Oprichting van virale infectie en analyse van Host-Virus interactie bij Drosophila Melanogaster

* These authors contributed equally
Immunology and Infection
 

Summary

Dit protocol wordt beschreven hoe om virale infectie in vivo bij Drosophila melanogaster met behulp van de methode van de nano-injectie en de basistechnieken voor het analyseren van virus-gastheer interactie.

Cite this Article

Copy Citation | Download Citations

Yang, S., Zhao, Y., Yu, J., Fan, Z., Gong, S. t., Tang, H., Pan, L. Establishment of Viral Infection and Analysis of Host-Virus Interaction in Drosophila Melanogaster. J. Vis. Exp. (145), e58845, doi:10.3791/58845 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Verspreiding van het virus is een belangrijke oorzaak van epidemische ziekten. Inzicht in de interactie tussen het virus en de host is dus heel belangrijk om uit te breiden onze kennis van preventie en behandeling van virale infectie. De fruitvlieg Drosophila melanogaster heeft bewezen als een van de meest efficiënte en productieve modelorganismen scherm voor antivirale factoren te onderzoeken van virus-gastheer interactie, als gevolg van krachtige genetische hulpmiddelen en zeer geconserveerde aangeboren immuun Signaalroutes. De hier beschreven procedure toont een nano-injectie methode om te zetten virale infectie en induceren systemische antivirale reacties in volwassen vliegen. De nauwkeurige controle van de virale injectie dosis bij deze methode kan hoge experimentele reproduceerbaarheid. Protocollen die zijn beschreven in deze studie zijn de voorbereiding van vliegen en het virus, de injectie methode overleving tarief analyse, de meting van de lading virus en eenbeoordeling van de antivirale traject. De effecten van de invloed van virale infectie door het vliegen achtergrond werden hier vermeld. Deze infectiemethode is gemakkelijk uit te voeren en kwantitatief herhaalbare; het kan worden toegepast op het scherm voor host/virale factoren betrokken bij virus-gastheer interactie en ontleden de Overspraak tussen aangeboren immuun signalering en andere biologische trajecten in reactie op virale infectie.

Introduction

Virale infecties, met name door arboviruses, zoals het Chikungunya virus1, opkomende het Dengue-virus, het gele koorts virus2 en de Zikavirus3, zijn een enorme bedreiging voor de volksgezondheid door het veroorzaken van pandemieën 4. zo een beter begrip van virus-gastheer interactie is steeds belangrijker geworden voor epidemische controle en behandeling van virale ziekten bij de mens. Voor dit doel, worden meer passende en efficiënte modellen vastgesteld om de onderzoeken van de mechanismen die ten grondslag liggen aan de virusinfectie.

De fruitvlieg, Drosophilamelanogaster (D. melanogaster), biedt een krachtig systeem om te onderzoeken van virus-gastheer interactie5,6 en heeft bewezen een van de meest efficiënte modellen om te studeren ziekten bij de mens virale7 , 8 , 9. zeer geconserveerde antiviral signalering trajecten en onvergelijkbare genetische hulpmiddelen maken vliegt een groot model te produceren aanzienlijke resultaten met echte gevolgen voor menselijke antivirale studies. Bovendien vliegen zijn gemakkelijk en goedkoop te onderhouden in het laboratorium en zijn geschikt voor grootschalig onderzoek voor nieuwe regelgevende factoren6,10 in het virus en de host tijdens de infectie.

Vier grote zeer geconserveerde antivirale trajecten (bijv., de RNA-interferentie (RNAi) traject11, de JAK-STAT traject12, de NF-recombination pathway en de autophagy traject13) zijn goed bestudeerd in Drosophila in recente jaar6. Het RNAi-traject is een brede antivirale mechanisme dat de meeste soorten virus infectie6,14kan onderdrukken. Verstoring van dit traject door mutatie in genen zoals Dicer-2 (Dcr-2) of Argonaute 2 (AGO2) kan leiden tot verhoogde virus titer en gastheer mortaliteit15,16,17. De JAK-STAT-traject heeft zijn betrokken bij de controle van infectie door een virus uit de familie van de Dicistroviridae en de Flavivirus -familie in insecten, bijv., Drosophila-C-virus (DCV) in vliegen16 en West-Nijlvirus (WNV) en Dengue Virus in mug18,19. De Drosophila tol (homoloog aan de menselijke NF-recombination pathway) en Immune deficiency (IMD) trajecten (vergelijkbaar met de menselijke NF-recombination en TNF pathway) zijn beiden betrokken bij de verdediging van virus invasie20,21, 22. autophagy is een ander geconserveerde mechanisme die betrokken zijn bij de regulering van virale infectie, die ook in Drosophila23,24 gekenmerkt is. Dus, de identificatie van nieuwe regelgevende factoren van deze trajecten en ontleden Overspraak tussen deze antivirale signalering en andere biologische studierichtingen, zoals de stofwisseling, veroudering, neurale reactie, enzovoort, kunnen eenvoudig worden ingesteld in de Drosophila systeem.

Hoewel meest gevestigde virale besmettelijke modellen in Drosophila zijn geïnduceerd door RNA virussen, besmetting door de ongewervelde iriserende Virus 6I (IV-6) en Kallithea virussen hebben getoond voor het potentieel voor studie van DNA-virussen vliegen25, 26. Bovendien, het virus kan ook zodanig gewijzigd dat besmetting van Drosophila, zoals het influenzavirus9. Dit is de toepassing van het platform van de screening Drosophila sterk uitgebreid. In deze procedure gebruiken we DCV als voorbeeld om te beschrijven hoe een virale besmettelijke systeem in Drosophilate ontwikkelen. DCV is een positieve-zin één gestrande RNA virus van ongeveer 9300 nucleotiden, 9 eiwitten27-codering. Als een natuurlijke ziekteverwekker van D. melanogaster, wordt DCV gezien als een geschikte virus bestuderen host fysiologische, gedragsmatige en basale immuunrespons tijdens interactie en Co-evolutie van de host-virus28. Bovendien maakt zijn snelle sterftecijfer na infectie in wild type vliegen DCV bruikbaar aan het scherm voor resistente of gevoelig genen in de host-29.

Echter, er zijn verschillende aspecten van zorg bij de studie van virale infecties in Drosophila. Bijvoorbeeld, hebben symbiotische bacterie Wolbachia een mogelijkheid om een breed spectra van RNA-virus verspreiding in Drosophila en mug30,31,32. Recente gegevens blijkt een mogelijk mechanisme in welke Wolbachia blokken Sindbis (SINV) virusbesmetting via de opregulatie van methyltransferase DT2 expressie in de host-33. Bovendien is de genetische achtergrond van insecten is ook essentieel voor virale infectie. De natuurlijke polymorfisme in het gen, pastrel (pst), bepaalt bijvoorbeeld de gevoeligheid voor DCV infectie in Drosophila34,35, terwijl de loci van Ubc-E2H en CG8492 betrokken zijn bij Cricket verlamming virus (CrPV) en Flock huis (FHV) virusinfectie, respectievelijk36.

De bijzondere manieren vast te stellen van de virus-gastheer interactie in vliegen, moet worden gekozen op basis van onderzoeksdoeleinden zoals een high-throughput scherm voor host cellulaire componenten in Drosophila cel lijnen37,38, mondelinge infectie te bestuderen gut-specifieke antivirale antwoord22,39,40, naald prikken41,42 of nano-injectie door het passeren van epitheliale belemmeringen voor het stimuleren van systemische immuun reacties. Nano-injectie kan exact bepalen de virale dosis om de reactie van een gecontroleerde antivirale en een fysiologische laesie43, aldus garanderen hoge experimentele reproduceerbaarheid44. In deze studie beschrijven we een nano-injectie methode om te studeren van virus-gastheer interacties in Drosophila, het belang van het vliegen achtergrond effecten.

Protocol

Opmerking: Voordat u begint experiment, de cellijnen en vliegen voorraden gebruikt mag niet verontreinigd zijn door andere ziekteverwekkers, met name voor virussen zoals DCV, FHV, Drosophila X virus (DXV), en aviaire nefritis virus (ANV). Idealiter worden RNA sequencing of een eenvoudiger PCR-gebaseerde identificatie gebruikt voor het detecteren van de besmetting10,45. Als er besmetting optreedt, de cellijnen en vliegen voorraden dient niet meer totdat zij zijn ontsmet volledig46.

1. virus en vliegen voorbereiding

  1. Vermeerdering van het virus en collectie
    Opmerking: Drosophila S2 * cellen worden gebruikt voor DCV propagatie en titratie. De S2 *-cellijn is afgeleid van een primaire cultuur van late fase D. melanogaster embryo's. Deze cellijn geweest goed47eerder is beschreven.
    1. S2 * cellen in Schneiders Drosophila Medium bij 25 ° C zonder extra CO2, groeien als een losse, semi-aanhangend enkelgelaagde in een 10 cm cel cultuur schotel, bij een dichtheid van 1 x 107 levensvatbare cellen/mL. Gebruik volledige medium voor S2 * cellen: Schneiders Drosophila opslagmedium met 10% warmte geïnactiveerd FBS, 100 eenheden/mL penicilline en 100 μg/mL streptomycine.
      Opmerking: Gezonde cellen moeten tonen een ronde vorm en homogene grootte vertonen.
    2. Snel ontdooien de DCV voorraad van-80 ° C in een bad van 25 ° C water. S2 * cellen met DCV op MOI infecteren = 0,01 onmiddellijk door direct het toevoegen van 1 mL van de oplossing van het virus aan de cel cultuur gerechten (Groeigebied: 55 cm2) met 10 mL van volledige medium voor S2 * cellen.
    3. Incubeer de cellen bij 25 ° C gedurende 3 tot 5 dagen. Wanneer het virus klaar voor de verzameling is, de morfologie van de cel is abnormale (cel vorm ziet er vervagen) en het kweekmedium zit vol zwarte deeltjes indicatieve van cel puin.
    4. Verzamelen van de hele celcultuur in een tube van 15 mL door omhoog en omlaag pipetteren en bevriezen bij-80 ° C (voor maximaal een jaar).
      Opmerking: DCV kan worden opgeslagen voor langdurig van tijd bij-80 ° C met minimaal verlies van infectiviteit, voor maximaal één jaar.
    5. Ontdooi de celcultuur in een bad van 25 ° C water met constante schudden en vervolgens Centrifugeer bij 6.000 x g, voor 15 min bij 4 ° C. Het verzamelen van de bovendrijvende substantie in een tube steriele 15 mL en vortex. Aliquot tot 200 μL van virus oplossing per buis.
      Opmerking: Virus aliquots kunnen worden opgeslagen voor een korte periode van maximaal 3 dagen bij 4 ° C voor maximaal 1 jaar bij-80 ° C. Herhaalde bevriezen-ontdooien cycli moeten worden vermeden. Het is altijd beter om te gebruiken in een keer alle het afgepipetteerde deel.
    6. Kies 5 willekeurige virus-bevattende buizen om te bepalen van de gemiddelde virus weefselkweek infectieuze dosis (TCID50) door een cytopathogeen effect (CPE) assay (1 eenheid van TCID50= 0.7 plaque die eenheid [PFU] vormen).
      Opmerking: CPE verwijst naar structurele veranderingen in de cellen van de gastheer veroorzaakt door virale invasie. De infecteren virus veroorzaakt lysis van de gastheercel, of wanneer de cel sterft zonder lysis te wijten aan een onvermogen om te reproduceren van48.
      1. Op dag 1, verzamelen u bereid S2 * cellen door pipetteren. Het aantal cellen tellen Centrifugeer cellen voor 300 x g gedurende 4 minuten en verwijder het supernatant. Verdun de cellen met de dichtheid van 1 x 106 cellen/mL met volledige medium voor S2 * cellen zoals beschreven in stap 1.1.1.
      2. 1 x 105 S2 zaad * cellen (100 μl) per putje aan de flat-96-goed-bodemplaat (~ 30% confluentie).
      3. Seriële 10-fold verdunningen van de DCV voorraad met volledige medium voor S2 * cellen uitvoeren. Voeg 50 µL verdunningen in de put. Voeg 50 µL cultuurmedium zonder virus aan het putje goed ingedeeld als de negatieve controle.
        Opmerking: Voor elke verdunning tarief, 8 putten werden gebruikt. Zoals de typisch DCV-opbrengst ongeveer 108-109 PFU/mL is, is de verdunning dient ten minste ~ 10-5-10-10.
      4. Op dag 4, observeren CPE met een helder-veld microscoop met een 20 X of 40 X doelstelling. Een goed waarin de cellen wazig kijken classificeren en het medium is vol met fragmenten als een "positieve", en een goed waarin de morfologie van de cel is normaal als "negatieve Nou".
      5. Mark CPE-positieve of negatieve putjes met + of –, respectievelijk. Bereken het virus TCID50 door de Reed en Muench methode49.
    7. Beschikken over alle verontreinigde materialen en handschoenen in de decontaminatie pan. Als het virus niet kan van de gewenste TCID50 bereiken, concentreren 100 mL virus oplossing door centrifugatie bij 68.000 x g gedurende 1 uur bij 4 ° C.
      Opmerking: afhankelijk van het doel van het experiment, een aantal doses van 102 tot 106 TCID50 eenheden kunnen worden gebruikt voor virusinfectie. Meestal gebruiken we 3 x 106 TCID50 eenheden.
    8. Verwijder het supernatant en resuspendeer in 1 mL van Tris-HCl buffer (10 mM, pH 7,2). Aliquot 20 μL van virus oplossing per buis en winkel bij-80 ° C. Kies 5 willekeurige buizen om te bepalen van het gemiddelde virus TCID50 weer.
  2. Voorbereiding voor infectie vliegen
    Opmerking: Symbiotische bacterie Wolbachia kunnen onderdrukken vele soorten RNA-virusinfectie in insecten30,31,32,33,41. Het is dus essentieel voor het zuiveren van Wolbachia van vliegen studeerde host-virus infectie in vivo33.
    1. Bereiden van vliegen eten met tetracycline door toevoeging van 400 μL van 50 µg Mo/mL tetracycline (in 70% ethanol) tot en met 4 g van vliegen voedsel vers standaard maïsmeel (1 L voor voedsel bevat 77.7 g maïsmeel, 32.19 g gist, 10,6 g agar, 0.726 g CaCl2 31.62 g van sacharose, glucose, 2 g van kaliumsorbaat en 15 mL 5% C8H8O363.3 g). Meng grondig en plaats het voedsel bij 4 ° C's nachts te verdampen van ethanol.
      Opmerking: Een hoge dosis van ethanol kan invloed op de vlieg vruchtbaarheid, dus doen niet het weglaten van deze stap.
    2. Warm het voedsel op kamertemperatuur en zet nieuwe eclosed volwassen vliegen (20 vrouwen en 10 mannen) in het flesje. Het fokken van de vliegen bij 25 ° C, 60% vochtigheid onder een normale licht/donker cyclus.
      Opmerking: Normaal gesproken duurt 3-4 dagen voor de vliegen om voldoende eieren te leggen. Teveel eieren remmen de ontwikkeling van het larven en tetracycline efficiëntie verlagen.
    3. Nieuw eclosed volwassen vliegen verzamelen (binnen 3 ~ 5 dagen) onder een lichte stroom van CO2, en herhaal stap ~ 1.2.1-1.2.2. Minstens 3 generaties zijn meestal nodig voor het volledig uitbannen van Wolbachia.
    4. Na 3 generaties met tetracycline behandeling, verzamelen 5 vliegen onder een lichte stroom van CO2 voor de Wolbachia infectie test. Slijpen vliegen voor 1 min met 250 μL van tweemaal gedestilleerd water (ddH2van O) en een paar 0.5 mm steriele keramische kralen in een 1,5 mL-buis met behulp van een homogenizer. Voeg een andere 250 μL van 2 x A buffer (0,2 M Tris-HCl, pH 9.0; 0.2 M EDTA; 2% SDS) aan het monster en de vortex.
      Opmerking: Aangezien SDS de kraal verkeer belemmeren zal, 1 x A buffer kan niet direct gebruikt worden om te slijpen vliegen. Als de vliegen rode ogen hebben, verwijderen hoofden voor slijpen, aangezien dit een invloed op de kleur van het product van DNA hebben kan.
    5. Het bevriezen van de monsters bij-80 ° C (houden voor maximaal één jaar). Snel ontdooien de het monster van-80 ° C in een bad van 25 ° C water tot het is opgelost. Incubeer de monsters bij 70 ° C gedurende 30 minuten.
    6. Voeg 190 l 5 M KOAc, vortex en broeden op het ijs 15 min of langer.
    7. Centrifugeer steekproeven bij 13.000 x g gedurende 5 minuten bij kamertemperatuur, verzamelen het supernatant en deze overbrengen naar nieuwe buizen.
    8. Herhaal stap 1.2.7 DNA met een betere kwaliteit te verkrijgen.
    9. 750 μL van isopropanol toevoegen aan elk monster en voorzichtig het omkeren van een paar keer met de hand. Incubeer bij kamertemperatuur gedurende 5 minuten.
    10. Centrifugeer steekproeven bij 13.000 x g gedurende 5 minuten bij kamertemperatuur en verwijder het supernatant. De witte genomic DNA pellet blijft aan de onderkant van de buis.
    11. Voeg 1 mL 70% ethanol tot de pellets, centrifuge op 13.000 x g gedurende 5 minuten, en verwijder het supernatant. Het DNA drogen totdat het wordt transparant.
    12. Los van DNA in 100 μl van ddH2O, Titreer DNA concentratie door UV-Vis absorptiespectrofotometrie en vul het DNA aan 100 ng/μL.
    13. Gebruik 200 ng van DNA voor de PCR reactie (Zie de Tabel van materialenin een systeem 20 μL). PCR uitvoeren door het volgende programma: 95 ° C gedurende 15 minuten; 36 cyclus van 95 ° C voor 45 s, 50 ° C voor 45 s, en 72 ° C gedurende 1 min; en een laatste uitbreiding stap (72 ° C gedurende 1 min) in een thermische cycler.
      Opmerking: Gebaseerd op de Wolbachia 16S rRNA, gebruiken de volgende inleidingen: 5' TGAGGAAGATAATGACGG 3' (in voorwaartse richting) en 5' CCTCTATCCTCTTTCAACC 3' (omgekeerde). Voor wsp, waren de inleidingen 5' CATTGGTGTTGGTGTTGGTG 3' (in voorwaartse richting) en 5' ACCGAAATAACGAGCTCCAG 3' (omgekeerde).
    14. Het analyseren van PCR producten met 1% agarose gelelektroforese. De grootte van het PCR product van Wolbachia 16S rRNA en wsp is ongeveer 200 bp en 600 bp, respectievelijk.
    15. Achterste Wolbachia gratis vliegen op voorraad standaard maïsmeel vliegen voedsel. Verzamelen 3-5 dagen nieuw eclosed mannetje vliegt voor infectie.
      Opmerking: Tetracycline behandeling kan ook invloed hebben op intestinale microbiota samenstelling, die vervolgens invloed antivirale reacties in de host. Het is raadzaam dat alle vliegen de dezelfde tetracycline behandelingen krijgen. Houd Wolbachia-gratis vliegen groeien onder standaardvoorwaarden voor ten minste 3 generaties om te herstellen van de darmflora.
  3. Pastrel genotypering
    Opmerking: De aanwezigheid van het S of R-allel van het pst -gen in de genetische achtergrond heeft gemeld DCV infectie in Drosophila34,35te beïnvloeden. Het is noodzakelijk om te controleren de pst -genotype, vooral voor DCV infectie. Er zijn een paar SNPs in pst die virusinfectie kunnen beïnvloeden, de grote SNP is 512 C/T. Het temperatuurverloop tijdens PCR is een snelle methode om te identificeren pst genotype.
    1. Uittreksel vliegen genomic DNA zoals hierboven (stap 1.2.4 - 1.2.15) beschreven.
    2. Gebruik 100 ng van DNA als de sjabloon, de 512C primer, 5' CAGCATGGTGTCCATGAAGTC 3' (in voorwaartse richting) en 5' ACGTGATCAATGCTGAAAGT 3' (omgekeerde) te detecteren het R-allel, de 512T primer, 5' CAGCATGGTGTCCATGAAGTT 3' (in voorwaartse richting) en 5' ACGTGATCAATGCTGAAAGT 3' (omgekeerde) op te sporen de S-allel.
    3. Stel de Tm (smelttemperatuur) verlopen als volgt: 54 ° C, 54.7 ° C, 55.5 ° C, 58 ° C, 59.7 ° C, 62.2 ° C, 63.7 ° C en 64 ° C (45 s bij elke temperatuur).
      Opmerking: 30 cycli van PCR de kettingreactie worden aanbevolen (20 μL systeem).
    4. Het PCR-product van 100-bp visualiseren door 2% agarose gelelektroforese.

2. virale infectie in Drosophila

  1. Infecteren vliegen door nano-injectie en overleving testen uit te voeren.
    1. Trek de haarvaten te bereiden injectie naalden, rug-Vul de injectie nld met olie en monteren van de injector50zoals hiervoor is beschreven.
    2. Anaesthetize vliegen op het pad onder een lichte stroom van CO2. Inoculeer vliegen door intra-thoracale injectie44 van 50,6 nL van virus-oplossing (100 PFU, verdund met Tris-HCl buffer, pH 7,2). Injecteren van ten minste 3 flesjes van vliegen (20 vliegen per flacon).
      Opmerking: De injectie is tijdrovend (over het algemeen 100 vliegt per uur) en DCV replicatie is zeer snel, dus het is zeer belangrijk om te noteren van de exacte tijd op de buis eenmaal afwerking elk flesje (20 vliegen). Buffer enige injectie is ingesteld als een mock besturingselement. Mannelijke volwassen vliegen hebben meestal de voorkeur, zoals resultaten zijn stabieler en reproduceerbare dan met vrouwtjes omdat hormonale variaties tijdens de paring en voortplanting invloed op de uitlezing van vrouwtjes51 hebben kunnen.
    3. Groeien de ingespoten vliegen bij 25 ° C, 60% vochtigheid onder een normale licht/donker cyclus. Vliegen met vers voedsel dagelijks leveren en registreren het aantal dode flies.
    4. Voer ten minste 3 biologische replicatieonderzoeken en uitzetten van de curve van de overleving.
    5. Genereren voor de statistische analyse van gegevens van de overleving, Kaplan-Meier overleving curven door statistische software. Het uitvoeren van log-rank test om de P-waarden te berekenen. Geef op de tabel van de overleving, informatie voor elk onderwerp. De software vervolgens berekent percentage overleven op elk moment, en plots een Kaplan-Meier overleving plot.
      Opmerking: Voeg geen extra gist in de flacon. Vergeleken met mock besturingselementen, DCV-geïnfecteerde vliegt af en toe hebben ascites en zijn onhandig, waardoor ze kwetsbaar zijn voor de kleverige gist. Het is beter om meer tijd punten opnemen in het voorontwerp experiment om erachter te komen een tijdsbestek waartegen de massale dood voor geïnfecteerde vliegen gebeuren zal. In het algemeen, sterven de besmette vliegen zelden binnen de eerste twee dagen, zelfs voor de Dcr-2 mutant lijnen. Voor de Wolbachia gratis w1118 (Bloomington 5905) vlieg besmet met 100 PFU van DCV, is het venster van deze tijd ongeveer 3-5 dagen post infectie. Fruitvliegjes dat binnen 0,5 h post injectie uur sterven wilt niet meetellen als een fataliteit omdat ze kunnen worden gedood door naald schade niet door virale infectie.
  2. DCV laden maatregel door CPE assay
    Opmerking: Virale lading wordt ook gemeten met de titratie van de virus-voorraad (stap 1.1.6) maar vereist extra monstervoorbereiding (2.2.1-2.2.4 stap).
    1. Op dag 1, infecteren mannelijke vliegen zoals beschreven in stap 2.1.1-2.1.2. Groep ingespoten vliegen in groepen van 20 en houd ze groeien op vers vliegen voedsel voor het gewenste tijdstip (typisch voor 24 h of 3 dagen). Leveren dagelijks vliegen met vers voedsel.
    2. Op dag 2, seed Drosophila S2 * cellen in een 10 cm cel cultuur schotel tot en met de dichtheid van ongeveer 5 x106 tot en met 1 x 107 cellen/mL zoals beschreven in stap 1.1.1.
    3. Op dag 3, verzamelen 5 vliegen (onder een lichte stroom van CO2) en ze vermalen in een centrifugebuis 1,5 mL voor 30 s met 200 μL van Tris buffer en keramische kralen met behulp van homogenizer. Opslaan van de monsters bij-80 ° C of onmiddellijk overgaan tot de volgende stap.
    4. Grondig vortex het monster. Gebruik een spuit van 1 mL en 0.22 μm datumfilter voor het supernatant tot een nieuwe 1,5 mL koker. Ga verder met de titratie, zoals beschreven in stappen 1.1.6.1-1.1.6.5.
  3. DCV belasting gemeten door qRT-PCR
    1. Op dag 1, infecteren vliegen zoals hierboven beschreven. Groep ingespoten mannetje vliegt (20 vliegen/groep) en groeien op vers vliegen voedsel voor gewenste tijdstip, meestal voor 24 h of 3 dagen. Leveren dagelijks vliegen met vers voedsel.
    2. Op dag 3, verzamelen 5 vliegen onder een lichte stroom van CO2 in een 1,5 mL-buis met 200 μL van lysis-buffermengsel en 20 keramische kralen (diameter = 0,5 mm), de monsters door homogenizer met hoge snelheid voor 30 s. toevoegen 800 μL van extra lysis-buffermengsel aan elke buis te slijpen en opslaan van de s meer bij-80 ° C of onmiddellijk voeren RNA extractie en qRT-PCR.
    3. Bereiden RNase gratis tips, buizen en gedeïoniseerd, diethylpyrocarbonate (DEPC) behandeld en 0,22 µm membraan gefiltreerd water. Toevoegen van 200 μL van chloroform (≥99.5%) in de steekproef en krachtig schudden voor de 15 s met de hand. Incubeer gedurende 5 minuten of langer bij kamertemperatuur totdat de waterfase en de organische fase duidelijk gescheiden zijn.
      Opmerking: Chloroform is uiterst gevaarlijk en moet met zorg worden behandeld. Doen niet vortex het monster, waardoor het risico van besmetting van het DNA.
    4. Centrifugeer steekproeven bij 13.000 x g gedurende 15 min bij 4 ° C.
    5. 400 μL van de bovendrijvende substantie verzamelen en overbrengen van het supernatant naar nieuwe buizen. Meng met de dezelfde volumedelen isopropanol (≥ 99,5%) voorzichtig het omkeren van de monsters voor 20 keer met de hand en vervolgens neerslag gedurende 10 minuten of langer bij kamertemperatuur.
      Opmerking: Neerslag bij-20 ° C zal RNA rendement verhogen.
    6. Centrifugeer steekproeven bij 13.000 x g gedurende 10 minuten bij 4 ° C. Wit RNA pellets zijn zichtbaar aan de onderkant van de buis.
    7. Verwijder het supernatant en voeg 1 mL 70% ethanol (ethanol in DEPC water) en paar keer te wassen de RNA omkeren.
    8. Centrifugeer steekproeven bij 13.000 x g gedurende 5 min bij 4 ° C. Gooi het supernatant en droge RNA voor 5-10 min; RNA moet transparant worden.
    9. 50 μl van DEPC water aan de steekproef, het pipet toevoegen voor paar keer en vortex.
    10. Neem 3 μL van RNA voor titrating de RNA-concentratie. Kwantificeren van het RNA op 260 nm. Normaal gesproken, is de concentratie van de RNA gehaald door dit protocol ongeveer 100-500 μg/μl, geschikt voor cDNA synthese.
    11. Gebruik 2 μg RNA voor cDNA synthese. Verdunnen van het monster, tot 100 μl met ddH2O en winkel bij-20 ° C.
    12. Uitvoeren van qRT-PCR volgens de instructies van de fabrikant en voer qRT-PCR.
      Opmerking: Voor cDNA synthese van DCV, willekeurige inleidingen werkte veel beter dan Poly A primer in onze handen. DCV mRNA uitdrukking is genormaliseerd naar endogene ribosomal eiwit 49 (rp49) mRNA. Oligonucleotide inleidingen gebruikt in dit deel: rp49 5' AGATCGTGAAGAAGCGCACCAAG 3' (in voorwaartse richting) en 5' CACCAGGAACTTCTTGAATCCGG 3' (omgekeerde); DCV, 5' TCATCGGTATGCACATTGCT 3' (in voorwaartse richting) en 5' CGCATAACCATGCTCTTCTG 3' (omgekeerde); Vago, 5' TGCAACTCTGGGAGGATAGC 3' (in voorwaartse richting) en 5' AATTGCCCTGCGTCAGTTT 3' (omgekeerde); virus-geïnduceerde RNA 1 (vir-1) 5-' GATCCCAATTTTCCCATCAA 3' (in voorwaartse richting) en 5' GATTACAGCTGGGTGCACAA 3' (omgekeerde).

Representative Results

Resultaten van deze afdeling worden verkregen na DCV infectie van D. melanogaster. Figuur 1 toont het stroomschema van virale infectie in Drosophila. Vliegen tijdens thoracically worden ingespoten, en vervolgens de monsters worden genomen voor de meting van de virale TCID50 en het genoom RNA niveau (Figuur 1). Virusinfectie kan veroorzaken lysis van de cel en CPE is waargenomen bij 3 dagen post infectie (figuur 2A). De virus belasting gemeten door de CPE-bepaling is in overeenstemming met die gemeten door qPCR (figuur 2B). Zoals blijkt uit Figuur 3, remt Wolbachia DCV infectie in Drosophila. wol-16s rRNA en wsp inleidingen worden gebruikt om op te sporen Wolbachia aanwezigheid (Figuur 3 bis) en Wolbachia-gratis vliegen Toon aanzienlijk verminderde overlevingskansen na DCV infectie (figuur 3B). Figuur 4 laat zien hoe om te controleren of pst polymorfisme door kleurovergang PCR met behulp van specifieke primers. Figuur 5 toont dosis afhankelijke effecten van DCV-infectie in de wildtype vlieg. De overlevingskans in figuur 5A en het virus laden bij 3 dagen post infectie wordt weergegeven in figuur 5B. Figuur 6 toont aan dat DCV infectie de antiviral van het Dcr2/RNAi en JAK/STAT signalering trajecten in de host-52kunt activeren. Het niveau van de expressie van de genexpressie vago verslaggever van Dcr2/RNAi leertraject is verhoogde 3 dagen post infectie (figuur 6A). De JAK-STAT-traject wordt ook geactiveerd na DCV infectie, die wordt aangegeven door het niveau van de expressie van reporter gene vir-1 (figuur 6B). Figuur 7 laat zien dat de Dcr2/RNAi pathway kritische voor antivirale infectie in Drosophila52. DCR-2 mutant vliegen hebben een verminderde overlevingskans (figuur 7A) en een verhoogde virus belasting (figuur 7B) na DCV infectie.

Figure 1
Figuur 1: stroomschema van Drosophila infectie en virus belasting analyse.
Tot oprichting van Drosophila infectie door nano-injectie. De schema-grafiek toont dat vliegen tijdens thoracically besmet zijn en dat virus belasting worden gemeten door de CPE assay en qRT-PCR. Klik hier voor een grotere versie van dit cijfer.

Figure 2
Figuur 2: DCV laden analyse.
De virus belasting gemeten door de CPE-bepaling is in overeenstemming met die gemeten door qPCR. (A) S2 * cellen worden gekweekt bij 25 ° C gedurende 3 dagen met een ander virus verdunning (50 μl). 1 eenheid TCID50 van gebruikte virus is 4.29 x 109 (equivalent aan 3 x 109 PFU/mL). Eerste panel, 10-3 verdunning; tweede paneel, 10-7 verdunning; derde bord, 10-10 verdunning; weer paneel, w/o de infectie. Cellen in deelvenster één en twee tonen de typische CPE-positieve fenotype (witte pijlen geven aan dat cel puin), en cellen in deelvenster drie en vier tonen de typische negatieve fenotype. De bar van de schaal wordt aangegeven in de cijfers. (B) meting van DCV laden door qPCR. Het uitvoeren van seriële 10-fold verdunningen van DCV en infecteren de S2 *-cellijn. De totale RNA van geïnfecteerde cellen is geëxtraheerd en qPCR voor het meten van het niveau van DCV RNA wordt uitgevoerd. Verloop virale besmettelijke lading (bepaald door CPE assay) in cellen is afgestemd en positief gerelateerd aan het meten van qPCR (r2= 0.999). Klik hier voor een grotere versie van dit cijfer.

Figure 3
Figuur 3: Virale infectie van vliegen met of zonder Wolbachia.
Wolbachia infectie draagt bij tot DCV weerstand in Drosophila. (A) de Wolbachia aanwezigheid wordt gedetecteerd door wol-16s rRNA en wsp inleidingen. G1, G2 en G3 vertegenwoordigd ertsrvliegen (Oregon-R) (Bloomington 5) behandeld door tetracycline voor één, twee of drie generaties respectievelijk. De grootte van het PCR-product is ongeveer 200 bp (wol-16s rRNA) en 600 bp (wsp). (B) Wolbachia gratis vliegen zijn gevoeliger voor DCV infectie. 3-5 dagen oude mannelijke volwassen vliegen zijn ingespoten met 100 PFU van DCV. Wolbachia gratis vliegt (ononderbroken lijnen) Toon aanzienlijk verminderd overleving dan Wolbachia beschermd (dash lijnen) na DCV infectie vliegt. Twee verschillende wildtype lijnen, ertsr en w1118, worden gebruikt voor de bepaling van de overleving en Toon soortgelijk resultaat. Alle foutbalken vertegenwoordigen standaardfout (SE) van ten minste drie onafhankelijke tests; * P < 0,05, ** P < 0,01, *** P < 0.001, *** P < 0.0001, ns, niet significant. Kaplan Meier (B). Klik hier voor een grotere versie van dit cijfer.

Figure 4
Figuur 4: Pastrel Genotypering door kleurovergang PCR.
pst polymorfisme wordt gecontroleerd door kleurovergang PCR. Kleurovergang PCR wordt uitgevoerd om te onderscheiden van pst R (512 C) en S (512T)-allel in de Drosophila volwassene. TM verlopen zijn a: 54 ° C, b: 54.7 ° C, c: 55,5 ° C, d: 58 ° C, e: 59.7 ° C, f: 62.2 ° C, g: 63.7 ºC, h: 64 ° C.  Klik hier voor een grotere versie van dit cijfer.

Figure 5
Figuur 5: Overlevingskans en DCV titer van ertsr vliegen besmet met een verschillende dosis DCV.
Ertsrvliegen worden geïnjecteerd met drie verschillende doses van 10 PFU/vliegen, 50 PFU/vliegen, DCV en 100 PFU/vliegen. (A) The flies' overlevingskans is aanzienlijk lager wanneer besmet met hogere infectieuze doses. (B) het niveau van de DCV RNA in het hele lichaam van aangegeven vliegen is gemeten door qRT-PCR op de aangegeven tijd en op die van 10 PFU/fly inoculatie groep genormaliseerd. Alle foutbalken vertegenwoordigen standaardfout (SE) van ten minste drie onafhankelijke tests; * P < 0,05, ** P < 0,01, *** P < 0.001, *** P < 0.0001, ns, niet significant. Kaplan-Meier (A) of One-way anova (B). Klik hier voor een grotere versie van dit cijfer.

Figure 6
Figuur 6: Dcr2/RNAi en JAK/STAT antiviral signalering traject geactiveerd na DCV infectie.
Ertsrvliegen waren besmet met 100 PFU van DCV. Vago (A) en (B) vir-1 mRNA uitgedrukt in het hele lichaam worden gemeten door qRT-PCR op aangegeven tijd punten post infectie. De verandering van meningsuiting is genormaliseerd naar die van basale niveau voordat de infectie. Alle foutbalken vertegenwoordigen standaardfout (SE) van ten minste drie onafhankelijke tests; * P < 0,05, ** P < 0,01, *** P < 0.001, *** P < 0.0001, ns, niet significant. One-way ANOVA (A, B). Klik hier voor een grotere versie van dit cijfer.

Figure 7
Figuur 7: Mutant Dcr-2, vlieg gevoelig voor DCV infectie.
DCR-2 mutant vliegt en de genetische controle w1118 vliegen besmet waren met 100 PFU van DCV. (A) overlevingscijfers van Dcr-2 tekort vliegt en wild-type (w1118) vliegen post DCV infectie. (B) DCV RNA niveau in het hele lichaam van aangegeven vliegen is gemeten door qRT-PCR 2 dagen post infectie en op die van w1118genormaliseerd. Alle foutbalken vertegenwoordigen standaardfout (SE) van ten minste drie onafhankelijke tests; * P < 0,05, ** P < 0,01, *** P < 0.001, *** P < 0.0001, ns, niet significant. Kaplan-Meier (A) of van de student T-test (B). Klik hier voor een grotere versie van dit cijfer.

Discussion

In dit artikel presenteren we een gedetailleerde procedure op hoe een systeem te zetten virale infectieziekten bij volwassen Drosophila melanogaster gebruik nano-injectie. De protocollen zijn de voorbereiding van de passende vliegen lijnen en virus voorraad, infectie technieken, de evaluatie van besmettelijke indicatoren en het meten van de antivirale reactie. Hoewel DCV wordt gebruikt als een voorbeeld van een virale ziekteverwekker, zijn tientallen verschillende soorten virus met succes toegepast voor studie in de Drosophila systeem. Bovendien zijn honderden regelgevende factoren, van het virus of de host, geïdentificeerd door grootschalig onderzoek in vliegen. Deze methode is dus zeer flexibel en niet beperkt tot DCV /Drosophila interactie.

Om met succes voortplanten en oogsten hoge titer DCV, moeten een paar voorzorgsmaatregelen worden genomen. Cellen moeten gezond, op een geschikte dichtheid gekweekt en geoogst op tijd. Cel cultuur volume verminderen aanzienlijk beïnvloedt niet virus titer. Typisch, 107 cellen septisch tegen DCV op MOI = 0,01 zal eindelijk opbrengst geschatte 108-109 TCID50 van DCV, die kan voldoen aan de eisen van de meeste in vivo en in vitro experimenten. De CPE assay en qRT-PCR-test zijn beschreven in dit protocol voor de meting van de lading van het virus. De CPE-bepaling is enigszins lastig. De juiste dichtheid van inoculatie van de cel en een ervaren standaard van positieve/negatieve CPE discriminatie kan een snelle en succesvolle CPE-assay. Dus, wij bieden een gemakkelijke qRT-PCR-test hier om te helpen bij de beslissing van de licht-donkerscheiding verdunning punt in CPE assay voor het beheersen van de CPE-bepaling.

DCV is echter een zeer krachtig virus voor de volwassen vlieg en Drosophila cellijn. Slechts 100 PFU/fly inoculatie kan 50% van de wilde vliegen doden binnen de 5 dagen. Een dosis van overtollige infectie kan de betekenis tussen de wild type vliegen en potentiële gevoelig regels schaduw. Het is belangrijk om toe te passen ten minste twee infectie doses starten van een nieuw scherm. Aangezien de massale dood van Drosophila in een zeer korte tijd venster als gevolg van de hoge dodelijkheid van DCV gebeuren kan, wordt opnemen de dood steeds vaker in voorbereidende experimenten sterk aanbevolen. Na infectie DCV hebben sommige vliegen soms ascites syndroom. Met name vliegen die binnen 0,5 h post-infectie sterven dienen te worden uitgesloten, die kan worden veroorzaakt door ongepaste naald injectie schade.

De besmettelijke sterkte van DCV wordt ook beïnvloed door vele factoren van de host, die moeten worden onderzocht voordat een experiment. Wolbachia is een verticale endosymbiont, die heeft grote impact op virusinfectie in vliegen32overbrengen. Tetracycline behandeling in vliegen voedsel is een gemeenschappelijk gebruikte methode om te elimineren Wolbachia infectie. Deze methode wijzigt echter ook intestinale microbiota samenstelling, die op hun beurt van invloed kan zijn op de antivirale antwoord53. Een paar studies hebben benadrukte het belang van de genetische variantie op virus infectie36, zoals ubc-e2h, cg8492 en pst. Bijvoorbeeld, hebben de meeste wild type vliegen lijnen pst S allel hebben en zijn gevoelig voor picorna-achtig virus, terwijl de meeste mutant lijnen we getest vanuit Bloomington voorraad midden pst R-allel, dus resistent fenotypen. Het is zeer belangrijk om uit te sluiten de impact van pst, vooral wanneer een gen van de weerstand vergelijken met wild type besturingselement29afschermen.

Naast nano-injectie voor het opwekken van systemische virusbesmetting, zijn andere methoden beschikbaar voor de studie van virusinfectie in vliegen. Drosophila cellijnen hebben bewezen als een hoge-doorvoer methode om het scherm uit virusinfectie gerelateerde host cellulaire component37,38. Een in vitro -systeem is echter altijd vergezeld met een hoge mate van valse positieven, waarbij bevestiging van in vivo. DCV kan ook worden toegepast om te infecteren Drosophila mondeling, overwegende dat het alleen leiden een beperkte en mildere infectie tot kan. Slechts 20% van de larven binnen 12 uur besmet waren en 14% sterfte werd waargenomen, met gewoon 25% vliegt mortaliteit in 20 dagen in volwassene22. Prikken vliegen met 0,15-mm-diameter pinnen is een andere manier om virale infectie, maar het kan niet zorgen voor de nauwkeurige infectie dosis en kwantitatieve herhaalbaarheid. Overexpressing virale eiwitten door genetische manipulatie van vliegen is een goede manier om de studie van moleculaire interactomes in vivo7. Het kan echter niet de realiteit van de Fysiologie en pathologie portretteren in de ontvangst na infectie. Ondertussen, de nano-injectie-methode heeft ook nadelen, het is niet de natuurlijke route van infectie en direct een sterk systeem immuunreactie net na infectie, die de epidermis, de eerste antivirale Verdediging Belijn omzeild kan stimuleren. Kortom zijn het doel van specifiek onderzoek en de beschikbare experimentele voorwaarde de beslissende factoren bij de keuze tussen verschillende methoden.

Disclosures

De auteurs hebben niets te onthullen.

Acknowledgments

We zouden graag bedanken de hele Pan lab in IPS. CAS. Wij danken Dr. Lanfeng Wang (IPS, CAS) voor de ondersteuning van de experimentele en Dr. Gonalo Cordova Steger (Springer natuur), Dr. Jessica VARGAS (IPS, Parijs) en Dr. Seng Zhu (IPS, Parijs) voor opmerkingen. Dit werk werd gesteund door subsidies van de strategische prioriteit Research Program van de Chinese Academie van Wetenschappen aan L.P (XDA13010500) en H.T (XDB29030300), de nationale Natural Science Foundation van China tot L.P (31870887 en 31570897) en J.Y (31670909). L.P is een fellow van CAS jeugd innovatie promotie Association (2012083).

Materials

Name Company Catalog Number Comments
0.22um filter Millipore SLGP033RS
1.5 ml Microcentrifuge tubes Brand 352070
1.5 ml RNase free Microcentrifuge tubes Axygen MCT-150-C
10 cm cell culture dish Sigma CLS430167 Cell culture
100 Replacement tubes Drummond Scientific 3-000-203-G/X
15 ml tube Corning 352096
ABI 7500 qPCR system ABI 7500 qPCR
Cell Incubator Sanyo MIR-553
Centriguge Eppendof 5810R
Centriguge Eppendof 5424R
Chloroform Sigma 151858 RNA extraction
DEPC water Sigma 95284-100ML RNA extraction
Drosophila Incubator Percival I-41NL Rearing Drosophila
FBS Invitrogen 12657-029 Cell culture
flat bottom 96-well-plate Sigma CLS3922 Cell culture
Fluorescence microscope Olympus DP73
Isopropyl alcohol Sigma I9516 RNA extraction
Lysis buffer (RNA extraction) Thermo Fisher 15596026 TRIzol Reagent
Lysis buffer (liquid sample RNA extraction) Thermo Fisher 10296028 TRIzol LS Reagent
Microscope Olympus CKX41
Nanoject II Auto-Nanoliter Injector Drummond Scientific 3-000-204 Nanoject II Variable Volume (2.3 to 69 nL) Automatic Injector with Glass Capillaries (110V)
Optical Adhesive Film ABI 4360954 qPCR
Penicillin-Streptomycin, Liquid Invitrogen 15140-122 Cell culture
qPCR plate ABI A32811 qPCR
Schneider’s Insect Medium Sigma S9895 Cell culture
statistical software GraphPad Prism 7
TransScript Fly First-Strand cDNA Synthesis SuperMix TransScript AT301 RNA extraction
Vortex IKA VORTEX 3 RNA extraction

DOWNLOAD MATERIALS LIST

References

  1. Rahim, M. A., Uddin, K. N. Chikungunya: an emerging viral infection with varied clinical presentations in Bangladesh: Reports of seven cases. BMC Research Notes. 10, 410 (2017).
  2. Douam, F., Ploss, A. Yellow Fever Virus: Knowledge Gaps Impeding the Fight Against an Old Foe. Trends in Microbiology. (2018).
  3. Santiago, G. A., et al. Performance of the Trioplex real-time RT-PCR assay for detection of Zika, dengue, and chikungunya viruses. Nature Communications. 9. 9, 1391 (2018).
  4. Gould, E., Pettersson, J., Higgs, S., Charrel, R., de Lamballerie, X. Emerging arboviruses: Why today? One Health. 4, 1-13 (2017).
  5. Hughes, T. T., et al. Drosophila as a genetic model for studying pathogenic human viruses. Virology. 423, 1-5 (2012).
  6. Xu, J., Cherry, S. Viruses and antiviral immunity in Drosophila. Developmental & Comparative Immunology. 42, 67-84 (2014).
  7. Shirinian, M., et al. A Transgenic Drosophila melanogaster Model To Study Human T-Lymphotropic Virus Oncoprotein Tax-1-Driven Transformation In Vivo. Journal of Virology. 89, 8092-8095 (2015).
  8. Adamson, A. L., Chohan, K., Swenson, J., LaJeunesse, D. A Drosophila model for genetic analysis of influenza viral/host interactions. Genetics. 189, 495-506 (2011).
  9. Hao, L., et al. Drosophila RNAi screen identifies host genes important for influenza virus replication. Nature. 454, 890-893 (2008).
  10. Webster, C. L., et al. The Discovery, Distribution, and Evolution of Viruses Associated with Drosophila melanogaster. Plos Biology. 13, e1002210 (2015).
  11. Heigwer, F., Port, F., Boutros, M. RNA Interference (RNAi) Screening in Drosophila. Genetics. 208, 853-874 (2018).
  12. West, C., Silverman, N. p38b and JAK-STAT signaling protect against Invertebrate iridescent virus 6 infection in Drosophila. PLOS Pathogens. 14, e1007020 (2018).
  13. Liu, Y., et al. STING-Dependent Autophagy Restricts Zika Virus Infection in the Drosophila Brain. Cell Host & Microbe. 24, 57-68 (2018).
  14. Wang, X. H., et al. RNA interference directs innate immunity against viruses in adult Drosophila. Science. 312, 452-454 (2006).
  15. van Rij, R. P., et al. The RNA silencing endonuclease Argonaute 2 mediates specific antiviral immunity in Drosophila melanogaster. Genes & Development. 20, 2985-2995 (2006).
  16. Deddouche, S., et al. The DExD/H-box helicase Dicer-2 mediates the induction of antiviral activity in drosophila. Nature Immunology. 9, 1425-1432 (2008).
  17. Chotkowski, H. L., et al. West Nile virus infection of Drosophila melanogaster induces a protective RNAi response. Virology. 377, 197-206 (2008).
  18. Paradkar, P. N., Trinidad, L., Voysey, R., Duchemin, J. B., Walker, P. J. Secreted Vago restricts West Nile virus infection in Culex mosquito cells by activating the Jak-STAT pathway. Proceedings of the National Academy of Sciences of the United States of America. 109, 18915-18920 (2012).
  19. Souza-Neto, J. A., Sim, S., Dimopoulos, G. An evolutionary conserved function of the JAK-STAT pathway in anti-dengue defense. Proceedings of the National Academy of Sciences of the United States of America. 106, 17841-17846 (2009).
  20. Zambon, R. A., Nandakumar, M., Vakharia, V. N., Wu, L. P. The Toll pathway is important for an antiviral response in Drosophila. Proceedings of the National Academy of Sciences of the United States of America. 102, 7257-7262 (2005).
  21. Costa, A., Jan, E., Sarnow, P., Schneider, D. The Imd pathway is involved in antiviral immune responses in Drosophila. PLoS One. 4, e7436 (2009).
  22. Ferreira, A. G., et al. The Toll-dorsal pathway is required for resistance to viral oral infection in Drosophila. PLOS Pathogens. 10, e1004507 (2014).
  23. Moy, R. H., et al. Antiviral autophagy restrictsRift Valley fever virus infection and is conserved from flies to mammals. Immunity. 40, 51-65 (2014).
  24. Shelly, S., Lukinova, N., Bambina, S., Berman, A., Cherry, S. Autophagy is an essential component of Drosophila immunity against vesicular stomatitis virus. Immunity. 30, 588-598 (2009).
  25. Bronkhorst, A. W., et al. The DNA virus Invertebrate iridescent virus 6 is a target of the Drosophila RNAi machinery. Proceedings of the National Academy of Sciences of the United States of America. 109, E3604-E3613 (2012).
  26. Palmer, W. H., Medd, N. C., Beard, P. M., Obbard, D. J. Isolation of a natural DNA virus of Drosophila melanogaster, and characterisation of host resistance and immune responses. PLOS Pathogens. 14, e1007050 (2018).
  27. Jousset, F. X., Bergoin, M., Revet, B. Characterization of the Drosophila C virus. Journal of General Virology. 34, 269-283 (1977).
  28. Gupta, V., Stewart, C. O., Rund, S. S. C., Monteith, K., Vale, P. F. Costs and benefits of sublethal Drosophila C virus infection. J Evol Biol. 30, 1325-1335 (2017).
  29. Yang, S., et al. Bub1 Facilitates Virus Entry through Endocytosis in a Model of Drosophila Pathogenesis. Journal of Virology. (2018).
  30. Teixeira, L., Ferreira, A., Ashburner, M. The bacterial symbiont Wolbachia induces resistance to RNA viral infections in Drosophila melanogaster. Plos Biology. 6, e2 (2008).
  31. Ferguson, N. M., et al. Modeling the impact on virus transmission of Wolbachia-mediated blocking of dengue virus infection of Aedes aegypti. Science Translational Medicine. 7, 279ra237 (2015).
  32. Hedges, L. M., Brownlie, J. C., O'Neill, S. L., Johnson, K. N. Wolbachia and virus protection in insects. Science. 322, 702 (2008).
  33. Bhattacharya, T., Newton, I. L. G., Hardy, R. W. Wolbachia elevates host methyltransferase expression to block an RNA virus early during infection. PLOS Pathogens. 13, e1006427 (2017).
  34. Magwire, M. M., et al. Genome-wide association studies reveal a simple genetic basis of resistance to naturally coevolving viruses in Drosophila melanogaster. PLOS Genetics. 8, e1003057 (2012).
  35. Cao, C., Cogni, R., Barbier, V., Jiggins, F. M. Complex Coding and Regulatory Polymorphisms in a Restriction Factor Determine the Susceptibility of Drosophila to Viral Infection. Genetics. 2159-2173 (2017).
  36. Martins, N. E., et al. Host adaptation to viruses relies on few genes with different cross-resistance properties. Proceedings of the National Academy of Sciences of the United States of America. 111, 5938-5943 (2014).
  37. Moser, T. S., Sabin, L. R., Cherry, S. RNAi screening for host factors involved in Vaccinia virus infection using Drosophila cells. Journal of Visualized Experiments. (2010).
  38. Zhu, F., Ding, H., Zhu, B. Transcriptional profiling of Drosophila S2 cells in early response to Drosophila C virus. Journal of Virology. 10, 210 (2013).
  39. Ekstrom, J. O., Hultmark, D. A Novel Strategy for Live Detection of Viral Infection in Drosophila melanogaster. Scientific Reports. 6, 26250 (2016).
  40. Durdevic, Z., et al. Efficient RNA virus control in Drosophila requires the RNA methyltransferase Dnmt2. EMBO Reports. 14, 269-275 (2013).
  41. Chrostek, E., et al. Wolbachia variants induce differential protection to viruses in Drosophila melanogaster: a phenotypic and phylogenomic analysis. PLOS Genetics. 9, e1003896 (2013).
  42. Gupta, V., Vale, P. F. Nonlinear disease tolerance curves reveal distinct components of host responses to viral infection. Royal Society Open Science. 4, 170342 (2017).
  43. Chtarbanova, S., et al. Drosophila C virus systemic infection leads to intestinal obstruction. Journal of Virology. 88, 14057-14069 (2014).
  44. Merkling, S. H., van Rij, R. P. Analysis of resistance and tolerance to virus infection in Drosophila. Nature Protocols. 10, 1084-1097 (2015).
  45. Goic, B., et al. RNA-mediated interference and reverse transcription control the persistence of RNA viruses in the insect model Drosophila. Nature Immunology. 14, 396-403 (2013).
  46. Ashburner, M., Golic, K., Hawley, R. S. Drosophila: A Laboratory Handbook. Cold Spring Harbor Laboratory Press. (2011).
  47. Biochemical and Biophysical Research Communications: 1991 index issue. Cumulative indexes for volumes 174-181. Biochemical and Biophysical Research Communications. 1-179 (1991).
  48. Cotarelo, M., et al. Cytopathic effect inhibition assay for determining the in-vitro susceptibility of herpes simplex virus to antiviral agents. Journal of Antimicrobial Chemotherapy. 44, 705-708 (1999).
  49. Reed, L. J. M., H, A simple method of estimating fifty percent endpoints. The American Journal of Hygiene. 27, 493-497 (1938).
  50. Khalil, S., Jacobson, E., Chambers, M. C., Lazzaro, B. P. Systemic bacterial infection and immune defense phenotypes in Drosophila melanogaster. Journal of Visualized Experiments. e52613 (2015).
  51. Schwenke, R. A., Lazzaro, B. P. Juvenile Hormone Suppresses Resistance to Infection in Mated Female Drosophila melanogaster. Current Biology. 27, 596-601 (2017).
  52. Sabin, L. R., Hanna, S. L., Cherry, S. Innate antiviral immunity in Drosophila. Current opinion in immunology. 22, 4-9 (2010).
  53. Yin, J., Zhang, X. X., Wu, B., Xian, Q. Metagenomic insights into tetracycline effects on microbial community and antibiotic resistance of mouse gut. Ecotoxicology. 24, 2125-2132 (2015).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics