Establecimiento de la infección Viral y análisis de la interacción huésped-Virus en Drosophila Melanogaster

* These authors contributed equally
Immunology and Infection
 

Summary

Este protocolo describe cómo establecer infección viral en vivo de Drosophila melanogaster utilizando el método de inyección de nano y técnicas básicas para analizar interacción virus-huésped.

Cite this Article

Copy Citation | Download Citations

Yang, S., Zhao, Y., Yu, J., Fan, Z., Gong, S. t., Tang, H., Pan, L. Establishment of Viral Infection and Analysis of Host-Virus Interaction in Drosophila Melanogaster. J. Vis. Exp. (145), e58845, doi:10.3791/58845 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Propagación del virus es una causa importante de enfermedades epidémicas. Por lo tanto, comprender la interacción entre el virus y el anfitrión es muy importante ampliar nuestro conocimiento de la prevención y el tratamiento de la infección viral. La mosca de la fruta Drosophila melanogaster ha demostrado para ser uno de los organismos modelo más eficiente y productivo de factores antivirales y investigar interacción virus-huésped, debido a poderosas herramientas genéticas e inmune innata altamente conservado vías de señalización. El procedimiento descrito aquí muestra un método de inyección de nano para establecer infección viral e inducir respuestas antivirales sistémicas en moscas adultas. El control preciso de la dosis de inyección viral en este método permite alta reproducibilidad experimental. Protocolos descritos en este estudio incluyen la preparación de moscas y el virus, el método de inyección, análisis de la tasa de supervivencia, la medición de la carga de virus y una evaluación antiviral vía. Los efectos de la influencia de la infección viral por el fondo de las moscas fueron mencionados aquí. Este método de infección es fácil de realizar y cuantitativamente repetible; se puede aplicar para detectar host viral factores que intervienen en la interacción virus-huésped y diseccionar la diafonía entre inmune innata de señalización y otras vías biológicas en respuesta a la infección viral.

Introduction

Emergentes de infecciones virales, especialmente por arbovirus, como el Chikungunya virus1, el virus del Dengue, la fiebre amarilla virus2 y elvirusZika3, han sido una gran amenaza para la salud pública al causar pandemias 4. por lo tanto, una mejor comprensión de la interacción virus-huésped se ha convertido en cada vez más importante para el control epidémico y tratamiento de enfermedades virales en los seres humanos. Para este objetivo, se establecerá modelos más adecuados y eficaces para investigar los mecanismos subyacentes a la infección del virus.

La mosca de la fruta, Drosophilamelanogaster (D. melanogaster), proporciona un poderoso sistema para investigar el virus host interacción5,6 y ha demostrado para ser uno de los modelos más eficientes para estudiar enfermedades virales humanas7 , 8 , 9. antiviral altamente conservado señalización vías y herramientas genéticas incomparables que vuela un gran modelo para producir resultados significativos, con implicaciones reales para estudios en humanos de antivirales. Además, las moscas son fáciles y baratos de mantener en el laboratorio y son convenientes para la investigación a gran escala de nuevos factores reguladores6,10 en el virus y el huésped durante la infección.

Cuatro principales vías antivirales altamente conservadas (por ej., el RNA de interferencia (ARNi) vía11, la vía JAK-STAT del12, la vía de NF-κB y la vía de la autofagia13) están bien estudiadas en Drosophila en los últimos años6. El camino de RNAi es un amplio mecanismo antiviral que puede suprimir la mayoría de las clases de virus infección6,14. Interrupción de esta vía por mutación en genes como Dicer-2 (Dcr-2) o 2 Argonaute (antes2) puede llevar a mayor virus título y host mortalidad15,16,17. La vía JAK-STAT se ha implicado en el control de la infección por el virus de la familia Dicistroviridae y la familia Flaviviridae de insectos, por ejemplo., el virus C de Drosophila (DCV) en moscas16 y virus del Nilo Occidental (VNO) y el Virus del Dengue en mosquitos18,19. El Toll de Drosophila (homólogo a la humana vía NF-κB) y vías (IMD) de la deficiencia inmune (similares a la vía de NF-κB y TNF humana) están involucrados en la defensa de virus invasión20,21, 22. autofagia es otro mecanismo conservado implicado en la regulación de la infección viral, que se caracteriza también en Drosophila23,24. Así, la identificación de nuevos factores reguladores de estas vías y disección interferencia entre estas señales antivirales y otras vías biológicas, tales como metabolismo, envejecimiento, reacción neural y así sucesivamente, se pueden configurar fácilmente en la Drosophila sistema.

Aunque más bien establecidos modelos infecciosos virales en Drosophila son inducidos por virus ARN, la infección por los invertebrados 6I de Virus iridiscente (IV-6) y virus de Kallithea han demostrado el potencial para el estudio de los virus ADN en moscas25, 26. Por otra parte, los virus pueden modificarse para permitir la infección de Drosophila, como el virus de la influenza9. Esto ha ampliado enormemente la aplicación de la plataforma de proyección de Drosophila . En este procedimiento utilizamos DCV como ejemplo para describir cómo desarrollar un sistema viral infeccioso en Drosophila. DCV es un virus trenzado solo ARN de sentido positivo de nucleótidos aproximadamente 9300, codificación de proteínas 927. Como un patógeno natural de D. melanogaster, DCV se considera como un virus conveniente estudiar inmunorespuesta fisiológico, conductual y basal del anfitrión durante virus host interacción y co-evolución28. Además, su rápida mortalidad después de la infección en moscas tipo salvaje hace DCV útil para detectar genes resistentes o susceptibles en el host29.

Sin embargo, hay varios aspectos de interés en el estudio de infecciones virales en Drosophila. Por ejemplo, simbióticas bacterias Wolbachia tienen una capacidad de inhibir un amplio espectros de la proliferación de virus ARN en Drosophila y mosquito30,31,32. La evidencia reciente muestra un posible mecanismo en que Wolbachia bloques Sindbis (SINV) infección por virus a través de la regulación al alza de methyltransferase expresión Mt2 en el host33. Además, el fondo genético de insectos también es crítico para la infección viral. Por ejemplo, el natural polimorfismo en el gen, pastrel (pst), determina la susceptibilidad a la infección de DCV en Drosophila34,35, mientras que los lugares geométricos de Ubc-E2H y CG8492 participan en el virus de la parálisis del grillo (CrPV) y la infección por el virus (FHV) casa rebaño, respectivamente36.

Las particulares maneras de establecer la interacción virus-huésped en moscas, deben ser elegidos según los propósitos de la investigación como una pantalla de alto rendimiento para los componentes celulares del anfitrión en Drosophila la célula líneas37,38, oral infección para estudiar respuesta antiviral específico de tripa22,39,40, aguja que pincha41,42 o nano-inyección pasando barreras epiteliales para estimular a inmunológico sistémico respuestas. Nano-inyección puede controlar con precisión la dosis viral para inducir una reacción controlada de antiviral y una lesión fisiológica43, garantizando alta reproducibilidad experimental44. En este estudio, se describe un método de inyección de nano para estudiar interacciones virus-huésped en Drosophila, resaltando la importancia de los efectos del fondo de las moscas.

Protocol

Nota: Antes de comenzar el experimento, las líneas celulares y las poblaciones de mosca utilizadas deben no ser contaminadas por otros patógenos, especialmente para virus como el DCV, FHV, Drosophila X virus (DXV) y virus de la nefritis aviar (ANV). Idealmente, la secuencia de RNA o una identificación de polimerización en cadena-basado más simple se utilizan para detectar contaminación10,45. Si la contaminación se produjo, las líneas celulares y las poblaciones de mosca no deberían utilizarse más hasta que estén completamente descontaminados46.

1. virus y preparación mosca

  1. Recolección y propagación de virus
    Nota: Drosophila S2 * las células se utilizan para la valoración y la propagación de DCV. La línea S2 * celular se deriva de un cultivo primario de embriones en fase finales de D. melanogaster . Esta línea celular ha sido bien descrito previamente47.
    1. Crecen S2 * células en medio de Drosophila de Schneider a 25 ° C sin más CO2, como una monocapa suelta, semi-adherente en una placa de cultivo celular de 10 cm, con una densidad de 1 x 107 células viables/mL. Medio completo uso S2 * células: medio de Drosophila de Schneider que contiene 10% de calor inactiva FBS, 100 unidades/mL penicilina y 100 μg/mL de estreptomicina.
      Nota: Las células sanas deben mostrar una forma redonda y exhiben tamaño homogéneo.
    2. Descongelar rápidamente el stock DCV de-80 ° C en un baño de agua de 25 ° C. Infectar células S2 * con el DCV en MOI = 0.01 inmediatamente añadiendo 1 mL de la solución antivirus directamente a los platos de cultivo celular (zona de crecimiento: 55 cm2) con 10 mL de medio completo para S2 * células.
    3. Incubar las células a 25 ° C durante 3 a 5 días. Cuando el virus está listo para la colección, la morfología de la célula es anormal (forma de la célula se ve borroso) y el medio de cultivo está lleno de partículas negras de restos celulares.
    4. Recoger la cultura de célula entera en un tubo de 15 mL por pipeteo arriba y abajo y congelar a-80 ° C (de hasta un año).
      Nota: DCV puede almacenarse por períodos prolongados de tiempo a-80 ° C con una mínima pérdida de infectividad, hasta por un año.
    5. Descongelar el cultivo celular en un baño de agua de 25 ° C con agitación constante y luego centrifugar a 6.000 xg durante 15 min a 4 ° C. Recoger el sobrenadante en un tubo estéril de 15 mL y agitar. Alícuota hasta 200 μL de solución de virus por el tubo.
      Nota: Alícuotas de Virus se pueden almacenar por períodos cortos de un máximo de 3 días a 4 ° C y hasta por 1 año a-80 ° C. Debe evitarse la congelación y descongelación repetida. Siempre es mejor utilizar la alícuota a la vez.
    6. Tomar 5 tubos que contienen el virus al azar para determinar la dosis infecciosa de virus medio cultivo de tejidos (TCID50) por un análisis de efecto citopático (CPE) (1 unidad de TCID50= 0.7 placa formando unidad [PFU]).
      Nota: La CPE se refiere a los cambios estructurales en las células del huésped causados por la invasión viral. El virus infeccioso causa lisis de la célula huésped o cuando la célula muere sin lisis debido a una incapacidad para reproducir48.
      1. El día 1, recoger preparado S2 * células mediante pipeteo. Contar el número de celular. Centrifugar las células para 300 x g durante 4 min y descarte el sobrenadante. Diluir las células a la densidad de 1 x 106 células/mL con medio completo para S2 * células como se describe en el paso 1.1.1.
      2. Semillas de 1 x 105 S2 * (100 μL) de células por pocillo a la plana 96-bien-placa inferior (confluencia de ~ 30%).
      3. Realizar diluciones seriadas 10 veces de la acción DCV con medio completo para S2 * células. Añadir 50 diluciones μL en el pozo. Añadir 50 μl de medio de cultivo sin virus al pozo clasificado como control negativo bien.
        Nota: Para cada velocidad de dilución, se utilizaron 8 pocillos. Como el rendimiento típico de DCV es de8-10 109 PFU/mL, la dilución debe cubrir por lo menos ~ 10-5-10-10.
      4. El día 4, observar CPE con un microscopio de campo brillante con un 20 X o 40 X objetivo. Clasificar un pozo en el que las células borrosas y el medio está lleno de fragmentos como un "bien positivo" y un pozo en el que la morfología de la célula es normal como "bien negativo".
      5. Pozos positivas o negativas de Mark CPE con + o-, respectivamente. Calcular el virus TCID50 por el método de Reed y Muench49.
    7. Deseche todos los materiales contaminados y guantes en el recipiente de la descontaminación. Si el virus no puede alcanzar la deseada TCID50, 100 mL de solución de antivirus se concentran por centrifugación a 68.000 x g durante 1 h a 4 ° C.
      Nota: dependiendo del objetivo del experimento, un rango de dosis de 102 a 10 unidades6 DICT50 puede ser utilizado para la infección del virus. Por lo general, utilizamos 3 x 106 DICT50 unidades.
    8. Desechar el sobrenadante y resuspender en 1 mL de tampón Tris-HCl (10 mM, pH 7,2). Alícuota 20 μL de solución de virus por el tubo y conservar a-80 ° C. Tomar 5 tubos al azar para determinar el virus media TCID50 otra vez.
  2. Preparación para la infección de la mosca
    Nota: Simbióticas bacterias Wolbachia pueden suprimir muchos tipos de infección por virus de RNA en insectos30,31,32,33,41. Por lo tanto, es esencial para purgar de Wolbachia de moscas antes de estudiar la infección virus host en vivo33.
    1. Preparar comida mosca contiene tetraciclina al añadir 400 μL de 50 tetraciclina μg/mL (en etanol al 70%) a 4 g de comida de mosca fresca harina estándar (1 L de alimentos contiene 77,7 g de harina de maíz, 32,19 g de levadura, 10,6 g de agar, 0,726 g de CaCl2 31,62 g de sacarosa, 63,3 g de glucosa, 2 g de sorbato de potasio y 15 mL de 5% C8H8O3). Mezcle bien y coloque los alimentos a 4 ° C durante la noche para evaporar el etanol.
      Nota: Una alta dosis de etanol puede afectar la fertilidad de mosca, para no omitir este paso.
    2. Calentar los alimentos a temperatura ambiente y recién eclosed moscas adultas (20 hembras y 10 machos) en el frasco. Se crían las moscas a 25 ° C, 60% de humedad en un ciclo normal de luz/oscuridad.
      Nota: Por lo general, tarda 3-4 días para las moscas a poner suficientes huevos. Demasiados huevos, impiden el desarrollo de larvas y disminuyen la eficacia de la tetraciclina.
    3. Recoger nuevas moscas adultas eclosed (dentro de 3 ~ 5 días) bajo un flujo de CO2y repita el paso ~ 1.2.1-1.2.2. Por lo general, por lo menos 3 generaciones se necesitan para totalmente la eliminación de Wolbachia.
    4. Después de 3 generaciones con tratamiento de tetraciclina, recoger 5 moscas en un flujo de CO2 para la prueba de infección por Wolbachia . Muela de moscas durante 1 min con 250 μL de agua destilada doble (ddH2O) y algunas perlas cerámica estéril de 0,5 mm en un tubo de 1,5 mL utilizando un homogeneizador. Añadir otro 250 μL de 2 x tampón A (0,2 M Tris-HCl, pH 9.0, 0.2 M de EDTA, SDS 2%) a la muestra y vortex.
      Nota: Puesto que SDS impedirá el movimiento del grano, 1 x buffer A no puede ser utilizado directamente para moler moscas. Si las moscas tienen ojos rojos, quitar cabezas antes de molerlo, como esto puede influir en el color del producto de la DNA.
    5. Congelar las muestras a-80 ° C (mantener hasta un año). Rápidamente descongelar la muestra de-80 ° C en un baño de agua de 25 ° C hasta que se disuelva. Incubar las muestras a 70 ° C por 30 minutos.
    6. Añadir 190 μL de 5 M KOAc, vortex e incubar en hielo por 15 minutos o más.
    7. Centrifugar las muestras a 13.000 x g durante 5 min a temperatura ambiente, recoger el sobrenadante y transferir a tubos nuevos.
    8. Repita el paso 1.2.7 para obtener ADN de mejor calidad.
    9. Añadir 750 μL de isopropanol a cada muestra e invierta suavemente un par de veces con la mano. Incubar a temperatura ambiente durante 5 minutos.
    10. Centrifugar las muestras a 13.000 x g durante 5 min a temperatura ambiente y descarte el sobrenadante. El precipitado de ADN genómico blanco permanecerá en la parte inferior del tubo.
    11. Añadir 1 mL de etanol al 70% a los pellets, centrifugar a 13.000 x g durante 5 min y descarte el sobrenadante. Deje secar al aire la DNA hasta que esté transparente.
    12. ADN se disuelven en 100 μL de ddH2O, valorar la concentración de ADN por espectrofotometría de absorción UV-Vis y diluir el ADN a 100 ng/μL.
    13. Uso 200 ng de ADN por la reacción de PCR (en un sistema de 20 μL, vea la Tabla de materiales). Realizar PCR mediante el siguiente programa: 95 ° C durante 15 min; 36 ciclo de 95 ° C por 45 s, 50 ° C por 45 s y 72 ° C por 1 min; y a un paso de extensión final (72 ° C por 1 min) en un termociclador.
      Nota: Basado en la Wolbachia 16S rRNA, utilice los siguientes cebadores: 5' TGAGGAAGATAATGACGG 3' (adelante) y 5' CCTCTATCCTCTTTCAACC 3' (atrás). Para wsp, fueron los primers 5' CATTGGTGTTGGTGTTGGTG 3' (adelante) y 5' ACCGAAATAACGAGCTCCAG 3' (atrás).
    14. Análisis de productos PCR con electroforesis en gel de agarosa al 1%. El tamaño del producto PCR de Wolbachia 16S rRNA y wsp es alrededor de 200 bp y 600 bp, respectivamente.
    15. Posterior Wolbachia libre stock mosca mosca comida de harina estándar. Recoger 3-5 días recién eclosed hombre vuela para la infección.
      Nota: Tratamiento de tetraciclina también puede afectar a composición de la microbiota intestinal, que posteriormente influye en las respuestas antivirales en el host. Recomendamos que todas moscas deben recibir los mismos tratamientos de tetraciclina. Mantener libre de Wolbachia moscas creciendo bajo condiciones estándar de al menos 3 generaciones restablecer la microbiota intestinal.
  3. Pastrel genotyping
    Nota: La presencia del alelo S o R del gene del pst en el fondo genético se ha divulgado para afectar la infección DCV en Drosophila34,35. Es necesario comprobar el genotipo de la pst , especialmente para la infección de DCV. Hay unos pocos SNPs en pst que puede afectar a la infección del virus, el SNP mayor es 512 C/T. El gradiente de temperatura PCR es un método rápido para identificar el genotipo de pst .
    1. Extracto de volar ADN genómico como se describió anteriormente (paso 1.2.4 - 1.2.15).
    2. Uso 100 ng de ADN como plantilla, la cartilla C 512, 5' CAGCATGGTGTCCATGAAGTC 3' (adelante) y 5' ACGTGATCAATGCTGAAAGT 3' (atrás) para detectar el alelo R, la cartilla 512T, 5' CAGCATGGTGTCCATGAAGTT 3' (adelante) y 5' ACGTGATCAATGCTGAAAGT 3' (atrás) para detectar la Alelo S.
    3. Establecidas en los gradientes de Tm (temperatura de fusión): 54 ° C 54,7 º C, 55,5 C °, 58 ° C, 59,7 ° C, 62,2 ° C, 63,7 ° C y 64 ° C (45 s a cada temperatura).
      Nota: 30 ciclos de PCR reacción en cadena se recomiendan (sistema de 20 μL).
    4. Visualizar el producto PCR 100-bp por electroforesis del gel de agarosa al 2%.

2. viral infección en Drosophila

  1. Infectar moscas por nano-inyección y realizar análisis de supervivencia.
    1. Tire los capilares para preparar agujas de inyección, back-fill la inyección de la aguja con el aceite y montar el inyector como describió anteriormente50.
    2. Anestesiar a moscas en la almohadilla debajo de un flujo de CO2. Inocular de moscas por inyección intra torácica44 50.6 nL de solución antivirus (100 PFF, diluir con tampón Tris-HCl, pH 7.2). Inyectar por lo menos 3 frascos de moscas (20 moscas por frasco).
      Nota: La inyección es desperdiciador de tiempo (generalmente 100 moscas por hora) y DCV la reproducción es muy rápida, por lo que es muy importante anotar la hora exacta en el tubo una vez acabado cada vial (20 moscas). Inyección única de búfer se define como un control simulado. Moscas adultas masculinas son generalmente, prefiere, como resultados son más estables y reproducibles que cuando las hembras ya que las variaciones hormonales durante el apareamiento y la reproducción pueden influir en la lectura de las hembras51.
    3. Crecen las moscas inyectados a 25 ° C, 60% de humedad en un ciclo normal de luz/oscuridad. Fuente de moscas con el alimento fresco diario y anote el número de muertos flies.
    4. Realizar al menos 3 repeticiones biológicas y trazar la curva de supervivencia.
    5. Para el análisis estadístico de los datos de supervivencia, generar las curvas de supervivencia de Kaplan-Meier de software estadístico. Realizar prueba de log-rank para calcular los valores de P. En la tabla de supervivencia, ingrese la información de cada materia. El software calcula la supervivencia porcentual en cada momento y traza una trama de supervivencia de Kaplan-Meier.
      Nota: No agregue levadura adicional en el frasco. En comparación con controles de simulacros, moscas infectadas DCV ocasionalmente tienen ascitis y son torpes, que hacen vulnerables a la levadura pegajosa. Es mejor registrar más puntos del tiempo en el experimento preliminar para un marco de tiempo en que sucederá la muerte masiva de moscas infectadas. Generalmente, las moscas infectadas rara vez mueren dentro de los dos primeros días, incluso para las líneas mutantes Dcr-2 . Para la Wolbachia w gratis1118 (Bloomington 5905) mosca infectada con 100 PFU del DCV, esta ventana de tiempo es alrededor de 3-5 días post infección. Moscas de la fruta que mueren dentro de las horas de la inyección de 0.5 h post debe no ser contados como una fatalidad porque puede ser muertos por heridas de aguja no por infección viral.
  2. DCV carga medida por análisis de la CPE
    Nota: La carga Viral se mide semejantemente a la valoración de la acción de virus (paso 1.1.6) pero requiere preparación adicional (paso 2.2.1-2.2.4).
    1. El día 1, infectar moscas macho como se describe en el paso 2.1.1-2.1.2. Grupo inyectado vuela en grupos de 20 y mantenerlos creciendo en alimentos frescos de mosca para el tiempo deseado (normalmente de 24 h o 3 días). Proporciona moscas alimentos frescos todos los días.
    2. En el día 2, semilla de Drosophila S2 * células en una placa de cultivo celular de 10 cm a la densidad de aproximadamente 5 x106 a 1 x 107 células/mL como se describe en el paso 1.1.1.
    3. El día 3, recoger 5 moscas (bajo un ligero flujo de CO2) y molerlos en un tubo de centrífuga de 1.5 mL por 30 s con 200 μL de tampón Tris y granos de cerámica usando homogeneizador. Almacenar las muestras a-80 ° C o proceder inmediatamente al siguiente paso.
    4. Fondo vortex la muestra. Utilice una jeringa de 1 mL y 0.22 μm filtro a filtro el sobrenadante a un tubo nuevo de 1,5 mL. Proceder a la valoración, como se describe en pasos 1.1.6.1-1.1.6.5.
  3. Carga DCV medido por qRT-PCR
    1. El día 1, infectar moscas como se describió anteriormente. Grupo inyectado macho vuela (20 moscas/grupo) y crecen en alimentos frescos de mosca para el tiempo deseado, normalmente para 24 horas o 3 días. Proporciona moscas alimentos frescos todos los días.
    2. El día 3, recoger 5 moscas en un flujo de CO2 en un tubo de 1,5 mL con 200 μL de tampón de lisis y 20 granos de cerámica (diámetro = 0,5 mm), moler las muestras por el homogeneizador de alta velocidad para 30 s. Añadir 800 μL de tampón de lisis adicional a cada tubo y guardar el s amplios a-80 ° C o inmediatamente realizan extracción de RNA y qRT-PCR.
    3. Preparar consejos libres de Rnasa, tubos y desionizada, diethylpyrocarbonate (DEPC) tratados y 0.22 μm membrana filtra agua. Añadir 200 μL de cloroformo (≥99.5%) en la muestra y vigorosamente agite por 15 s a mano. Incubar durante 5 minutos o más a temperatura ambiente hasta que la fase líquida y la fase orgánica se separan claramente.
      Nota: El cloroformo es extremadamente peligroso y debe ser manipulado con cuidado. No no agitar con vortex de la muestra, lo que aumentará el riesgo de contaminación del ADN.
    4. Centrifugar las muestras a 13.000 x g durante 15 min a 4 ° C.
    5. Recoger 400 μL del sobrenadante y transferir el sobrenadante a tubos nuevos. Mezclar con el mismo volumen isopropanol (≥ 99.5%), invierta suavemente las muestras de 20 veces a mano y luego precipitar durante 10 minutos o más a temperatura ambiente.
      Nota: Precipitación a-20 ° C aumentará producción de RNA.
    6. Centrifugar las muestras a 13.000 x g por 10 min a 4 ° C. Gránulos de ARN blanco son visibles en la parte inferior del tubo.
    7. Deseche el sobrenadante y agregar 1 mL de etanol al 70% (etanol en agua DEPC) e invertir varias veces para lavar el ARN.
    8. Centrifugar las muestras a 13.000 x g durante 5 min a 4 ° C. Deseche el sobrenadante y seco ARN durante 5-10 min; RNA debe ser transparente.
    9. Añadir 50 μL de agua DEPC a la muestra, la pipeta para par de veces y vortex.
    10. Tomar 3 μL del ARN para valorar la concentración de RNA. Cuantificar el RNA a 260 nm. Normalmente, la concentración de RNA extraída por este protocolo es aproximadamente 100-500 μg/μL, que es adecuado para síntesis de cDNA.
    11. Uso 2 μg de ARN para la síntesis de cDNA. Diluir la muestra a 100 μL con ddH2O y almacenar a-20 ° C.
    12. Realice qRT-PCR según las instrucciones del fabricante y ejecute qRT-PCR.
      Nota: Para síntesis de cDNA de DCV, random primers trabajaban mucho mejor que el primer poli A en nuestras manos. Expresión de mRNA DCV se normaliza a proteínas endógenas mRNA (rp49) 49. Cartillas del oligonucleótido utilizados en esta parte: rp49 5' AGATCGTGAAGAAGCGCACCAAG 3' (adelante) y 5' CACCAGGAACTTCTTGAATCCGG 3' (atrás); DCV, 5' TCATCGGTATGCACATTGCT 3' (adelante) y 5' CGCATAACCATGCTCTTCTG 3' (atrás); vago, 5' TGCAACTCTGGGAGGATAGC 3' (adelante) y 5' AATTGCCCTGCGTCAGTTT 3' (atrás); inducido por virus RNA 1 (vir-1) 5' GATCCCAATTTTCCCATCAA 3' (adelante) y 5' GATTACAGCTGGGTGCACAA 3' (atrás).

Representative Results

Resultados de esta sección se obtienen después de la infección de DCV de D. melanogaster. La figura 1 muestra el organigrama de la infección viral en Drosophila. Moscas se inyectan intra thoracically, y luego se recogen las muestras para la medición de la viral TCID50 y el nivel de ARN del genoma (figura 1). La infección del virus puede inducir lisis celular y CPE se observa en 3 días post infección (figura 2A). De acuerdo con la carga del virus medida por el ensayo CPE se mide por qPCR (figura 2B). Como se muestra en la figura 3, inhibe la Wolbachia infección DCV en Drosophila. WOL-16s rRNA y wsp imprimaciones se utilizan para detectar la presencia de Wolbachia (Figura 3A) y Wolbachia-vuela libre muestra la tasa de supervivencia significativamente menor después de la infección de DCV (figura 3B). La figura 4 muestra cómo comprobar pst polimorfismo por gradiente PCR usando las cartillas específicas. Figura 5 se muestra dosis efectos dependientes de la infección de DCV en la mosca de tipo salvaje. La tasa de supervivencia en la figura 5A y el virus se cargan en 3 días post infección se muestra en la figura 5B. Figura 6 muestra que la infección DCV puede activar el antiviral Dcr2/ARNi y JAK/STAT, señalización de vías en el host52. El nivel de expresión de la expresión de vago gen reportero del camino de RNAi/Dcr2 es elevado 3 días post infección (figura 6A). También se activa la vía JAK-STAT en infección de DCV, que es indicada por el nivel de expresión del periodista gen vir-1 (Figura 6B). La figura 7 muestra que el camino de RNAi/Dcr2 es crítico para la infección antiviral en Drosophila52. DCR-2 moscas mutantes tienen una tasa de supervivencia disminuida (Figura 7A) y una carga mayor de virus (figura 7B) después de la infección de DCV.

Figure 1
Figura 1: Diagrama de flujo de la Drosophila infección y análisis de la carga de virus.
Establecer infección Drosophila por nano-inyección. La tabla de esquema muestra que moscas infectadas intra thoracically carga del virus se mide por el ensayo CPE y qRT-PCR. Haga clic aquí para ver una versión más grande de esta figura.

Figure 2
Figura 2: Análisis de carga DCV.
De acuerdo con la carga del virus medida por el ensayo CPE se mide por qPCR. (A) S2 * las células se cultivan a 25 ° C durante 3 días con una dilución de virus diferentes (50 μL). 1 unidad TCID50 de virus usado es de 4,29 x 109 (equivalente a 3 x 109 PFU/mL). Primer panel, 10-3 dilución; segundo panel, 10-7 disolución; tercer panel, 10-10 dilución; luz del panel, sin infección. Las células en el panel y mostrar el fenotipo positivo típico de CPE (flechas blancas indican restos celulares), y las células en el panel de tres y cuatro muestran el fenotipo negativo típico. La barra de escala se indica en las figuras. (B) medición de DCV de la carga por qPCR. Realizar diluciones seriadas 10 veces de DCV e infectar la línea S2 * celular. Se extrae el ARN total de las células infectadas y qPCR se realiza para medir el nivel de ARN del DCV. Gradiente infecciosa carga viral (determinada por análisis de la CPE) en las células es emparejado y positivamente relacionados con la medición por qPCR (r2= 0.999). Haga clic aquí para ver una versión más grande de esta figura.

Figure 3
Figura 3: Infección Viral de las moscas con o sin Wolbachia.
Wolbachia infección contribuye a la resistencia de DCV en Drosophila. (A) la Wolbachia presencia se detecta por cartillas wol-16s rRNA y wsp . G1, G2 y G3 representado mineralrmoscas (Oregon-R) (Bloomington 5) tratan por tetraciclina para uno, dos y tres generaciones respectivamente. El tamaño del producto PCR es de alrededor de 200 bp (wol-16s rRNA) y 600 bp (wsp). (B) moscas gratis Wolbachia son más sensibles a la infección del DCV. día 3-5 moscas adultas macho viejo se inyectan con 100 PFU del DCV. Wolbachia libre vuela (líneas sólidas) Mostrar reducida significativamente la supervivencia de Wolbachia protegido vuela (líneas de guión) sobre infección de DCV. Dos líneas diferentes de tipo salvaje, mineralr y w1118, se utilizan para el análisis de supervivencia y muestran resultados similares. Todas las barras de error representan el error estándar (s.e.) de al menos tres pruebas independientes; * P < 0.05, ** P < 0.01, *** P < 0.001, *** P < 0,0001, ns, no significativos. Kaplan-Meier (B). Haga clic aquí para ver una versión más grande de esta figura.

Figure 4
Figura 4: Pastrel genotipado mediante PCR degradado.
polimorfismo de PST es verificado por PCR degradado. Se realiza PCR gradiente para distinguir pst R (512 C) y el alelo S (512T) del adulto de Drosophila . Gradientes de TM son a: 54 ° C, b: 54,7 º C, c: 55,5 º C, d: 58 ° C, e: 59,7 ° C, f: 62,2 ° C, g: 63,7 ° C h: 64 ° C.  Haga clic aquí para ver una versión más grande de esta figura.

Figure 5
Figura 5: Tasa de supervivencia y título DCV de mineralr moscas infectadas con diferentes dosis de DCV.
Moscas del mineralrse inyectan con tres dosis diferentes de DCV, 10 PFU/fly, 50 PFU/mosca y mosca de PFU 100. (A) tasa de supervivencia de las moscas es significativamente menor cuando mayor dosis infecciosa. (B) el nivel de ARN del DCV en todo el cuerpo de moscas indicados es medido por qRT-PCR en el momento indicado y normalizado a la del grupo de inoculación de 10 PFU/fly. Todas las barras de error representan el error estándar (s.e.) de al menos tres pruebas independientes; * P < 0.05, ** P < 0.01, *** P < 0.001, *** P < 0,0001, ns, no significativos. Kaplan-Meier (A) o unidireccional anova (B). Haga clic aquí para ver una versión más grande de esta figura.

Figure 6
Figura 6: Dcr2/ARNi y antiviral JAK/STAT vía activada después de la infección de DCV de señalización.
Mineralrmoscas estaban infectadas con 100 PFU del DCV. Vago (A) y vir-1 (B) mRNA expresado en todo el cuerpo se miden mediante qRT-PCR en tiempo indicado puntos post infección. El cambio de expresión se normalizó al nivel basal antes de la infección. Todas las barras de error representan el error estándar (s.e.) de al menos tres pruebas independientes; * P < 0.05, ** P < 0.01, *** P < 0.001, *** P < 0,0001, ns, no significativos. ANOVA unidireccional (A, B). Haga clic aquí para ver una versión más grande de esta figura.

Figure 7
Figura 7: Dcr-2 mosca mutante sensible a la infección del DCV.
DCR-2 mutante vuela y sus control genético w1118 moscas estaban infectadas con 100 PFU del DCV. (A) las tasas de supervivencia de Dcr-2 deficientes moscas y moscas tipo salvaje (w1118) post infección de DCV. (B) DCV RNA nivel en todo el cuerpo de las moscas indicados es medido por qRT-PCR 2 días post infección y normalizado a la de w1118. Todas las barras de error representan el error estándar (s.e.) de al menos tres pruebas independientes; * P < 0.05, ** P < 0.01, *** P < 0.001, *** P < 0,0001, ns, no significativos. Kaplan-Meier (A) o T-pruebas (B) estudiante. Haga clic aquí para ver una versión más grande de esta figura.

Discussion

En este artículo, presentamos un procedimiento detallado sobre cómo establecer un sistema viral infeccioso en adultos de Drosophila melanogaster utilizando nano-inyección. Los protocolos incluyen la preparación de líneas moscas apropiadas y stock de virus, técnicas de infección, la evaluación de indicadores de infecciosas y la medición de la respuesta antiviral. Aunque el DCV se utiliza como un ejemplo de un patógeno viral, decenas de diferentes tipos de virus se ha aplicado con éxito para el estudio en el sistema de Drosophila. Además, se han identificado cientos de factores reguladores, del virus o del huésped, a través de la proyección a gran escala en moscas. Así, este método es altamente adaptable y se limita a DCV / interacción deDrosophila .

Para propagar y cosechar alto título DCV con éxito, deben tomarse algunas precauciones. Células deben ser saludables, cultivadas con una densidad adecuada y cosechadas a tiempo. Reduce el volumen de la célula cultura no afectó significativamente la titulación de virus. Por lo general, 107 células infectadas por DCV en MOI = 0,01 será finalmente rendimiento aproximado 108-109 TCID50 de DCV, que puede satisfacer las demandas de la mayoría de los experimentos en vivo y en vitro . El ensayo CPE y análisis de qRT-PCR se describen en el presente Protocolo para la medición de la carga del virus. El ensayo CPE de alguna manera es complicado. La densidad adecuada de la inoculación de células y un experimentado nivel de discriminación de CPE positiva/negativa permiten un rápido y acertado análisis CPE. Así, ofrecemos aquí un ensayo de fácil qRT-PCR para ayudar a decidir el punto de dilución de corte en ensayo CPE antes de dominar el ensayo de la CPE.

Sin embargo, el DCV es un virus muy potente para la mosca adulta y la línea de células de Drosophila . Sólo 100 de PFU/mosca inoculación puede matar 50% de las moscas salvajes dentro de 5 días. Una dosis excesiva de infección puede sombra la importancia entre el tipo salvaje mosca y potenciales líneas susceptibles. Es importante aplicar al menos dos dosis de infección cuando se inicia una nueva pantalla. Puesto que la masiva muerte de Drosophila puede ocurrir en una ventana de tiempo muy corto debido a la alta mortalidad del DCV, registrar el número de muerte más frecuente en experimentos preliminares se recomienda. Después de la infección del DCV, algunas moscas tienen ocasionalmente síndrome ascítico. En particular, deben ser excluidos moscas que mueren dentro de post infección de 0.5 h, que puedan ser causados por lesiones por inyección aguja inadecuado.

La resistencia infecciosa del DCV también está influenciada por muchos factores del anfitrión, que deben considerar antes de comenzar un experimento. Wolbachia es un vertical transmitir endosymbiont que tiene gran impacto en la infección del virus en moscas32. Tratamiento de tetraciclina en mosca alimentos es un método común usado para eliminar la infección por Wolbachia . Sin embargo, este método también altera la composición de la microbiota intestinal, que a su vez puede afectar la respuesta antiviral53. Algunos estudios han subrayado la importancia de la varianza genética en virus infección36, como el ubc-e2h, cg8492 y pst. Por ejemplo, mosca de tipo salvaje más líneas tienen pst S alelo y son sensibles a por picornavirus-como el virus, mientras que mayoría de las líneas mutante probamos de centro de población de Bloomington pst R alelo, así tener fenotipos resistentes. Es muy importante descartar el impacto de la pst, especialmente cuando la proyección hacia fuera de un gen de resistencia comparando con el tipo salvaje control29.

Además de nano-inyección para inducir la infección sistémica de virus, otros métodos están disponibles para el estudio de la infección del virus en moscas. Líneas de células de Drosophila han demostrado ser un método de alto rendimiento para descartar infección por el virus relacionadas con host componente celular37,38. Sin embargo, un sistema in vitro se acompaña siempre con una alta tasa de falsos positivos, al confirmar en vivo. DCV puede aplicarse también para infectar Drosophila por vía oral, mientras que sólo puede desencadenar una infección restringida y más suave. Sólo el 20% de las larvas estaban infectado dentro de las 12 h y se observó mortalidad de 14%, con sólo 25% mortalidad en 20 días en adulto vuela22. Pinchazo de moscas con pasadores de 0.15 mm de diámetro es otra manera de establecer infección viral pero no puede asegurar la dosis exacta de la infección y repetibilidad cuantitativa. Overexpressing proteínas virales por la manipulación genética en las moscas es una buena manera para el estudio de interactomes molecular en vivo7. Sin embargo, no puede retratar la realidad de la fisiología y patología en el anfitrión a la infección. Mientras tanto, el método de inyección nano también tiene inconvenientes, ya que no es la ruta natural de infección y directamente puede estimular una respuesta inmune fuerte justo después de la infección, que puentea la cutícula, la primera línea de defensa antiviral. En suma, el propósito de investigación específica y la condición experimental disponible son los factores decisivos en la elección entre diferentes métodos.

Disclosures

Los autores no tienen nada que revelar.

Acknowledgments

Nos gustaría agradecer al laboratorio de Pan todo en IPS. CAS. Agradecemos Dr. Lanfeng Wang (IPS, CAS) asistencia experimental y Dr. Gonalo Cordova Steger (naturaleza de Springer), Dr. Jessica VARGAS (IPS, París) y el Dr. Seng Zhu (IPS, París) Comentarios. Este trabajo fue financiado por becas del programa de investigación prioridad estratégica de la Academia China de Ciencias L.P (XDA13010500) y HT (XDB29030300), la Fundación Nacional de Ciencias naturales de China a L.P (31870887 y 31570897) y J.Y (31670909). L.P es miembro de la Asociación de promoción de innovación CAS juvenil (2012083).

Materials

Name Company Catalog Number Comments
0.22um filter Millipore SLGP033RS
1.5 ml Microcentrifuge tubes Brand 352070
1.5 ml RNase free Microcentrifuge tubes Axygen MCT-150-C
10 cm cell culture dish Sigma CLS430167 Cell culture
100 Replacement tubes Drummond Scientific 3-000-203-G/X
15 ml tube Corning 352096
ABI 7500 qPCR system ABI 7500 qPCR
Cell Incubator Sanyo MIR-553
Centriguge Eppendof 5810R
Centriguge Eppendof 5424R
Chloroform Sigma 151858 RNA extraction
DEPC water Sigma 95284-100ML RNA extraction
Drosophila Incubator Percival I-41NL Rearing Drosophila
FBS Invitrogen 12657-029 Cell culture
flat bottom 96-well-plate Sigma CLS3922 Cell culture
Fluorescence microscope Olympus DP73
Isopropyl alcohol Sigma I9516 RNA extraction
Lysis buffer (RNA extraction) Thermo Fisher 15596026 TRIzol Reagent
Lysis buffer (liquid sample RNA extraction) Thermo Fisher 10296028 TRIzol LS Reagent
Microscope Olympus CKX41
Nanoject II Auto-Nanoliter Injector Drummond Scientific 3-000-204 Nanoject II Variable Volume (2.3 to 69 nL) Automatic Injector with Glass Capillaries (110V)
Optical Adhesive Film ABI 4360954 qPCR
Penicillin-Streptomycin, Liquid Invitrogen 15140-122 Cell culture
qPCR plate ABI A32811 qPCR
Schneider’s Insect Medium Sigma S9895 Cell culture
statistical software GraphPad Prism 7
TransScript Fly First-Strand cDNA Synthesis SuperMix TransScript AT301 RNA extraction
Vortex IKA VORTEX 3 RNA extraction

DOWNLOAD MATERIALS LIST

References

  1. Rahim, M. A., Uddin, K. N. Chikungunya: an emerging viral infection with varied clinical presentations in Bangladesh: Reports of seven cases. BMC Research Notes. 10, 410 (2017).
  2. Douam, F., Ploss, A. Yellow Fever Virus: Knowledge Gaps Impeding the Fight Against an Old Foe. Trends in Microbiology. (2018).
  3. Santiago, G. A., et al. Performance of the Trioplex real-time RT-PCR assay for detection of Zika, dengue, and chikungunya viruses. Nature Communications. 9. 9, 1391 (2018).
  4. Gould, E., Pettersson, J., Higgs, S., Charrel, R., de Lamballerie, X. Emerging arboviruses: Why today? One Health. 4, 1-13 (2017).
  5. Hughes, T. T., et al. Drosophila as a genetic model for studying pathogenic human viruses. Virology. 423, 1-5 (2012).
  6. Xu, J., Cherry, S. Viruses and antiviral immunity in Drosophila. Developmental & Comparative Immunology. 42, 67-84 (2014).
  7. Shirinian, M., et al. A Transgenic Drosophila melanogaster Model To Study Human T-Lymphotropic Virus Oncoprotein Tax-1-Driven Transformation In Vivo. Journal of Virology. 89, 8092-8095 (2015).
  8. Adamson, A. L., Chohan, K., Swenson, J., LaJeunesse, D. A Drosophila model for genetic analysis of influenza viral/host interactions. Genetics. 189, 495-506 (2011).
  9. Hao, L., et al. Drosophila RNAi screen identifies host genes important for influenza virus replication. Nature. 454, 890-893 (2008).
  10. Webster, C. L., et al. The Discovery, Distribution, and Evolution of Viruses Associated with Drosophila melanogaster. Plos Biology. 13, e1002210 (2015).
  11. Heigwer, F., Port, F., Boutros, M. RNA Interference (RNAi) Screening in Drosophila. Genetics. 208, 853-874 (2018).
  12. West, C., Silverman, N. p38b and JAK-STAT signaling protect against Invertebrate iridescent virus 6 infection in Drosophila. PLOS Pathogens. 14, e1007020 (2018).
  13. Liu, Y., et al. STING-Dependent Autophagy Restricts Zika Virus Infection in the Drosophila Brain. Cell Host & Microbe. 24, 57-68 (2018).
  14. Wang, X. H., et al. RNA interference directs innate immunity against viruses in adult Drosophila. Science. 312, 452-454 (2006).
  15. van Rij, R. P., et al. The RNA silencing endonuclease Argonaute 2 mediates specific antiviral immunity in Drosophila melanogaster. Genes & Development. 20, 2985-2995 (2006).
  16. Deddouche, S., et al. The DExD/H-box helicase Dicer-2 mediates the induction of antiviral activity in drosophila. Nature Immunology. 9, 1425-1432 (2008).
  17. Chotkowski, H. L., et al. West Nile virus infection of Drosophila melanogaster induces a protective RNAi response. Virology. 377, 197-206 (2008).
  18. Paradkar, P. N., Trinidad, L., Voysey, R., Duchemin, J. B., Walker, P. J. Secreted Vago restricts West Nile virus infection in Culex mosquito cells by activating the Jak-STAT pathway. Proceedings of the National Academy of Sciences of the United States of America. 109, 18915-18920 (2012).
  19. Souza-Neto, J. A., Sim, S., Dimopoulos, G. An evolutionary conserved function of the JAK-STAT pathway in anti-dengue defense. Proceedings of the National Academy of Sciences of the United States of America. 106, 17841-17846 (2009).
  20. Zambon, R. A., Nandakumar, M., Vakharia, V. N., Wu, L. P. The Toll pathway is important for an antiviral response in Drosophila. Proceedings of the National Academy of Sciences of the United States of America. 102, 7257-7262 (2005).
  21. Costa, A., Jan, E., Sarnow, P., Schneider, D. The Imd pathway is involved in antiviral immune responses in Drosophila. PLoS One. 4, e7436 (2009).
  22. Ferreira, A. G., et al. The Toll-dorsal pathway is required for resistance to viral oral infection in Drosophila. PLOS Pathogens. 10, e1004507 (2014).
  23. Moy, R. H., et al. Antiviral autophagy restrictsRift Valley fever virus infection and is conserved from flies to mammals. Immunity. 40, 51-65 (2014).
  24. Shelly, S., Lukinova, N., Bambina, S., Berman, A., Cherry, S. Autophagy is an essential component of Drosophila immunity against vesicular stomatitis virus. Immunity. 30, 588-598 (2009).
  25. Bronkhorst, A. W., et al. The DNA virus Invertebrate iridescent virus 6 is a target of the Drosophila RNAi machinery. Proceedings of the National Academy of Sciences of the United States of America. 109, E3604-E3613 (2012).
  26. Palmer, W. H., Medd, N. C., Beard, P. M., Obbard, D. J. Isolation of a natural DNA virus of Drosophila melanogaster, and characterisation of host resistance and immune responses. PLOS Pathogens. 14, e1007050 (2018).
  27. Jousset, F. X., Bergoin, M., Revet, B. Characterization of the Drosophila C virus. Journal of General Virology. 34, 269-283 (1977).
  28. Gupta, V., Stewart, C. O., Rund, S. S. C., Monteith, K., Vale, P. F. Costs and benefits of sublethal Drosophila C virus infection. J Evol Biol. 30, 1325-1335 (2017).
  29. Yang, S., et al. Bub1 Facilitates Virus Entry through Endocytosis in a Model of Drosophila Pathogenesis. Journal of Virology. (2018).
  30. Teixeira, L., Ferreira, A., Ashburner, M. The bacterial symbiont Wolbachia induces resistance to RNA viral infections in Drosophila melanogaster. Plos Biology. 6, e2 (2008).
  31. Ferguson, N. M., et al. Modeling the impact on virus transmission of Wolbachia-mediated blocking of dengue virus infection of Aedes aegypti. Science Translational Medicine. 7, 279ra237 (2015).
  32. Hedges, L. M., Brownlie, J. C., O'Neill, S. L., Johnson, K. N. Wolbachia and virus protection in insects. Science. 322, 702 (2008).
  33. Bhattacharya, T., Newton, I. L. G., Hardy, R. W. Wolbachia elevates host methyltransferase expression to block an RNA virus early during infection. PLOS Pathogens. 13, e1006427 (2017).
  34. Magwire, M. M., et al. Genome-wide association studies reveal a simple genetic basis of resistance to naturally coevolving viruses in Drosophila melanogaster. PLOS Genetics. 8, e1003057 (2012).
  35. Cao, C., Cogni, R., Barbier, V., Jiggins, F. M. Complex Coding and Regulatory Polymorphisms in a Restriction Factor Determine the Susceptibility of Drosophila to Viral Infection. Genetics. 2159-2173 (2017).
  36. Martins, N. E., et al. Host adaptation to viruses relies on few genes with different cross-resistance properties. Proceedings of the National Academy of Sciences of the United States of America. 111, 5938-5943 (2014).
  37. Moser, T. S., Sabin, L. R., Cherry, S. RNAi screening for host factors involved in Vaccinia virus infection using Drosophila cells. Journal of Visualized Experiments. (2010).
  38. Zhu, F., Ding, H., Zhu, B. Transcriptional profiling of Drosophila S2 cells in early response to Drosophila C virus. Journal of Virology. 10, 210 (2013).
  39. Ekstrom, J. O., Hultmark, D. A Novel Strategy for Live Detection of Viral Infection in Drosophila melanogaster. Scientific Reports. 6, 26250 (2016).
  40. Durdevic, Z., et al. Efficient RNA virus control in Drosophila requires the RNA methyltransferase Dnmt2. EMBO Reports. 14, 269-275 (2013).
  41. Chrostek, E., et al. Wolbachia variants induce differential protection to viruses in Drosophila melanogaster: a phenotypic and phylogenomic analysis. PLOS Genetics. 9, e1003896 (2013).
  42. Gupta, V., Vale, P. F. Nonlinear disease tolerance curves reveal distinct components of host responses to viral infection. Royal Society Open Science. 4, 170342 (2017).
  43. Chtarbanova, S., et al. Drosophila C virus systemic infection leads to intestinal obstruction. Journal of Virology. 88, 14057-14069 (2014).
  44. Merkling, S. H., van Rij, R. P. Analysis of resistance and tolerance to virus infection in Drosophila. Nature Protocols. 10, 1084-1097 (2015).
  45. Goic, B., et al. RNA-mediated interference and reverse transcription control the persistence of RNA viruses in the insect model Drosophila. Nature Immunology. 14, 396-403 (2013).
  46. Ashburner, M., Golic, K., Hawley, R. S. Drosophila: A Laboratory Handbook. Cold Spring Harbor Laboratory Press. (2011).
  47. Biochemical and Biophysical Research Communications: 1991 index issue. Cumulative indexes for volumes 174-181. Biochemical and Biophysical Research Communications. 1-179 (1991).
  48. Cotarelo, M., et al. Cytopathic effect inhibition assay for determining the in-vitro susceptibility of herpes simplex virus to antiviral agents. Journal of Antimicrobial Chemotherapy. 44, 705-708 (1999).
  49. Reed, L. J. M., H, A simple method of estimating fifty percent endpoints. The American Journal of Hygiene. 27, 493-497 (1938).
  50. Khalil, S., Jacobson, E., Chambers, M. C., Lazzaro, B. P. Systemic bacterial infection and immune defense phenotypes in Drosophila melanogaster. Journal of Visualized Experiments. e52613 (2015).
  51. Schwenke, R. A., Lazzaro, B. P. Juvenile Hormone Suppresses Resistance to Infection in Mated Female Drosophila melanogaster. Current Biology. 27, 596-601 (2017).
  52. Sabin, L. R., Hanna, S. L., Cherry, S. Innate antiviral immunity in Drosophila. Current opinion in immunology. 22, 4-9 (2010).
  53. Yin, J., Zhang, X. X., Wu, B., Xian, Q. Metagenomic insights into tetracycline effects on microbial community and antibiotic resistance of mouse gut. Ecotoxicology. 24, 2125-2132 (2015).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics