Inrättandet av virusinfektion och analys av värd-Virus interaktion i Drosophila Melanogaster

* These authors contributed equally
Immunology and Infection
 

Summary

Det här protokollet beskriver hur du upprättar virusinfektion i vivo i Drosophila melanogaster använder nano-injektion metod och grundläggande tekniker för att analysera virus-host interaktion.

Cite this Article

Copy Citation | Download Citations

Yang, S., Zhao, Y., Yu, J., Fan, Z., Gong, S. t., Tang, H., Pan, L. Establishment of Viral Infection and Analysis of Host-Virus Interaction in Drosophila Melanogaster. J. Vis. Exp. (145), e58845, doi:10.3791/58845 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Virus sprids är en viktig orsak till epidemiska sjukdomar. Thus, förstå samspelet mellan virus och värd är mycket viktigt att utvidga vår kunskap om förebyggande och behandling av viral infektion. Bananflugan Drosophila melanogaster har visat sig vara en av de mest effektiva och produktiva modellorganismerna skärm för antivirala faktorer och undersöka virus-host interaktion, tack vare kraftfulla verktyg för genetiska och mycket medfödda immunförsvaret signalvägar. Den procedur som beskrivs här visar en nano-injektion metod för att fastställa virusinfektion och inducera systemisk antivirala svar i vuxna flugor. Exakt kontroll av viral injektion dosen i denna metod möjliggör hög experimentell reproducerbarhet. Protokoll som beskrivs i denna studie inbegripa förberedelse av flugor och viruset, metoden injektion, klassar överlevnadsanalys, virus belastning mätning och en antiviral utbildningsavsnitt bedömning. Inflytande effekterna av virusinfektion av flugorna bakgrunden nämndes här. Denna infektion metod är enkel att utföra och kvantitativt repeterbara; Det kan användas till skärmen för värd/viral faktorer som är inblandade i virus-host interaktion och att dissekera överhörning mellan medfödd immun signalering och andra biologiska spridningsvägar som svar på virusinfektion.

Introduction

Framväxande virusinfektioner, speciellt av arboviruses, såsom den Chikungunya virus1, denguefeber virus, den gula feber-virus2 och den Zikavirus3, har varit ett stort hot mot folkhälsan genom att orsaka pandemier 4. alltså en bättre förståelse för virus-host interaktion har blivit allt viktigare för epidemiska kontroll och behandling av virussjukdomar hos människor. För detta mål, måste mer lämpliga och effektiva modeller inrättas för att undersöka mekanismerna bakom virusinfektion.

Bananflugan, Drosophilamelanogaster (D. melanogaster), ger ett kraftfullt system för att undersöka virus-host interaktion5,6 och har visat sig vara en av de mest effektiva modellerna att studera mänskliga virussjukdomar7 , 8 , 9. mycket antiviral signalering vägar och makalös genetiska verktyg gör flugor en bra modell för att producera betydande resultat med verkliga konsekvenser för antivirala studier på människa. Dessutom flugor är enkla och billiga att underhålla i laboratorium och är praktiskt för storskalig undersökning av romanen reglerande faktorer6,10 i viruset och värden under infektion.

Fyra stora mycket antivirala vägar (t.ex., RNA interferens (RNAi) väg11, JAK-STAT väg12, NF-κB vägen och autofagi väg13) är väl studerat i Drosophila i senaste år6. RNAi stigen är en bred antivirala mekanism som kan dämpa de flesta typer av virus infektion6,14. Störningar i denna väg av mutation i gener som Dicer-2 (Dcr-2) eller Argonaute 2 (AGO2) kan leda till ökad virus titer och värd dödlighet15,16,17. Den JAK-STAT-signalvägen har varit inblandade i kontroll av infektion av virus från familjen Dicistroviridae och familjen Flaviviridae i insekter, t.ex., Drosophila C-virus (DCV) flugor16 och West Nile-virus (Moskitbett) och denguefeber Virus i mygga18,19. De Drosophila Toll (homolog till den mänskliga NF-κB vägen) och immunbrist (IMD) vägar (liknar den mänskliga NF-κB och TNF-vägen) är båda engagerade i att försvara virus invasion20,21, 22. autofagi är en annan bevarade mekanism som är involverade i regleringen av virusinfektion, som kännetecknas väl i Drosophila23,24. Således, identifiering av romanen reglerande faktorer av dessa vägar och dissekera överhörning mellan dessa antivirala signalering och andra biologiska spridningsvägar, t ex ämnesomsättning, åldrande, neurala reaktion och så vidare, kan vara enkelt ställa in i den Drosophila systemet.

Även om mest väletablerade viral infektionssjukdomar modeller i Drosophila induceras av RNA-virus, infektion av de ryggradslösa skimrande Virus 6I (IV-6) och Kallithea virus har visat potentialen för studie av DNA virus i flugor25, 26. Dessutom kan viruset också ändras för att tillåta infektion i Drosophila, såsom influensavirus9. Detta har kraftigt utökade tillämpningen av Drosophila screening plattformen. I den här proceduren använder vi DCV som ett exempel för att beskriva hur man utvecklar en viral infektionssjukdomar system i Drosophila. DCV är en positiv-sense enda stranded RNA-virus av cirka 9300 nukleotider, kodning 9 proteiner27. Som en naturlig patogen D. melanogasteranses DCV som lämplig virus studera värd fysiologiska, beteendemässiga och basala immunsvaret under host-virus interaktion och samtidig evolution28. Dessutom gör dess snabba dödligheten efter infektion i vildtyp flugor DCV användbar till skärmen för resistenta eller mottagliga gener i värd29.

Det finns dock flera aspekter av oro när man studerar virusinfektioner i Drosophila. Till exempel har symbiotiska bakterier Wolbachia en förmåga att hämma ett brett spektra av RNA-virus spridning i Drosophila och mygga30,31,32. Senaste belägg visar en möjlig mekanism i vilken Wolbachia block Sindbis virus (SINV) infektion genom uppreglering av methyltransferase Mt2 uttryck i den värd33. Dessutom, är den genetiska bakgrunden av insekter också kritisk för virusinfektion. Exempelvis den naturliga polymorfism i genen, pastrel (pst), bestämmer infektionskänslighet DCV i Drosophila34,35, medan loci Ubc-E2H och CG8492 är involverade i Cricket förlamning virus (CrPV) och Flock hus (FHV) infektion, respektive36.

Den särskilda sätten att fastställa den virus-host interaktionen i flugor, måste väljas enligt forskningsändamål såsom en hög genomströmning skärm för värd cellulära komponenter i Drosophila cell linjer37,38, oral infektion att studera gut-specifika antivirala svar22,39,40, nål prickning41,42 eller nano-injektion av passerar epiteliala hinder för att stimulera systemisk immun Svaren. Nano-injektion kan exakt styra viral dosen för att framkalla en kontrollerad antivirala reaktion och en fysiologisk lesion43, vilket garanterar hög experimentell reproducerbarhet44. I denna studie beskriver vi en nano-injektion metod för att studera virus-host interaktioner i Drosophila, belysa vikten av flugorna bakgrundseffekter.

Protocol

Obs: Innan du börjar experiment, av cellinjer och flyga lagren används måste inte vara förorenat av andra patogener, särskilt för virus såsom DCV, FHV, Drosophila X virus (DXV) och aviär nefrit virus (ANV). Idealiskt, RNA-sekvensering eller en enklare PCR-baserat identifiering används för att upptäcka kontaminering10,45. Om kontaminering skett, de cellinjer och flyga bestånd ska inte användas mer tills de är helt dekontamineras46.

1. virus och flyga förberedelse

  1. Virus förökning och insamling
    Obs: Drosophila S2 * celler används för DCV förökning och titrering. S2 * cell raden härrör från en primär kultur av sena skede D. melanogaster embryon. Denna cellinje har varit väl beskrivs tidigare47.
    1. Växa S2 * celler i Schneiders Drosophila Medium vid 25 ° C utan ytterligare CO2, som en lös, halv vidhäftande enskiktslager i en 10 cm cell kultur maträtt, med en täthet på 1 x 107 livskraftiga celler/mL. Användning komplett medium för S2 * celler: Schneiders Drosophila Medium innehållande 10% värme inaktiverat FBS, 100 enheter/mL Penicillin och 100 μg/mL Streptomycin.
      Obs: Friska celler bör visa en rund form och uppvisar homogen storlek.
    2. Snabbt Tina DCV beståndet från-80 ° C i 25 ° C vattenbad. Infektera S2 * celler med DCV på MOI = 0,01 omedelbart genom att direkt lägga till 1 mL virus lösning till cell kultur rätter (tillväxtområde: 55 cm2) med 10 mL komplett medium för S2 * celler.
    3. Inkubera cellerna vid 25 ° C i 3 till 5 dagar. När viruset är redo för samling, Cellmorfologi är onormal (cell form ser oskärpa) och odlingssubstratet är full av svarta partiklar vägledande av cellfragment.
    4. Samla hela cellkulturen i en 15 mL tub genom pipettering upp och ner och frysa vid-80 ° C (för upp till ett år).
      Obs: DCV kan lagras under längre perioder vid-80 ° C med minimal förlust av smittsamhet, upp till ett år.
    5. Tina cellkulturen i 25 ° C vattenbad under ständig skakning och sedan Centrifugera 6000 x g under 15 minuter vid 4 ° C. Samla in supernatanten i en steril 15 mL tub och vortex. Alikvot upp till 200 μL av virus lösning per rör.
      Obs: Virus alikvoter kan lagras under kortare perioder på upp till 3 dagar vid 4 ° C och upp till 1 år vid-80 ° C. Upprepad frysning-tining cykler bör undvikas. Det är alltid bättre att använda alla alikvoten på en gång.
    6. Plocka 5 slumpmässiga virusinnehållande rör att avgöra den genomsnittliga virus vävnad infektiös dos i cellkultur (TCID50) av en cytopatisk effekt (CPE)-analysen (1 enhet TCID50= 0,7 plackbildande enhet [PFU]).
      Obs: CPE refererar till strukturella förändringar i värdceller som orsakas av viral invasion. Det infekterande viruset orsakar Lys av värdcellen eller när cellen dör utan Lys på grund av en oförmåga att reproducera48.
      1. Dag 1, samla beredda S2 * celler genom pipettering. Räkna antalet cell. Centrifugera celler för 300 x g i 4 min och kasta bort supernatanten. Späd cellerna att tätheten av 1 x 106 celler/mL med komplett medium för S2 * celler som beskrivs i steg 1.1.1.
      2. Frö 1 x 105 S2 * celler (100 μL) per brunn till platt-96-brunn-bottenplattan (~ 30% konfluens).
      3. Utföra 10-faldig seriespädningar av DCV beståndet med komplett medium för S2 * celler. Tillsätt 50 µL utspädningar i brunnen. Tillsätt 50 µL av odlingsmedium utan virus till brunnen klassificeras som den negativa kontrollen väl.
        Obs: För varje spädning användes 8 brunnar. Den typiska DCV avkastningen är cirka 108-109 PFU/mL, bör utspädning minst omfatta ~ 10-5-10-10.
      4. På dag 4, Observera CPE med ljusa fält Mikroskop med en 20 X eller 40 X-objektiv. Klassificera en brunn där cellerna ser suddiga och medium är full av fragment en ”positiv samt”, och en brunn där Cellmorfologi är normalt som ”negativa väl”.
      5. Mark CPE positiva eller negativa brunnar med + eller-, respektive. Beräkna viruset TCID50 Reed och Muench metod49.
    7. Bortskaffa alla förorenade material och handskar i sanering pannan. Om viruset inte kan nå den önskade TCID50, koncentrat 100 mL virus lösning genom centrifugering vid 68.000 x g för 1 h vid 4 ° C.
      Obs: beroende på syftet med försöket, en serie doser från 102 106 TCID50 enheter kan användas för virusinfektion. Vanligtvis använder vi 3 x 106 TCID50 enheter.
    8. Avlägsna supernatanten och slamma i 1 mL av Tris-HCl buffert (10 mM, pH 7,2). Alikvotens 20 μL av virus lösning per tub och förvaras vid-80 ° C. Plocka 5 slumpmässiga rör att avgöra den genomsnittliga viruset TCID50 igen.
  2. Flyga förberedelse för infektion
    Obs: Symbiotiska bakterier Wolbachia kan undertrycka många sorters RNA-virusinfektion i insekter30,31,32,33,41. Därför är det viktigt att rensa Wolbachia från flugor innan studera värd-virus infektion i vivo33.
    1. Förbereda flyga mat som innehåller tetracyklin genom att lägga till 400 μL av 50 µg/mL tetracyklin (i 70% etanol) till 4 g färska standard majsmjöl flyga mat (1 L av mat innehåller 77,7 g majsmjöl, 32.19 g jäst, 10,6 g agar, 0.726 g CaCl2 31.62 g sackaros, 63,3 g glukos, 2 g kaliumsorbat och 15 mL 5% C8H8O3). Blanda väl och placera maten vid 4 ° C över natten för att förånga etanol.
      Obs: En hög dos av etanol kan påverka flyga fertilitet, så utelämna inte detta steg.
    2. Varm mat till rumstemperatur och sätta nya eclosed vuxna flugor (20 kvinnor och 10 män) i injektionsflaskan. Föder upp flugor vid 25 ° C, 60% fuktighet under en normal ljus/mörker-cykel.
      Obs: Typiskt, det tar 3-4 dagar för flugorna att lägga tillräckligt ägg. För många ägg hämmar larver utveckling och minska tetracyklin effektivitet.
    3. Samla nya eclosed vuxna flugor (inom 3 ~ 5 dagar) under ett lättare flöde av CO2, och upprepa steg ~ 1.2.1-1.2.2. Normalt krävs minst 3 generationer för att helt avskaffa Wolbachia.
    4. Efter 3 generationer med tetracyklin behandling, samla 5 flugor under ett lättare flöde av CO2 för Wolbachia infektion testet. Mala flugor för 1 min med 250 μL dubbeldestillerat vatten (ddH2O) och några 0,5 mm steril keramiska pärlor i ett 1,5 mL rör med hjälp av en Homogenisatorer. Lägga till en annan 250 μL av 2 x buffert A (0,2 M Tris-HCl, pH 9,0; 0,2 M EDTA; 2% SDS) till prov och vortex.
      Obs: Eftersom SDS kommer att hindra pärla rörelse, 1 x buffert A kan inte direkt användas för att slipa flugor. Om flugorna har röda ögon, ta bort huvuden innan slipning, eftersom detta kan påverka färgen på DNA produkten.
    5. Frysa proverna vid-80 ° C (hålla upp till ett år). Snabbt tinar det provet från-80 ° C i 25 ° C vattenbad tills upplöst. Inkubera proverna vid 70 ° C i 30 min.
    6. Tillsätt 190 μl 5 M KOAc, vortex och inkubera på is i 15 min eller längre.
    7. Centrifugera proverna vid 13 000 x g under 5 minuter i rumstemperatur, samla supernatanten och överföra dem till nya rör.
    8. Upprepa steg 1.2.7 att få DNA med bättre kvalitet.
    9. Lägga till 750 μL isopropanol i varje prov och vänd försiktigt några gånger för hand. Odla i rumstemperatur i 5 min.
    10. Centrifugera proverna vid 13 000 x g under 5 minuter i rumstemperatur och kasta bort supernatanten. Den vita genomiska DNA pelleten kommer bo på botten av röret.
    11. Tillsätt 1 mL 70% etanol till pellets, Centrifugera vid 13 000 x g i 5 min, och kasta bort supernatanten. Lufttorka DNA tills den blir genomskinlig.
    12. Lös upp DNA i 100 μL av ddH2O, titrera DNA-koncentration genom UV-Vis absorption spectrophotometry och späd DNA till 100 ng/μl.
    13. Använd 200 ng DNA för PCR-reaktionen (i en 20 μL system, se Tabell för material). Utföra PCR av följande program: 95 ° C i 15 min; 36 cykel av 95 ° C för 45 s, 50 ° C för 45 s, och 72 ° C i 1 min. och en sista förlängning steg (72 ° C i 1 min) i en termocykel.
      Obs: Baserat på den Wolbachia 16S rRNA, Använd följande grundfärger: 5' TGAGGAAGATAATGACGG 3' (framåt) och 5' CCTCTATCCTCTTTCAACC 3' (bakåt). För wsp, primers var 5' CATTGGTGTTGGTGTTGGTG 3' (framåt) och 5' ACCGAAATAACGAGCTCCAG 3' (bakåt).
    14. Analysera PCR-produkter med 1% agaros gelelektrofores. PCR-Produktstorlek Wolbachia 16S rRNA och wsp är cirka 200 bp och 600 bp, respektive.
    15. Bakre Wolbachia gratis flyga lager på standard majsmjöl flyga mat. Samla 3-5 dagars nyligen eclosed manliga flugor för infektion.
      Obs: Tetracyklin behandling kan också påverka tarmens bakterieflora sammansättning, som därefter påverkar antivirala svar i värden. Vi rekommenderar att alla flugor bör få samma tetracyklin behandlingar. Håll Wolbachia-fri flugor växer under standart villkorar i minst 3 generationer att återställa tarmfloran.
  3. Pastrel genotypning
    Obs: Förekomsten av S eller R-allelen av pst genen i den genetiska bakgrunden har rapporterats påverka DCV infektion i Drosophila34,35. Det är nödvändigt att kontrollera pst genotypen, särskilt för DCV infektion. Det finns några SNP i pst som kan påverka virusinfektion, major SNP är 512 C/T. Temperaturlutning PCR är en snabb metod att identifiera pst genotyp.
    1. Extrakt flyga genomiskt DNA som beskrivs ovan (steg 1.2.4 - 1.2.15).
    2. Använd 100 ng DNA som mall, 512C primer, 5' CAGCATGGTGTCCATGAAGTC 3' (framåt) och 5' ACGTGATCAATGCTGAAAGT 3' (omvänd) att upptäcka den R allelen, den 512T primern, 5' CAGCATGGTGTCCATGAAGTT 3' (framåt) och 5' ACGTGATCAATGCTGAAAGT 3' (bakåt) för att upptäcka den S-allelen.
    3. Ange de Tm (smälttemperatur) lutningarna följande: 54 ° C, 54,7 ° C, 55,5 ° C, 58 ° C, 59,7 ° C, 62,2 ° C, 63,7 ° C och 64 ° C (45 s vid varje temperatur).
      Obs: 30 cykler av PCR kedjereaktion rekommenderas (20 μL system).
    4. Visualisera 100-bp PCR-produkten av 2% agaros gelelektrofores.

2. virusinfektion i Drosophila

  1. Infektera flugor av nano-injektion och utföra överlevnad analyser.
    1. Dra kapillärerna för att förbereda injektionsnålar, back-fylla injektion nål med olja och montera injektorn som tidigare beskrivits50.
    2. Bedöva flugor på pad under ett lättare flöde av CO2. Inokulera flugor av Intra bröstkorg injektion44 i 50,6 nL virus lösning (100 PFU, utspädd med Tris-HCl buffert, pH 7,2). Injicera minst 3 injektionsflaskor av flugor (20 flugor per injektionsflaska).
      Obs: Injektionen är tidskrävande (allmänt 100 flugor per timme) och DCV-replikering är mycket snabb, så det är mycket viktigt att skriva ner exakt tid på tuben en gång efterbehandling varje injektionsflaska (20 flugor). Buffert bara injektion är inställd som en mock kontroll. Manliga vuxna flugor är vanligtvis att föredra, eftersom resultaten är mer stabila och reproducerbara än när du använder Honor eftersom hormonella variationerna under parning och reproduktion kan påverka avläsningen av kvinnor51.
    3. Växa de injicerade flugor vid 25 ° C, 60% fuktighet under en normal ljus/mörker-cykel. Levererar flugor med färsk mat dagligen och registrera antalet döda flies.
    4. Utför minst 3 biologiska replikat och Rita kurvan överlevnad.
    5. För statistisk analys av överlevnadsdata, generera Kaplan-Meier överlevnadskurvor av statistisk programvara. Utföra log-rank-test för att beräkna de P-värdena. Ange information för varje ämne på tabellen överlevnad. Programvaran sedan beräknar procent överlevnad vid varje gång, och tomter en Kaplan-Meier överlevnad tomt.
      Obs: Lägg inte till extra jäst i injektionsflaskan. Jämfört med mock kontroller, DCV-infekterade flugor ibland har ascites och är klumpig, vilket gör dem sårbara för klibbiga jästen. Det är bättre att spela in fler tidpunkter i det preliminära experimentet för att ta reda på en tidsram som massiv död kommer att hända för infekterade flugor. Allmänhet, infekterade flugor dör sällan inom de första två dagarna, även för de Dcr-2 mutant linjerna. För den Wolbachia som gratis w1118 (Bloomington 5905) flyga infekterade för med 100 PFU av DCV, är detta tidsfönster runt 3-5 dagar efter infektion. Bananflugor som dör inom 0,5 h post injektion timmar bör inte räknas som en dödsolycka eftersom de kan dödas av nålen skada inte av virusinfektion.
  2. DCV ladda åtgärd av CPE assay
    Obs: Viral load mäts på samma sätt till titrering av virus beståndet (steg 1.1.6) men kräver ytterligare provberedning (steg 2.2.1-2.2.4).
    1. Dag 1, infektera manliga flugor som beskrivs i steg 2.1.1-2.1.2. Gruppera injicerade flugor i grupper om 20 och hålla dem växer på färsk flyga mat för önskad tid (typiskt för 24 h eller 3 dagar). Ge flugor med färsk mat dagligen.
    2. Dag 2, utsäde Drosophila S2 * celler i en 10 cm cell kultur maträtt till tätheten av ungefärligt 5 x106 till 1 x 107 celler/mL enligt steg 1.1.1.
    3. Dag 3, samla 5 flugor (under ett lättare flöde av CO2) och Mala dem i en 1,5 mL centrifugrör för 30 s med 200 μL av Tris buffert och keramiska pärlor med hjälp av Homogenisatorer. Lagra proverna vid-80 ° C eller genast fortsätta till nästa steg.
    4. Grundligt vortex provet. Använd en 1 mL spruta och 0,22 μm filter för att filtrera supernatanten till en ny 1,5 mL tub. Fortsätt med titreringen, enligt beskrivningen i steg 1.1.6.1-1.1.6.5.
  3. DCV belastning mätt qRT-PCR
    1. Dag 1, infektera flugor som beskrivs ovan. Grupp injicerade man flyger (20 flugor/grupp) och växer på färsk flyga mat för önskad tid, typiskt för 24 h eller 3 dagar. Ge flugor med färsk mat dagligen.
    2. Dag 3, samla 5 flugor under ett lättare flöde av CO2 i ett 1,5 mL rör med 200 μL lyseringsbuffert och 20 keramiska pärlor (diameter = 0,5 mm), slipa proverna med Homogenisatorer med hög hastighet för 30 s. lägga 800 μL av ytterligare lysisbuffert till varje rör och lagra s empel vid-80 ° C eller omedelbart genomföra RNA-extraktion och qRT-PCR.
    3. Förbereda RNase gratis tips, rör och avjoniserat, diethylpyrocarbonate (DEPC) behandlas och 0,22 µm membran-filtrerat vatten. Tillsätt 200 μl kloroform (≥99.5%) i provet och kraftfullt skaka för 15 s för hand. Inkubera i 5 minuter eller längre vid rumstemperatur tills vattenfasen och den organiska fasen är klart avgränsade.
      Obs: Kloroform är extremt farliga och måste hanteras med försiktighet. Gör inte vortex urvalet, vilket ökar risken för DNA kontaminering.
    4. Centrifugera proverna vid 13 000 x g i 15 minuter vid 4 ° C.
    5. Samla in 400 μL av supernatanten och överför supernatanten till nya rör. Blanda med den samma volymdelar isopropanol (≥ 99,5%), vänd försiktigt proverna för 20 gånger för hand och sedan fällningen i 10 min eller längre i rumstemperatur.
      Obs: Vid-20 ° C nederbörden RNA avkastning.
    6. Centrifugera proverna vid 13 000 x g under 10 minuter vid 4 ° C. Vit RNA pellets är synliga på botten av röret.
    7. Avlägsna supernatanten och tillsätt 1 mL 70% etanol (etanol i DEPC vatten) och Invertera några gånger att tvätta RNA.
    8. Centrifugera proverna vid 13 000 x g under 5 minuter vid 4 ° C. Kassera supernatanten och torr RNA för 5-10 min. RNA bör bli genomskinliga.
    9. Tillsätt 50 μL DEPC vatten till prov, pipett för några gånger och vortex.
    10. Ta 3 μL av RNA för titrering av RNA-koncentrationen. Kvantifiera RNA på 260 nm. Normalt, är den RNA-koncentrationen som utvinns av detta protokoll ca 100-500 μg/μL, som passar för cDNA syntes.
    11. Använd 2 μg RNA för cDNA syntes. Späd provet med 100 μL med ddH2O och förvaras vid-20 ° C.
    12. Utföra qRT-PCR enligt tillverkarens anvisningar och köra qRT-PCR.
      Obs: CDNA syntes av DCV, slumpmässiga primers arbetat mycket bättre än Poly A primer i våra händer. DCV mRNA uttryck är normaliserat till endogena ribosomala proteinet 49 (rp49) mRNA. Oligonukleotid primers används i denna del: rp49 5' AGATCGTGAAGAAGCGCACCAAG 3' (framåt) och 5' CACCAGGAACTTCTTGAATCCGG 3' (omvänd); DCV, 5' TCATCGGTATGCACATTGCT 3' (framåt) och 5' CGCATAACCATGCTCTTCTG 3' (omvänd); Vago, 5' TGCAACTCTGGGAGGATAGC 3' (framåt) och 5' AATTGCCCTGCGTCAGTTT 3' (omvänd); virus-inducerad RNA 1 (vir-1) 5' GATCCCAATTTTCCCATCAA 3' (framåt) och 5' GATTACAGCTGGGTGCACAA 3' (bakåt).

Representative Results

Resultaten av detta avsnitt erhålls efter DCV infektion av D. melanogaster. Figur 1 visar flödet kartlägger av virusinfektion i Drosophila. Flugor injiceras inom thoracically, och då proverna samlas in för mätning av den virala TCID50 och arvsmassan RNA nivån (figur 1). Virusinfektion kan inducera cell lysis och CPE iakttas på 3 dagar efter infektion (figur 2A). Viruset belastningen mäts av CPE analysen mäts i linje med qPCR (figur 2B). Som visas i figur 3, hämmar Wolbachia DCV infektion i Drosophila. WOL-16s rRNA och wsp primers används för att upptäcka Wolbachia närvaro (figur 3A) och Wolbachia-gratis flugor visar signifikant minskad överlevnad efter DCV infektion (figur 3B). Figur 4 visar hur man verifierar pst polymorfism av gradient PCR använder specifika primers. Figur 5 visar dos beroende effekterna av DCV infektion i vildtyp fluga. Överlevnaden i figur 5A och viruset laddar på 3 dagar post infektion visas i figur 5B. Figur 6 visar att DCV infektion kan aktivera den Dcr2/RNAi och JAK/STAT antiviral signalering vägar i den mottagande52. Reporter vago genuttrycket i Dcr2/RNAi utbildningsavsnittet är uttryck förhöjda 3 dagar post infektion (figur 6A). Den JAK-STAT-signalvägen aktiveras även vid DCV infektion, vilket indikeras av uttrycket nivån på reporter gen vir-1 (figur 6B). Figur 7 visar att Dcr2/RNAi smittvägen är kritisk för antivirala infektion i Drosophila52. DCR-2 muterade flugor har en minskad överlevnad (figur 7A) och en ökad viruset laddar (figur 7B) efter DCV infektion.

Figure 1
Figur 1: flödesschema Drosophila infektion och virus belastning analys.
Inrättande av Drosophila infektion av nano-injektion. Tabellen schema visar att flugor är smittade inom thoracically och att viruset laddar mäts av CPE assay och qRT-PCR. Klicka här för att se en större version av denna siffra.

Figure 2
Figur 2: DCV belastning analys.
Viruset belastningen mäts av CPE analysen mäts i linje med qPCR. (A) S2 * celler odlas vid 25 ° C i 3 dagar med ett annat virus utspädning (50 μL). 1 enhet TCID50 används virus är 4,29 x 109 (motsvarande 3 x 109 PFU/mL). Första panelen, 10-3 utspädning; andra panel, 10-7 utspädning; tredje panel, 10-10 utspädning; fram panel, utan infektion. Celler i panelen ett och två visar den typiska CPE positiva fenotypen (vita pilar indikerar cellfragment), och celler i panelen tre och fyra Visa den typiska negativa fenotypen. Skalstapeln indikeras i siffrorna. (B) mätning av DCV ladda av qPCR. Utföra 10-faldig seriespädningar av DCV och infektera den S2 * cellinje. Den total-RNA av infekterade celler utvinns och qPCR utförs för att mäta DCV RNA nivån. Gradient smittsamma virusmängd (bestäms av CPE assay) i celler är matchas och positivt relaterat till mätningen av qPCR (r2= 0,999). Klicka här för att se en större version av denna siffra.

Figure 3
Figur 3: Virusinfektion av flugor med eller utan Wolbachia.
Wolbachia infektion bidrar till DCV motstånd i Drosophila. (A) det Wolbachia närvaron detekteras av wol-16s rRNA och wsp primrar. G1, G2 och G3 representerade malmrflugor (Oregon-R), (Bloomington 5) behandlades av tetracyklin för en, två och tre generationer. PCR-Produktstorlek är cirka 200 bp (wol-16s rRNA) och 600 bp (wsp). (B) Wolbachia gratis flugor är mer känsliga för DCV infektion. 3-5 dagars gamla manliga vuxna flugor injiceras med 100 PFU av DCV. Wolbachia gratis flyger (heldragna linjer) Visa signifikant minskad överlevnad än Wolbachia skyddade flugor (dash linjer) vid DCV infektion. Två olika vildtyp linjer, malmr och w1118, används för överlevnad analysen och visar liknande resultat. Alla felstaplar representera minst tre oberoende tester, standardfel (s.ö.) * P < 0,05, ** P < 0,01, *** P < 0,001, *** P < 0,0001, ns, ej signifikant. Kaplan – Meier (B). Klicka här för att se en större version av denna siffra.

Figure 4
Figur 4: Pastrel genotypning av gradient PCR.
PST -polymorfism är verifierad av gradient PCR. Gradient PCR utförs för att skilja pst R (512 C) och S (512T)-allel i Drosophila vuxen människa. TM lutningar är a: 54 ° C, b: 54,7 ° C, c: 55,5 ° C, d: 58 ° C, e: 59,7 ° C, f: 62,2 ° C, g: 63,7 ° C, h: 64 ° C.  Klicka här för att se en större version av denna siffra.

Figure 5
Figur 5: Överlevnaden och DCV titer för malmr flugor infekterade med en annan dos av DCV.
Malmrflugor injiceras med tre olika doser av DCV, 10 PFU/flyga, 50 PFU/flyga och 100 PFU/flyga. (A) flugor överlevnaden är betydligt lägre när infekterade med högre infektiösa doser. (B) DCV RNA nivån i hela kroppen av angiven flugorna mäts av qRT-PCR vid den angivna tiden och normaliserade till 10 PFU/flyga inympning grupp. Alla felstaplar representera minst tre oberoende tester, standardfel (s.ö.) * P < 0,05, ** P < 0,01, *** P < 0,001, *** P < 0,0001, ns, ej signifikant. Kaplan – Meier (A) eller One-way anova (B). Klicka här för att se en större version av denna siffra.

Figure 6
Figur 6: Dcr2/RNAi och JAK/STAT antiviral signalering utbildningsavsnitt aktiveras efter DCV infektion.
Malmrflugor var infekterade med 100 PFU av DCV. Vago (A) och vir-1 (B) mRNA uttryckt i hela kroppen mäts av qRT-PCR vid angiven tid punkter post infektion. Ändringen av uttryck är normaliserat som basal nivå innan infektion. Alla felstaplar representera minst tre oberoende tester, standardfel (s.ö.) * P < 0,05, ** P < 0,01, *** P < 0,001, *** P < 0,0001, ns, ej signifikant. Envägs ANOVA (A, B). Klicka här för att se en större version av denna siffra.

Figure 7
Figur 7: Dcr-2 mutant fluga känslig för DCV infektion.
DCR-2 mutant flugor och dess genetiska kontroll w1118 flugor var infekterade med 100 PFU av DCV. (A) överlevnaden av Dcr-2 bristfällig flugor och vildtyp (w1118) flugor inlägg DCV infektion. (B) DCV RNA nivå i hela kroppen av angiven flugorna mäts av qRT-PCR 2 dagar post infektion och normaliserade som w1118. Alla felstaplar representera minst tre oberoende tester, standardfel (s.ö.) * P < 0,05, ** P < 0,01, *** P < 0,001, *** P < 0,0001, ns, ej signifikant. Kaplan – Meier (A) eller student's T-test (B). Klicka här för att se en större version av denna siffra.

Discussion

I denna artikel presenterar vi detaljerade anvisningar om hur du upprättar en viral infektionssjukdomar system i vuxen Drosophila melanogaster använder nano-injektion. Protokollen omfattar utarbetandet av lämpliga Fluglinor och virus lager, infektion tekniker, utvärdering av infektiös indikatorer och mätning av antivirala responsen. Även om DCV används som ett exempel på en viral patogen, har tiotals olika sorters virus framgångsrikt tillämpats för studie i Drosophila systemet. Dessutom har hundratals reglerande faktorer, antingen av virus eller av värden, identifierats genom storskalig screening i flugor. Således, denna metod är mycket anpassningsbara och begränsar inte till DCV /Drosophila interaktion.

För att framgångsrikt propagera och skörden hög titer DCV, måste några försiktighetsåtgärder vidtas. Cellerna bör vara friska, odlade på en lämplig täthet och skördats på tid. Att minska cellvolym kultur påverkar inte signifikant virus titer. Normalt 107 celler infekterade av DCV på MOI = 0,01 kommer slutligen avkastning ungefärliga 108-109 TCID50 av DCV, som kan möta kraven från de flesta i vivo och in vitro- experiment. De CPE assay och qRT-PCR analys beskrivs i detta protokoll för mätning av viruset laddar. CPE analysen är något knepigt. Den lämpliga djurtäthet cell inympning och en erfaren standard av positiva/negativa CPE diskriminering tillåter en snabb och framgångsrik CPE-analysen. Därför tillhandahåller vi en lätt qRT-PCR-analys här för att hjälpa välja utspädning brytpunkten i CPE analys innan mastering CPE analysen.

DCV är dock ett mycket potent virus för vuxen fluga och Drosophila cellinje. Endast 100 PFU/flyga inympningen kan döda 50% av vilda flugor inom 5 dagar. En överflödig infektion DOS kan skugga betydelsen mellan vildtyps flyga och potentiella mottagliga raderna. Det är viktigt att tillämpa minst två infektion doser när man initierar en ny skärm. Eftersom Drosophila massiv död kan hända en mycket kort tid fönster på grund av hög dödlighet av DCV, rekommenderas inspelning antalet dödsfall oftare i preliminära experiment starkt. Efter DCV-infektion har några flugor ibland ascites syndrom. Särskilt, bör flugor som dör inom 0,5 h post infektion uteslutas, som kan orsakas av olämpligt nål injektion skada.

DCV smittsamma styrka påverkas även av många värd faktorer, som bör beaktas innan ett experiment. Wolbachia är en vertikal överför endosymbiont som har stor inverkan på virusinfektion i flugor32. Tetracyklin behandling i flyga mat är en vanlig metod att eliminera Wolbachia infektion. Men förändrar denna metod också tarmens bakterieflora sammansättning, som i sin tur kan påverka antivirala svar53. Ett fåtal studier har betonat vikten av genetisk varians på virus infektion36, såsom ubc-e2h, cg8492 och pst. Exempelvis har de flesta vildtyp flyga linjer har pst S allelen och är känsliga för picorna-liknande virus, medan de flesta muterade linjer vi testat från Bloomington lager center har pst R allel, således resistenta fenotyper. Det är mycket viktigt att utesluta inverkan av pst, särskilt när sålla ut en motstånd gen jämföra med vildtyp kontroll29.

Förutom nano-injektion för att inducera systemisk infektion, finns andra metoder att studera virusinfektion i flugor. Drosophila cellinjer har bevisat till vara en hög genomströmning metod att sålla bort virusinfektion med värd cellulära komponent37,38. Ett in vitro -system åtföljs dock alltid med en hög grad av falska positiva resultat, när du bekräftar i vivo. DCV kan också tillämpas för att infektera Drosophila oralt, medan det endast kan utlösa en begränsad och mildare infektion. Endast 20% av larver smittades inom 12 h och 14% dödlighet observerades, med bara 25% flyger dödlighet i 20 dagar i vuxen22. Prickning flugor med 0,15 mm diameter stift är ett annat sätt att ange virusinfektion men det kan inte garantera korrekt infektion DOS och kvantitativa repeterbarhet. Överuttryck av virala proteiner genom genmanipulation i flugor är ett bra sätt att studera molekylära interactomes i vivo7. Det får dock inte beskriva verkligheten i fysiologi och patologi i mottagande vid infektion. Samtidigt har metoden nano-injektion också nackdelar, eftersom det inte är naturliga sträckningen av infektion och direkt kan stimulera ett starkt system immunsvar strax efter infektion som kringgås nagelband, första antivirala försvarslinje. Sammanfattningsvis är specifik forskning syfte och tillgänglig experimentell skick de avgörande faktorerna i valet mellan olika metoder.

Disclosures

Författarna har något att avslöja.

Acknowledgments

Vi vill tacka hela Pan labbet i IPS. CAS. Vi tackar Dr. Lanfeng Wang (IPS, CAS) för experimental stöd och Dr Gonalo Cordova Steger (Springer natur), Dr Jessica VARGAS (IPS, Paris) och Dr. Seng Zhu (IPS, Paris) för kommentarer. Detta arbete stöds av bidrag från programmet strategisk prioritet forskning av den kinesiska Vetenskapsakademien Larsson (XDA13010500) och Hägg (XDB29030300), den nationella naturvetenskap Foundation i Kina Larsson (31870887 och 31570897) och J.Y (31670909). Larsson är en fellow av CAS ungdom Innovation Promotion Association (2012083).

Materials

Name Company Catalog Number Comments
0.22um filter Millipore SLGP033RS
1.5 ml Microcentrifuge tubes Brand 352070
1.5 ml RNase free Microcentrifuge tubes Axygen MCT-150-C
10 cm cell culture dish Sigma CLS430167 Cell culture
100 Replacement tubes Drummond Scientific 3-000-203-G/X
15 ml tube Corning 352096
ABI 7500 qPCR system ABI 7500 qPCR
Cell Incubator Sanyo MIR-553
Centriguge Eppendof 5810R
Centriguge Eppendof 5424R
Chloroform Sigma 151858 RNA extraction
DEPC water Sigma 95284-100ML RNA extraction
Drosophila Incubator Percival I-41NL Rearing Drosophila
FBS Invitrogen 12657-029 Cell culture
flat bottom 96-well-plate Sigma CLS3922 Cell culture
Fluorescence microscope Olympus DP73
Isopropyl alcohol Sigma I9516 RNA extraction
Lysis buffer (RNA extraction) Thermo Fisher 15596026 TRIzol Reagent
Lysis buffer (liquid sample RNA extraction) Thermo Fisher 10296028 TRIzol LS Reagent
Microscope Olympus CKX41
Nanoject II Auto-Nanoliter Injector Drummond Scientific 3-000-204 Nanoject II Variable Volume (2.3 to 69 nL) Automatic Injector with Glass Capillaries (110V)
Optical Adhesive Film ABI 4360954 qPCR
Penicillin-Streptomycin, Liquid Invitrogen 15140-122 Cell culture
qPCR plate ABI A32811 qPCR
Schneider’s Insect Medium Sigma S9895 Cell culture
statistical software GraphPad Prism 7
TransScript Fly First-Strand cDNA Synthesis SuperMix TransScript AT301 RNA extraction
Vortex IKA VORTEX 3 RNA extraction

DOWNLOAD MATERIALS LIST

References

  1. Rahim, M. A., Uddin, K. N. Chikungunya: an emerging viral infection with varied clinical presentations in Bangladesh: Reports of seven cases. BMC Research Notes. 10, 410 (2017).
  2. Douam, F., Ploss, A. Yellow Fever Virus: Knowledge Gaps Impeding the Fight Against an Old Foe. Trends in Microbiology. (2018).
  3. Santiago, G. A., et al. Performance of the Trioplex real-time RT-PCR assay for detection of Zika, dengue, and chikungunya viruses. Nature Communications. 9. 9, 1391 (2018).
  4. Gould, E., Pettersson, J., Higgs, S., Charrel, R., de Lamballerie, X. Emerging arboviruses: Why today? One Health. 4, 1-13 (2017).
  5. Hughes, T. T., et al. Drosophila as a genetic model for studying pathogenic human viruses. Virology. 423, 1-5 (2012).
  6. Xu, J., Cherry, S. Viruses and antiviral immunity in Drosophila. Developmental & Comparative Immunology. 42, 67-84 (2014).
  7. Shirinian, M., et al. A Transgenic Drosophila melanogaster Model To Study Human T-Lymphotropic Virus Oncoprotein Tax-1-Driven Transformation In Vivo. Journal of Virology. 89, 8092-8095 (2015).
  8. Adamson, A. L., Chohan, K., Swenson, J., LaJeunesse, D. A Drosophila model for genetic analysis of influenza viral/host interactions. Genetics. 189, 495-506 (2011).
  9. Hao, L., et al. Drosophila RNAi screen identifies host genes important for influenza virus replication. Nature. 454, 890-893 (2008).
  10. Webster, C. L., et al. The Discovery, Distribution, and Evolution of Viruses Associated with Drosophila melanogaster. Plos Biology. 13, e1002210 (2015).
  11. Heigwer, F., Port, F., Boutros, M. RNA Interference (RNAi) Screening in Drosophila. Genetics. 208, 853-874 (2018).
  12. West, C., Silverman, N. p38b and JAK-STAT signaling protect against Invertebrate iridescent virus 6 infection in Drosophila. PLOS Pathogens. 14, e1007020 (2018).
  13. Liu, Y., et al. STING-Dependent Autophagy Restricts Zika Virus Infection in the Drosophila Brain. Cell Host & Microbe. 24, 57-68 (2018).
  14. Wang, X. H., et al. RNA interference directs innate immunity against viruses in adult Drosophila. Science. 312, 452-454 (2006).
  15. van Rij, R. P., et al. The RNA silencing endonuclease Argonaute 2 mediates specific antiviral immunity in Drosophila melanogaster. Genes & Development. 20, 2985-2995 (2006).
  16. Deddouche, S., et al. The DExD/H-box helicase Dicer-2 mediates the induction of antiviral activity in drosophila. Nature Immunology. 9, 1425-1432 (2008).
  17. Chotkowski, H. L., et al. West Nile virus infection of Drosophila melanogaster induces a protective RNAi response. Virology. 377, 197-206 (2008).
  18. Paradkar, P. N., Trinidad, L., Voysey, R., Duchemin, J. B., Walker, P. J. Secreted Vago restricts West Nile virus infection in Culex mosquito cells by activating the Jak-STAT pathway. Proceedings of the National Academy of Sciences of the United States of America. 109, 18915-18920 (2012).
  19. Souza-Neto, J. A., Sim, S., Dimopoulos, G. An evolutionary conserved function of the JAK-STAT pathway in anti-dengue defense. Proceedings of the National Academy of Sciences of the United States of America. 106, 17841-17846 (2009).
  20. Zambon, R. A., Nandakumar, M., Vakharia, V. N., Wu, L. P. The Toll pathway is important for an antiviral response in Drosophila. Proceedings of the National Academy of Sciences of the United States of America. 102, 7257-7262 (2005).
  21. Costa, A., Jan, E., Sarnow, P., Schneider, D. The Imd pathway is involved in antiviral immune responses in Drosophila. PLoS One. 4, e7436 (2009).
  22. Ferreira, A. G., et al. The Toll-dorsal pathway is required for resistance to viral oral infection in Drosophila. PLOS Pathogens. 10, e1004507 (2014).
  23. Moy, R. H., et al. Antiviral autophagy restrictsRift Valley fever virus infection and is conserved from flies to mammals. Immunity. 40, 51-65 (2014).
  24. Shelly, S., Lukinova, N., Bambina, S., Berman, A., Cherry, S. Autophagy is an essential component of Drosophila immunity against vesicular stomatitis virus. Immunity. 30, 588-598 (2009).
  25. Bronkhorst, A. W., et al. The DNA virus Invertebrate iridescent virus 6 is a target of the Drosophila RNAi machinery. Proceedings of the National Academy of Sciences of the United States of America. 109, E3604-E3613 (2012).
  26. Palmer, W. H., Medd, N. C., Beard, P. M., Obbard, D. J. Isolation of a natural DNA virus of Drosophila melanogaster, and characterisation of host resistance and immune responses. PLOS Pathogens. 14, e1007050 (2018).
  27. Jousset, F. X., Bergoin, M., Revet, B. Characterization of the Drosophila C virus. Journal of General Virology. 34, 269-283 (1977).
  28. Gupta, V., Stewart, C. O., Rund, S. S. C., Monteith, K., Vale, P. F. Costs and benefits of sublethal Drosophila C virus infection. J Evol Biol. 30, 1325-1335 (2017).
  29. Yang, S., et al. Bub1 Facilitates Virus Entry through Endocytosis in a Model of Drosophila Pathogenesis. Journal of Virology. (2018).
  30. Teixeira, L., Ferreira, A., Ashburner, M. The bacterial symbiont Wolbachia induces resistance to RNA viral infections in Drosophila melanogaster. Plos Biology. 6, e2 (2008).
  31. Ferguson, N. M., et al. Modeling the impact on virus transmission of Wolbachia-mediated blocking of dengue virus infection of Aedes aegypti. Science Translational Medicine. 7, 279ra237 (2015).
  32. Hedges, L. M., Brownlie, J. C., O'Neill, S. L., Johnson, K. N. Wolbachia and virus protection in insects. Science. 322, 702 (2008).
  33. Bhattacharya, T., Newton, I. L. G., Hardy, R. W. Wolbachia elevates host methyltransferase expression to block an RNA virus early during infection. PLOS Pathogens. 13, e1006427 (2017).
  34. Magwire, M. M., et al. Genome-wide association studies reveal a simple genetic basis of resistance to naturally coevolving viruses in Drosophila melanogaster. PLOS Genetics. 8, e1003057 (2012).
  35. Cao, C., Cogni, R., Barbier, V., Jiggins, F. M. Complex Coding and Regulatory Polymorphisms in a Restriction Factor Determine the Susceptibility of Drosophila to Viral Infection. Genetics. 2159-2173 (2017).
  36. Martins, N. E., et al. Host adaptation to viruses relies on few genes with different cross-resistance properties. Proceedings of the National Academy of Sciences of the United States of America. 111, 5938-5943 (2014).
  37. Moser, T. S., Sabin, L. R., Cherry, S. RNAi screening for host factors involved in Vaccinia virus infection using Drosophila cells. Journal of Visualized Experiments. (2010).
  38. Zhu, F., Ding, H., Zhu, B. Transcriptional profiling of Drosophila S2 cells in early response to Drosophila C virus. Journal of Virology. 10, 210 (2013).
  39. Ekstrom, J. O., Hultmark, D. A Novel Strategy for Live Detection of Viral Infection in Drosophila melanogaster. Scientific Reports. 6, 26250 (2016).
  40. Durdevic, Z., et al. Efficient RNA virus control in Drosophila requires the RNA methyltransferase Dnmt2. EMBO Reports. 14, 269-275 (2013).
  41. Chrostek, E., et al. Wolbachia variants induce differential protection to viruses in Drosophila melanogaster: a phenotypic and phylogenomic analysis. PLOS Genetics. 9, e1003896 (2013).
  42. Gupta, V., Vale, P. F. Nonlinear disease tolerance curves reveal distinct components of host responses to viral infection. Royal Society Open Science. 4, 170342 (2017).
  43. Chtarbanova, S., et al. Drosophila C virus systemic infection leads to intestinal obstruction. Journal of Virology. 88, 14057-14069 (2014).
  44. Merkling, S. H., van Rij, R. P. Analysis of resistance and tolerance to virus infection in Drosophila. Nature Protocols. 10, 1084-1097 (2015).
  45. Goic, B., et al. RNA-mediated interference and reverse transcription control the persistence of RNA viruses in the insect model Drosophila. Nature Immunology. 14, 396-403 (2013).
  46. Ashburner, M., Golic, K., Hawley, R. S. Drosophila: A Laboratory Handbook. Cold Spring Harbor Laboratory Press. (2011).
  47. Biochemical and Biophysical Research Communications: 1991 index issue. Cumulative indexes for volumes 174-181. Biochemical and Biophysical Research Communications. 1-179 (1991).
  48. Cotarelo, M., et al. Cytopathic effect inhibition assay for determining the in-vitro susceptibility of herpes simplex virus to antiviral agents. Journal of Antimicrobial Chemotherapy. 44, 705-708 (1999).
  49. Reed, L. J. M., H, A simple method of estimating fifty percent endpoints. The American Journal of Hygiene. 27, 493-497 (1938).
  50. Khalil, S., Jacobson, E., Chambers, M. C., Lazzaro, B. P. Systemic bacterial infection and immune defense phenotypes in Drosophila melanogaster. Journal of Visualized Experiments. e52613 (2015).
  51. Schwenke, R. A., Lazzaro, B. P. Juvenile Hormone Suppresses Resistance to Infection in Mated Female Drosophila melanogaster. Current Biology. 27, 596-601 (2017).
  52. Sabin, L. R., Hanna, S. L., Cherry, S. Innate antiviral immunity in Drosophila. Current opinion in immunology. 22, 4-9 (2010).
  53. Yin, J., Zhang, X. X., Wu, B., Xian, Q. Metagenomic insights into tetracycline effects on microbial community and antibiotic resistance of mouse gut. Ecotoxicology. 24, 2125-2132 (2015).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics