сразу перейти к следующему шагу.
    4. Тщательно вихрь образца. Используйте 1 мл шприц и 0,22 мкм фильтр для фильтрации супернатант в новой 1,5 мл трубки. Продолжите титрование, как описано в шагах 1.1.6.1-1.1.6.5.
  3. DCV нагрузки измеряется qRT-PCR
    1. День 1 заразить мух, как описано выше. Группа вводят Самец мухи (20 мух/группа) и растут на свежие покупать продукты для желаемого времени, обычно 24 h или 3 дней. Предоставить мух с свежие продукты ежедневно.
    2. День 3, собрать 5 летит под поток света CO2 в 1,5 мл трубку с 200 мкл буфера lysis и 20 керамический бисер (диаметр = 0,5 мм), молоть образцы гомогенизатор с высокой скоростью для 30 s. Добавить 800 мкл буфера lysis дополнительных к каждой пробке и хранить s Примеры-80 ° c или немедленно провести РНК добыча и qRT-PCR.
    3. Подготовить РНКазы бесплатные советы, трубы и деионизированная, Диэтилпирокарбонат (DEPC) лечение и 0,22 мкм мембранная фильтрация воды. Добавить 200 мкл хлороформ (≥99.5%) в образце и энергично встряхнуть для 15 s вручную. Инкубируйте на 5 минут или дольше при комнатной температуре до водной фазы и органические фазы четко разделены.
      Примечание: Хлороформ чрезвычайно опасными и должны быть обработаны с осторожностью. Сделать не вихревой образца, который увеличит риск загрязнения ДНК.
    4. Центрифуга образцы на 13 000 x g 15 мин при 4 ° C.
    5. Собирать 400 мкл супернатант и передать новые трубы супернатант. Смешать с же объем изопропиловый спирт (≥ 99,5%), аккуратно перевернуть образцы для 20 раз вручную и затем осадок на 10 минут или дольше при комнатной температуре.
      Примечание: Осадков при-20 ° C увеличит урожайность РНК.
    6. Центрифуга образцы на 13 000 x g 10 мин при 4 ° C. Гранулы белого РНК видны в нижней части трубки.
    7. Отменить супернатант и добавить 1 мл 70% этанола (этанол в воде DEPC) и инвертировать несколько раз, чтобы вымыть РНК.
    8. Центрифуга образцы на 13 000 x g 5 мин при 4 ° C. Отбросить супернатанта и сухой РНК для 5-10 мин; РНК должна стать прозрачным.
    9. Добавьте 50 мкл воды DEPC образца, пипетки для несколько раз и вихрь.
    10. Возьмите 3 мкл РНК для титрования концентрации РНК. Количественного определения РНК в 260 Нм. Обычно концентрация РНК, извлеченные этим протоколом составляет приблизительно 100-500 мкг/мкл, который подходит для синтеза cDNA.
    11. Используйте 2 мкг РНК для синтеза cDNA. Разбавить образца до 100 мкл с ddH2O и хранить при температуре от-20 ° C.
    12. QRT ПЦР согласно инструкциям производителя и запустите qRT ПЦР.
      Примечание: Для синтеза cDNA DCV, случайных праймеров работала намного лучше, чем поли A грунт в наших руках. Выражение mRNA DCV нормируется эндогенного белка рибосомных 49 мРНК (rp49). Праймеры олигонуклеотида используемых в этой части: rp49 5' AGATCGTGAAGAAGCGCACCAAG 3' (вперед) и 5' CACCAGGAACTTCTTGAATCCGG 3' (реверс); DCV, 5' TCATCGGTATGCACATTGCT 3' (вперед) и 5' CGCATAACCATGCTCTTCTG 3' (реверс); Ваго, 5' TGCAACTCTGGGAGGATAGC 3' (вперед) и 5' AATTGCCCTGCGTCAGTTT 3' (реверс); вирус индуцированной 1 РНК (ВИР-1) GATCCCAATTTTCCCATCAA 3' 5' (вперед) и 5' GATTACAGCTGGGTGCACAA 3' (реверс).

Representative Results

Результаты этого раздела после инфекции DCV D. melanogaster. Рисунок 1 показывает схему вирусной инфекции у дрозофилы. Мухи являются вводят внутри thoracically, а затем собраны образцы для измерения вирусной TCID50 и уровень РНК генома (рис. 1). Вирус может вызвать лизис клеток и CPE наблюдается на 3 дня пост инфекции (рис. 2A). Вирусную нагрузку, измеряется CPE assay соответствовала измеряется ПЦР (рис. 2B). Как показано на рисунке 3, Wolbachia подавляет DCV инфекции у дрозофилы. WOL-16s рРНК и wsp праймеры используются для обнаружения присутствия Wolbachia (Рисунок 3А) и Wolbachia-бесплатные мух показывают значительно снижение выживаемости после DCV инфекции (рис. 3B). На рисунке 4 показано, как проверить pst полиморфизм градиентный ПЦР с использованием конкретных грунтовки. Рисунок 5 показывает дозы зависимых эффектов DCV инфекции в wildtype летать. Выживаемость в Рисунок 5A и вирус нагрузки на 3 дня, пост инфекции показано на рисунке 5B. Рисунок 6 показывает, что DCV инфекции может активировать Dcr2/RNAi и JAK/STAT противовирусное, сигнальные пути в принимающей52. Уровень экспрессии Репортер ген vago выражения Dcr2/РНК-интерференции инфекция повышенных 3 дней поста (рис. 6A). Як-STAT путь также активируется при DCV инфекции, которая обозначается уровень экспрессии Репортер ген Вир-1 (Рисунок 6B). Рисунок 7 показывает, что Dcr2/интерференции имеет решающее значение для противовирусное инфекции у дрозофилы52. DCR-2 черепашки мух после инфекции DCV снижение выживаемости (рис. 7A) и увеличение вирусной нагрузки (рис. 7B).

Figure 1
Рисунок 1: схема дрозофилы инфекции и анализ вирусной нагрузки.
Создание дрозофилы инфекции нано-инъекции. Таблица схемы показывает, что мухи заражены внутри thoracically и что вирусную нагрузку измеряются CPE пробирного и qRT-PCR. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 2
Рисунок 2: Анализ нагрузки DCV.
Вирусную нагрузку, измеряется CPE assay соответствовала измеряется ПЦР. (A) S2 * клетки являются культивировали при 25 ° C для 3 дней с другой вирус разрежения (50 мкл). 1 единица TCID50 используется вируса является 4,29 х 109 (эквивалент 3 х 109 ОРП/мл). Первая группа, 10-3 разрежения; Вторая группа, 10-7 разрежения; Третья группа, 10-10 разрежения; Далее Группа, инфекции. Клетки в панели и два показывают типичный позитивные фенотип CPE (белые стрелки показывают ячейки мусор), и клетки панели, три и четыре показывают типичный негативные фенотип. Линейки шкалы указано в цифрах. (B) измерение DCV нагрузка ПЦР. Выполнить последовательный десятикратного разведений DCV и заразить клетки линии S2 *. Общая РНК инфицированных клеток извлекаются и ПЦР проводится для измерения уровня DCV РНК. Соответствие и положительно связаны с измерения ПЦР градиента инфекционной вирусной нагрузки (определяется пробирного CPE) в клетках (r2= 0,999). Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 3
Рисунок 3: Вирусная инфекция мух с или без Wolbachia.
Wolbachia инфекции способствует DCV сопротивления у дрозофилы. (A) Wolbachia присутствие обнаружено wol-16s рРНК и wsp грунтовки. G1, G2 и G3 представлены рудыrмух (Орегон-R) (Блумингтон 5) лечится тетрациклина для одного, двух и трех поколений соответственно. Размер продукта PCR составляет около 200 bp (wol-16s рРНК) и 600 bp (wsp). (B) Wolbachia бесплатно мух более чувствительны к инфекции DCV. с 100 PFU DCV вводят 3-5 день старые мужчины взрослых мух. Wolbachia бесплатно мухи (сплошные линии) показывают значительно сократила выживания чем Wolbachia защищены мухи (тире линии) на DCV инфекции. Две линии различных wildtype, рудаr и w1118, используются для assay выживаемости и показать аналогичный результат. Все планки погрешностей представляют стандартная ошибка (ФБ) по крайней мере три независимых испытаний; * P < 0,05, ** P < 0.01, *** P < 0,001, *** P < 0,0001, НС, не значительные. Каплана Мейера (B). Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 4
Рисунок 4: Pastrel генотипирования градиентный ПЦР.
Полиморфизм PST проверяется градиентный ПЦР. Градиентный ПЦР проводится различать pst R (512 C) и S (512T) аллеля у дрозофилы взрослых. TM градиенты, a: 54 ° C, b: 54,7 ° C, c: 55.5 ° C, d: 58 ° C, 59.7 ° C e:, f: 62,2 ° C, g: 63.7 ° C, h: 64 ° C.  Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 5
Рисунок 5: Выживаемость и DCV титр рудыr мухи заражены различные дозы DCV.
Штуфrмух вводят с трех различных доз DCV, 10 ОРП/летать, 50 ОРП/летать и 100 ОРП/летать. (A) мух выживаемость значительно ниже, когда зараженные с большими дозами инфекционных. (B) уровень DCV РНК в целом органом указанных мух измеряется qRT ПЦР в назначенное время и нормализуется до 10 ОРП/летать прививка группы. Все планки погрешностей представляют стандартная ошибка (ФБ) по крайней мере три независимых испытаний; * P < 0,05, ** P < 0.01, *** P < 0,001, *** P < 0,0001, НС, не значительные. Каплана-Мейера (A) или односторонний дисперсионный анализ (B). Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 6
Рисунок 6: Dcr2/RNAi и противовирусное JAK/STAT, сигнальный путь активации после DCV инфекции.
Штуфrмух были инфицированы 100 PFU DCV. Ваго (A) и мРНК Вир-1 (B), выразила в целом организме измеряются qRT ПЦР в назначенное время точки пост инфекции. Изменение выражения нормируется, базальный уровень до инфекции. Все планки погрешностей представляют стандартная ошибка (ФБ) по крайней мере три независимых испытаний; * P < 0,05, ** P < 0.01, *** P < 0,001, *** P < 0,0001, НС, не значительные. Односторонний дисперсионный анализ (А, Б). Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 7
Рисунок 7: Dcr-2 черепашки летать чувствительны к инфекции DCV.
DCR-2 мутант мух и мух w1118 его генетического контроля были заражены 100 PFU DCV. (A) выживаемость Dcr-2 несовершенным мух и мух одичал тип (w1118) должность DCV инфекции. (B) DCV РНК уровень во всем организме указанных мух измеряется qRT ПЦР 2 дней поста инфекции и нормированы, w1118. Все планки погрешностей представляют стандартная ошибка (ФБ) по крайней мере три независимых испытаний; * P < 0,05, ** P < 0.01, *** P < 0,001, *** P < 0,0001, НС, не значительные. Каплана-Мейера (A) или студента T-тест (B). Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Discussion

В этой статье мы представляем подробную процедуру о том, как создать вирусный инфекционных систему в взрослых Drosophila melanogaster с использованием нано инъекции. Протоколы включают подготовку соответствующих летать линий и вирус фондовой, инфекции методов, оценки инфекционных показателей и измерения противовирусное ответа. Хотя DCV служит примером вирусного возбудителя, десятки различных видов вируса успешно применяется для исследования в системе дрозофилы. Кроме того сотни регуляторные факторы, вируса или хоста, были выявлены в ходе крупномасштабных скрининга в мух. Таким образом, этот метод является весьма гибкой и не ограничивать DCV /дрозофилы взаимодействия.

Успешно распространять и урожай высокий титр DCV, необходимо принять некоторые меры предосторожности. Клетки должны быть здоровыми, культивируемых на подходящие плотности и собирают на время. Сокращение объема клетки культуры не влияет существенно титр вируса. Как правило, 107 клеток, инфицированных DCV в MOI = 0.01 будет наконец урожайность приблизительно 108-109 TCID50 DCV, который может удовлетворить требования большинства в vivo и in vitro экспериментов. CPE пробирного и qRT ПЦР анализа описаны в настоящем Протоколе, для определения вирусной нагрузки. CPE assay как-то сложно. Соответствующую плотность клеток прививка и опытный стандарт положительных/отрицательных CPE дискриминации позволяют быстро и успешно пробирного CPE. Таким образом мы предоставляем легко qRT ПЦР assay здесь помочь решить пороговой разрежения в assay CPE перед мастеринг CPE assay.

Однако DCV является очень мощный вирус для взрослых летать и дрозофилы клеточной линии. Только 100 ОРП/летать прививка может убить 50% диких мух в течение 5 дней. Избыток инфекции доза может тени значение между дикого типа летать и потенциальных восприимчивы линиями. Важно применять по крайней мере две дозы инфекции при инициировании новый экран. Так как массивные смерть дрозофилы может произойти в очень короткое время окно из-за высокой летальности DCV, смерть номер записи более часто в предварительные эксперименты настоятельно рекомендуется. После DCV инфекции некоторые мухи иногда имеют синдром асцит. В частности должны быть исключены мух, которые умирают в течение 0,5 ч пост инфекции, которые могут быть вызваны неуместным иглой инъекции травмы.

Инфекционные прочность DCV зависит также от многих принимающих факторов, которые следует рассмотреть перед началом эксперимента. Wolbachia является вертикальной передачи endosymbiont, который имеет большое влияние на инфекции вируса в32мух. Тетрациклинов лечение в летать еда является общий используемый метод для ликвидации Wolbachia инфекции. Однако этот метод также изменяет состав кишечной микробиоты, который в свою очередь может повлиять на противовирусное ответ53. Несколько исследований подчеркивали значение генетических отклонений на вирусной инфекции36, например ubc-e2h, cg8492 и pst. Например большинство дикого типа летать линии имеют pst S аллелей и чувствительны к picorna как вирус, в то время как большинство мутантных линий, мы проверили из Блумингтон фондовый центр pst R аллеля, таким образом с устойчивостью фенотипов. Это очень важно исключить влияние pst, особенно когда отсева сопротивления гена, сравнивая с дикого типа управления29.

Помимо нано инъекции побудить системные инфекции другие методы доступны для изучения вирусной инфекции в мух. Дрозофилы клеточных линий доказали быть высок объём метод отсеивать вирусной инфекции связанных с принимающей клеточных компонентов37,38. Однако в пробирке системы всегда сопровождается высокий уровень ложных срабатываний, когда подтверждение в естественных условиях. DCV могут также применяться к заразить дрозофилы устно, в то время как это может только вызвать ограниченного и мягким инфекции. Только 20% личинок были инфицированы в течение 12 ч и 14% смертности было отмечено, с только 25% смертности в течение 20 дней в взрослых мух22. Прокалывание мух с штифтами диаметром 0,15 мм это еще один способ задания вирусной инфекции, но он не может обеспечить точное инфекции доза и количественных повторяемость. Экспрессирующих вирусные белки, генетические манипуляции в мухи является хорошим способом для изучения молекулярных interactomes в vivo7. Однако она не может изобразить реальность физиологии и патологии в принимающей страны после инфекции. Тем временем нано инъекционный метод также имеет недостатки, поскольку он не является естественным маршрутом инфекции и непосредственно может стимулировать иммунную систему сильной системы сразу после инфекции, которая обошла кутикулы, первая линия обороны противовирусное. В целом цели конкретные исследования и доступные экспериментальные условия являются решающими факторами в выборе между различными методами.

Disclosures

Авторы не имеют ничего сообщать.

Acknowledgments

Мы хотели бы поблагодарить весь Пан лаборатории в IPS. CAS. Мы благодарим Ванг Lanfeng (IPS, CAS) для экспериментальной помощи и доктор Gonalo Cordova Steger (Springer природы), доктор Джессика Варгас (IPS, Париж) и доктор Seng Чжу (IPS, Париж) для комментариев. Эта работа была поддержана грантов из стратегических приоритетных исследований программы Китайской академии наук L.P (XDA13010500) и H.T (XDB29030300), Национальный фонд естественных наук Китая L.P (31870887 и 31570897) и J.Y (31670909). L.P является членом CAS молодежных инноваций ассоциации (2012083).

Materials

Name Company Catalog Number Comments
0.22um filter Millipore SLGP033RS
1.5 ml Microcentrifuge tubes Brand 352070
1.5 ml RNase free Microcentrifuge tubes Axygen MCT-150-C
10 cm cell culture dish Sigma CLS430167 Cell culture
100 Replacement tubes Drummond Scientific 3-000-203-G/X
15 ml tube Corning 352096
ABI 7500 qPCR system ABI 7500 qPCR
Cell Incubator Sanyo MIR-553
Centriguge Eppendof 5810R
Centriguge Eppendof 5424R
Chloroform Sigma 151858 RNA extraction
DEPC water Sigma 95284-100ML RNA extraction
Drosophila Incubator Percival I-41NL Rearing Drosophila
FBS Invitrogen 12657-029 Cell culture
flat bottom 96-well-plate Sigma CLS3922 Cell culture
Fluorescence microscope Olympus DP73
Isopropyl alcohol Sigma I9516 RNA extraction
Lysis buffer (RNA extraction) Thermo Fisher 15596026 TRIzol Reagent
Lysis buffer (liquid sample RNA extraction) Thermo Fisher 10296028 TRIzol LS Reagent
Microscope Olympus CKX41
Nanoject II Auto-Nanoliter Injector Drummond Scientific 3-000-204 Nanoject II Variable Volume (2.3 to 69 nL) Automatic Injector with Glass Capillaries (110V)
Optical Adhesive Film ABI 4360954 qPCR
Penicillin-Streptomycin, Liquid Invitrogen 15140-122 Cell culture
qPCR plate ABI A32811 qPCR
Schneider’s Insect Medium Sigma S9895 Cell culture
statistical software GraphPad Prism 7
TransScript Fly First-Strand cDNA Synthesis SuperMix TransScript AT301 RNA extraction
Vortex IKA VORTEX 3 RNA extraction

DOWNLOAD MATERIALS LIST

References

  1. Rahim, M. A., Uddin, K. N. Chikungunya: an emerging viral infection with varied clinical presentations in Bangladesh: Reports of seven cases. BMC Research Notes. 10, 410 (2017).
  2. Douam, F., Ploss, A. Yellow Fever Virus: Knowledge Gaps Impeding the Fight Against an Old Foe. Trends in Microbiology. (2018).
  3. Santiago, G. A., et al. Performance of the Trioplex real-time RT-PCR assay for detection of Zika, dengue, and chikungunya viruses. Nature Communications. 9. 9, 1391 (2018).
  4. Gould, E., Pettersson, J., Higgs, S., Charrel, R., de Lamballerie, X. Emerging arboviruses: Why today? One Health. 4, 1-13 (2017).
  5. Hughes, T. T., et al. Drosophila as a genetic model for studying pathogenic human viruses. Virology. 423, 1-5 (2012).
  6. Xu, J., Cherry, S. Viruses and antiviral immunity in Drosophila. Developmental & Comparative Immunology. 42, 67-84 (2014).
  7. Shirinian, M., et al. A Transgenic Drosophila melanogaster Model To Study Human T-Lymphotropic Virus Oncoprotein Tax-1-Driven Transformation In Vivo. Journal of Virology. 89, 8092-8095 (2015).
  8. Adamson, A. L., Chohan, K., Swenson, J., LaJeunesse, D. A Drosophila model for genetic analysis of influenza viral/host interactions. Genetics. 189, 495-506 (2011).
  9. Hao, L., et al. Drosophila RNAi screen identifies host genes important for influenza virus replication. Nature. 454, 890-893 (2008).
  10. Webster, C. L., et al. The Discovery, Distribution, and Evolution of Viruses Associated with Drosophila melanogaster. Plos Biology. 13, e1002210 (2015).
  11. Heigwer, F., Port, F., Boutros, M. RNA Interference (RNAi) Screening in Drosophila. Genetics. 208, 853-874 (2018).
  12. West, C., Silverman, N. p38b and JAK-STAT signaling protect against Invertebrate iridescent virus 6 infection in Drosophila. PLOS Pathogens. 14, e1007020 (2018).
  13. Liu, Y., et al. STING-Dependent Autophagy Restricts Zika Virus Infection in the Drosophila Brain. Cell Host & Microbe. 24, 57-68 (2018).
  14. Wang, X. H., et al. RNA interference directs innate immunity against viruses in adult Drosophila. Science. 312, 452-454 (2006).
  15. van Rij, R. P., et al. The RNA silencing endonuclease Argonaute 2 mediates specific antiviral immunity in Drosophila melanogaster. Genes & Development. 20, 2985-2995 (2006).
  16. Deddouche, S., et al. The DExD/H-box helicase Dicer-2 mediates the induction of antiviral activity in drosophila. Nature Immunology. 9, 1425-1432 (2008).
  17. Chotkowski, H. L., et al. West Nile virus infection of Drosophila melanogaster induces a protective RNAi response. Virology. 377, 197-206 (2008).
  18. Paradkar, P. N., Trinidad, L., Voysey, R., Duchemin, J. B., Walker, P. J. Secreted Vago restricts West Nile virus infection in Culex mosquito cells by activating the Jak-STAT pathway. Proceedings of the National Academy of Sciences of the United States of America. 109, 18915-18920 (2012).
  19. Souza-Neto, J. A., Sim, S., Dimopoulos, G. An evolutionary conserved function of the JAK-STAT pathway in anti-dengue defense. Proceedings of the National Academy of Sciences of the United States of America. 106, 17841-17846 (2009).
  20. Zambon, R. A., Nandakumar, M., Vakharia, V. N., Wu, L. P. The Toll pathway is important for an antiviral response in Drosophila. Proceedings of the National Academy of Sciences of the United States of America. 102, 7257-7262 (2005).
  21. Costa, A., Jan, E., Sarnow, P., Schneider, D. The Imd pathway is involved in antiviral immune responses in Drosophila. PLoS One. 4, e7436 (2009).
  22. Ferreira, A. G., et al. The Toll-dorsal pathway is required for resistance to viral oral infection in Drosophila. PLOS Pathogens. 10, e1004507 (2014).
  23. Moy, R. H., et al. Antiviral autophagy restrictsRift Valley fever virus infection and is conserved from flies to mammals. Immunity. 40, 51-65 (2014).
  24. Shelly, S., Lukinova, N., Bambina, S., Berman, A., Cherry, S. Autophagy is an essential component of Drosophila immunity against vesicular stomatitis virus. Immunity. 30, 588-598 (2009).
  25. Bronkhorst, A. W., et al. The DNA virus Invertebrate iridescent virus 6 is a target of the Drosophila RNAi machinery. Proceedings of the National Academy of Sciences of the United States of America. 109, E3604-E3613 (2012).
  26. Palmer, W. H., Medd, N. C., Beard, P. M., Obbard, D. J. Isolation of a natural DNA virus of Drosophila melanogaster, and characterisation of host resistance and immune responses. PLOS Pathogens. 14, e1007050 (2018).
  27. Jousset, F. X., Bergoin, M., Revet, B. Characterization of the Drosophila C virus. Journal of General Virology. 34, 269-283 (1977).
  28. Gupta, V., Stewart, C. O., Rund, S. S. C., Monteith, K., Vale, P. F. Costs and benefits of sublethal Drosophila C virus infection. J Evol Biol. 30, 1325-1335 (2017).
  29. Yang, S., et al. Bub1 Facilitates Virus Entry through Endocytosis in a Model of Drosophila Pathogenesis. Journal of Virology. (2018).
  30. Teixeira, L., Ferreira, A., Ashburner, M. The bacterial symbiont Wolbachia induces resistance to RNA viral infections in Drosophila melanogaster. Plos Biology. 6, e2 (2008).
  31. Ferguson, N. M., et al. Modeling the impact on virus transmission of Wolbachia-mediated blocking of dengue virus infection of Aedes aegypti. Science Translational Medicine. 7, 279ra237 (2015).
  32. Hedges, L. M., Brownlie, J. C., O'Neill, S. L., Johnson, K. N. Wolbachia and virus protection in insects. Science. 322, 702 (2008).
  33. Bhattacharya, T., Newton, I. L. G., Hardy, R. W. Wolbachia elevates host methyltransferase expression to block an RNA virus early during infection. PLOS Pathogens. 13, e1006427 (2017).
  34. Magwire, M. M., et al. Genome-wide association studies reveal a simple genetic basis of resistance to naturally coevolving viruses in Drosophila melanogaster. PLOS Genetics. 8, e1003057 (2012).
  35. Cao, C., Cogni, R., Barbier, V., Jiggins, F. M. Complex Coding and Regulatory Polymorphisms in a Restriction Factor Determine the Susceptibility of Drosophila to Viral Infection. Genetics. 2159-2173 (2017).
  36. Martins, N. E., et al. Host adaptation to viruses relies on few genes with different cross-resistance properties. Proceedings of the National Academy of Sciences of the United States of America. 111, 5938-5943 (2014).
  37. Moser, T. S., Sabin, L. R., Cherry, S. RNAi screening for host factors involved in Vaccinia virus infection using Drosophila cells. Journal of Visualized Experiments. (2010).
  38. Zhu, F., Ding, H., Zhu, B. Transcriptional profiling of Drosophila S2 cells in early response to Drosophila C virus. Journal of Virology. 10, 210 (2013).
  39. Ekstrom, J. O., Hultmark, D. A Novel Strategy for Live Detection of Viral Infection in Drosophila melanogaster. Scientific Reports. 6, 26250 (2016).
  40. Durdevic, Z., et al. Efficient RNA virus control in Drosophila requires the RNA methyltransferase Dnmt2. EMBO Reports. 14, 269-275 (2013).
  41. Chrostek, E., et al. Wolbachia variants induce differential protection to viruses in Drosophila melanogaster: a phenotypic and phylogenomic analysis. PLOS Genetics. 9, e1003896 (2013).
  42. Gupta, V., Vale, P. F. Nonlinear disease tolerance curves reveal distinct components of host responses to viral infection. Royal Society Open Science. 4, 170342 (2017).
  43. Chtarbanova, S., et al. Drosophila C virus systemic infection leads to intestinal obstruction. Journal of Virology. 88, 14057-14069 (2014).
  44. Merkling, S. H., van Rij, R. P. Analysis of resistance and tolerance to virus infection in Drosophila. Nature Protocols. 10, 1084-1097 (2015).
  45. Goic, B., et al. RNA-mediated interference and reverse transcription control the persistence of RNA viruses in the insect model Drosophila. Nature Immunology. 14, 396-403 (2013).
  46. Ashburner, M., Golic, K., Hawley, R. S. Drosophila: A Laboratory Handbook. Cold Spring Harbor Laboratory Press. (2011).
  47. Biochemical and Biophysical Research Communications: 1991 index issue. Cumulative indexes for volumes 174-181. Biochemical and Biophysical Research Communications. 1-179 (1991).
  48. Cotarelo, M., et al. Cytopathic effect inhibition assay for determining the in-vitro susceptibility of herpes simplex virus to antiviral agents. Journal of Antimicrobial Chemotherapy. 44, 705-708 (1999).
  49. Reed, L. J. M., H, A simple method of estimating fifty percent endpoints. The American Journal of Hygiene. 27, 493-497 (1938).
  50. Khalil, S., Jacobson, E., Chambers, M. C., Lazzaro, B. P. Systemic bacterial infection and immune defense phenotypes in Drosophila melanogaster. Journal of Visualized Experiments. e52613 (2015).
  51. Schwenke, R. A., Lazzaro, B. P. Juvenile Hormone Suppresses Resistance to Infection in Mated Female Drosophila melanogaster. Current Biology. 27, 596-601 (2017).
  52. Sabin, L. R., Hanna, S. L., Cherry, S. Innate antiviral immunity in Drosophila. Current opinion in immunology. 22, 4-9 (2010).
  53. Yin, J., Zhang, X. X., Wu, B., Xian, Q. Metagenomic insights into tetracycline effects on microbial community and antibiotic resistance of mouse gut. Ecotoxicology. 24, 2125-2132 (2015).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics