Omvandling av mänskliga inducerade pluripotenta stamceller (iPSCs) till funktionella spinal och kranial motor neuron använda PiggyBac vektorer

Neuroscience

Your institution must subscribe to JoVE's Neuroscience section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Detta protokoll möjliggör snabb och effektiv omvandling av inducerade pluripotenta stamceller till motoriska nerv celler med en spinal eller kranial identitet, genom ektopisk uttryck av transkriptionsfaktorer från inducerbara piggyBac vektorer.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Garone, M. G., de Turris, V., Soloperto, A., Brighi, C., De Santis, R., Pagani, F., Di Angelantonio, S., Rosa, A. Conversion of Human Induced Pluripotent Stem Cells (iPSCs) into Functional Spinal and Cranial Motor Neurons Using PiggyBac Vectors. J. Vis. Exp. (147), e59321, doi:10.3791/59321 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Vi beskriver här en metod för att få funktionella spinal och kraniala motoriska nerv celler från humana inducerade pluripotenta stamceller (iPSCs). Direkt omvandling till motor neuron erhålls genom ektopisk uttryck för alternativa moduler av transkriptionsfaktorer, nämligen Ngn2, Isl1 och Lhx3 (NIL) eller Ngn2, Isl1 och Phox2a (NIP). NIL och NIP specificera, respektive, spinal och kranial motor neuron identitet. Vårt protokoll börjar med generering av modifierade iPSC linjer där NIL eller NIP är stabilt integrerade i arvs massan via en piggyBac transposon vektor. Uttryck av transgenerna framkallas därefter av doxycyklin och blytak, i 5 dagar, till omvandlingen av iPSCs in i MN progenitors. Efterföljande mognad, för 7 dagar, leder till homogena populationer av spinal eller kranial MNs. Vår metod har flera fördelar jämfört med tidigare protokoll: det är extremt snabbt och förenklat; Det kräver inte virus infektion eller ytterligare MN-isolering; Det gör det möjligt att generera olika MN subpopulationer (spinal och kranial) med en anmärknings värd mognads grad, vilket framgår av förmågan att avfyra tåg av åtgärder potentialer. Dessutom kan ett stort antal motoriska nerv celler erhållas utan rening från blandade populationer. iPSC-härledda spinal och kranial motoriska nerv celler kan användas för in vitro-modellering av amyotrofisk lateral skleros och andra neurodegenerativa sjukdomar i motorn neuron. Homogena motor neuron populationer kan representera en viktig resurs för cell typ specifika drog screening.

Introduction

Motorisk neuron (MN) degeneration spelar en orsakande roll i mänskliga sjukdomar som amyotrofisk lateral skleros (ALS) och spinal muskelatrofi (SMA). Etablera lämpliga in vitro cell modell system som upprepa komplexiteten i den mänskliga mn är ett viktigt steg mot utvecklingen av nya terapeutiska metoder. Inducerade pluripotenta stamceller (ipscs), som är utrustade med anmärknings värda plurilineage differentiering egenskaper, har nu härletts från ett antal patienter som drabbats av motor neuron sjukdomar1,2. Ytterligare iPSC linjer redovisade patogena mutationer associerade till MN sjukdomar har genererats av gen redigering, från kontroll "friska" pluripotenta stamceller3. Dessa linjer representerar användbara verktyg för in vitro-modellering och drog screening, förutsatt att lämpliga metoder för iPSC differentiering i MNs finns tillgängliga. Logiken bakom utvecklingen av denna metod är att ge vetenskaps samfundet intresse rad av MN sjukdomar med en snabb och effektiv differentiering protokoll ger upphov till mogna funktionella MNs. Den första fördelen med denna metod är dess tidsram för utförande. En annan relevant punkt av styrka kommer från avskaffandet av varje renings steg. Slutligen kan protokollet användas för att generera två distinkta populationer av motoriska nerv celler.

Möjligheten att skapa olika subtyper av MNs är särskilt relevant för modellering av MN-sjukdomar. Inte alla mn under typer är lika sårbara i ALS och sma och uppkomsten av symtom i olika motoenheter påverkar kraftigt prognosen. I ALS, spinal debut med symtom som börjar i övre och nedre extremiteterna leder till döden i ca 3-5 år4. Omvänt, bulbar debut, börjar med degeneration av kranial MNs, har en värsta prognos. Dessutom är andelen bulbar debut signifikant högre hos patienter med mutationer i RNA-bindande proteiner FUS och TDP-43 än hos individer med SOD1 mutationer5. Nästan helheten av alternativa mn differentiering protokoll förlitar sig på aktiviteten av retinoinsyra syra (ra), som ger en spinal karaktär att differentiera ipscs6,7,8. Detta begränsar möjligheten att studera inneboende faktorer, som kan vara skyddande i specifika mn under typer9,10.

I överensstämmelse med ett tidigare arbete i mus embryonala stamceller11, har vi nyligen visat att i mänskliga ipscs ektopisk uttryck för Ngn2, Isl1 och LHX3 (Nil) inducerar en spinal mn identitet, medan Ngn2 och Isl1 plus PHOX2A (NiP) ange kranial mns12. Vi har därför utvecklat ett effektivt protokoll, som leder till produktion av mänskliga MNs begåvad med funktionella egenskaper i en 12 dagars vändning. Syftet med denna metod är att på kort tid och utan behov av rening (t. ex. av FACS) uppnå en cell population som är mycket berikad för MNs med spinal-eller kranialidentitet.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. underhåll av mänskliga iPSCs

  1. Beredning av matrixbelagda plåtar
    1. Tina en 5 mL injektions flaska med matris (se material tabell) vid 4 ° c över natten. De ursprungliga mat ris lagren kommer vid olika lagerkoncentrationer och Ali kvoter görs enligt den utspädnings faktor som anges på data bladet, specifikt för det enskilda partiet. Det är viktigt att hålla injektions flaskan och rören iskalla för att förhindra för tidig geleringsmedel av matrisen. Fördela Matrixen i Ali kvoter i förkylda krysrör på is. Frys oanvända Ali kvoter vid-20 ° c.
    2. Placera en alikvot på is i ca 2 h för att Tina.
    3. Späd ut alikvot av matrisen med 20 mL kallt DMEM/F12 i en 50 mL konisk tub.
    4. Blanda väl och fördela 1 mL utspädd matris till 35 mm rätter (motsvarande belopp per yta av andra rätter).
    5. Förvara rätterna som innehåller utspädd matris för 1 h vid rums temperatur för att tillåta beläggning.
      Anmärkning: Mat rätter, förseglade med parafilm, kan förvaras vid 4 ° c i upp till 2 veckor.
  2. Beredning av stam lösning (20 ml) och 1x arbets Ali kvoter av mild cell dissociation reagens (se material tabell).
    1. Lös upp pulvret till 10 mg/mL i PBS (ca2 +/mg2 + gratis).
    2. Filtrera sterilisera genom en 0,22 μm filter membran.
    3. Förbered 20 Ali kvoter (1 mL vardera) och förvara vid-20 ° c.
    4. Späd ut en alikvot i PBS (ca2 +/mg2 + gratis) före användning till 1 mg/ml (1x arbetande Ali kvoter).
      Anmärkning: 1x arbets Ali kvoter kan förvaras vid 4 ° c i upp till 2 veckor.
  3. Passaging mänskliga iPSCs.
    1. Före start: om det förvaras vid 4 ° c, förvarma Matrix-belagda plattor i inkubator vid 37 ° c för 20-30 min. Förvarm vid rums temperatur mängden humant iPSC medium (se material tabell) behövs. Förvärm DMEM/F12.
    2. Aspirera odlings substrat.
    3. Skölj iPSCs med PBS (ca2 +/mg2 + gratis).
    4. Tillsätt 1x mild dissociationslösning (0,5 mL för en 35 mm mat rätt). Inkubera vid 37 ° c tills kanterna på kolonierna börjar lossna från plattan, vanligt vis 3-5 min.
    5. Aspirera den milda dissociation lösning, vara noga med att inte lossa iPSC kolonier.
    6. Tvätta cellerna med DMEM/F12 (2 mL för en 35 mm mat rätt) och aspirera att vara noga med att inte ta loss cellerna. Upprepa detta steg en gång till.
    7. Tillsätt humant iPSC medium (1 mL för en 35 mm mat rätt).
    8. Ta försiktigt bort kolonierna med en celllyftare och överför till ett 15 mL-rör.
    9. Bryt försiktigt cell klumpar genom att Pipettera upp och ner med en P1000-pipett 3-4 gånger.
    10. Aspirera supernatanten från den matris-belagda plattan (s).
    11. Frö cellerna i lämplig kultur volym av mänskliga iPSC medium. Delnings förhållandet kan variera från rad till rad och är ca 1:4-1:8. Ändra mediet dagligen.

2. generering av NIL-och NIP-inducerbara iPSC-linjer

  1. Cell transfektion.
    1. Skölj cellerna med PBS (ca2 +/mg2 + gratis).
    2. Tillsätt celldissociationreagens (se material tabell) (0,35 ml för en 35 mm mat rätt) och inkubera vid 37 ° c tills enstaka celler separeras (5-10 min).
    3. Avsluta cell separationen varsamt genom att Pipettera upp och ner med en P1000-pipett 3-4 gånger.
    4. Samla i en 15 mL tub och tillsätt PBS (ca2 +/mg2 + gratis) till 10 ml. Räkna cellerna.
    5. Pellet 106 celler och resuspendera i 100 μl buffert R (ingår i cell elektroporation kit, se tabell över material).
    6. Tillsätt plasmid DNA för transfektion: 4,5 μg överföras vektor (EPB-BSD-tt-Nil eller EPB-BSD-tt-Nip12) och 0,5 μg av piggybac transposase Plasmid13.
    7. Transfekt med cell elektroporationssystemet (se material tabell) enligt tillverkarens anvisningar och som tidigare beskrivits3 med följande parametrar: 1 200 V spänning, 30 MS bredd, 1 puls. Frö cellerna i mänskliga iPSC medium kompletteras med 10 μM Y-27632 (ROCK-hämmare, se tabell över material) i en 6 mm matris-belagda skålen.
  2. Urval med antibiotika.
    1. Tillsätt 5 μg/mL blasticidin till odlings mediet två dagar efter transfektion.
    2. De flesta av de icke-transfected celler kommer att dö inom 48 h av blasticidin urval. Håll cellerna i blasticidin i minst 7-10 dagar för att motverka-Välj de celler som inte har integrerat transgener i genomet.
    3. Bibehålla stabilt transfekterade celler som en blandad population, bestående av celler med olika antal transgener och olika integrations platser, eller isolera enstaka kloner.
    4. Förbered en extra mat rätt för att kontrol lera för effektivt uttryck av transgenerna, på 1 μg/mL doxycyklininduktion, av RT-PCR med Transgene-specifika primers för Ngn2 (framåt: TATGCACCTCACCTCCCCATAG; Omvänd: GAAGGGAGGAGGGCTCGACT), som tidigare beskrivits12.
    5. I detta skede, frysa lager av romanen NIL-och NIP-iPSC linjer i frys mediet för mänskliga iPSCs (se tabell över material).

3. motor neuron differentiering

  1. Separera cellerna med celldissociationreagens enligt beskrivningen (steg 2.1.1.-2.1.3.). Samla separerade celler i ett 15 mL-rör och späd med 5 volymer DMEM/F12. Pellet cellerna och resuspendera i mänskliga iPSC medium kompletteras med 10 μM ROCK-hämmare. Räkna cellerna och frö på matris-belagda rätter med en densitet på 62 500 celler/cm2.
  2. Dagen efter, ersätta mediet med DMEM/F12, kompletteras med 1x stabil L-glutamin analog, 1x icke-essentiell aminosyra (NEAA) cell kultur tillägg och 0.5 x penicillin/streptomycin, och innehåller 1 μg/mL doxycyklin. Detta betraktas som dag 0 av differentiering. På dag 1, uppdatera mediet och doxycyklin.
  3. På dag 2, ändra mediet till Neurobasal/B27 medium (Neurobasal medium kompletteras med 1x B27, 1x stabil L-glutamin analog, 1x NEAA och 0.5 x penicillin/streptomycin), innehåll ande 5 μM DAPT, 4 μM SU5402 och 1 μg/mL doxycyklin (se tabell över material ). Uppdatera mediet och doxycyklin varje dag till dag 5.
  4. Dag 5: celler dissociation med cell dissociation reagens (se material tabell).
    1. Skölj cellerna med PBS (ca2 +/mg2 + gratis).
    2. Tillsätt celldissociationreagens (0,35 ml för en 35 mm mat rätt) och inkubera vid 37 ° c tills hela cell enskiktslager skiljs från skålen. Observera att enstaka celler inte kommer att separeras under inkubation.
    3. Tillsätt 1 mL DMEM/F12 och samla cellerna i ett 15 mL-rör.
    4. Avsluta cell separationen varsamt genom att Pipettera upp och ner med en P1000-pipett 10-15 gånger.
    5. Tillsätt 4 mL DMEM/F12 och räkna cellerna.
    6. I detta skede, frysa motor neuron progenitorer i cell frysning medium (se tabell över material), enligt tillverkarens instruktioner.
    7. Pellet cellerna och resuspendera i neuronal medium (Neurobasal/B27 medium kompletteras med 20 ng/mL BDNF, 10 ng/mL GDNF och 200 ng/mL L-askor bin syra, se tabell över materials) kompletteras med 10 μM Rock inhibitor.
    8. Frö cellerna på Poly-ornitin/laminin-eller alternativt på matris-belagda stöd vid densiteten av 100 000 celler/cm2. Använd μ-Slide plast stöd med polymer täckglas (se tabell över material) för immunofärgningsanalys.
  5. På dag 6, ändra mediet med färska neuronal medium saknar ROCK-hämmare. På de kommande dagarna, uppdatera halva mediet var 3 dagar. Odlings mediet måste bytas mycket noggrant för att förhindra lossnar från ytan.

4. immunofärgningsanalys

  1. Cellfixering. Skölj cellerna med PBS (med ca2 +/mg2 +) och inkubera i 15 min i 4% paraformaldehyd i PBS (med ca2 +/mg2 +) i rums temperatur.
    Var försiktig: Paraformaldehyd är giftigt och misstänks orsaka cancer. Undvik kontakt med hud och ögon och handtag under en kemisk draghuv.
  2. Permeabilize med PBS (med ca2 +/mg2 +) innehåll ande 0,1% Triton X-100 för 5 min vid rums temperatur.
  3. Inkubera i 30 minuter i rums temperatur i anti kropps blockerande lösning (ABS: 3% BSA i PBS med ca2 +/mg2 +).
  4. Inkubera i 1 h vid rums temperatur med primära anti kroppar i ABS: anti-TUJ1 (1:1000; kanin) och anti-Oct4 (1:200; mus) eller anti-CHAT (anti-kolin Acetyltransferas; 1:150; get). Se material tabell.
  5. Inkubera för 45 min i rums temperatur med lämplig åsna sekundära anti kropp par i ABS: anti-mus Alexa fluor 647 (1:250), anti-kanin Alexa fluor 594 (1:250) och anti-Goat Alexa fluor 488 (1:250). Se material tabell.
  6. Inkubera i 0,4 μg/mL DAPI i 5 min vid rums temperatur för att märka Atom kärnor.
  7. Montera cellerna med monterings medium (se material tabell) för avbildning med fluorescensmikroskop.

5. funktionell karakterisering via patch-Clamp Recordings

  1. Förbered HEPES-equilibrated extern lösning (NES) enligt följande: 140 mM NaCl, 2,8 mM KCl, 2 mM CaCl2, 2 mm mgcl2, 10 mm Hepes, och 10 mm glukos. Ställ in osmolaritet mellan 290-300 mΩ. Justera pH till 7,3 med 1N NaOH och förvara lösningen vid 4 ° c.
  2. Förbered den inre lösningen: 140 mM K-glukonat, 2 mM NaCl, 5 mM BAPTA, 2 mM MgCl2, 10 mm Hepes, 2 mm mg-ATP, 0,3 mm na-GTP. Justera pH till 7,3 med 1M KOH och kontrol lera att osmolaritet är inställt på cirka 290 mΩ. Frys lösningen vid-20 ° c i små Ali kvoter.
  3. Innan du kör experiment, förvärma NES lösningen i ett vatten bad till ca 28-30 ° c.
  4. Dra några borosilikatmikropipetter (ID 0,86 mm; OD 1,5 mm) med ett spets motstånd: 5-6 MΩ och fyll med den intracellulära lösningen innan den monteras i pipetthållaren.
    Anmärkning: Kom ihåg att klorid silver trådar av inspelnings elektrod och referens elektrod i blek medel i minst 30 min för att bilda ett enhetligt skikt av AgCl på tråd ytan.
  5. Överför Petriskskålen i inspelnings kammaren och låt kammaren med NES-lösningen på 1-2 mL/min. Låt flödet passera genom en inline värmare inställd på temperatur av 30 ° c för att hålla lösningen varm.
  6. Placera Elektrofysiologisk inspelnings kammare under ett upprätt Mikroskop. Spela in membran strömmar med patch-Clamp förstärkare och förvärva data med en lämplig program vara.
  7. Öppna förstärkarens kontroll program och Ställ in signal förstärkningen vid värde 1 och Bessel-filtret vid 10 kHz. Se till att Bessel-filtret är 2,5 gånger lägre än provtagnings frekvensen.
  8. Ställ in experimentella protokoll för spännings-och ström kläm experiment i inspelnings programmet.
  9. I protokollets inställning, kryssa i episodiskt stimuleringsläge och Ställ in samplings frekvensen vid 25 kHz. Flytta sedan till fliken vågform och ange spänning eller nuvarande steg amplitud och längd som följer.
  10. För spännings-gated natrium strömmar, Använd 15 spännings steg (50 ms varaktighet vardera) från-100 mV till + 40 mV (10 mV ökning). Kör protokollet efter införande av den lappade cellen en hållningspotential på-60 mV genom förstärkaren. Likaså de spänningsreglerade kalium strömmarna framkallas av spännings steg (250 MS varaktighet vardera) från-30 mV till + 50 mV (10 mV ökning) som innehar den inspelade cellen till-40 mV.
  11. För undersökning av bränning egenskaper iPSC-derived kranial och spinal MNs, klämma celler, i ström-Clamp läge, på en membranpotential på-70 mV och använda 4 ström pulser (1 s varaktighet vardera) av ökande amplitud (från + 20 pA till + 80 pA, 20 pA ökning).
  12. Förvärva för varje cell spänningsaktiverade strömmar, framkallat bränning aktivitet och tre passiva egenskaper som hela cellen kapacitans (cm), cell membran resistens (RM) och vilande membran potential (RMP).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

En schematisk beskrivning av differentierings metoden visas i figur 1. Mänskliga ipscs (WT I linje3) var transfekterade med EPB-BSD-tt-Nil eller EPB-BSD-tt-Nip, genererar, på blasticidin urval, stabila och inducerbara cellinjer12, nedan kallad IPSC-Nil och IPSC-Nip, respectively. Differentiera celler karakteriserades för uttrycket av pluripotens markör OCT4 och Pan-neuronal markör TUJ1. Immunofärgningsanalys visade enhetligt uttryck av OCT4 i alla celler vid dag 0, i avsaknad av TUJ1 positivitet (figur 2a). Vid dag 3 observerade vi en kraftig minskning av antalet OCT4-positiva celler, speglat av uttryck av TUJ1 i en delmängd av differentierande iPSCs (figur 2B). Vid dag 5 observerades inget uttryck för OCT4 i populationen, som visade konsekvent uttryck för TUJ1 och förvärvade en neuronala morfologi (figur 2C). Motor neuron förfäder separerades sedan och ompläterade för ytterligare mognad. Efter 7 dagar (12 dagar sedan dag 0), celler jämnt uttryckt TUJ1 och den mogna motorn neuron markör CHAT (figur 3). Liknande resultat har erhållits med två ytterligare kommersiella iPSC-linjer (se material tabell), med samma odlings-och differentierings villkor (tilläggs figur S1 och tilläggs figur S2). På samma sätt som Nil-inducerad motoriska nerv celler från mus ESCS11, mänskliga ipscs inducerad med Nil och Nip uttryckte låga nivåer av hox transkriptionsfaktorer och kan mönstra längs rostro-caudal axeln med retinoinsyra Acid (kompletterande figur S3 ).

Dessa resultat erhölls när 62 500 celler/cm2 var seedade i början av differentiering och inducerade med 1 μM doxycyklin vid dag 0. Detta resulterade i den optimala koncentrationen av doxycyklin för att uppnå maximal induktion av transgenerna utan uppenbar toxicitet för cellerna (kompletterande figur S4A). Vid avlägsnandet av doxycyklin dag 5 tystades uttrycket av transgenerna (kompletterande figur s4b). Vi har också utfört pilot experiment för att fastställa den optimala densiteten av cellerna vid denna punkt i protokollet. Vi märkte att varierande denna parameter i parallella differentierings experiment gav olika utfall. Med initial densitet sänkt till 31 250 celler/cm2, differentiering var tydligen normal, som utvärderas genom att observera Cellmorfologi. Men vi märkte resistens mot dissociation dag 5 (avsnitt 3,4) och minskad lönsamhet i den efterföljande mognads fasen. Omvänt, när den initiala densiteten av cellerna höjdes till 125 000 celler/cm2, observerade vi ineffektiv differentiering, som bedömdes av brist på förvärv av den typiska neuron-liknande morfologi. Detta resulterade i en blandad population som endast innehöll en mindre fraktion av MNs, vilket skulle behöva ytterligare rening (t. ex. av FACS). Vi har därför fastställt att den optimala densiteten för att få en ren population av neuronala celler, kunna överleva i kulturen i mer än två månader, är 62 500 celler/cm2.

Vi bedömde sedan den funktionella mognads lagring av iPSC NIL-härledda spinal motoriska nerv celler genom att karakterisera deras elektro fysiologiska egenskaper (figur 4), som tidigare rapporter ATS för IPSC Nip-derived kranial motoriska nerv celler12. Vid dag 7 av MNs mognads steg i protokollet (se figur 1; total tid för differentiering: 12 dagar) (figur 4A) utfördes patchklaminspelningar, antingen i spännings-och ström kläm modalitet. Vid denna tidpunkt visade iPSC NIL-härledda motoriska nerv celler en något lägre vila membran potential (-30 ± 2 mV, n = 24) och en liknande cell kapacitans värde (+ 25 ± 2 pF, n = 25) jämfört med tidigare rapporterade iPSC NIP-derived MNs12. Sedan, för att djupare karakterisera graden av mognad av differentierade celler, undersökte vi deras förmåga att framkalla natrium och kalium strömmar när stimuleras med en serie av spännings pulser. I dessa experiment visade IPSC Nil-härledda neuroner framgångs rikt spännings beroende natrium strömmar (figur 4B), och spännings beroende kalium strömmar (figur 4C), når maximal amplitud när de är fastspända vid en membran potential nära − 20 mV respektive + 50 mV. Jämvikt potentialerna för na+ och K+, beräknas med hjälp av nernst ekvation (www.physiologyweb.com/calculators/nernst_potential_calculator.html) med tidigare rapporterade extracellulära och intracellulära lösningar, var + 110 mV respektive-102 mV. Dessutom 80% av iPSC NIL-härledda MNs fastklämda i ström-Clamp modalitet kunde utlösa Spike tåg när injiceras med en ström puls på + 60 pA eller mer (figur 4D). Den minsta ström som krävs för att framkalla upprepad bränning i mer än 50% av de registrerade cellerna var + 40 pA (15 av 18 celler; Figur 4 E). Spike-tröskeln var-37,6 ± 0,8 MV och den genomsnittliga eld frekvensen vid + 40 pa var ca 7,9 ± 2,2 Hz (n = 18; Figur 4 F).

Sammantaget tyder dessa data på att, i likhet med tidigare rapporterade iPSC NIP-derived kranial MNs12, IPSC-Nil-härledda spinal mns har funktionella egenskaper typiska för mogna nerv celler.

Figure 1
Figur 1 : Motor neuron differentiering protokoll. Figuren visar en schematisk representation av differentierings protokollet, från generering av stabila iPSC-linjer med piggyBac-vektorer till tids punkten för den funktionella analys som rapporteras i texten. Representativa fas kontrast bilder av cellerna vid olika steg i protokollet visas. Skal streck = 50 μm. Vänligen klicka här för att se en större version av denna siffra.

Figure 2
Figur 2 : Representativ immunofärgningsanalys av differentierande celler. iPSC-NIL och iPSC-NIP celler analyserades genom immunofärgning för uttryck av pluripotens markör OCT4 (lila) och Pan-neuronal markör TUJ1 (röd) på dag 0 (a), dag 3 (B) och dag 5 (C). Nuklei motfärgas med DAPI. Konfokalmikroskopi bilder förvärvades vid laser scanning konfokal Mikroskop (se tabell över material) med hjälp av en 20x na 0,75 mål med zoom 2x, 1024 x 1024 pixel, utrustad med 405 nm, 473 nm, 559 nm och 635 Nm lasrar. Filter inställning för DAPI, Alexa fluor 594 och Alexa fluor 647 användes. Skal streck = 50 μm. Vänligen klicka här för att se en större version av denna siffra.

Figure 3
Figur 3 : Representativ immunofärgningsanalys av iPSC-härledda motoriska nerv celler. iPSC-NIL och iPSC-NIP celler analyserades av immunofärgning för uttrycket av Pan-neuronal markör TUJ1 (röd) och motorn neuron markör CHAT (kolin kolinacetyltransferas; grön) på dag 12. Nuklei motfärgas med DAPI. Konfokala bilder förvärvades enligt beskrivningen i figur 2 legend. Skal streck = 50 μm. Vänligen klicka här för att se en större version av denna siffra.

Figure 4
Figur 4 : Funktionell analys av spinal och kranial motoriska nerv celler. (A) ljus fält bild av hela cellen patch klämma på IPSC Nil-härledda spinal motor neuron. Brepresentativ i/V-kurva för na+ ström som registrerats i IPSC Nil-härledda mns som svar på en serie ökande spännings steg (n = 26; hållningspotential lika med-60 MV). Crepresentativ i/V-kurva för K+ som registrerats i IPSC Nil-härledda mns som svar på en serie ökande spännings steg (n = 23; hållningspotential lika med-40 MV). (D) representativt spår av ett tåg av åtgärder potentialer framkallat som svar på en 1 s varaktig ström insprutning av + 60 pa. (E) histogram som representerar den procentuella andelen IPSC Nil-härledda mns som framkallar actionpotentialer vid varje aktuell puls (n = 18). (F) histogram som visar den frammanade tänd frekvensen vid varje aktuell puls (n = 18). Elektrofysiologisk inspelning utfördes under ett upprätt Mikroskop. Inspelnings systemet för membran strömmar anges i material tabellen. Vänligen klicka här för att se en större version av denna siffra.

Supplementary Figure 1
Kompletterande figur S1: mn-differentiering med Episomal hiPSCs. (A) brightfield bilder av differentierande Episomal HIPSC-Nil (vänster) och Episomal HIPSC-Nip (höger) vid angivna tidpunkter. Skal streck = 50 μm. (B) analys av uttrycket av de indikerade markörer för att differentiera Episomal HIPSC-Nil (övre) och Episomal HIPSC-Nip (botten) celler med Real tid QRT-PCR. För varje markör har tids punkten med det högsta uttrycket använts som kalibratorprov. Primers används för ISL1 är specifika för den endogena genen. (C) immunofärgning för den pan-NEURONALA markören TUJ1 (röd) och KRANIAL mn-markör PHOX2B (grön) i differentierad (dag 6) Episomal HIPSC-Nil (vänster) och Episomal HIPSC-Nip (höger) celler. Nuklei motfärgas med DAPI. Skalbar för alla paneler: 50 μm. D) analys av uttrycket HB9 och PHOX2B för att differentiera Episomal HIPSC-Nil (övre) och Episomal HIPSC-Nip (nederst) celler med QRT-PCR i real tid. Dag 0 har använts som kalibratorprov. PCR primers och metoder rapporteras i de Santis et al., 2018-12. Vänligen klicka här för att se en större version av denna siffra.

Supplementary Figure 2
Kompletterande figur S2: mn differentiering med DS2U iPSCs. (A) brightfield bilder av differentiera DS2U-Nil (vänster) och DS2U-Nip (höger) vid angivna tidpunkter. Skal streck = 50 μm. (B) analys av uttrycket av de indikerade markörer i differentiera DS2U-Nil (topp) och DS2U-Nip (Bottom) celler av real tid QRT-PCR. För varje markör har tids punkten med det högsta uttrycket använts som kalibratorprov. Primers används för ISL1 är specifika för den endogena genen. (C) immunofärgning för den pan-NEURONALA markören TUJ1 (röd) och KRANIAL mn-markör PHOX2B (grön) i differentierade (dag 6) DS2U-Nil (vänster) och DS2U-Nip (höger) celler. Nuklei motfärgas med DAPI. Skal streck = 50 μm. (D) analys av uttrycket HB9 och PHOX2B för att differentiera DS2U-Nil (topp) och DS2U-Nip (botten) celler med Real tid QRT-PCR. Dag 0 har använts som kalibratorprov. PCR primers och metoder rapporteras i de Santis et al., 2018-12. Vänligen klicka här för att se en större version av denna siffra.

Supplementary Figure 3
Kompletterande figur S3: HOX-genuttryck. (A) analys av uttrycket av fyra olika hox-gener (hox a2, hox B1, hox A4, hox B5) efter 5 dagars differentiering av IPSC-Nil och IPSC-Nil + ra-celler i real tid QRT-PCR. IPSC-NIL vid dag 0 har använts som kalibratorprov. (B) analys av uttrycket av fyra olika hox-gener (hox a2, hox B1, hox A4, hox B5) efter 5 dagars differentiering av IPSC-Nip och IPSC-Nip + ra-celler i real tid QRT-PCR. IPSC-NIP vid dag 0 har använts som kalibratorprov. (C) PCR primer-par. Vänligen klicka här för att se en större version av denna siffra.

Supplementary Figure 4
Kompletterande figur S4: induktions analys av doxycyklin. Aanalys i real tid QRT-PCR av uttrycket av exogena Ngn2 i IPSC-Nil (övre) och IPSC-Nip (botten) celler obehandlade eller odlade under 24 timmar i närvaro av doxycyklin vid olika koncentrationer (0,5 μm, 1,0 μm, 2,0 μM). Ngn2 analyserades med primers specifika för den exogena mus genen. Föräldrarnas iPSC linje, saknar NIL och NIP konstruktioner, har inkluderats i analysen som en kontroll. Uttryck för transgener i iPSC-NIL och iPSC-NIP var försumlig i avsaknad av doxycyklin. iPSC-NIL och iPSC-NIP vid dag 0 har använts som kalibratorprover. (B) analys med QRT-PCR i real tid av uttrycket av exogena Ngn2 för att differentiera cellerna IPSC-Nil (vänster) och IPSC-Nip (höger) vid de angivna tids punkterna i protokollet. Ngn2 analyserades med primers specifika för den exogena mus genen. iPSC-NIL och iPSC-NIP vid dag 0 har använts som kalibratorprover. PCR primers och metoder rapporteras i de Santis et al., 2018-12. Vänligen klicka här för att se en större version av denna siffra.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Detta protokoll gör det möjligt att effektivt omvandla mänskliga iPSCs i spinal och kranial motoriska nerv celler tack vare ektopisk uttryck för härstamning specifika transkriptionsfaktorer. Dessa transgener induceras av doxycyklin och stabilt integreras i arvs massan tack vare en piggyBac transposon-baserade vektor. I en blandad population kommer en eller flera kopior av piggyBac-vektorn att slumpmässigt integreras i enskilda cellers arvs massa, vilket ökar risken för förändringar av genomens integritet. Dessutom kan ett progressivt urval av iPSC-subkloner inträffa med tiden, med möjliga konsekvenser för differentiering och för jämför ande analys av sjukdomar och kontroll cellinjer. Sammantaget kommer iPSC-härledda MNs erhålls med detta protokoll vara olämpliga för regenerativ medicin. Emellertid, vår metod kan vara särskilt användbart för in vitro-motor neuron sjukdoms modellering. Viktiga styrke punkter representeras av den extremt förenklade kulturen villkor, snabbhet av MN omvandling, den höga graden av mognad av iPSC-härledda MNs och möjligheten att få både spinal och kranial MNs, som tidigare visats av analys av specifika markörgener uttryck12. Protokollets robusthet framgår av dess reproducerbarhet. Hittills har vi framgångs rikt tillämpat detta protokoll mer än 30 gånger för spinal och/eller kranial MN generation, bedöma resultaten av markör och/eller funktionella analyser. Vi har framgångs rikt upprätthållit motor neuron kulturer i upp till två månader utan uppenbar minskning av lönsamheten. Dessutom, när den stabilt transducerade IPSC linje har erhållits, varje experiment kan inledas med doxycyklin induktion utan behov av ny transfektion. Viral vektorer krävs inte heller. De representativa resultat som presenteras här har erhållits genom elektroporating iPSCs med cell elektroporation system som anges i material tabellen. Andra elektroporeringsmetoder kan dock utgöra alternativa alternativ. Omvänt, enligt vår erfarenhet, transfektion system baserade på lipofection är inte ett bra alternativ för pluripotenta stamceller12. Cell populationer som erhålls i slutet av processen består nästan uteslutande av MNs, vilket undviker behovet av ytterligare rening (t. ex. av FACS). Som vi tidigare visade12, tillåter protokollet att erhålla 90% TUJ1-positiva celler, varav 95% där också PHOX2B positiva i Nip-härledda kulturer.

Vi kan tänka oss några kritiska punkter som måste beaktas på ett korrekt sätt. För det första är kvaliteten på den ursprungliga populationen av iPSCs avgörande för att säkerställa en homogen och konsekvent omvandling till MNs. kulturer som innehåller en betydande del av differentiering (mer än 5-10%) måste undvikas. Vi har inrättat protokollet med hjälp av mänskliga iPSC medium som beskrivs i tabellen över material som underhålls medium för odifferentierade iPSCs. Andra kommersiellt tillgängliga definierade medier kan representera giltiga alternativ, trots att vi inte experimentellt har tagit upp denna punkt i det nuvarande arbetet. Eftersom medie sammansättningen kan påverka spridnings takten för den första cell populationen kan anpassningen av protokollet till andra underhålls medier kräva optimering av den initiala densiteten vid dag 0. Efter transfektion, det är viktigt att hålla cellerna under antibiotikum val i minst 2 veckor för att få stabila cellinjer. Det kan vara lämpligt för vissa tillämpningar att härleda klon linjer efter piggyBac integration, för att få en mer homogen befolkning när det gäller nivåer av transgen uttryck och en bättre kontroll av integrations anläggningar. Densitet av cellerna på dag 0, tiden för doxycyklin tillägg till mediet, är en avgörande parameter. Som nämnts i avsnittet representativa resultat, beräknade vi en optimal cell täthet för att säkerställa reproducerbarhet. Vi kan inte utesluta att andra pluripotenta stamcells linjer kan kräva olika initiala densitet, som bör empiriskt bestämmas i pilot experiment, eftersom fördubblingen hastigheten kan variera avsevärt mellan enskilda linjer. Medium switch till Neurobasal/B27 måste inträffa efter 48 h sedan doxycyklin induktion (avsnitt 3,3): differentiering kan resultera långsammare och mindre effektiv om cellerna inte hålls i 2 hela dagar i DMEM/F12 mediet. Dissociation dag 5 måste utföras utan att man behöver betona differentierande celler. Tiden för inkubation med celldissociationreagens (steg 3,4) kan skilja sig från sats till parti och bör noggrant uppskattas i pilot experiment. Vid inkubation med celldissociationsreagens lossar hela cell enskiktslager från plattan. Därefter måste det noggrant separeras genom pipettering, som beskrivs i avsnitt 3,4, för att bevara cellernas integritet och för att undvika mekanisk påfrestning, vilket kan ha en negativ inverkan på upprätthållandet av cell kulturen bortom D5. Slutligen märkte vi att efter omplätering MNs följa bättre på vävnads odling plast än glas. Polymertäckglasen säkerställer optimal cell följsamhet och lämpliga optiska egenskaper är ett bra alternativ för Microscopy-baserade applikationer.

Vår metod representerar en direkt "programmering" av pluripotenta celler till ett MN-öde, och inte rekapitulera de mellanliggande steg genom vilka embryonala celler förvärva en MN identitet under in vivo utveckling, såsom initial specifikation till neurala ektoderm och mönster längs dorso-ventrala och rostro-caudal axlar. Därför skulle det inte vara lämpligt att modellera mänsklig MN-specifikation in vitro för att studera, till exempel, molekyl ära mekanismer som ligger till grund för differentiering. Å andra sidan tillåter vårt protokoll att generera en avsevärd mängd spinal eller kranial MNs utan behov av ytterligare rening. Med hänsyn också till den mognads grad som uppnåtts, utgör detta ett användbart verktyg för att studera den molekyl ära grunden för neurodegenerativa sjukdomar i motor neuron. Ett konsekvent antal iPSC linjer med patogena mutationer i motorneuron sjukdomsrelaterade gener har producerats av vetenskaps samfundet under de senaste åren. Samlingar av MN "programmerbara" iPSC linjer kan därför lätt genereras genom stabil integration av NIL och NIP moduler i dessa mutanta iPSC linjer. Vi kan föreställa oss, som en möjlig framtida tillämpning av metoden, karakteriseringen av de cell autonoma bestämnings faktorerna som ger olika känslighet för enskilda MN-subtyper, genom att jämföra sida-vid-sida-kranial-och ryggrads-MNs som erhållits från iPSCs med samma genetiska bakgrund. Dessutom effektiv omvandling av iPSCs till MNs i förenklade odlings förhållanden som behöver minimal manipulation (dvs utan över gång genom embryoid organ) och som lätt kan skalas, kan kraftigt under lätta automatiserad hög genom strömning läkemedel screening metoder för motor neuron sjukdomar. In vitro-modellering av vuxna debuterande neurodegenerativa sjukdomar kan vara utmanande på grund av foster-liknande karaktär iPSC-derived neuroner14. Tidigare strategier som utarbetats för att påskynda åldrandet av MNs härrör från konventionell differentiering av iPSCs, såsom progerin överuttryck15, kan kombineras med vår metod för att få bättre sjukdoms modeller.

Metoden som beskrivs här, baserad på det inducerbara uttrycket av transkriptionsfaktorer som medieras av en piggyBac-vektor, kan tillämpas på andra inducerade cell typer. Vi har tidigare visat att Skelett muskel celler kan erhållas från mänskliga iPSCs genom uttryck av BAF60c och Myod16. Likaså kan vi föreställa oss möjligheten att utvidga metoden till andra cell typer av intresse, inklusive andra neuronala subtyper och astrocyter, genom piggybac-medierad uttryck för lämpliga uppsättningar av programmerings faktorer17,18, 19,20,21.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Författarna har inget att avslöja

Acknowledgments

Författarna vill tacka Imaging Facility vid centrum för Life nano Science, Istituto Italiano di Tecnologia, för stöd och teknisk rådgivning. Vi är tacksamma till medlemmar i centrum för Life nano Science för hjälpsam diskussion. Detta arbete stöddes delvis av ett bidrag från AriSLA (pilot Grant 2016 "StressFUS") till AR.

Materials

Name Company Catalog Number Comments
5-Bapta Sigma-Aldrich A4926-1G chemicals for electrophysiological solutions
Accutase Sigma-Aldrich A6964-100ML  Cell dissociation reagent
anti-CHAT EMD Millipore  AB144P Anti-Choline Acetyltransferase. Primary antibody used in immunostaining assays. RRID: AB_2079751; Lot number: 2971003
anti-goat Alexa Fluor 488  Thermo Fisher Scientific  A11055 Secondary antibody used for immonofluorescence assays. RRID: AB_2534102; Lot number: 1915848
anti-mouse Alexa Fluor 647 Thermo Fisher Scientific  A31571 Secondary antibody used for immonofluorescence assays. RRID: AB_162542; Lot number: 1757130
anti-Oct4  BD Biosciences 611202 Primary antibody used in immunostaining assays. RRID: AB_398736; Lot number: 5233722
anti-Phox2b Santa Cruz Biotechnology, Inc. sc-376997 Primary antibody used in immunostaining assays. Lot number: E0117
anti-rabbit Alexa Fluor 594  Immunological Sciences IS-20152-1 Secondary antibody used for immonofluorescence assays
anti-TUJ1  Sigma-Aldrich  T2200 Primary antibody used in immunostaining assays. RRID: AB_262133
B27 Miltenyi Biotec 130-093-566 Serum free supplement for neuronal cell maintenance
Bambanker Nippon Genetics NGE-BB02 Cell freezing medium, used here for motor neuron progenitors
BDNF PreproTech 450-02 Brain-Derived Neurotrophic Factor
Blasticidin Sigma-Aldrich 203350 Nucleoside antibiotic that inhibits protein synthesis in prokaryotes and eukaryotes
BSA Sigma-Aldrich A2153 Bovine Serum Albumin. Blocking agent to prevent non-specific binding of antibodies in immunostaining assays
CaCl2 Sigma-Aldrich C3881 chemicals for electrophysiological solutions
Clampex 10 software Molecular Devices Clampex 10 Membrane currents recording system
Corning Matrigel hESC-qualified Matrix Corning 354277 Reconstituted basement membrane preparation from the Engelbreth-Holm-Swarm (EHS) mouse sarcoma. Used for adhesion of iPSC to plastic and glass supports
CRYOSTEM ACF FREEZING MEDIA Biological Industries 05-710-1E Freezing medium for human iPSCs
D-Glucose Sigma-Aldrich G5146 chemicals for electrophysiological solutions
DAPI powder Roche 10236276001 4′,6-diamidino-2-phenylindole. Fluorescent stain that binds to adenine–thymine rich regions in DNA used for nuclei staining in immonofluorescence assays
DAPT AdipoGen AG-CR1-0016-M005 Gamma secretase inhibitor
Dispase Gibco 17105-041 Reagent for gentle dissociation of human iPSCs
DMEM/F12 Sigma-Aldrich D6421-500ML Basal medium for cell culture
Doxycycline Sigma-Aldrich D9891-1G  Used to induce expression of transgenes from epB-Bsd-TT-NIL and epB-Bsd-TT-NIP vectors
DS2U  WiCell UWWC1-DS2U Commercial human iPSC line
E.Z.N.A Total RNA Kit  Omega bio-tek R6834-02 Kit for total extraction of RNA from cultured eukaryotic cells
GDNF PreproTech 450-10 Glial-Derived Neurotrophic Factor
Gibco Episomal hiPSC Line Thermo Fisher Scientific A18945 Commercial human iPSC line
Glutamax Thermo Fisher Scientific 35050038 An alternative to L-glutamine with increased stability. Improves cell health.
Hepes Sigma-Aldrich H4034 chemicals for electrophysiological solutions
iScript Reverse Transcription Supermix for RT-qPCR  Bio-Rad 1708841 Kit for gene expression analysis using real-time qPCR
iTaqTM Universal SYBR Green Supermix  Bio-Rad 172-5121  Ready-to-use reaction master mix optimized for dye-based quantitative PCR (qPCR) on any real-time PCR instrument
K-Gluconate Sigma-Aldrich G4500 chemicals for electrophysiological solutions
KCl Sigma-Aldrich P9333 chemicals for electrophysiological solutions
L-ascorbic acid LKT Laboratories A7210 Used in cell culture as an antioxidant
Laminin Sigma-Aldrich 11243217001 Promotes attachment and growth of neural cells in vitro
Laser scanning confocal microscope  Olympus  iX83 FluoView1200 Confocal microscope for acquisition of immunostaining images
Mg-ATP Sigma-Aldrich A9187 chemicals for electrophysiological solutions
MgCl2 Sigma-Aldrich M8266 chemicals for electrophysiological solutions
Mounting Medium  Ibidi 50001 Mounting solution used for confocal microscopy and immunofluorescence assays
Multiclamp patch-clamp amplifier Molecular Devices 700B Membrane currents recording system
Na-GTP Sigma-Aldrich G8877 chemicals for electrophysiological solutions
NaCl Sigma-Aldrich 71376 chemicals for electrophysiological solutions
NEAA Thermo Fisher Scientific 11140035 Non-Essential Amino Acids. Used as a supplement for cell culture medium, to increase cell growth and viability.
Neon 100 μL Kit Thermo Fisher Scientific MPK10096 Cell electroporation kit
Neon Transfection System Thermo Fisher Scientific MPK5000 Cell electroporation system
Neurobasal Medium Thermo Fisher Scientific 21103049 Basal medium designed for long-term maintenance and maturation of neuronal cell populations without the need for an astrocyte feeder layer
NutriStem-XF/FF  Biological Industries 05-100-1A Human iPSC culture medium
Paraformaldehyde Electron Microscopy Sciences 157-8 Used for cell fixation in immunostaining assays
PBS Sigma-Aldrich D8662-500ML Dulbecco's Phosphate Buffer Saline, with Calcium, with Magnesium
PBS Ca2+/Mg2+ free Sigma-Aldrich D8537-500ML Dulbecco's Phosphate Buffer Saline, w/o Calcium, w/o Magnesium
Penicillin/Streptomycin  Sigma-Aldrich P4333-100ML Penicillin/Streptomicin solution used to prevent cell culture contamination from bacteria.
poly-ornithine Sigma-Aldrich P4957 Promotes attachment and growth of neural cells in vitro
SU5402 Sigma-Aldrich SML0443-5MG Selective inhibitor of vascular endothelial growth factor receptor 2 (VEGFR-2)
Triton X-100  Sigma-Aldrich T8787 4-(1,1,3,3-Tetramethylbutyl)phenyl-polyethylene glycol, t-Octylphenoxypolyethoxyethanol, Polyethylene glycol tert-octylphenyl ether. Used for cell permeabilization in immunostaining assays
Upright microscope Olympus BX51VI Microscope for electrophysiological recording equipped with CoolSnap Myo camera 
Y-27632  (ROCK inhibitor) Enzo Life Sciences ALX-270-333-M005  Cell-permeable selective inhibitor of Rho-associated, coiled-coil containing protein kinase (ROCK). Increases iPSC survival
μ-Slide 8 Well  Ibidi 80826 Support for high–end microscopic analysis of fixed cells

DOWNLOAD MATERIALS LIST

References

  1. Dimos, J. T., et al. Induced Pluripotent Stem Cells Generated from Patients with ALS Can Be Differentiated into Motor Neurons. Science (New York, NY). 321, (5893), 1218 (2008).
  2. Ebert, A. D., et al. Induced pluripotent stem cells from a spinal muscular atrophy patient. Nature. 457, (7227), 277-280 (2009).
  3. Lenzi, J., et al. ALS mutant FUS proteins are recruited into stress granules in induced Pluripotent Stem Cells (iPSCs) derived motoneurons. Disease models & mechanisms. 8, (7), 755-766 (2015).
  4. Wijesekera, L. C., Leigh, P. N. Amyotrophic lateral sclerosis. Orphanet journal of rare diseases. 4, (3), 1-22 (2009).
  5. Yan, J., et al. Frameshift and novel mutations in FUS in familial amyotrophic lateral sclerosis and ALS/dementia. Neurology. 75, (9), 807-814 (2010).
  6. Boulting, G. L., et al. A functionally characterized test set of human induced pluripotent stem cells. Nature biotechnology. 29, (3), 279-286 (2011).
  7. Amoroso, M. W., et al. Accelerated high-yield generation of limb-innervating motor neurons from human stem cells. The Journal of neuroscience: the official journal of the Society for Neuroscience. 33, (2), 574-586 (2013).
  8. Maury, Y., et al. Combinatorial analysis of developmental cues efficiently converts human pluripotent stem cells into multiple neuronal subtypes. Nature biotechnology. 33, (1), 89-96 (2015).
  9. Allodi, I., et al. Differential neuronal vulnerability identifies IGF-2 as a protective factor in ALS. Scientific reports. 6, 25960 (2016).
  10. Kaplan, A., et al. Neuronal matrix metalloproteinase-9 is a determinant of selective neurodegeneration. Neuron. 81, (2), 333-348 (2014).
  11. Mazzoni, E. O., et al. Synergistic binding of transcription factors to cell-specific enhancers programs motor neuron identity. Nature neuroscience. 16, (9), 1219-1227 (2013).
  12. De Santis, R., Garone, M. G., Pagani, F., de Turris, V., Di Angelantonio, S., Rosa, A. Direct conversion of human pluripotent stem cells into cranial motor neurons using a piggyBac vector. Stem Cell Research. 29, 189-196 (2018).
  13. Yusa, K., Zhou, L., Li, M. A., Bradley, A., Craig, N. L. A hyperactive piggyBac transposase for mammalian applications. Proceedings of the National Academy of Sciences of the United States of America. 108, (4), 1531-1536 (2011).
  14. Sances, S., et al. Modeling ALS with motor neurons derived from human induced pluripotent stem cells. Nature Neuroscience. 16, (4), 542-553 (2016).
  15. Miller, J. D., et al. Human iPSC-based modeling of late-onset disease via progerin-induced aging. Cell stem cell. 13, (6), 691-705 (2013).
  16. Lenzi, J., et al. Differentiation of control and ALS mutant human iPSCs into functional skeletal muscle cells, a tool for the study of neuromuscolar diseases. Stem Cell Research. 17, (1), 140-147 (2016).
  17. Zhang, Y., et al. Rapid Single-Step Induction of Functional Neurons from Human Pluripotent Stem Cells. Neuron. 78, (5), 785-798 (2013).
  18. Theka, I., et al. Rapid generation of functional dopaminergic neurons from human induced pluripotent stem cells through a single-step procedure using cell lineage transcription factors. Stem cells translational medicine. 2, (6), 473-479 (2013).
  19. Pawlowski, M., et al. Inducible and Deterministic Forward Programming of Human Pluripotent Stem Cells into Neurons, Skeletal Myocytes, and Oligodendrocytes. Stem Cell Reports. 8, (4), 803-812 (2017).
  20. Li, X., et al. Fast Generation of Functional Subtype Astrocytes from Human Pluripotent Stem Cells. Stem Cell Reports. 11, (4), 998-1008 (2018).
  21. Nehme, R., et al. Combining NGN2 Programming with Developmental Patterning Generates Human Excitatory Neurons with NMDAR-Mediated Synaptic Transmission. Cell reports. 23, (8), 2509-2523 (2018).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics