Viral enfeksiyon ve analiz Drosophila Melanogaster ana bilgisayar virüs etkileşimin kurulması

* These authors contributed equally
Immunology and Infection
 

Summary

Bu iletişim kuralı, viral enfeksiyon vivo içinde virüs ana bilgisayar etkileşimi analiz için nano-enjeksiyon yöntemi ve temel teknikleri kullanarak Drosophila melanogaster içinde kurmak açıklar.

Cite this Article

Copy Citation | Download Citations

Yang, S., Zhao, Y., Yu, J., Fan, Z., Gong, S. t., Tang, H., Pan, L. Establishment of Viral Infection and Analysis of Host-Virus Interaction in Drosophila Melanogaster. J. Vis. Exp. (145), e58845, doi:10.3791/58845 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Yayılan virüs salgın hastalıklar önemli bir nedenidir. Böylece, virüs ve ev sahibi arasındaki etkileşimi anlamak önleme ile ilgili bilgilerimizi ve viral enfeksiyon tedavisinde genişletmek çok önemlidir. Meyve sineği Drosophila melanogaster için antiviral etkenler ekran ve güçlü genetik araçlar ve son derece korunmuş doğuştan gelen bağışıklık nedeniyle virüs ana bilgisayar etkileşimi araştırmak için en verimli ve üretken canlılar olduğu ispatlanmıştır sinyal yollar. Burada açıklanan yordamı viral enfeksiyon kurmak ve yetişkin sinekler sistemik antiviral yanıt ikna etmek için bir nano-enjeksiyon yöntemi gösterir. Bu yöntemde viral enjeksiyon dozu hassas kontrol yüksek deneysel tekrarlanabilirlik sağlar. Bu çalışmada açıklanan iletişim kuralları sinekler ve virüs, enjeksiyon yöntemi, sağkalım oranı analizi, virüs yükü ölçüm ve bir antiviral yolu değerlendirme hazırlanması içerir. Viral enfeksiyon uçar arka plan tarafından etkisi etkileri burada bahsedildi. Bu bulaşma yönteminin gerçekleştirmek kolay ve kantitatif yinelenebilir; ana bilgisayar/viral etkenler virüs ana bilgisayar etkileşime katılan ilgili için ekran ve sinyal doğuştan gelen bağışıklık ve diğer biyolojik yollar yanıt olarak viral enfeksiyon arasında çapraz karışma incelemek için uygulanabilir.

Introduction

Viral enfeksiyonlar, özellikle Chikungunya virüsü1, gibi arboviruses tarafından ortaya çıkan dang virüs, sarı humma virüsü2 ve Zikavirüs3,-si olmak be halk sağlığı için büyük bir tehdit salgınları neden olarak 4. böylece, virüs ana bilgisayar etkileşimi daha iyi bir anlayış salgın kontrol ve insanlarda viral hastalıkların tedavisinde giderek önem kazanmıştır. Bu hedef için virüs enfeksiyonu altta yatan mekanizmaları araştırmak için daha uygun ve etkili modelleri oluşturulmuş olmalıdır.

Meyve sineği, Drosophilamelanogaster (D. melanogaster), virüs-ana etkileşim5,6 araştırmak için güçlü bir sistemi sağlar ve bir insan viral hastalıkları7 çalışmaya en verimli model olduğu ispatlanmıştır , 8 , 9. son derece korunmuş antiviral yolları ve eşsiz genetik araçları sinyal sinekler insan antiviral çalışmaları için gerçek etkileri ile önemli sonuçlar üretmek için harika bir model. Buna ek olarak, sinekler kolay ve laboratuvar olarak korumak ucuz ve roman düzenleyici faktörler6,10 virüs ve ev sahibi olarak büyük ölçekli tarama sırasında enfeksiyon için uygundur.

Dört son derece korunmuş antiviral yollar büyük (örn., RNA müdahale (RNAi) yolu11, JAK-STAT yolu12, NF-κB yolu ve autophagy yolu13) de Drosophila içinde son olarak incelendiği yıl6. Çoğu virüs enfeksiyonu6,14çeşit önleyebilirsiniz geniş bir antiviral mekanizma RNAi yoludur. Bu yolu dilici-2 (Dcr-2) veya Argonaute 2 (AGO2) gibi genlerde mutasyon tarafından bozulma artan virüs titresi ve ana bilgisayar ölüm15,16,17' ye yol açabilir. JAK-STAT yolu enfeksiyon kontrol altında Dicistroviridae aile ve böcekler, e.g Flaviviridae ailesinde bir virüs tarafından karıştığı olmuştur., Drosophila C virüsü (DCV) sinekler16 ve Batı Nil virüsü (WNV) ve dang virüs sivrisinek18,19. Drosophila Toll (insan NF-κB yolun homolog) ve bağışıklık yetersizliği (IMD) yolları (insan NF-κB ve TNF yolun benzer) virüs istilası20,21, savunan dahil her ikisi are 22. autophagy korunmuş mekanizması tür Drosophila23,24saat içinde de karakterize viral enfeksiyon ile ilgili başka bir şey. Böylece, kimliği roman düzenleyici faktörler bu yollar ve bu antiviral sinyal ve diğer arasında parçalanmış crosstalk metabolizma, yaşlanma, sinirsel tepki ve benzeri gibi biyolojik yollar kolayca ayarlanabilir Drosophila içinde sistem.

Drosophila viral enfeksiyon modellerinde en köklü RNA virüsleri, omurgasız yanardöner virüs 6I tarafından Enfeksiyon Mod tarafından indüklenir rağmen (IV-6) ve Kallithea virüs sinekler25içinde, DNA virüsleri incelenmesi için potansiyel göstermiştir 26. Ayrıca, virüs Drosophila, enfeksiyon grip virüsü9gibi izin vermek için de değiştirilebilir. Bu büyük ölçüde Drosophila tarama platform uygulama genişletti. Bu yordam, biz Drosophilabir viral enfeksiyon sistemi geliştirmek nasıl açıklamak için örnek olarak DCV kullanın. DCV bir pozitif anlamda tek telli RNA virüsü yaklaşık 9300 nükleotit, 9 proteinler27kodlama olduğunu. D. melanogasterdoğal bir patojen, DCV ana bilgisayar virüs etkileşim ve işbirliği evrim28sırasında ana bilgisayar fizyolojik, davranış ve Bazal bağışıklık yanıtı çalışmaya uygun bir virüs olarak kabul edilir. Ayrıca, vahşi türü sinekler enfeksiyonu takip onun hızlı ölüm oranı DCV ekrana dayanıklı veya duyarlı genler için konak29kullanışlıdır.

Ancak, Drosophilaviral enfeksiyonlar okurken endişe çeşitli yönleri vardır. Örneğin, simbiyotik bakteriler Wolbachia geniş spectra Drosophila ve Sivrisinek30,31,32RNA virüsü yayılması etkisizleştirmek için bir yeteneğim var. Son kanıtlar hangi Wolbachia blok Sindbis virüs (SINV) yoluyla enfeksiyon upregulation metiltransferaz Mt2 ana bilgisayar33ifadesinde, olası bir mekanizma gösterir. Ayrıca, böceklerin genetik arka plan da viral enfeksiyon için önemlidir. Örneğin, gene, pastrel (pst), doğal polimorfizmi Drosophila34,35, DCV enfeksiyona yatkınlık belirler iken loci Ubc-E2H ve CG8492 Kriket felç virüs (CrPV) ve Flock ev virüs (FHV) enfeksiyonu, sırasıyla36katılmaktadırlar.

Sinekler, virüs-ana etkileşim kurmak için belirli yolları araştırma amaçlı Drosophila hücre hatları37,38, sözlü Ana hücresel bileşenleri için bir yüksek üretilen iş ekran gibi göre seçilen gerekir gut özgü antiviral yanıt22,39,40,41,42 ya da nano-enjeksiyon sistemik bağışıklık uyarmak için epitel engelleri geçerek iğneleyici iğne çalışmaya enfeksiyon yanıt. Nano-enjeksiyon, böylece yüksek deneysel tekrarlanabilirlik44güvence altına alınması kontrollü bir antiviral tepki ve fizyolojik lezyon43, ikna etmek için viral doz tam olarak denetleyebilirsiniz. Bu çalışmada, Drosophilauçar arka plan efektleri önemini vurgulayarak, etkileşimlerde virüs ana bilgisayar çalışmaya bir nano-enjeksiyon yöntemi açıklanmaktadır.

Protocol

Not: deney başlamadan önce hücre satırları ve sinek stokları kullanılan DCV, FHV, Drosophila gibi virüs virüs (DXV) ve kuş nefrit virüs (ANV) X için özellikle diğer patojenler tarafından kirlenmiş gerekir değil. İdeal olarak, RNA sıralama veya daha basit bir PCR tabanlı kimlik kirlenme10,45algılamak için kullanılır. Kirlenme oluştuysa, hücre satırları ve sinek stokları kullanılmaması gereken daha fazla onlar kadar tamamen46dekontamine.

1. virüs ve sinek hazırlık

  1. Virüs yayılması ve koleksiyon
    Not: Drosophila S2 * hücreler DCV yayılması ve titrasyon için kullanılır. S2 * hücre kültürünü geç sahne D. melanogaster embriyo bir birincil kültüründen elde edilir. Bu hücre kültürünü iyi oldu daha önce açıklanan47.
    1. 1 x 107 canlı hücre/mL yoğunluğu, bir 10 cm hücre kültür tabak içinde gevşek, yarı yapisan monolayer olarak S2 * Schneider'ın Drosophila orta ek CO2, olmadan 25 ° C'de hücrelerinde büyür. Kullanım tam orta S2 * hücreler için: Schneider'ın Drosophila % 10 ısı içeren orta inaktive FBS, 100 adet/mL penisilin ve 100 μg/mL streptomisin.
      Not: Sağlıklı hücreler yuvarlak bir şekil göstermek ve homojen boyutu sergilemek gerekir.
    2. Hızlı bir şekilde-80 ° C 25 ° C su banyosunda DCV stoktan çözülme. S2 * DCV MOI, hücrelerle bulaştırmak virüs çözümü 1 mL doğrudan hücre kültür yemekleri ekleyerek hemen 0,01 = (büyüme alanı: 55 cm2) S2 * hücreler için tam orta 10 mL ile.
    3. 25 ° C'de hücreler için 3-5 gün kuluçkaya. Virüs koleksiyonu için hazır olduğunda, hücre morfolojisi anormal (hücre şekil görünüyor bulanıklık) ve kültür orta siyah parçacıkların hücre artıkları gösterge dolu.
    4. Yukarı ve aşağı pipetting tarafından bir 15 mL tüp tüm hücre kültüründe toplamak ve-80 ° C'de dondurmak (için bir yıl kadar).
      Not: DCV uzun bir süre için-80 ° C'de infektivite, en az kayıp ile bir yıl süreyle saklanır.
    5. Sürekli titriyor ile 25 ° C su banyosu hücre kültüründe çözülme ve 4 ° C'de 15 dakika 6.000 x g, santrifüj kapasitesi Steril 15 mL tüp ve girdap süpernatant toplamak. Aliquot virüs çözüm tüp başına 200 μL kadar.
      Not: Virüs aliquots 4 ° C'de 3 gün kısa bir süre için ve ilâ 1 yıl-80 ° C'de saklanabilir Tekrarlanan donma-çözülme çevrimleri kaçınılmalıdır. Her zaman aynı anda tüm aliquot kullanmak daha iyidir.
    6. Ortalama virüs doku kültürü infektif doz (TCID50) tarafından cytopathic etkisi (CPE) tahlil belirlemek için 5 rasgele virüs içeren tüpler almak (TCID501 adet 0,7 = birim [PFU] şekillendirme plak).
      Not: CPE viral istilası nedeniyle konak hücreleri yapısal değişiklikler gösterir. Bulaşmasını virüs lizis konak hücre veya hücre lizis48çoğaltmak bir yetersizlik nedeniyle olmadan öldüğünde neden olur.
      1. 1 gün pipetting tarafından hazırlanan S2 * hücreleri toplamak. Hücre sayısı. Hücreler için 300 x g 4 dk santrifüj kapasitesi ve süpernatant atın. 1 x 106 hücre/mL 1.1.1. adımda açıklandığı gibi S2 * hücreler için tam orta ile yoğunluğu hücrelere sulandırmak.
      2. 1 x 105 S2 tohum * hücreleri düz-alt 96-iyi-plaka (~ %30 confluency) iyi (100 μL).
      3. Tam orta ile DCV stokunun seri 10 kat dilutions S2 * hücreler için gerçekleştirin. 50 µL dilutions kuyunun içine ekleyin. Virüs olmadan kültür ortamının 50 µL negatif kontrol de gizli kuyu ekleyin.
        Not: her seyreltme oranı için 8 wells kullanılmıştır. Tipik DCV verim yaklaşık 108-109 PFU/mL olarak, seyreltme en az ~ 10-5-10-10kapsamalıdır.
      4. Gün 4, CPE X 20 veya 40 X hedef alan parlak mikroskop ile gözlemlemek. Hücreleri bulanık görünüyor ve Orta parçaları bir "olumlu", ve bir de hücre morfolojisi "olumsuz yanı sıra" normaldir dolu bir kuyunun sınıflandırmak.
      5. Mark CPE pozitif veya negatif wells ile + veya-, anılan sıraya göre. Virüs TCID50 Reed ve Muench yöntemi49tarafından hesaplayın.
    7. Tüm kirli malzeme ve eldiven dekontaminasyon tavada atmayın. Virüs istenen TCID50erişemiyorlarsa, 68.000 x g 4 ° C'de 1 h için de centrifuging tarafından virüs çözümü 100 mL konsantre
      Not: bağlı deneme, 10 doz aralığı amacı olarak2 ' ye 106 TCID50 birim-ebilmek var olmak kullanılmış için virüs enfeksiyonu. Tipik olarak, biz 3 x 106 TCID50 birimleri kullanın.
    8. Süpernatant atın ve 1 mL Tris-HCl tampon (10 mM, pH 7.2) yeniden askıya alma. Virüs çözüm tüp ve-80 ° C'de mağaza başına aliquot 20 μL 5 rastgele tüpler ortalama virüs TCID50 yeniden belirlemek için Seç.
  2. Enfeksiyon için hazırlık sinek
    Not: Simbiyotik bakteriler Wolbachia pek çok böcek30,31,32,33,41RNA virüsü enfeksiyonu gizle. Böylece, ana bilgisayar virüs enfeksiyonu vivo içinde33eğitim önce sinekler Wolbachia temizlemek için esastır.
    1. 50 µg/mL tetrasiklin (içinde % 70 etanol) 400 μL ekleyerek tetrasiklin içeren sinek yemek hazırlamak için 4 g taze standart Mısır unu sinek gıda (gıda 1 L Mısır unu, Maya, agar, 0.726 g CaCl2 10.6 g 32.19 g 77,7 g içerir sukroz, glikoz, 2 g Potasyum Sorbat ve 15 mL % 5 C8H8O363.3 g 31.62 g). İyice karıştırın ve 4 ° etanol buharlaşır için C bir gecede yemek yer.
      Not: Bu adımı atlarsanız değil bu yüzden sinek doğurganlık, etanol yüksek bir doz etkileyebilir.
    2. Oda sıcaklığında yemeğe sıcak ve yeni eclosed yetişkin sinekler (20 kadın ve 10 erkek) şişede koymak. 25 ° c, % 60 nem normal bir ışık/karanlık döngü altında sinekler doğurmak.
      Not: Genellikle, o yeterli yumurtlamak sinekler için 3-4 gün sürer. Çok fazla yumurta larva geliştirme inhibe ve tetrasiklin verimliliği azaltır.
    3. Yeni eclosed yetişkin sinekler toplamak (içinde 3 ~ 5 gün) CO2ve adımı yineleyin hafif bir akış altında ~ 1.2.1-1.2.2. Tipik olarak, en az 3 kuşaktır tamamen ortadan kaldırılması Wolbachiaiçin gereklidir.
    4. Tetrasiklin tedavi ile 3 kuşaktır sonra 5 sinekler CO2 Wolbachia enfeksiyon test için hafif bir akış altında toplamak. Sinekler 250 μL çift distile su (GKD2O) ve birkaç 0,5 mm steril seramik boncuklar bir homogenizer kullanarak bir 1,5 mL tüp ile 1 dk. için eziyet. 2 x 250 μL bir arabelleğe A Ekle (0,2 M Tris-HCl, pH 9.0; 0.2 M EDTA; % 2 SDS) örnek ve girdap.
      Not: Bu yana SDS boncuk hareket engel, 1 x arabellek A doğrudan sinekler öğütmek için kullanılamaz. Sinekler kırmızı gözleri var, bu DNA ürün rengini etkileyebilir gibi kafaları zımpara önce kaldırın.
    5. -80 ° c (en fazla bir yıl için keep) örnekleri dondur. Hızlı bir şekilde çözülme-80 ° c eriyene kadar bir 25 ° C su banyosunda örnek. Örnekleri için 30 dk 70 ° C'de kuluçkaya.
    6. 5 190 μL eklemek M KOAc, girdap ve buz üzerinde 15 dakika veya daha uzun kuluçkaya.
    7. 13.000 x g oda sıcaklığında 5 min için de örnekler santrifüj kapasitesi, süpernatant toplamak ve yeni tüpler aktarmak.
    8. 1.2.7 DNA ile daha iyi kalite elde etmek için adımları yineleyin.
    9. Her örnek için isopropanol 750 μL ekleyin ve bir kaç kez el ile yavaşça tersine çevirin. 5 min için oda sıcaklığında kuluçkaya.
    10. 13.000 x g oda sıcaklığında 5 min için de örnekler santrifüj kapasitesi ve süpernatant atın. Beyaz genomik DNA Pelet tüp alt kısmında kalacak.
    11. 1 mL % 70 etanol granül, 5 min için 13.000 x g, santrifüj ekleyin ve süpernatant atın. Saydam hale gelene kadar DNA kuruması.
    12. DNA GKD2O 100 μL içinde dağıtılması, UV-VIS emme spectrophotometry tarafından DNA toplama titre ve DNA 100 ng/μL'yı oranında seyreltin.
    13. Kullanım 200 ng DNA PCR reaksiyon (20 μL sisteminde Malzemeler tablogörmek). PCR tarafından aşağıdaki program yerine: 95 ° C 15 dakika; 36 çevriminde 45 95 ° c s, 50 ° C 45 s ve 72 ° C için 1 dk; ve termal cycler bir son uzantısı adım (1 dk 72 ° C).
      Not: Wolbachia 16S rRNA üzerinde bağlı olarak, aşağıdaki astar kullanın: 5' TGAGGAAGATAATGACGG 3' (İleri) ve 5' CCTCTATCCTCTTTCAACC 3' (ters). WSP için astar 5' CATTGGTGTTGGTGTTGGTG vardı 3' (İleri) ve 5' ACCGAAATAACGAGCTCCAG 3' (ters).
    14. PCR ürünlerinin % 1'özel Jel Elektroforez ile analiz. 200 civarında Wolbachia 16S rRNA ve wsp PCR ürünü boyutudur bp ve 600 bp, anılan sıraya göre.
    15. Arka Wolbachia özgür sinek stok standart Mısır unu sinek gıda. 3-5 gün yeni eclosed erkek uçar enfeksiyon için toplamak.
      Not: Tetrasiklin tedavi daha sonra ev sahibi antiviral yanıt etkiler bağırsak microbiota kompozisyon da etkileyebilir. Tüm sinekler aynı tetrasiklin tedavi alması gereken tavsiye ediyoruz. Wolbachia-Alerjik sinekler gut microbiota geri yüklemek en az 3 nesiller için standart koşullar altında büyüyen tutun.
  3. Pastrel Genotipleme
    Not: S veya R alleli genetik arka planda pst genin varlığı Drosophila34,35enfeksiyonunda DCV etkiler bildirilmiştir. Özellikle DCV enfeksiyon için pst genotip kontrol etmek gereklidir. Virüs enfeksiyonu etkileyen pst içinde birkaç SNPs vardır, Binbaşı SNP 512 C/T. Sıcaklık gradyanı PCR pst genotip tanımlamak için hızlı bir yöntemdir.
    1. Özü genomik DNA (yukarıdaki adım 1.2.4 - 1.2.15) açıklandığı gibi uç.
    2. Kullanım 100 ng Şablon 5' CAGCATGGTGTCCATGAAGTC 512C astar olarak DNA'ın 3' (İleri) ve 5 R alleli, 5' CAGCATGGTGTCCATGAAGTT 512T astar algılamak için ' ACGTGATCAATGCTGAAAGT 3' (ters) algılamak için 3' (İleri) ve 5' ACGTGATCAATGCTGAAAGT 3' (ters) S alleli.
    3. (Erime sıcaklığı) Tm degradeleri aşağıdaki gibi ayarlayın: 54 ° C, 54,7 ° C, 55,5 ° C, 58 ° C, 59,7 ° C, 62.2 ° C, 63,7 ° C ve 64 ° C (45 s her sıcaklıkta).
      Not: 30 döngüleri PCR zincirleme reaksiyon (20 μL sistemi) tavsiye edilir.
    4. 100-bp PCR ürünü % 2 özel Jel Elektroforez tarafından görselleştirin.

2. Drosophila viral enfeksiyon

  1. Nano-enjeksiyon Sineklerin bulaştırmak ve hayatta kalma deneyleri gerçekleştirmek.
    1. Enjeksiyon iğneler hazırlamak için kılcal çek, geri-dolgu enjeksiyonu yağı ile iğne ve enjektör monte daha önce50açıklandığı gibi.
    2. Sinekler panelindeki CO2hafif bir akış altında uyuşturan. İntra torasik enjeksiyon44 50,6 Sineklerin aşılamak nL virüs çözüm (100 PFU, Tris-HCl tampon, pH 7.2 ile seyreltilmiş). En az 3 şişeleri uçar (şişe başına 20 sinekler) enjekte.
      Not: Enjeksiyon zaman alıcı (genellikle 100 sinekler) saat ve DCV çoğaltma çok hızlı, bu yüzden tam olarak ne zaman bir kez her şişe (20 sinekler) kaplama tüp yazmak çok önemlidir. Arabellek tek enjeksiyon sahte bir denetim olarak ayarlanır. Genellikle, daha istikrarlı ve hormonal değişimleri çiftleşme ve üreme sırasında kadın51okuma etkileyebilir beri kadın kullanarak zaman daha tekrarlanabilir sonuçlar olduğu gibi erkek yetişkin sinekler tercih edilen, vardır.
    3. Büyümek enjekte sinekler 25 ° c, % 60 nem normal bir ışık/karanlık döngü altında. Her gün taze gıda sinekli tedarik ve ölü flies kaydedin.
    4. En az 3 Biyolojik çoğaltır gerçekleştirmek ve sağkalım eğrisi çizmek.
    5. Hayatta kalma verilerin istatistiksel analizi için istatistiksel yazılım tarafından Kaplan-Meier hayatta kalma eğriler oluşturmak. P değerleri hesaplamak için günlük-rank testi gerçekleştirin. Hayatta kalma masada her ders için bilgileri girin. Belgili tanımlık bilgisayar yazılımı her zaman yüzde hayatta kalma hesaplar ve bir Kaplan-Meier hayatta kalma arsa Arsalar.
      Not: ek Maya şişeyi eklemeyin. Sahte denetimleri ile karşılaştırıldığında, DCV-enfekte sinekler bazen asit var ve hantal, hangi onları yapışkan Maya için savunmasız. Ön denemede en büyük ölüm enfekte sinekler için olacak bir zaman dilimi için daha fazla zaman Puan kaydetmek iyidir. Genel olarak, enfekte sinekler nadiren Dcr-2 mutant satırları için bile ilk iki gün ölür. Ücretsiz w1118 (Bloomington 5905) sinek enfekte Wolbachia için 100 PFU DCV ile bu zaman penceresini yaklaşık 3-5 gün enfeksiyon yazı olduğunu. İğne yaralanma öldürdükleri için 0,5 h mesaj enjeksiyon saat içinde ölmek meyve sinekleri bir kısmet değil viral enfeksiyon tarafından sayılması değil.
  2. DCV yük ölçü CPE tahlil tarafından
    Not: Viral yük virüs hisse senedi (Adım 1.1.6) titrasyon için benzer şekilde ölçülür ancak ek numune hazırlama (Adım 2.2.1-2.2.4) gerektirir.
    1. Gün 1, adım 2.1.1-2.1.2 içinde açıklandığı gibi erkek sinek bulaştırmak. Gruplar halinde 20 enjekte sinekler grup ve onları tutmak (genellikle 24 saat veya 3 gün için) istenen süre taze uçmak gıda üzerinde büyüyor. Sinekler her gün taze gıda ile sağlar.
    2. Gün 2, Drosophila S2 * 10 cm hücre kültür yemek için yaklaşık 5 yoğunluğu hücrelerde tohum x106 -1 x 107 hücre/mL 1.1.1. adımda açıklandığı gibi.
    3. 3 günde 5 sinekler (altında bir ışık akışı CO2) toplamak ve 1,5 mL santrifüj tüpü 30 için yapılan eziyet 200 μL Tris arabellek ve seramik boncuklar homogenizer kullanarak bir iyimsersin. -80 ° C'de örnekleri depolamak veya hemen sonraki adıma geçin.
    4. İyice girdap örnek. 1 mL şırınga ve 0,22 mikron süzgeci, süzgeç süpernatant yeni 1,5 mL tüp için kullanın. Titrasyon ile adımları 1.1.6.1-1.1.6.5 içinde açıklandığı gibi devam edin.
  3. DCV yük qRT-PCR tarafından ölçülen
    1. Gün 1, yukarıda açıklandığı gibi sinekler bulaştırmak. Grup enjekte erkek (20 sinek/grup) uçar ve taze uçmak gıda büyümek için istediğiniz zaman, genellikle 24 saat veya 3 gün için. Sinekler her gün taze gıda ile sağlar.
    2. 3 günde 5 sinekler CO2 1.5 mL tüp içinde bir ışık akışı 200 μL lizis arabellek ve 20 seramik boncuklar ile altında toplamak (çapı 0,5 mm =), örnekleri için her tüpün 30 s. 800 eklemek μL ek lizis arabelleği için yüksek hız ile homogenizer tarafından eziyet ve s depolamak amples-80 ° C'de veya hemen RNA çıkarma ve qRT-PCR kuralları.
    3. RNase ücretsiz ipuçları, tüpler hazırlamak ve deiyonize, tedavi diethylpyrocarbonate (DEPC) ve 0,22 µm membran filtre su. Kloroform (≥99.5%) 200 μL Ekle örnek içine ve şiddetle 15 için sallamak elle s. Su faz ve organik faz açıkça ayrılmış kadar 5 dakika veya daha uzun oda sıcaklığında kuluçkaya.
      Not: Kloroform son derece tehlikeli ve bakımı ile ele alınması gerekir. DEĞİL girdap DNA bulaşma riskini artıracak örnek yapmak.
    4. Santrifüj örnekleri 4 ° C'de 15 dakika 13.000 x g de
    5. 400 μL süpernatant, toplamak ve süpernatant yeni tüpler için transfer. Aynı birim isopropanol (≥ % 99.5) ile karıştırmak, yavaşça örnekleri el ile 20 kez tersine çevirin ve oda sıcaklığında 10 dakika veya daha uzun çökelti.
      Not:-20 ° C'de yağış RNA verim artacak.
    6. Santrifüj örnekleri 13.000 x g 4 ° C'de 10 dk de Beyaz RNA granül tüp alt kısmında görünür.
    7. Süpernatant atmak ve 1 mL % 70 etanol (etanol DEPC su) ekleyin ve RNA yıkamak için birkaç kez tersine çevirin.
    8. Santrifüj örnekleri 4 ° C'de 5 min için 13.000 x g de 5-10dk süpernatant ve kuru RNA atmak; RNA şeffaf hale gelmelidir.
    9. DEPC su 50 μL örnek, pipet birkaç kez ve girdap için ekleyin.
    10. RNA'ın 3 μL RNA konsantrasyon titrating için al. 260 RNA ölçmek nm. Normalde, bu iletişim kuralı tarafından çıkarılan RNA konsantrasyon cDNA sentezi için uygun olan yaklaşık 100-500 μg/μL, dür.
    11. RNA'ın 2 μg cDNA sentezi için kullanın. GKD2O ve mağaza-20 ° C'de 100 μL örnek sulandırmak
    12. QRT-PCR üretici yönergelerine göre gerçekleştirmek ve qRT-PCR çalıştırın.
      Not: DCV cDNA sentezi için rasgele astar bizim ellerimizde Poli A astar daha iyi çalıştı. DCV mRNA ifade endojen ribozomal protein 49 (rp49) mRNA normalleştirilmiş. Bu bölümünde kullanılan Oligonükleotid astar: rp49 5' AGATCGTGAAGAAGCGCACCAAG 3' (İleri) ve 5' CACCAGGAACTTCTTGAATCCGG 3' (ters); DCV, 5' TCATCGGTATGCACATTGCT 3' (İleri) ve 5' CGCATAACCATGCTCTTCTG 3' (ters); Vago, 5' TGCAACTCTGGGAGGATAGC 3' (İleri) ve 5' AATTGCCCTGCGTCAGTTT 3' (ters); virüs RNA 1 (vir-1) 5' GATCCCAATTTTCCCATCAA 3' (İleri) kaynaklı ve 5' GATTACAGCTGGGTGCACAA 3' (ters).

Representative Results

Bu bölümde sonuçlarını D. melanogasterDCV enfeksiyon sonra elde edilir. Şekil 1 , Drosophilaiçinde viral enfeksiyon akış şeması görülmektedir. Sinekler intra thoracically enjekte edilmiş ve o zaman örnekleri viral TCID50 ve genom RNA düzeyinin (Resim 1) ölçüm için toplanır. Virüs enfeksiyonu hücre lizis tetikleyebilir ve CPE 3 gün sonrası enfeksiyon (şekil 2A) görülmektedir. CPE tahlil tarafından ölçülen virüs yükü bu paralel olarak qPCR (şekil 2B) tarafından ölçülür. Şekil 3' te gösterildiği gibi Wolbachia DrosophilaDCV enfeksiyonu engeller. WOL-16s rRNA ve wsp astar Wolbachia varlığı (şekil 3A) ve Wolbachiaalgılamak için kullanılır-Ücretsiz sinekler göstermek önemli ölçüde azalmıştır sağkalım oranı DCV enfeksiyon (şekil 3B) sonra. Şekil 4 pst polimorfizm degrade PCR tarafından doğrulamak belirli primerler kullanılarak gösterilmiştir. Şekil 5 doz wildtype sinek DCV enfeksiyon bağımlı etkilerini gösterir. Yük şekil 5A sağkalım oranı ve virüs 3 gün sonrası enfeksiyon şekil 5Biçinde gösterilir. Şekil 6 DCV enfeksiyon konak52yollar sinyal Dcr2/RNAi ve JAK/STAT antiviral etkinleştirebilirsiniz gösterir. Yükseltilmiş 3 gün sonrası enfeksiyon (şekil 6A) muhabir gen vago ifade Dcr2/RNAi yolun ifade seviyesidir. JAK-STAT yolu da muhabir gen vir-1 (şekil 6B) ifade düzeyi tarafından belirtilen DCV enfeksiyon üzerine devreye girer. Şekil 7 Dcr2/RNAi yolu Drosophila52antiviral enfeksiyon için kritik olduğunu gösterir. DCR-2 mutant sinekler düşük sağkalım (şekil 7A) ve bir artan virüs yükü (şekil 7B) DCV enfeksiyon sonra var.

Figure 1
Resim 1: akış şeması Drosophila enfeksiyon ve virüs yükü analizi.
Drosophila enfeksiyon nano-enjeksiyon tarafından kurulması. Şema grafiği sinekler intra thoracically bulaşmış ve bu virüs yükü ölçülen CPE tahlil ve qRT-PCR tarafından gösterilmiştir. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 2
Resim 2: DCV yük analizi.
CPE tahlil tarafından ölçülen virüs yükü bu doğrultusunda qPCR tarafından ölçülür. (A)S2 * hücreleri farklı virüs seyreltme (50 μL) ile 3 gündür 25 ° C'de kültürlü. 1 birim TCID50 kullanılan virüs olduğunu 4,29 x 109 (3 x 109 ' a PFU/mL eşdeğer). İlk paneli, 10-3 seyreltme; İkinci Pano, 10-7 seyreltme; Üçüncü Pano, 10-10 seyreltme; ileri w/o enfeksiyon paneli. Hücreleri panelinde bir ve iki tipik CPE olumlu fenotip gösterir (beyaz okları hücre artıkları gösterir), ve panelindeki üç ve dört hücreleri tipik negatif fenotip gösterir. Ölçek çubuğu rakamlar gösterilir. (B) ölçüm DCV yük tarafından qPCR. DCV seri 10 kat dilutions gerçekleştirmek ve S2 * hücre kültürünü bulaştırmak. Enfekte hücreleri toplam RNA çıkarılan ve qPCR DCV RNA düzeyini ölçmek için gerçekleştirilir. Hücrelere degrade viral enfeksiyon yük (CPE tahlil tarafından belirlenir) eşleşen ve olumlu qPCR tarafından ölçümle ilgili (r20.999 =). Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 3
Şekil 3: Viral enfeksiyon uçar ile veya olmadan Wolbachia.
Wolbachia enfeksiyon Drosophiladirenişinde DCV katkıda bulunur. (A) varlığı wol-16s rRNA ve wsp astar tarafından tespit Wolbachia. G1, G2 ve G3 temsil cevherirsinekler (Oregon-R) (Bloomington 5) tetrasiklin tarafından bir, iki ve üç nesiller sırasıyla tedavi. PCR ürünü boyutu yaklaşık 200 IS bp (wol-16s rRNA) ve 600 bp (wsp). (B) Wolbachia ücretsiz sinekler DCV enfeksiyona daha duyarlı. 3-5 gün eski erkek yetişkin sinekler DCV 100 PFU ile enjekte edilir. Korumalı Wolbachia (çizgi hat) DCV enfeksiyon sinekler daha Wolbachia ücretsiz (düz çizgi) gösteri azaltılacağını hayatta kalma uçar. İki farklı wildtype satır, cevherir ve w1118, hayatta kalma tahlil için kullanılır ve benzer sonucu göster. Tüm hata çubukları standart hatası (SE) en az üç bağımsız test gösterir; * P < 0,05, ** P < 0,01, *** P < 0,001, *** P < 0.0001, ns, önemli değil. Kaplan-Meier (B). Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 4
Resim 4: Pastrel Genotipleme degrade PCR tarafından.
PST çok biçimlilik degrade PCR tarafından doğrulanır. Degrade PCR pst R (512 C) ve S (512T) alleli Drosophila yetişkin ayırt etmek için gerçekleştirilir. TM degradeler vardır a: 54 ° C, b: 54,7 ° C, c: 55,5 ° C, 58 ° C d:, e: 59,7 ° C, f: 62.2 ° C, g: 63,7 ° C, h: 64 ° C.  Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 5
Şekil 5: Hayatta kalma oranı ve DCV titresi DCV farklı bir doz ile enfekte cevherir uçar.
Cevherirsinekler ile DCV, 10 PFU/sinek, 50 PFU/sinek ve 100 PFU/sinek üç farklı dozlarda enjekte edilir. (A)sinekler hayatta kalma oranı ile daha yüksek bulaşıcı doz bulaştığında önemli ölçüde daha düşük. (B) bütün DCV RNA kademede vücut belirtilen Sineklerin Tanrısı qRT-PCR tarafından belirtilen zamanda ölçülür ve bu 10 PFU/sinek aşılama grup için normalleştirilmiş. Tüm hata çubukları standart hatası (SE) en az üç bağımsız test gösterir; * P < 0,05, ** P < 0,01, *** P < 0,001, *** P < 0.0001, ns, önemli değil. Kaplan-Meier (A) veya tek yönlü anova (B). Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 6
Şekil 6: Dcr2/RNAi ve JAK/STAT antiviral DCV enfeksiyon sonra harekete geçirmek yolu sinyal.
Cevherirsinekler DCV 100 PFU ile bulaşmış. Vago(a)ve tüm vücut ifade vir-1 (B) mRNA qRT-PCR, belirtilen süre puan sonrası enfeksiyon tarafından ölçülür. İfade değişiklik enfeksiyon önce Bazal seviyesi için normalleştirilmiş. Tüm hata çubukları standart hatası (SE) en az üç bağımsız test gösterir; * P < 0,05, ** P < 0,01, *** P < 0,001, *** P < 0.0001, ns, önemli değil. Tek yönlü ANOVA (A, B). Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 7
Şekil 7: Dcr-2 mutasyona uğramış sinek DCV enfeksiyona duyarlı.
DCR-2 mutant uçar ve onun genetik kontrol w1118 sinekler DCV 100 PFU ile enfekte. (A)sağkalım oranları Dcr-2 eksik sinekler ve vahşi-tipi (w1118) sinekler DCV enfeksiyon sonrası. Belirtilen sinekler tüm vücut (B) DCV RNA kademede qRT-PCR 2 gün sonrası enfeksiyon tarafından ölçülen ve bu w1118için normalleştirilmiş. Tüm hata çubukları standart hatası (SE) en az üç bağımsız test gösterir; * P < 0,05, ** P < 0,01, *** P < 0,001, *** P < 0.0001, ns, önemli değil. Kaplan-Meier (A) veya öğrenci T-testi (B). Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Discussion

Bu makalede, biz ayrıntılı bir yordam içinde yetişkin Drosophila melanogaster viral bir enfeksiyon sistemi kurmak nasıl nano-enjeksiyon kullanarak mevcut. İletişim kuralları uygun sinek çizgiler ve virüs hisse senedi, enfeksiyon teknikleri, bulaşıcı göstergelerin değerlendirilmesi ve antiviral yanıt ölçümü hazırlanması içerir. DCV viral bir patojen bir örnek olarak kullanılmasına rağmen onlarca çeşit virüs başarıyla çalışması için Drosophila sistemi uygulandı. Ayrıca, düzenleyici faktörler, virüs veya ev sahibi, yüzlerce sinekler büyük ölçekli tarama yoluyla tespit edilmiştir. Bu nedenle, bu yöntem son derece uyarlanabilir ve does değil limit DCV için /Drosophila etkileşim.

Başarılı bir şekilde yaymak ve yüksek titresi DCV hasat için birkaç önlem alınmalıdır. Hücreler uygun bir yoğunluk kültürlü ve zamanında hasat sağlıklı, olmalıdır. Hücre kültür ses düzeyini azaltmayı virüs titresi önemli ölçüde etkilemez. Tipik olarak, 107 hücre bulaştırmak yanında DCV MOI, 0,01 = sonunda verim 108-109 TCID50 çoğu in vivo ve in vitro deneyler taleplerini karşılayabilir DCV itibaren yaklaşık. CPE tahlil ve qRT-PCR tahlil virüs yükü ölçümü için bu protokolü açıklanmıştır. CPE tahlil bir şekilde ince bir iş. Hücre aşılama uygun yoğunluk ve pozitif/negatif CPE ayrımcılık deneyimli bir standartta izin hızlı ve başarılı CPE tahlil. Böylece, biz daha önce CPE tahlil mastering CPE tahlil kesme seyreltme noktasında karar vermenize yardımcı olacak bir kolay qRT-PCR yöntemi sağlar.

Ancak, DCV yetişkin sinek ve Drosophila hücre hattı için çok güçlü bir virüstür. Sadece 100 PFU/sinek aşılama vahşi sinekler % 50'si 5 gün içinde öldürebilir. Bir aşırı enfeksiyon doz önemini vahşi türü sinek ve potansiyel duyarlı satırları arasındaki gölge. Yeni bir ekran başlatma sırasında en az iki enfeksiyon doz uygulamak önemlidir. Drosophila büyük ölümünden çok kısa bir sürede penceresinde DCV yüksek ölümcül nedeniyle olabilir beri ölüm sayısı daha sık ön deneyler kayıt önemle önerilir. DCV enfeksiyon sonra bazı sinekler bazen asit sendromu var. Özellikle, hangi-ebilmek var olmak neden uygunsuz iğne iğne yaralanma 0,5 h sonrası enfeksiyon içinde ölmek sinekler çıkarılmalıdır.

DCV bulaşıcı gücünü de bir deney başlamadan önce dikkate alınması gereken birçok ana faktör tarafından etkilenir. Wolbachia dikey iletimi virüs enfeksiyonu sinekler32üzerinde büyük etkisi vardır endosymbiont var. Tetrasiklin tedavisi sinek gıda Wolbachia enfeksiyonu ortadan kaldırmak için ortak bir kullanılan yöntemdir. Ancak, bu yöntem de sırayla antiviral yanıt53etkileyebilir bağırsak microbiota kompozisyon değiştirir. Bir kaç çalışmalar tarihinde virüs enfeksiyonu36, ubc-e2h, cg8492 ve pstgibi genetik sapma önemini vurguladı. Örneğin, çizgiler pst S gen var ve çoğu mutant hatları test ettik Bloomington hisse senedi Merkezi'nden pst R alleli, böylece varken picorna benzeri virüs için hassas en vahşi türü sinek dayanıklı fenotipleri sahip. Özellikle vahşi türü denetim29ile karşılaştırarak bir direnç gen dışarı eleme zaman pst, etkisi ekarte etmek çok önemlidir.

Nano-sistemik virüs enfeksiyonu ikna etmek için enjeksiyon yanı sıra, diğer yöntemleri sinekler virüs enfeksiyonu eğitim kullanılabilir. Drosophila hücre hatları virüs enfeksiyonu ekrana uzun yüksek üretilen iş yöntemi ana hücresel bileşeni37,38ile ilgili kanıtlanmıştır. Ancak, bir vitro sistemi her zaman yüksek bir yanlış pozitif oranı ile içinde vivoonaylarken eşlik ediyor. Sadece sınırlı ve daha hafif enfeksiyon tetikleyebilir, ancak DCV da sözlü olarak, Drosophila bulaştırmak için uygulanabilir. Yalnızca larva % 20'si içinde 12 h bulaşmış olduğunu ve % 14 ölüm gözlendi, sadece % 25 ile 20 gün içinde yetişkin mortalite22uçar. Sinekler 0.15 mm çaplı iğne ile iğneleyici viral enfeksiyon ayarlamak için başka bir yoludur ancak doğru enfeksiyon doz ve nicel tekrarlanabilirlik garanti edemez. Genetik manipülasyon sinekler tarafından viral proteinler overexpressing moleküler interactomes vivo içinde7çalışma için iyi bir yoldur. Ancak, bu gerçeği fizyolojisi ve patoloji enfeksiyon üzerine ev sahibi tasvir değil. Bu arada, o enfeksiyon doğal yol değildir ve doğrudan güçlü sistem bağışıklık yanıtı sadece manikür, ilk antiviral savunma hattı yan yol enfeksiyonu sonra da teşvik edebilirsiniz nano-enjeksiyon yöntemi Ayrıca sakıncaları vardır. Özetle, özel araştırma amaç ve mevcut deneysel durumu farklı yöntemler arasında seçiminde belirleyici faktörler vardır.

Disclosures

Yazarlar ifşa gerek yok.

Acknowledgments

Tüm Pan lab IPS teşekkür etmek istiyorum. CA'LARI. Biz Dr Lanfeng Wang (IPS, CAS) deneysel destek ve Dr Gonalo Cordova Steger (Springer doğa), Dr Jessica VARGAS (IPS, Paris) ve Dr. Seng Zhu (IPS, Paris) için yorum için teşekkür ederiz. Bu eser, Çin Bilimler Akademisi stratejik öncelik araştırma programdan hibe L.P (XDA13010500) ve H.T (XDB29030300), Ulusal Doğa Bilimleri Vakfı Çin L.P (31870887 ve 31570897) ve J.Y (31670909) tarafından desteklenmiştir. L.P CAS gençlik yenilik promosyon Derneği (2012083) üyesi olduğunu.

Materials

Name Company Catalog Number Comments
0.22um filter Millipore SLGP033RS
1.5 ml Microcentrifuge tubes Brand 352070
1.5 ml RNase free Microcentrifuge tubes Axygen MCT-150-C
10 cm cell culture dish Sigma CLS430167 Cell culture
100 Replacement tubes Drummond Scientific 3-000-203-G/X
15 ml tube Corning 352096
ABI 7500 qPCR system ABI 7500 qPCR
Cell Incubator Sanyo MIR-553
Centriguge Eppendof 5810R
Centriguge Eppendof 5424R
Chloroform Sigma 151858 RNA extraction
DEPC water Sigma 95284-100ML RNA extraction
Drosophila Incubator Percival I-41NL Rearing Drosophila
FBS Invitrogen 12657-029 Cell culture
flat bottom 96-well-plate Sigma CLS3922 Cell culture
Fluorescence microscope Olympus DP73
Isopropyl alcohol Sigma I9516 RNA extraction
Lysis buffer (RNA extraction) Thermo Fisher 15596026 TRIzol Reagent
Lysis buffer (liquid sample RNA extraction) Thermo Fisher 10296028 TRIzol LS Reagent
Microscope Olympus CKX41
Nanoject II Auto-Nanoliter Injector Drummond Scientific 3-000-204 Nanoject II Variable Volume (2.3 to 69 nL) Automatic Injector with Glass Capillaries (110V)
Optical Adhesive Film ABI 4360954 qPCR
Penicillin-Streptomycin, Liquid Invitrogen 15140-122 Cell culture
qPCR plate ABI A32811 qPCR
Schneider’s Insect Medium Sigma S9895 Cell culture
statistical software GraphPad Prism 7
TransScript Fly First-Strand cDNA Synthesis SuperMix TransScript AT301 RNA extraction
Vortex IKA VORTEX 3 RNA extraction

DOWNLOAD MATERIALS LIST

References

  1. Rahim, M. A., Uddin, K. N. Chikungunya: an emerging viral infection with varied clinical presentations in Bangladesh: Reports of seven cases. BMC Research Notes. 10, 410 (2017).
  2. Douam, F., Ploss, A. Yellow Fever Virus: Knowledge Gaps Impeding the Fight Against an Old Foe. Trends in Microbiology. (2018).
  3. Santiago, G. A., et al. Performance of the Trioplex real-time RT-PCR assay for detection of Zika, dengue, and chikungunya viruses. Nature Communications. 9. 9, 1391 (2018).
  4. Gould, E., Pettersson, J., Higgs, S., Charrel, R., de Lamballerie, X. Emerging arboviruses: Why today? One Health. 4, 1-13 (2017).
  5. Hughes, T. T., et al. Drosophila as a genetic model for studying pathogenic human viruses. Virology. 423, 1-5 (2012).
  6. Xu, J., Cherry, S. Viruses and antiviral immunity in Drosophila. Developmental & Comparative Immunology. 42, 67-84 (2014).
  7. Shirinian, M., et al. A Transgenic Drosophila melanogaster Model To Study Human T-Lymphotropic Virus Oncoprotein Tax-1-Driven Transformation In Vivo. Journal of Virology. 89, 8092-8095 (2015).
  8. Adamson, A. L., Chohan, K., Swenson, J., LaJeunesse, D. A Drosophila model for genetic analysis of influenza viral/host interactions. Genetics. 189, 495-506 (2011).
  9. Hao, L., et al. Drosophila RNAi screen identifies host genes important for influenza virus replication. Nature. 454, 890-893 (2008).
  10. Webster, C. L., et al. The Discovery, Distribution, and Evolution of Viruses Associated with Drosophila melanogaster. Plos Biology. 13, e1002210 (2015).
  11. Heigwer, F., Port, F., Boutros, M. RNA Interference (RNAi) Screening in Drosophila. Genetics. 208, 853-874 (2018).
  12. West, C., Silverman, N. p38b and JAK-STAT signaling protect against Invertebrate iridescent virus 6 infection in Drosophila. PLOS Pathogens. 14, e1007020 (2018).
  13. Liu, Y., et al. STING-Dependent Autophagy Restricts Zika Virus Infection in the Drosophila Brain. Cell Host & Microbe. 24, 57-68 (2018).
  14. Wang, X. H., et al. RNA interference directs innate immunity against viruses in adult Drosophila. Science. 312, 452-454 (2006).
  15. van Rij, R. P., et al. The RNA silencing endonuclease Argonaute 2 mediates specific antiviral immunity in Drosophila melanogaster. Genes & Development. 20, 2985-2995 (2006).
  16. Deddouche, S., et al. The DExD/H-box helicase Dicer-2 mediates the induction of antiviral activity in drosophila. Nature Immunology. 9, 1425-1432 (2008).
  17. Chotkowski, H. L., et al. West Nile virus infection of Drosophila melanogaster induces a protective RNAi response. Virology. 377, 197-206 (2008).
  18. Paradkar, P. N., Trinidad, L., Voysey, R., Duchemin, J. B., Walker, P. J. Secreted Vago restricts West Nile virus infection in Culex mosquito cells by activating the Jak-STAT pathway. Proceedings of the National Academy of Sciences of the United States of America. 109, 18915-18920 (2012).
  19. Souza-Neto, J. A., Sim, S., Dimopoulos, G. An evolutionary conserved function of the JAK-STAT pathway in anti-dengue defense. Proceedings of the National Academy of Sciences of the United States of America. 106, 17841-17846 (2009).
  20. Zambon, R. A., Nandakumar, M., Vakharia, V. N., Wu, L. P. The Toll pathway is important for an antiviral response in Drosophila. Proceedings of the National Academy of Sciences of the United States of America. 102, 7257-7262 (2005).
  21. Costa, A., Jan, E., Sarnow, P., Schneider, D. The Imd pathway is involved in antiviral immune responses in Drosophila. PLoS One. 4, e7436 (2009).
  22. Ferreira, A. G., et al. The Toll-dorsal pathway is required for resistance to viral oral infection in Drosophila. PLOS Pathogens. 10, e1004507 (2014).
  23. Moy, R. H., et al. Antiviral autophagy restrictsRift Valley fever virus infection and is conserved from flies to mammals. Immunity. 40, 51-65 (2014).
  24. Shelly, S., Lukinova, N., Bambina, S., Berman, A., Cherry, S. Autophagy is an essential component of Drosophila immunity against vesicular stomatitis virus. Immunity. 30, 588-598 (2009).
  25. Bronkhorst, A. W., et al. The DNA virus Invertebrate iridescent virus 6 is a target of the Drosophila RNAi machinery. Proceedings of the National Academy of Sciences of the United States of America. 109, E3604-E3613 (2012).
  26. Palmer, W. H., Medd, N. C., Beard, P. M., Obbard, D. J. Isolation of a natural DNA virus of Drosophila melanogaster, and characterisation of host resistance and immune responses. PLOS Pathogens. 14, e1007050 (2018).
  27. Jousset, F. X., Bergoin, M., Revet, B. Characterization of the Drosophila C virus. Journal of General Virology. 34, 269-283 (1977).
  28. Gupta, V., Stewart, C. O., Rund, S. S. C., Monteith, K., Vale, P. F. Costs and benefits of sublethal Drosophila C virus infection. J Evol Biol. 30, 1325-1335 (2017).
  29. Yang, S., et al. Bub1 Facilitates Virus Entry through Endocytosis in a Model of Drosophila Pathogenesis. Journal of Virology. (2018).
  30. Teixeira, L., Ferreira, A., Ashburner, M. The bacterial symbiont Wolbachia induces resistance to RNA viral infections in Drosophila melanogaster. Plos Biology. 6, e2 (2008).
  31. Ferguson, N. M., et al. Modeling the impact on virus transmission of Wolbachia-mediated blocking of dengue virus infection of Aedes aegypti. Science Translational Medicine. 7, 279ra237 (2015).
  32. Hedges, L. M., Brownlie, J. C., O'Neill, S. L., Johnson, K. N. Wolbachia and virus protection in insects. Science. 322, 702 (2008).
  33. Bhattacharya, T., Newton, I. L. G., Hardy, R. W. Wolbachia elevates host methyltransferase expression to block an RNA virus early during infection. PLOS Pathogens. 13, e1006427 (2017).
  34. Magwire, M. M., et al. Genome-wide association studies reveal a simple genetic basis of resistance to naturally coevolving viruses in Drosophila melanogaster. PLOS Genetics. 8, e1003057 (2012).
  35. Cao, C., Cogni, R., Barbier, V., Jiggins, F. M. Complex Coding and Regulatory Polymorphisms in a Restriction Factor Determine the Susceptibility of Drosophila to Viral Infection. Genetics. 2159-2173 (2017).
  36. Martins, N. E., et al. Host adaptation to viruses relies on few genes with different cross-resistance properties. Proceedings of the National Academy of Sciences of the United States of America. 111, 5938-5943 (2014).
  37. Moser, T. S., Sabin, L. R., Cherry, S. RNAi screening for host factors involved in Vaccinia virus infection using Drosophila cells. Journal of Visualized Experiments. (2010).
  38. Zhu, F., Ding, H., Zhu, B. Transcriptional profiling of Drosophila S2 cells in early response to Drosophila C virus. Journal of Virology. 10, 210 (2013).
  39. Ekstrom, J. O., Hultmark, D. A Novel Strategy for Live Detection of Viral Infection in Drosophila melanogaster. Scientific Reports. 6, 26250 (2016).
  40. Durdevic, Z., et al. Efficient RNA virus control in Drosophila requires the RNA methyltransferase Dnmt2. EMBO Reports. 14, 269-275 (2013).
  41. Chrostek, E., et al. Wolbachia variants induce differential protection to viruses in Drosophila melanogaster: a phenotypic and phylogenomic analysis. PLOS Genetics. 9, e1003896 (2013).
  42. Gupta, V., Vale, P. F. Nonlinear disease tolerance curves reveal distinct components of host responses to viral infection. Royal Society Open Science. 4, 170342 (2017).
  43. Chtarbanova, S., et al. Drosophila C virus systemic infection leads to intestinal obstruction. Journal of Virology. 88, 14057-14069 (2014).
  44. Merkling, S. H., van Rij, R. P. Analysis of resistance and tolerance to virus infection in Drosophila. Nature Protocols. 10, 1084-1097 (2015).
  45. Goic, B., et al. RNA-mediated interference and reverse transcription control the persistence of RNA viruses in the insect model Drosophila. Nature Immunology. 14, 396-403 (2013).
  46. Ashburner, M., Golic, K., Hawley, R. S. Drosophila: A Laboratory Handbook. Cold Spring Harbor Laboratory Press. (2011).
  47. Biochemical and Biophysical Research Communications: 1991 index issue. Cumulative indexes for volumes 174-181. Biochemical and Biophysical Research Communications. 1-179 (1991).
  48. Cotarelo, M., et al. Cytopathic effect inhibition assay for determining the in-vitro susceptibility of herpes simplex virus to antiviral agents. Journal of Antimicrobial Chemotherapy. 44, 705-708 (1999).
  49. Reed, L. J. M., H, A simple method of estimating fifty percent endpoints. The American Journal of Hygiene. 27, 493-497 (1938).
  50. Khalil, S., Jacobson, E., Chambers, M. C., Lazzaro, B. P. Systemic bacterial infection and immune defense phenotypes in Drosophila melanogaster. Journal of Visualized Experiments. e52613 (2015).
  51. Schwenke, R. A., Lazzaro, B. P. Juvenile Hormone Suppresses Resistance to Infection in Mated Female Drosophila melanogaster. Current Biology. 27, 596-601 (2017).
  52. Sabin, L. R., Hanna, S. L., Cherry, S. Innate antiviral immunity in Drosophila. Current opinion in immunology. 22, 4-9 (2010).
  53. Yin, J., Zhang, X. X., Wu, B., Xian, Q. Metagenomic insights into tetracycline effects on microbial community and antibiotic resistance of mouse gut. Ecotoxicology. 24, 2125-2132 (2015).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics