הקמתה של זיהום נגיפי וניתוח של התערבות מארח-וירוס דרוזופילה Melanogaster

* These authors contributed equally
Immunology and Infection
 

Summary

פרוטוקול זה מתאר כיצד להקים זיהום ויראלי ויוו דרוזופילה melanogaster באמצעות שיטת ננו-הזרקת טכניקות בסיסיות כדי לנתח וירוס-פונדקאי אינטראקציה.

Cite this Article

Copy Citation | Download Citations

Yang, S., Zhao, Y., Yu, J., Fan, Z., Gong, S. t., Tang, H., Pan, L. Establishment of Viral Infection and Analysis of Host-Virus Interaction in Drosophila Melanogaster. J. Vis. Exp. (145), e58845, doi:10.3791/58845 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

וירוס מפיצים הוא הגורם העיקרי במחלות מדבקות. לפיכך, להבין את האינטראקציה בין הוירוס המארח הוא מאוד חשוב להרחיב את הידע שלנו על מניעה וטיפול של זיהום ויראלי. זבוב הפירות melan דרוזופילהogaster הוכיחה להיות אחד האורגניזמים מודל פורה ויעיל ביותר המסך עבור גורמים אנטי ויראליים ולחקור אינטראקציה וירוס-מארח, בשל כלים גנטית חזקים מאוד שנשמרת חיסונית מולדת איתות המסלולים. ההליך המתואר כאן מדגים שיטת ננו-הזרקת ליצור זיהום נגיפי, זירוז תגובות אנטי מערכתית של הזבוב הבוגר. שליטה מדויקת של המינון הזרקת ויראלי בשיטה זו מאפשר הפארמצבטית ניסויית גבוהה. הפרוטוקולים המתוארים במחקר זה כוללים את ההכנה של זבובים, הווירוס, בשיטת הזרקה, ניתוח שיעור הישרדות, המדידה עומס וירוס הערכה מסלול אנטי ויראליים. ההשפעות ההשפעה של זיהום נגיפי מאת רקע הזבובים שהוזכרו כאן. שיטה זו דלקת היא קלה לביצוע, הדיר באופן כמותי; זה יכול להיות מיושם על המסך עבור המחשב המארח/ויראלי הגורמים המעורבים באינטראקציה וירוס-מארח, לנתח crosstalk בין החיסון מולדים איתות מסלולים ביולוגיים אחרים בתגובה זיהום ויראלי.

Introduction

מתעוררים זיהומים נגיפיים, במיוחד על-ידי arboviruses, כגון וירוס Chikungunya1, נגיף דנגי, קדחת צהובה וירוס2 ו-וירוסZika3, כבר היוו איום על בריאות הציבור על-ידי גרימת מגיפות 4. לפיכך, הבנה טובה יותר של וירוס-פונדקאי אינטראקציה הפך להיות חשוב יותר ויותר שליטה מגיפה וטיפול מחלות ויראליות אצל בני אדם. עבור מטרה זו, חייב להקים מודלים מתאימים ויעילים יותר לחקור את המנגנונים בנגיף.

זבוב הפירות, Drosophilamelanogaster (melanogaster ד), מספקת מערכת חזקה לחקור וירוס-פונדקאי אינטראקציה5,6 , הוכיחה להיות אחד המודלים היעילה ביותר לחקר מחלות ויראליות האדם7 , 8 , 9. נגיפים מאוד שנשמרת איתות משעולים, האחד והיחיד כלים גנטיים לגרום זבובים מודל לייצר תוצאות משמעותיות עם השלכות אמיתי לחקר נגיפים אנושיים. בנוסף, זבובים הם קלה וזולה לשמור על מעבדה, והם נוחים להקרנה בקנה מידה גדול של גורמים רגולטוריים הרומן6,10 הנגיף, המארח במהלך זיהום.

ארבע הגדולות מאוד שנשמרת מסלולים אנטי ויראליים (למשל., ה RNA מסלול של הפרעה (RNAi)11, מסלול JAK-STAT12, מסלול NF-κB ולאחר מסלול autophagy13) נלמדים גם בדרוזופילה האחרונים שנה6. מסלול RNAi היא מנגנון אנטי-ויראלי רחב יכול לדכא את רוב סוגי וירוס זיהום6,14. הפרעה של מסלול זה על ידי מוטציה בגנים כמו מקצץ-2 (Dcr-2) או Argonaute 2 (AGO2) יכול להוביל וירוס מוגברת כייל נוגדנים ומנחה התמותה15,16,17. הנתיב JAK-STAT היה מעורב השליטה זיהום על ידי וירוס של משפחת Dicistroviridae ומשפחת Flaviviridae בחרקים, למשל., וירוס דרוזופילה C (DCV) זבובים16 ו וירוס הנילוס המערבי (WNV) וירוס דנגה יתושים18,19. אגרה דרוזופילה (הומולוגי ל מסלול NF-κB אנושי) חיסוני (IMD) מסלולים (בדומה מסלול NF-κB ו- TNF אנושי) הן מעורב מגן וירוס הפלישה20,21, 22. autophagy הוא במנגנון שנשמרת אחר מעורב ברגולציה של זיהום ויראלי, אשר מאופיין היטב דרוזופילה23,24. לפיכך, זיהוי גורמים רגולטוריים הרומן של מסלולים אלה ויבתר crosstalk בין אלה איתות נגיפים ועוד מסלולים ביולוגיים, כגון חילוף החומרים, הזדקנות, התגובה העצבית וכן הלאה, ניתן בקלות להגדיר ב- דרוזופילה מערכת.

למרות ביותר ומבוססת במודלים דרוזופילה זיהומיות ויראליות הם המושרה על ידי RNA וירוסים, זיהום על ידי 6I וירוס ססגוני הגעה (IV-6) וירוסים קליתיאה (kallithea) הראו הפוטנציאל ללימוד הווירוסים DNA זבובים25, 26. יתר על כן, ניתן לשנות את הנגיף גם כדי לאפשר זיהום של דרוזופילה, כגון וירוס שפעת9. זה התרחב באופן משמעותי את היישום של פלטפורמת הסינון דרוזופילה . בהליך זה, אנו משתמשים DCV כדוגמה כדי לתאר כיצד לפתח מערכת זיהומיות ויראליות דרוזופילה. DCV הוא חיובי-סנס נטושים RNA שוירוס יחיד של נוקלאוטידים כ 9300, קידוד חלבונים 927. בתור חיידק הטבעי של melanogaster ד, DCV נחשב כמו וירוס מתאים ללמוד התגובה החיסונית פיזיולוגיים, התנהגותי, הבסיס מארח במהלך אינטראקציה והתפתחות משותף מארח-וירוס28. בנוסף, שיעור התמותה המהירה שלה בעקבות זיהום פראי סוג בזבובים הופכת DCV שימושי עבור גנים עמיד או רגישים מסך מארח29.

עם זאת, ישנם מספר היבטים של דאגה כשלמדתי זיהומים נגיפיים ב דרוזופילה. לדוגמה, חיידקים סימביוטיים Wolbachia יש את היכולת לעכב את ספקטרום רחב של התפשטות וירוס רנ א ב דרוזופילה וכילה נגד יתושים30,31,32. הראיות זה התבצעה מציגה את מנגנון אפשרי אשר Wolbachia רחובות Sindbis (SINV) בנגיף דרך קולטנים upregulation של methyltransferase Mt2 ביטוי מארח33. בנוסף, הרקע הגנטי של חרקים גם הוא קריטי עבור זיהום ויראלי. למשל, פולימורפיזם טבעי בגן, pastrel (pst), קובעת את הרגישות לזיהום DCV דרוזופילה34,35, בעוד מנחלת Ubc-E2H ו- CG8492 מעורבים קריקט שיתוק וירוס (CrPV) ואת הצאן הבית זיהום בנגיף (FHV), בהתאמה36.

הדרכים מסוים להקים את האינטראקציה וירוס-פונדקאי בזבובים, להיבחר על-פי מחקר למטרות כגון מסך תפוקה גבוהה עבור מרכיבי התא המארח דרוזופילה תא קווים37,38, אוראלי זיהום ללמוד תגובה אנטי-ויראלי ספציפי בטן22,39,40, המחט חירור41,42 או ננו-הזרקת על-ידי העברת אפיתל מחסומים כדי לעורר החיסונית מערכתית תגובות. ננו-הזרקת בדיוק יכול לשלוט המינון ויראלית כדי לגרום תגובה אנטי ויראליים מבוקרת, הנגע פיזיולוגיים43, ומבטיח הפארמצבטית ניסויית גבוהה44. במחקר זה, אנו מתארים שיטה ננו-הזרקת ללמוד אינטראקציות וירוס-מארח דרוזופילה, הדגשת חשיבות תופעות רקע הזבובים.

Protocol

הערה: לפני תחילת הניסוי, שורות תאים ומניות לטוס פעם חייב לא להיות שזוהמו על ידי פתוגנים אחרים, במיוחד עבור וירוסים כגון DCV, FHV, דרוזופילה-וירוס (DXV), ווירוס דלקת כליות העופות (ANV). באופן אידיאלי, רצפי RNA או מזהה מבוססי ה-PCR פשוטים משמשים כדי לזהות את זיהום10,45. אם זיהום אירעה, שורות תאים ומניות לטוס לא אמור לשמש יותר עד שהם ושוקמו לחלוטין46.

1. וירוסים והכנת לעוף

  1. הפצת וירוס וגבייה
    הערה: דרוזופילה S2 * תאים משמשים DCV הפצת טיטור. S2 * תא הקו נגזרת תרבות העיקרי של עוברי ד melanogaster בשלב מאוחר. שורת התאים. זה היה טוב כפי שתוארה לעיל47.
    1. ינבכ S2 * בתאים דרוזופילה בינוני של שניידר 25 ° c ללא נוספים CO2, טפט רופף, חסיד למחצה בצלחת תרבות תא 10 ס מ, על צפיפות של עונה 1 פרק 107 קיימא תאים/mL. שימוש בינוני מלא עבור תאים S2 *: דרוזופילה בינוני של שניידר המכיל 10% חום להשבית FBS, 100 יחידות למ"ל פניצילין ו 100 μg/mL סטרפטומיצין.
      הערה: תאים בריאים צריך להראות עגול, מוצג גודל הומוגנית.
    2. במהירות להפשיר את מניות DCV מ-80 מעלות צלזיוס בתוך אמבט מים 25 ° C. להדביק תאים S2 * עם DCV-MOI = 0.01 באופן מיידי על-ידי הוספת 1 מ"ל של וירוס פתרון ישירות הכלים התרבות התא (אזור גידול: 55 ס מ2) עם 10 מ"ל של מדיום מלאה עבור S2 * תאים.
    3. תקופת דגירה תאים 25 ° c של 3 עד 5 ימים. כאשר הוירוס מוכן לאיסוף, המורפולוגיה התא יהיה חריג (צורת התא נראה טשטוש) והוא המדיום תרבות מלא מעידה על שאריות תאים שחור חלקיקים.
    4. לאסוף את התרבות התא כולו צינור 15 מ"ל על ידי pipetting למעלה ולמטה ומקפיאים ב-80 מעלות צלזיוס (במשך שנה).
      הערה: DCV ניתן לאחסן לתקופות ממושכות של זמן ב-80 מעלות צלזיוס עם הפסד מינימלי של infectivity, עד שנה אחת.
    5. להפשיר את התרבות התא באמבט מים 25 ° C עם טלטול מתמיד, אז צנטריפוגה ב 6,000 g x, למשך 15 דקות ב 4 º C. לאסוף את תגובת שיקוע צינור סטרילי 15 מ"ל ו מערבולת. Aliquot עד μL 200 של וירוס פתרון למחזור.
      הערה: וירוס aliquots ניתן לאחסן לתקופות קצרות של עד 3 ימים ב- 4 מעלות צלזיוס, עד 1 שנה ב-80 מעלות צלזיוס. יש להימנע מחזורים ההקפאה חוזרות ונשנות-הפשרה. . זה תמיד עדיף להשתמש בבת אחת את כל aliquot...
    6. לבחור 5 אקראי המכיל וירוס צינורות כדי לקבוע את ממוצע וירוס תרביות רקמה מינון זיהומיות (TCID50) על ידי assay ציטופתי (CPE) (1 יחידה של TCID50= 0.7 פלאק ויוצרים יחידה [PFU]).
      הערה: CPE מתייחס שינויים מבניים בתאי המארח הנגרמת על ידי הפלישה ויראלי. הווירוס המזהם גורמת פירוק של התא המארח, או כאשר התא מת ללא פירוק עקב חוסר יכולת להתרבות48.
      1. יום 1, לאסוף מוכן S2 * תאים על ידי pipetting. לספור את מספר התאים. צנטריפוגה תאים עבור 300 גרם x במשך 4 דקות וזורקים את תגובת שיקוע. לדלל את התאים לצפיפות של עונה 1 פרק 106 תאים למ"ל בינונית מלאה עבור S2 * התאים כפי שמתואר בשלב 1.1.1.
      2. זרע עונה 1 פרק 105 S2 * תאי (100 μL) ובכן שטוח-96-ובכן-צלחת התחתון (~ 30% confluency).
      3. ביצוע דילולים 10-fold סדרתי של המניה DCV בינונית מלאה עבור S2 * תאים. להוסיף 50 דילולים µL לתוך הבאר. להוסיף 50 µL של תרבות בינונית ללא וירוס הבאר מסווגים את הפקד שלילי. טוב.
        הערה: עבור כל שיעור הדילול, בארות 8 שימשו. כמו התשואה DCV טיפוסי הוא סביב 108-109 PFU/mL, הדילול אמור לכסות לפחות ~ 10-5-10-10.
      4. יום 4, להתבונן CPE עם מיקרוסקופ שדה בהיר עם 20 X או המטרה X 40. לסווג באר בו התאים נראים מטושטשים, המדיום הוא מלא קטעים "באר חיובית", וכן באר שבה המורפולוגיה תא נורמלי כמו "ובכן שלילי".
      5. מארק CPE בארות חיובית או שלילית עם + או-, בהתאמה. לחשב את הוירוס TCID50 מאת ריד, Muench שיטת49.
    7. השלך כל חומרים מזוהמים וכפפות במחבת טיהור. אם הווירוס לא מצליח להשיג את TCID הרצוי50, להתרכז 100 מ של וירוס פתרון על ידי צריך שתוציאו כ-68,000 g x עבור h 1-4 מעלות צלזיוס.
      הערה: בהתאם מטרת הניסוי, מגוון של מנות גדולות מ-102 ל- 10 יחידות6 TCID50 יכול לשמש עבור זיהום בנגיף. בדרך כלל, אנו משתמשים6 TCID50 3 x 10 יחידות.
    8. למחוק את תגובת שיקוע והשהה מחדש ב 1 מ"ל של מאגר טריס-HCl (10 מ מ, pH 7.2). Aliquot 20 μL של וירוס פתרון לכל שפופרת וחנות ב-80 מעלות צלזיוס. לבחור 5 צינורות אקראי כדי לקבוע את הוירוס הממוצע TCID50 שוב.
  2. לטוס לקראת זיהום
    הערה: חיידקים סימביוטיים Wolbachia יכול לדכא סוגים רבים של זיהום בנגיף ה-RNA חרקים30,31,32,33,41. לכן חיוני לטהר Wolbachia מהזבובים לפני שלמדתי את המארח-וירוס זיהום ויוו33.
    1. להכין אוכל לטוס המכילה טטרציקלין על-ידי הוספת μL 400 של טטרציקלין 50 µg/mL (ב-70% אתנול) 4 גר' קמח תירס סטנדרטי טריים אוכל לעוף (1 ליטר של מזון מכיל 77.7 גר' קמח תירס, 32.19 גר' שמרים, 10.6 גר' אגר, 0.726 גר' CaCl2 31.62 גר' סוכרוז, 63.3 גר' גלוקוז, דור 2 של אשלגן sorbate ו-15 מיליליטר 5% C-8H-8O-3). מערבבים היטב ומניחים את האוכל ב 4 מעלות צלזיוס למשך הלילה מתמוססות אתנול.
      הערה: מינון גבוה של אתנול עלולה להשפיע פוריות לטוס, אז לא ישמיטו שלב זה.
    2. מומלץ לחמם את המזון לטמפרטורת החדר ולשים לאחרונה eclosed הזבוב הבוגר (20 נקבות וזכרים 10) המבחנה. גזע הזבובים 25 ° c, 60% לחות תחת מחזור/כהה נורמליים.
      הערה: בדרך כלל, זה לוקח 3-4 ימים על הזבובים להטיל ביצים מספיק. ביצים רבות מדי לעכב התפתחות הזחלים ולהקטין יעילות טטרציקלין.
    3. לאסוף לאחרונה הזבוב הבוגר eclosed (בתוך 3 ~ 5 ימים) תחת זרם אור CO2, וחזור על שלב מספר ~ 1.2.1-1.2.2. בדרך כלל, לפחות 3 דורות נדרשים למניעת לחלוטין Wolbachia.
    4. לאחר 3 דורות עם הטיפול טטרציקלין, לאסוף זבובים 5 תחת זרם אור של CO2 עבור הבדיקה זיהום Wolbachia . לטחון זבובים עבור 1 דקות עם 250 μL של מים מזוקק פעמיים (ddH2O), כמה 0.5 מ מ סטרילי קרמיקה חרוזים צינור 1.5 mL באמצעות מהמגן. להוסיף עוד 250 μL של 2 x מאגר A (0.2 0.2 מ' EDTA; 2% מרחביות; מ' טריס-HCl, pH 9.0) לדוגמה, מערבולת.
      הערה: מאז מרחביות לעכב את התנועה חרוז, 1 x A מאגר לא ישירות לשמש לטחון זבובים. אם הזבובים יש עיניים אדומות, הסר ראשי לפני שחיקה, כפי זה עשוי להשפיע על הצבע של מוצר ה-DNA.
    5. להקפיא את הדגימות ב-80 מעלות צלזיוס (שמור עד שנה אחת). במהירות להפשיר הדגימה מ-80 מעלות צלזיוס בתוך אמבט מים 25 ° C עד התפרקה. דגירה בדגימות ב 70 מעלות צלזיוס למשך 30 דקות.
    6. להוסיף μL 190 של 5 מ' KOAc, מערבולת דגירה על קרח למשך 15 דקות או יותר.
    7. צנטריפוגה דגימות ב g 13,000 x למשך 5 דקות בטמפרטורת החדר, לאסוף את תגובת שיקוע, להעביר אותם צינורות חדשים.
    8. חזור על שלב 1.2.7 להשיג DNA עם איכות טובה יותר.
    9. להוסיף μL 750 של אלכוהול איזופרופיל כל דגימה, היפוך בעדינות מספר פעמים על ידי יד. דגירה בטמפרטורת החדר במשך 5 דקות.
    10. צנטריפוגה דגימות-13,000 g x עבור 5 דקות בטמפרטורת החדר וזורקים את תגובת שיקוע. בגדר דנ א גנומי לבן תישאר בתחתית הצינורית.
    11. להוסיף 1 מ"ל אתנול 70% כדורי, צנטריפוגה ב 13,000 x g במשך 5 דקות, ולמחוק את תגובת שיקוע. מילה נהדרת הדנ א עד שיהפוך לשקוף.
    12. ה-DNA ב 100 μL של ddH2O, titrate ריכוז ה-DNA על ידי ספקטרופוטומטר UV-Vis הקליטה ו לדלל דנ א 100 ng/μL.
    13. שימוש 200 ng של ה-DNA עבור התגובה PCR (במערכת 20 μL, ראה את הטבלה של חומרים). לבצע PCR על-ידי התוכנית הבאה: 95 מעלות צלזיוס למשך 15 דקות; מחזור 36 של 95 מעלות צלזיוס במשך 45 s, 50 מעלות צלזיוס במשך 45 s, ו- 72 מעלות צלזיוס במשך 1 דקה; ובצעד סיומת הסופי (72 מעלות צלזיוס במשך 1 דקה) הצנטרפוגה תרמי.
      הערה: על סמך של rRNA Wolbachia מטוסי אף-16, להשתמש את תחל הבאים: 5' TGAGGAAGATAATGACGG 3' (קדימה) ו- 5' CCTCTATCCTCTTTCAACC 3' (הפוכה). Wsp, תחל היו 5' CATTGGTGTTGGTGTTGGTG 3' (קדימה) ו- 5' ACCGAAATAACGAGCTCCAG 3' (הפוכה).
    14. לנתח את מוצרי ה-PCR עם 1% agarose בג'ל. גודל מוצר ה-PCR Wolbachia מטוסי אף-16 rRNA ו wsp הוא בסביבות 200 bp ו- 600 bp, בהתאמה.
    15. אחורי Wolbachia מניות לטוס חינם על אוכל לטוס קמח תירס סטנדרטי. לאסוף 3-5 ימים לאחרונה eclosed זכר זבובים על זיהום.
      הערה: טטרציקלין טיפול יכול להשפיע גם בהרכב microbiota מעיים, אשר לאחר מכן השפעות תגובות אנטי ויראליים במארח. אנו ממליצים כי מכל הזבובים אמור לקבל את הטיפולים טטרציקלין אותו. שמור ללא Wolbachia זבובים גדל תחת תנאים סטנדרטיים של פחות 3 דורות לשחזר את הבטן microbiota.
  3. Pastrel genotyping
    הערה: הנוכחות של אלל S או R של הגן pst ברקע גנטי דווחה להשפיע על זיהום DCV דרוזופילה34,35. יש צורך לבדוק את גנוטיפ pst , במיוחד עבור DCV זיהום. ישנם כמה SNPs pst יכול להשפיע על זיהום בנגיף, הסנ רס פ 512 C/ט מעבר הצבע החום PCR היא שיטה מהירה לזיהוי גנוטיפ pst .
    1. תמצית לטוס דנ א גנומי כמתואר לעיל (שלב 1.2.4 - 1.2.15).
    2. שימוש 100 ננוגרם של DNA כתבנית, פריימר 512C, 5' CAGCATGGTGTCCATGAAGTC 3' (קדימה) ו- 5' ACGTGATCAATGCTGAAAGT 3' (הפוכה) כדי לזהות אלל R, פריימר 512T, 5' CAGCATGGTGTCCATGAAGTT 3' (קדימה) ו 5' ACGTGATCAATGCTGAAAGT 3' (הפוכה) כדי לאתר אלל S.
    3. הגדר מעברי הצבע Tm (טמפרטורת התכה) כדלקמן: 54 מעלות, 54.7 ° C, 55.5 ° C, 58 ° C, 59.7 ° C, 62.2 ° C, זורמת לאורך 63.7 ° C, ו 64 ° C (45 s על כל טמפרטורה).
      הערה: 30 מחזורים של תגובת שרשרת PCR מומלץ (מערכת μL 20).
    4. המחש את המוצר PCR 100-bp מאת 2% agarose בג'ל.

2. זיהום ויראלי דרוזופילה

  1. להדביק זבובים באמצעות ננו-הזרקת ולבצע מבחני הישרדות.
    1. משוך את הנימים להכין מחטים הזרקת, הגב-מילוי הזריקה מחט עם שמן ולהרכיב את מזרק שתואר קודם לכן כמו50.
    2. להרדים זבובים על כרית תחת זרם אור של CO2. לחסן זבובים על ידי הזרקת אינטרה-בית החזה44 של 50.6 nL של וירוס פתרון (100 PFU, מדולל עם מאגר טריס-HCl, pH 7.2). להזריק לפחות 3 צלוחיות של זבובים (20 זבובים לכל מבחנה).
      הערה: ההזרקה היא גוזלת זמן (בדרך כלל 100 זבובים לשעה), שכפול DCV היא מהירה מאוד, ולכן חשוב מאוד לכתוב את הזמן המדויק על המרקע פעם לסיים כל מבחנה (20 זבובים). הזרקת רק מאגר מוגדרות פקד מעושה. בדרך כלל, זבובים זכרים בוגרים עדיפים, כמו תוצאות גם לשחזור מאשר בעת שימוש נקבות מאז שינויים הורמונליים בזמן חיזור ורביה עשויים להשפיע את המדידה של נקבות51ויציבה יותר.
    3. לגדל את הזבובים מוזרק 25 ° c, 60% לחות תחת מחזור/כהה נורמליים. לספק זבובים עם אוכל טרי מדי יום, לרשום את מספר flies מת.
    4. משכפל ביולוגית לפחות 3 ונדע התווה את עקומת הישרדות.
    5. לניתוח סטטיסטי של נתוני ההישרדות, ליצור עקומות הישרדות קפלן-מאייר בתוכנות סטטיסטיות. בצע בדיקה יומן-דרגה כדי לחשב את ערכי P. על השולחן ' הישרדות ', הזן מידע עבור כל נושא. התוכנה מחשבת את אחוז ההישרדות בכל מועד, ואז מתווה מגרש הישרדות קפלן-מאייר.
      הערה: לא להוסיף שמרים נוספים לתוך הבקבוקון. בהשוואה עם פקדים מעושה, זבובים הנגועים DCV מדי פעם יש מיימת והם מגושם, אשר להפוך אותם לפגיעים שמרים דביק. עדיף להקליט יותר נקודות זמן לניסוי ראשוני כדי לגלות מסגרת זמן שבו המוות מסיבית יקרה זבובים נגועים. באופן כללי, הזבובים הנגוע לעתים נדירות מתים בתוך היומיים הראשונים, אפילו עבור הקווים המוטנטים Dcr-2 . Wolbachia לטוס חינם w1118 (בלומינגטון 5905) נגוע עם PFU 100 של DCV, חלון הזמן הזה היא בסביבות 3-5 ימים פוסט זיהום. זבובי פירות מתים בתוך 0.5 h פוסט הזרקת שעות צריך לא ניתן לספור לנו מקרה מוות כי הם עלולים להיהרג על ידי מחט פגיעה לא על ידי זיהום ויראלי.
  2. DCV לטעון מדידה על ידי CPE assay
    הערה: עומס נגיפי נמדד באופן דומה טיטרציה של המניה וירוס (שלב 1.1.6) אך דורשת הכנת הדוגמא נוספים (שלב 2.2.1-2.2.4).
    1. יום 1, להדביק זבובים זכרים כפי שמתואר בשלב 2.1.1-2.1.2. קבוצת זבובים מוזרק בקבוצות של 20 ולשמור אותם גוברת על אוכל לעוף טרי במשך הזמן המבוקש (בדרך כלל עבור 24 שעות או שלושה ימים). לספק זבובים עם אוכל טרי מדי יום.
    2. יום 2, זרע דרוזופילה S2 * תאים בצלחת תרבות תא 10 ס מ לצפיפות של 5 x106 עונה 1 פרק 107 תאים למ"ל כפי שמתואר בשלב 1.1.1.
    3. יום 3, לאסוף זבובים 5 (תחת זרם אור של CO2), לטחון אותם בשפופרת צנטרפוגה 1.5 mL ל 30 s עם 200 μL של המאגר טריס וחרוזים קרמיקה באמצעות מהמגן. הדגימות ב-80 מעלות צלזיוס או להמשיך לשלב הבא.
    4. ביסודיות מערבולת המדגם. השתמש מזרק 1 מ"ל 0.22 μm מסנן כדי לסנן את תגובת שיקוע על צינור 1.5 מ. להמשיך עם טיטור, כפי שמתואר שלבים 1.1.6.1-1.1.6.5.
  3. עומס DCV נמדדת לרביעיית-PCR
    1. יום 1, להדביק זבובים כמתואר לעיל. זכר מוזרק קבוצה זבובים (זבובים 20/קבוצה), גדלים על אוכל לעוף טרי במשך הזמן הרצויים, בדרך כלל 24 שעות או שלושה ימים. לספק זבובים עם אוכל טרי מדי יום.
    2. יום 3, לאסוף זבובים 5 תחת זרם אור של CO2 צינור 1.5 מ עם 200 μL של פירוק מאגר וחרוזים קרמיקה 20 (קוטר = 0.5 מ מ), לטחון את הדגימות מאת מהמגן במהירות גבוהה עבור 30 ס' μL 800 להוסיף מאגר פירוק נוספים כדי כל שפופרת, חנות ה-s amples ב-80 מעלות צלזיוס או מיד לנהל את החילוץ-RNA ולרביעיית-PCR.
    3. להכין RNase עצות חינם, צינורות, יונים, diethylpyrocarbonate (DEPC) התייחס ומים 0.22 מיקרומטר ממברנה-מסוננים. להוסיף 200 μL של כלורופורם (≥99.5%) לדוגמה, נמרצות לנער 15 s ביד. דגירה במשך 5 דקות או יותר בטמפרטורת החדר עד השלב מים ואת השלב אורגני מופרדים בצורה ברורה.
      הערה: כלורופורם הוא מאוד מסוכנים, יש לטפל בזהירות. לא מערבולת המדגם, אשר יגדיל את הסיכון לזיהום הדנ א.
    4. צנטריפוגה דגימות ב g x 13,000 למשך 15 דקות ב 4 º C.
    5. לאסוף את μL 400 של תגובת שיקוע ולהעביר את תגובת שיקוע צינורות חדשים. מערבבים עם אלכוהול איזופרופיל נפח זהה (≥ 99.5%), בעדינות היפוך הדגימות עבור 20 פעמים ביד ולאחר מכן לזרז במשך 10 דקות או יותר בטמפרטורת החדר.
      הערה: משקעים ב-20 ° C יהיה להגדיל תשואה RNA.
    6. צנטריפוגה דגימות ב 13,000 g x 10 דקות ב 4 º C. כדורי לבן RNA גלויים בתחתית הצינורית.
    7. למחוק את תגובת שיקוע, להוסיף 1 מ"ל של 70% אתנול (אתנול במים DEPC), היפוך כמה פעמים כדי לשטוף את הרנ א.
    8. צנטריפוגה דגימות-13,000 g x עבור 5 דקות ב 4 º C. למחוק את הרנ א supernatant ויבש למשך 5-10 דקות; רנ א צריך להיות שקוף.
    9. להוסיף 50 μL מים DEPC הדגימה, פיפטה כמה פעמים ו מערבולת.
    10. לקחת 3 μL של RNA titrating את ריכוז ה-RNA. לכמת את הרנ א-260 ננומטר. בדרך כלל, ריכוז ה-RNA שחולצו על ידי פרוטוקול זה הוא כ 100-500 μg/μL, שהוא מתאים cDNA סינתזה.
    11. השתמש μg 2 של רנ א cDNA סינתזה. לדלל את הדגימה כדי μL 100 עם ddH2O וחנות ב-20 ° C.
    12. בצע לרביעיית-PCR על פי הוראות היצרן והפעל לרביעיית-PCR.
      הערה: עבור cDNA סינתזה של DCV, תחל אקראי עבד הרבה יותר טוב מאשר פולי A פריימר בידיים שלנו. הביטוי mRNA DCV מנורמל לחלבון ribosomal אנדוגני mRNA (rp49) 49. לנוקלאוטידים להשתמש בחלק הזה: rp49 5' AGATCGTGAAGAAGCGCACCAAG 3' (קדימה) ו- 5' CACCAGGAACTTCTTGAATCCGG 3' (הפוכה); DCV, 5' TCATCGGTATGCACATTGCT 3' (קדימה) ו- 5' CGCATAACCATGCTCTTCTG 3' (הפוכה); vago, 5' TGCAACTCTGGGAGGATAGC 3' (קדימה) ו- 5' AATTGCCCTGCGTCAGTTT 3' (הפוכה); וירוס-induced RNA 1 (vir-1) 5' GATCCCAATTTTCCCATCAA 3' (קדימה) ו 5' GATTACAGCTGGGTGCACAA 3' (הפוכה).

Representative Results

התוצאות של סעיף זה מתקבלים לאחר DCV זיהום של melanogaster ד. איור 1 מציג את תרשים זרימה של זיהום ויראלי דרוזופילה. זבובים מוזרקים intra-thoracically ולאחר מכן הדגימות נאספים לשקילת TCID ויראלי50 ואת רמת ה-RNA הגנום (איור 1). להדבקת וירוס יכול לגרום פירוק התא, CPE נצפית ב- 3 ימים שלאחר זיהום (איור 2 א). העומס וירוס נמדדת וזמינותו CPE בקנה אחד עם זה נמדד על ידי qPCR (איור 2B). כפי שמוצג באיור3, Wolbachia מעכב הידבקות DCV דרוזופילה. דאבליו-16 rRNA ו wsp תחל משמשים לגילוי נוכחות Wolbachia (איור 3 א) ו- Wolbachia-זבובים חינם הראה שיעור ההישרדות ירד משמעותית לאחר ההדבקה DCV (איור 3B). איור 4 מראה כיצד לוודא פולימורפיזם pst על-ידי ה-PCR מעבר צבע באמצעות תחל ספציפיים. איור 5 מציג המינון תלוי השפעות זיהום DCV הזבוב wildtype. שיעור ההישרדות של איור 5A ווירוסים טען ב- 3 ימים שלאחר זיהום מוצג באיור 5B. איור 6 מדגים DCV זיהום יכול להפעיל את הנוגדן Dcr2/RNAi, JAK/סטטיסטיקה ב- מארח52מסלולי איתות. רמת הביטוי של התבטאות הכתבת ג'ין vago Dcr2/RNAi מסלול הוא גבוה 3 ימים שלאחר זיהום (איור 6A). הנתיב JAK-STAT מופעל גם על זיהום DCV, אשר מציינים את רמת הביטוי של הכתב ג'ין vir-1 (איור 6B). איור 7 מראה כי מסלול Dcr2/RNAi הוא קריטי עבור זיהום נגיפים דרוזופילה52. זבובים מוטציה Dcr-2 יש סיכויי הישרדות ירד (איור 7 א) של עומס מוגבר וירוס (איור 7 ב) לאחר DCV זיהום.

Figure 1
איור 1: תרשים זרימה של זיהום דרוזופילה וניתוח עומס וירוס.
הקמת דרוזופילה זיהום בזריקה-ננו. התרשים הסכימה מראה זבובים נגועים intra-thoracically אותו עומס וירוס נמדדים על ידי CPE assay לרביעיית-PCR. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 2
איור 2: DCV לטעון ניתוח.
העומס וירוס נמדדת וזמינותו CPE בקנה אחד עם זה נמדד על ידי qPCR. (א) S2 * תאים מתורבתים 25 ° c במשך 3 ימים עם וירוס שונות לדילול (50 μL). TCID יחידה 150 של וירוס רגיל הוא 4.29 x 109 (שווה ערך ל- 3 x 109 PFU/mL). פאנל הראשון, דילול-3 10; הפאנל השני, דילול-7 10; לוח השלישי, דילול-10 10; ושוב פאנל, ללא זיהום. תאים בחלונית אחת ושתיים להראות פנוטיפ אופייני של CPE חיובי (החצים הלבנים לציין שאריות תאים), ולהראות תאים בלוח 3 ו-4 של פנוטיפ שלילית טיפוסית. סרגל קנה מידה מסומן בהדמויות. (B) מדידה של DCV לטעון על-ידי qPCR. ביצוע דילולים 10-fold סדרתי של DCV, להדביק את S2 * שורת התאים. הרנ א הכולל של תאים נגועים מופק, qPCR מתבצע כדי למדוד את רמת DCV RNA. הדרגתיות זיהומיות העומס הנגיפי (שנקבע על ידי CPE assay) בתאים ושה קשר חיובי בין למדידה באמצעות qPCR (r2= 0.999). אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 3
איור 3: זיהום ויראלי של הזבובים עם או בלי Wolbachia.
זיהום Wolbachia תורמת עמידות DCV דרוזופילה. (א) Wolbachia תזוהה נוכחות על-ידי דאבליו-16 rRNA ו wsp תחל. זבובים G1 G2, G3 ייצג עפרתr(אורגון-R) (בלומינגטון 5) מטופלים על ידי טטרציקלין עבור אחד, שניים או שלושה דורות בהתאמה. גודל מוצר ה-PCR הוא בסביבות 200 bp (rRNA דאבליו-16) ו- 600 bp (wsp). (B) זבובים חינם Wolbachia רגישים יותר לזיהומים DCV. 3-5 ימים הישן זבובים זכרים בוגרים הם הזריקו PFU 100 של DCV. Wolbachia חופשי זבובים הישרדות הצג הקטינה באופן משמעותי (קווים מלאים) מאשר Wolbachia מוגן זבובים (מקף שורות) על DCV זיהום. שני קווי wildtype שונים, עפרותr ו- w1118, משמשים וזמינותו להישרדות ולהראות תוצאות דומות. כל קווי השגיאה מייצג שגיאה סטנדרטית (s.e.) לפחות שלוש בדיקות עצמאיות; * P < 0.05, * * P < 0.01, * * * P < 0.001, * * * P < 0.0001, ns, לא משמעותי. קפלן – מאייר (B). אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 4
איור 4: genotyping Pastrel על ידי ה-PCR הדרגתיות.
פולימורפיזם pst מאומתת על-ידי ה-PCR הדרגתיות. PCR הדרגתיות מתבצע כדי להבחין pst R (512 C) ו- S (512T) אלל במבוגר דרוזופילה . Tm מעברי צבע הם ת 54 ° C, b: 54.7 ° C, c: 55.5 ° C, d: 58 ° C, e: 59.7 ° C, f: 62.2 ° C, g: זורמת לאורך 63.7 ° C, h: 64 ° C.  אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 5
איור 5: שיעור ההישרדות, DCV כייל של הזבובים עפרתr נגוע מנה שונה של DCV.
עפרתrזבובים הם הזריקו בשלושה מינונים שונים של DCV, PFU 10/טוס, PFU 50/טוס, PFU 100/טוס. (א) שיעור ההישרדות של הזבובים הוא נמוך באופן משמעותי כאשר נגוע זיהומיות במינונים גבוהים. (B) רמת DCV RNA בכל הגוף של הזבובים המצוין נמדדת לרביעיית-PCR ברגע המתאים, מנורמל לזה של 10 קבוצה חיסון PFU/טוס. כל קווי השגיאה מייצג שגיאה סטנדרטית (s.e.) לפחות שלוש בדיקות עצמאיות; * P < 0.05, * * P < 0.01, * * * P < 0.001, * * * P < 0.0001, ns, לא משמעותי. קפלן – מאייר (א) או חד-כיווני אנובה (B). אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 6
איור 6: Dcr2/RNAi, נגיפים JAK/סטטיסטיקה איתות מופעל לאחר DCV זיהום.
עפרתrזבובים נדבקו בנגיף PFU 100 של DCV. Vago (א) ו- mRNA vir-1 (ב') לידי ביטוי בגוף כולו נמדדים על ידי לרביעיית-PCR-הזמן שצוין נקודות פוסט זיהום. השינוי של הביטוי הוא מנורמל לזה של רמת הבסיס לפני זיהום. כל קווי השגיאה מייצג שגיאה סטנדרטית (s.e.) לפחות שלוש בדיקות עצמאיות; * P < 0.05, * * P < 0.01, * * * P < 0.001, * * * P < 0.0001, ns, לא משמעותי. חד-כיווני אנובה (A, B). אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 7
איור 7: Dcr-2 מוטציות לטוס רגיש לזיהום DCV.
מוטציה Dcr-2 זבובים, זבובים w1118 הבקרה הגנטית שלו נדבקו בנגיף PFU 100 של DCV. (א) שיעורי ההישרדות של זבובים לקוי Dcr-2 וזבובים פראי-סוג (w1118) פוסט DCV זיהום. (B) DCV RNA ברמת הגוף כולו זבובים המצוין נמדדת לרביעיית-PCR 2 ימים שלאחר זיהום, מנורמל לזה של w1118. כל קווי השגיאה מייצג שגיאה סטנדרטית (s.e.) לפחות שלוש בדיקות עצמאיות; * P < 0.05, * * P < 0.01, * * * P < 0.001, * * * P < 0.0001, ns, לא משמעותי. קפלן – מאייר (א) או מבחן T של סטודנט (B). אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Discussion

במאמר זה, נציג הליך מפורט על איך להקים מערכת זיהומיות ויראליות למבוגרים דרוזופילה melanogaster באמצעות ננו-הזרקה. הפרוטוקולים כוללים את הכנת קווים לטוס המתאים ואת וירוס מניות, זיהום, ההערכה זיהומיות האינדיקטורים וטכניקות המדידה של התגובה אנטי ויראליים. למרות DCV משמש כדוגמה חיידק ויראלי, עשרות סוגים שונים של וירוס בהצלחה הוחלו למחקר במערכת דרוזופילה. בנוסף, מאות גורמים רגולטוריים, של הוירוס או של המחשב המארח, זוהו באמצעות הקרנה בקנה מידה גדול בזבובים. לכן, בשיטה זו היא יכולת הסתגלות גבוהה, אינו מגביל את DCV / אינטראקציהדרוזופילה .

בהצלחה להפיץ, לקצור כייל נוגדנים גבוה DCV, במספר אמצעי זהירות יש לנקוט. תאים צריך להיות בריא, תרבותי-צפיפות מתאימים וקצרו בזמן. צמצום נפח התרבות התאים לא להשפיע באופן משמעותי על וירוס כייל נוגדנים. בדרך כלל, 107 תאים נגועים על ידי DCV-MOI = 0.01 יהיה סוף סוף התשואה משוער 108-109 TCID50 של DCV, אשר יכול לעמוד בדרישות של רוב הניסויים ב- vivo ו- in vitro לקשרי . CPE assay ואת וזמינותו לרביעיית-PCR מתוארים פרוטוקול זה לשקילת וירוס עומס. וזמינותו CPE זה מסובך. הצפיפות המתאים של תאי חיסון תקן מנוסים האפליה CPE חיובי/שלילי מאפשרות של assay CPE מוצלחת ומהירה. לכן, אנו מספקים של לרביעיית קל-PCR assay כאן יסייעו לך להחליט את נקודת דילול ניתוק CPE assay לפני מאסטרינג CPE וזמינותו.

עם זאת, DCV הוא וירוס חזק מאוד לטוס למבוגרים, שורת התאים דרוזופילה . רק 100 PFU/טוס חיסון יכול להרוג 50% של הזבובים פרא בתוך 5 ימים. המינון זיהום עודף עלול צל המשמעות בין פראי סוג לטוס ופוטנציאליים רגישים השורות. חשוב ליישם לפחות שתי מנות זיהום בעת אתחול מסך חדש. מאז מות דרוזופילה מסיבי עלול לקרות בחלון זמן קצר מאוד עקב הקטלניות גבוהה של DCV, הקלטה מספר מוות בתדירות גבוהה יותר בניסויים ראשוני מומלץ מאוד. לאחר זיהום DCV, כמה זבובים מדי פעם יש סינדרום מיימת. ראוי לציין, זבובים מתים בתוך 0.5 h פוסט זיהום לא להיות כלולים, אשר עלול להיגרם על ידי פגיעה הזרקת המחט לא הולם.

עוצמת זיהומיות DCV מושפעת גם גורמים מארח רבים, אשר יש לקחת בחשבון לפני תחילת הניסוי. Wolbachia הוא אנכי לשדר אנדוסימביוזה שיש לו השפעה רבה על זיהום בנגיף ב זבובים32. טטרציקלין טיפול במזון לעוף הוא שיטה נפוצה בשימוש כדי למנוע זיהום Wolbachia . עם זאת, שיטה זו משנה גם בהרכב microbiota מעיים, אשר בתורו עלול להשפיע על התגובה אנטי ויראליים53. מעט מחקרים הדגישו את החשיבות של שונות גנטית על וירוס זיהום36, כגון ubc-e2h, cg8492 ו pst. לדוגמה, רוב זבוב פראי סוג קווים יש pst S אלל והם רגישים פיקורנה כמו וירוס, בעוד רוב הקווים המוטנטים בדקנו ממרכז מניות בלומינגטון pst R אלל, ובכך יש פנוטיפים עמיד. חשוב מאוד לשלול את ההשפעה של pst, במיוחד כאשר ניפוי גנים עמידות השוואת עם פראי סוג הבקרה29.

מלבד ננו-זריקה כדי לגרום זיהום בנגיף מערכתית, שיטות אחרות זמינים ללמוד בנגיף בזבובים. שורות תאים דרוזופילה הוכיחו להיות שיטה תפוקה גבוהה לסנן בנגיף הקשורים מארח רכיב הסלולר37,38. עם זאת, מערכת במבחנה מלווה תמיד עם שיעור גבוה של תוצאות חיוביות שגויות, כאשר המאשר בתוך vivo. DCV ניתן להחיל גם להדביק דרוזופילה בעל פה, ואילו זה ניתן רק מפעילים זיהום מוגבלת, מתון יותר. רק 20% של הזחלים נדבקו בתוך 12 שעות, 14% התמותה נצפתה, רק ב-25% תמותה בשיעור של 20 ימים למבוגרים טסה22. חירור זבובים עם סיכות 0.15 מ מקוטר דרך נוספת להגדיר זיהום ויראלי אבל זה לא יכול להבטיח את מינון מדויק זיהום ואת הדיר כמותית. Overexpressing חלבונים ויראלי על ידי מניפולציה גנטית בזבובים הוא דרך טובה ללמוד interactomes מולקולרית ויוו7. עם זאת, זה אולי לא מתארים את המציאות של פיזיולוגיה, פתולוגיה במארח על זיהום. בינתיים, השיטה ננו-הזרקת יש גם חסרונות, כמו זה לא המסלול הטבעי של זיהום יכול ישירות לעורר תגובה חיסונית חזקה המערכת רק לאחר זיהום, אשר עוקפת את הקוטיקולה, השורה הראשונה הגנה אנטי-ויראלי. לסיכום, המטרה מחקר ספציפי ואת תנאי הניסוי הזמינים הם הגורמים המכריע בבחירת בין שיטות שונות.

Disclosures

המחברים אין לחשוף.

Acknowledgments

ברצוננו להודות את כל המעבדה פאן IPS. רשויות אישורים. אנו מודים ד ר וואנג Lanfeng (IPS, CAS) על סיוע ניסיוני, ד ר Gonalo קורדובה סטגר (ספרינגר הטבע), ד ר ג'סיקה ורגס (IPS, פריז), ד ר ז'ו סנג (IPS, פריז) להערות. עבודה זו נתמכה על ידי מענקים מהתוכנית האסטרטגית עדיפות מחקר של האקדמיה הסינית למדעים L.P (XDA13010500) או מלאה (XDB29030300), הלאומי מדעי הטבע קרן של סין L.P (31870887 ו- 31570897), J.Y (31670909). L.P הוא עמית CAS הנוער חדשנות קידום האגודה (2012083).

Materials

Name Company Catalog Number Comments
0.22um filter Millipore SLGP033RS
1.5 ml Microcentrifuge tubes Brand 352070
1.5 ml RNase free Microcentrifuge tubes Axygen MCT-150-C
10 cm cell culture dish Sigma CLS430167 Cell culture
100 Replacement tubes Drummond Scientific 3-000-203-G/X
15 ml tube Corning 352096
ABI 7500 qPCR system ABI 7500 qPCR
Cell Incubator Sanyo MIR-553
Centriguge Eppendof 5810R
Centriguge Eppendof 5424R
Chloroform Sigma 151858 RNA extraction
DEPC water Sigma 95284-100ML RNA extraction
Drosophila Incubator Percival I-41NL Rearing Drosophila
FBS Invitrogen 12657-029 Cell culture
flat bottom 96-well-plate Sigma CLS3922 Cell culture
Fluorescence microscope Olympus DP73
Isopropyl alcohol Sigma I9516 RNA extraction
Lysis buffer (RNA extraction) Thermo Fisher 15596026 TRIzol Reagent
Lysis buffer (liquid sample RNA extraction) Thermo Fisher 10296028 TRIzol LS Reagent
Microscope Olympus CKX41
Nanoject II Auto-Nanoliter Injector Drummond Scientific 3-000-204 Nanoject II Variable Volume (2.3 to 69 nL) Automatic Injector with Glass Capillaries (110V)
Optical Adhesive Film ABI 4360954 qPCR
Penicillin-Streptomycin, Liquid Invitrogen 15140-122 Cell culture
qPCR plate ABI A32811 qPCR
Schneider’s Insect Medium Sigma S9895 Cell culture
statistical software GraphPad Prism 7
TransScript Fly First-Strand cDNA Synthesis SuperMix TransScript AT301 RNA extraction
Vortex IKA VORTEX 3 RNA extraction

DOWNLOAD MATERIALS LIST

References

  1. Rahim, M. A., Uddin, K. N. Chikungunya: an emerging viral infection with varied clinical presentations in Bangladesh: Reports of seven cases. BMC Research Notes. 10, 410 (2017).
  2. Douam, F., Ploss, A. Yellow Fever Virus: Knowledge Gaps Impeding the Fight Against an Old Foe. Trends in Microbiology. (2018).
  3. Santiago, G. A., et al. Performance of the Trioplex real-time RT-PCR assay for detection of Zika, dengue, and chikungunya viruses. Nature Communications. 9. 9, 1391 (2018).
  4. Gould, E., Pettersson, J., Higgs, S., Charrel, R., de Lamballerie, X. Emerging arboviruses: Why today? One Health. 4, 1-13 (2017).
  5. Hughes, T. T., et al. Drosophila as a genetic model for studying pathogenic human viruses. Virology. 423, 1-5 (2012).
  6. Xu, J., Cherry, S. Viruses and antiviral immunity in Drosophila. Developmental & Comparative Immunology. 42, 67-84 (2014).
  7. Shirinian, M., et al. A Transgenic Drosophila melanogaster Model To Study Human T-Lymphotropic Virus Oncoprotein Tax-1-Driven Transformation In Vivo. Journal of Virology. 89, 8092-8095 (2015).
  8. Adamson, A. L., Chohan, K., Swenson, J., LaJeunesse, D. A Drosophila model for genetic analysis of influenza viral/host interactions. Genetics. 189, 495-506 (2011).
  9. Hao, L., et al. Drosophila RNAi screen identifies host genes important for influenza virus replication. Nature. 454, 890-893 (2008).
  10. Webster, C. L., et al. The Discovery, Distribution, and Evolution of Viruses Associated with Drosophila melanogaster. Plos Biology. 13, e1002210 (2015).
  11. Heigwer, F., Port, F., Boutros, M. RNA Interference (RNAi) Screening in Drosophila. Genetics. 208, 853-874 (2018).
  12. West, C., Silverman, N. p38b and JAK-STAT signaling protect against Invertebrate iridescent virus 6 infection in Drosophila. PLOS Pathogens. 14, e1007020 (2018).
  13. Liu, Y., et al. STING-Dependent Autophagy Restricts Zika Virus Infection in the Drosophila Brain. Cell Host & Microbe. 24, 57-68 (2018).
  14. Wang, X. H., et al. RNA interference directs innate immunity against viruses in adult Drosophila. Science. 312, 452-454 (2006).
  15. van Rij, R. P., et al. The RNA silencing endonuclease Argonaute 2 mediates specific antiviral immunity in Drosophila melanogaster. Genes & Development. 20, 2985-2995 (2006).
  16. Deddouche, S., et al. The DExD/H-box helicase Dicer-2 mediates the induction of antiviral activity in drosophila. Nature Immunology. 9, 1425-1432 (2008).
  17. Chotkowski, H. L., et al. West Nile virus infection of Drosophila melanogaster induces a protective RNAi response. Virology. 377, 197-206 (2008).
  18. Paradkar, P. N., Trinidad, L., Voysey, R., Duchemin, J. B., Walker, P. J. Secreted Vago restricts West Nile virus infection in Culex mosquito cells by activating the Jak-STAT pathway. Proceedings of the National Academy of Sciences of the United States of America. 109, 18915-18920 (2012).
  19. Souza-Neto, J. A., Sim, S., Dimopoulos, G. An evolutionary conserved function of the JAK-STAT pathway in anti-dengue defense. Proceedings of the National Academy of Sciences of the United States of America. 106, 17841-17846 (2009).
  20. Zambon, R. A., Nandakumar, M., Vakharia, V. N., Wu, L. P. The Toll pathway is important for an antiviral response in Drosophila. Proceedings of the National Academy of Sciences of the United States of America. 102, 7257-7262 (2005).
  21. Costa, A., Jan, E., Sarnow, P., Schneider, D. The Imd pathway is involved in antiviral immune responses in Drosophila. PLoS One. 4, e7436 (2009).
  22. Ferreira, A. G., et al. The Toll-dorsal pathway is required for resistance to viral oral infection in Drosophila. PLOS Pathogens. 10, e1004507 (2014).
  23. Moy, R. H., et al. Antiviral autophagy restrictsRift Valley fever virus infection and is conserved from flies to mammals. Immunity. 40, 51-65 (2014).
  24. Shelly, S., Lukinova, N., Bambina, S., Berman, A., Cherry, S. Autophagy is an essential component of Drosophila immunity against vesicular stomatitis virus. Immunity. 30, 588-598 (2009).
  25. Bronkhorst, A. W., et al. The DNA virus Invertebrate iridescent virus 6 is a target of the Drosophila RNAi machinery. Proceedings of the National Academy of Sciences of the United States of America. 109, E3604-E3613 (2012).
  26. Palmer, W. H., Medd, N. C., Beard, P. M., Obbard, D. J. Isolation of a natural DNA virus of Drosophila melanogaster, and characterisation of host resistance and immune responses. PLOS Pathogens. 14, e1007050 (2018).
  27. Jousset, F. X., Bergoin, M., Revet, B. Characterization of the Drosophila C virus. Journal of General Virology. 34, 269-283 (1977).
  28. Gupta, V., Stewart, C. O., Rund, S. S. C., Monteith, K., Vale, P. F. Costs and benefits of sublethal Drosophila C virus infection. J Evol Biol. 30, 1325-1335 (2017).
  29. Yang, S., et al. Bub1 Facilitates Virus Entry through Endocytosis in a Model of Drosophila Pathogenesis. Journal of Virology. (2018).
  30. Teixeira, L., Ferreira, A., Ashburner, M. The bacterial symbiont Wolbachia induces resistance to RNA viral infections in Drosophila melanogaster. Plos Biology. 6, e2 (2008).
  31. Ferguson, N. M., et al. Modeling the impact on virus transmission of Wolbachia-mediated blocking of dengue virus infection of Aedes aegypti. Science Translational Medicine. 7, 279ra237 (2015).
  32. Hedges, L. M., Brownlie, J. C., O'Neill, S. L., Johnson, K. N. Wolbachia and virus protection in insects. Science. 322, 702 (2008).
  33. Bhattacharya, T., Newton, I. L. G., Hardy, R. W. Wolbachia elevates host methyltransferase expression to block an RNA virus early during infection. PLOS Pathogens. 13, e1006427 (2017).
  34. Magwire, M. M., et al. Genome-wide association studies reveal a simple genetic basis of resistance to naturally coevolving viruses in Drosophila melanogaster. PLOS Genetics. 8, e1003057 (2012).
  35. Cao, C., Cogni, R., Barbier, V., Jiggins, F. M. Complex Coding and Regulatory Polymorphisms in a Restriction Factor Determine the Susceptibility of Drosophila to Viral Infection. Genetics. 2159-2173 (2017).
  36. Martins, N. E., et al. Host adaptation to viruses relies on few genes with different cross-resistance properties. Proceedings of the National Academy of Sciences of the United States of America. 111, 5938-5943 (2014).
  37. Moser, T. S., Sabin, L. R., Cherry, S. RNAi screening for host factors involved in Vaccinia virus infection using Drosophila cells. Journal of Visualized Experiments. (2010).
  38. Zhu, F., Ding, H., Zhu, B. Transcriptional profiling of Drosophila S2 cells in early response to Drosophila C virus. Journal of Virology. 10, 210 (2013).
  39. Ekstrom, J. O., Hultmark, D. A Novel Strategy for Live Detection of Viral Infection in Drosophila melanogaster. Scientific Reports. 6, 26250 (2016).
  40. Durdevic, Z., et al. Efficient RNA virus control in Drosophila requires the RNA methyltransferase Dnmt2. EMBO Reports. 14, 269-275 (2013).
  41. Chrostek, E., et al. Wolbachia variants induce differential protection to viruses in Drosophila melanogaster: a phenotypic and phylogenomic analysis. PLOS Genetics. 9, e1003896 (2013).
  42. Gupta, V., Vale, P. F. Nonlinear disease tolerance curves reveal distinct components of host responses to viral infection. Royal Society Open Science. 4, 170342 (2017).
  43. Chtarbanova, S., et al. Drosophila C virus systemic infection leads to intestinal obstruction. Journal of Virology. 88, 14057-14069 (2014).
  44. Merkling, S. H., van Rij, R. P. Analysis of resistance and tolerance to virus infection in Drosophila. Nature Protocols. 10, 1084-1097 (2015).
  45. Goic, B., et al. RNA-mediated interference and reverse transcription control the persistence of RNA viruses in the insect model Drosophila. Nature Immunology. 14, 396-403 (2013).
  46. Ashburner, M., Golic, K., Hawley, R. S. Drosophila: A Laboratory Handbook. Cold Spring Harbor Laboratory Press. (2011).
  47. Biochemical and Biophysical Research Communications: 1991 index issue. Cumulative indexes for volumes 174-181. Biochemical and Biophysical Research Communications. 1-179 (1991).
  48. Cotarelo, M., et al. Cytopathic effect inhibition assay for determining the in-vitro susceptibility of herpes simplex virus to antiviral agents. Journal of Antimicrobial Chemotherapy. 44, 705-708 (1999).
  49. Reed, L. J. M., H, A simple method of estimating fifty percent endpoints. The American Journal of Hygiene. 27, 493-497 (1938).
  50. Khalil, S., Jacobson, E., Chambers, M. C., Lazzaro, B. P. Systemic bacterial infection and immune defense phenotypes in Drosophila melanogaster. Journal of Visualized Experiments. e52613 (2015).
  51. Schwenke, R. A., Lazzaro, B. P. Juvenile Hormone Suppresses Resistance to Infection in Mated Female Drosophila melanogaster. Current Biology. 27, 596-601 (2017).
  52. Sabin, L. R., Hanna, S. L., Cherry, S. Innate antiviral immunity in Drosophila. Current opinion in immunology. 22, 4-9 (2010).
  53. Yin, J., Zhang, X. X., Wu, B., Xian, Q. Metagenomic insights into tetracycline effects on microbial community and antibiotic resistance of mouse gut. Ecotoxicology. 24, 2125-2132 (2015).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics