निष्क्रिय एक्स गुणसूत्र पर Mecp2 के औषधीय पुनः सक्रियण के लिए एक गैर यादृच्छिक माउस मॉडल

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

यहां, हम एक प्रोटोकॉल का वर्णन करने के लिए गैर यादृच्छिक एक्स गुणसूत्र inactivation के साथ एक व्यवहार्य महिला murine मॉडल उत्पंन, अर्थात्, मातृत्व-वंशानुगत एक्स गुणसूत्र कोशिकाओं के १००% में निष्क्रिय है । हम भी एक प्रोटोकॉल का वर्णन करने के लिए व्यवहार्यता परीक्षण, सहनशीलता, और vivo में निष्क्रिय एक्स गुणसूत्र के औषधीय पुनः सक्रियण की सुरक्षा ।

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Przanowski, P., Zheng, Z., Wasko, U., Bhatnagar, S. A Non-random Mouse Model for Pharmacological Reactivation of Mecp2 on the Inactive X Chromosome. J. Vis. Exp. (147), e59449, doi:10.3791/59449 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

X गुणसूत्र निष्क्रियण (xci) लिंगों के बीच जीन खुराक संतुलन को प्राप्त करने के लिए महिलाओं में एक एक्स गुणसूत्र के यादृच्छिक मुंह बंद है । नतीजतन, सभी महिलाओं एक्स से जुड़े जीन अभिव्यक्ति के लिए विषमयुग्मज हैं । XCI के प्रमुख नियामकों में से एक Xciहै, जो दीक्षा और xci के रखरखाव के लिए आवश्यक है । पिछले अध्ययनों से 13 ट्रांस अभिनय एक्स गुणसूत्र inactivation कारक (XCIFs) एक बड़े पैमाने पर, समारोह आनुवंशिक स्क्रीन के नुकसान का उपयोग कर की पहचान की है । इस तरह के ACVR1 और PDPK1 के रूप में XCIFs, का निषेध, छोटी हेयरपिन आरएनए या छोटे अणु inhibition का उपयोग, सुसंस्कृत कोशिकाओं में एक्स गुणसूत्र से जुड़े जीन को सक्रिय करता है । लेकिन विवो में निष्क्रिय एक्स क्रोमोसोम को फिर से सक्रिय करने की व्यवहार्यता और सहनशीलता का निर्धारण किया जाना बाकी है । इस लक्ष्य की ओर, एक xistδ: Mecp2/xist: Mecp2-Gfp माउस मॉडल एक एक्स गुणसूत्र पर xist के विलोपन के कारण गैर यादृच्छिक xist के साथ उत्पंन किया गया है । इस मॉडल का उपयोग करना, निष्क्रिय एक्स रिनोवेशन की हद तक xcif inhibitors के साथ उपचार के बाद माउस मस्तिष्क में quantitated था । हाल ही में प्रकाशित परिणाम दिखाने के लिए, पहली बार के लिए, कि xcifs के औषधीय निषेध Mecp2 जीवित माउस मस्तिष्क के वल्कुट ंयूरॉंस में निष्क्रिय एक्स गुणसूत्र से पुनः सक्रिय ।

Introduction

एक्स क्रोमोसोम इनएक्टिवेशन (XCI) खुराक क्षतिपूर्ति की एक प्रक्रिया है जो एक्स-लिंक्ड जीन एक्सप्रेशन को महिलाओं में एक्स क्रोमोसोम की एक प्रति कोसाइलैंसिंग करके संतुलित करता है | एक परिणाम के रूप में, निष्क्रिय एक्स गुणसूत्र (Xi) में डीएनए मेथिलन और निरोधात्मक हिस्टोन संशोधनों, जैसे हिस्टोन H3-lysine 27 trimethylation (H3K27me3) और हिस्टोन H2A सर्वव्यापी (H2Aub) सहित विषमवर्णक की विशिष्ट सुविधाओं जमा 2. एक्स गुणसूत्र मुंह बंद के मास्टर नियामक एक्स-inactivation केंद्र (xic) क्षेत्र, लगभग 100 − 500 केबी, जो गिनती और एक्स क्रोमोसोम के युग्मन, inactivation के लिए एक्स गुणसूत्र के यादृच्छिक चयन को नियंत्रित करता है, और दीक्षा और 3क्रोमोसोम के साथ साइलैंसिंग का फैलाव. एक्स inactivation की प्रक्रिया एक्स निष्क्रिय विशिष्ट प्रतिलिपि (Xist) है कि सीआईएस में ग्यारहवीं कोट करने के लिए गुणसूत्र व्यापक मुंह में और फिर से तैयार की तीन आयामी संरचना एक्स गुणसूत्र4के द्वारा शुरू की है । हाल ही में, कई proteomic और आनुवंशिक स्क्रीन xci के अतिरिक्त नियामकों की पहचान की है, जैसे xci के रूप में बातचीत प्रोटीन5,6,7,8,9 , 10 , 11 , 12. उदाहरण के लिए, एक निष्पक्ष जीनोम व्यापक आरएनए हस्तक्षेप स्क्रीन का उपयोग कर पिछले एक अध्ययन 13 पारXci कारकों (xcifs)12की पहचान की । यंत्रवत्, XCIFs Xist अभिव्यक्ति को विनियमित और इसलिए, xci समारोह के साथ हस्तक्षेप दोषपूर्ण xसीआई12का कारण बनता है । साथ में, क्षेत्र में हाल ही में अग्रिमों आणविक मशीनरी है कि शुरू करने और XCI बनाए रखने के लिए आवश्यक है में महत्वपूर्ण अंतर्दृष्टि प्रदान की है ।

Xci नियामकों की पहचान और उनके तंत्र को समझना एक्स-लिंक्ड मानव रोगों, जैसे rett सिंड्रोम (rtt)13,14के लिए सीधे प्रासंगिक है । Rtt एक दुर्लभ neurodevelopmental विकार एक्स में एक विषम युग्मज उत्परिवर्तन की वजह से जुड़े methyl-cpg बाध्यकारी प्रोटीन 2 (MECP2) है कि मुख्य रूप से लड़कियों को प्रभावित करता है15MECP2 एक्स गुणसूत्र पर स्थित है, क्योंकि rtt लड़कियों ~ ५०% कोशिकाओं जंगली प्रकार व्यक्त करने और ~ ५०% उत्परिवर्ती MECP2व्यक्त करने के साथ MECP2 की कमी के लिए विषम युग्मज हैं । विशेष रूप से, RTT उत्परिवर्ती कोशिकाओं को ग्यारहवीं पर Mecp2 के एक निष्क्रिय लेकिन जंगली प्रकार की प्रतिलिपि, कार्यात्मक जीन है, जो अगर फिर से सक्रिय, संभवतः रोग के लक्षणों को कम कर सकता का एक स्रोत प्रदान हार्बर । RTT के अलावा, वहाँ रहे हैं कई अन्य एक्स से जुड़े मानव रोगों, जिसके लिए ग्यारहवीं के पुनः सक्रियण ऐसे DDX3X सिंड्रोम के रूप में एक संभावित चिकित्सीय दृष्टिकोण, का प्रतिनिधित्व करता है.

XCIFs का निषेध, 3-फ़ॉसफोनोसिटाइड आश्रित प्रोटीन kinase-1 (PDPK1), और activin एक रिसेप्टर प्रकार 1 (ACVR1), या तो शॉर्ट हेयरपिन आरएनए (एसएचएनए) या छोटे अणु निरोधक द्वारा, Xi-लिंक्ड जीन को पुनः सक्रिय करता है12. ग्यारहवीं से जुड़े जीन के औषधीय पुनः सक्रियण विभिन्न पूर्व vivo मॉडल है कि माउस फाइब्रोब्लास्ट सेल लाइनों, वयस्क माउस वल्कुट ंयूरॉंस, माउस भ्रूणीय रेशकोरक, और एक rtt रोगी12से व्युत्पंन फाइब्रोब्लास्ट सेल लाइनों को शामिल में मनाया जाता है । तथापि, क्या vivo में ग्यारहवीं से जुड़े जीन के औषधीय पुनर्सक्रियन संभव है कि प्रदर्शन किया जाना है । एक सीमित कारक प्रभावी पशु मॉडल की कमी को सही ढंग से पुनः सक्रिय ग्यारहवीं से जीन की अभिव्यक्ति को मापने के लिए है । इस लक्ष्य की ओर, एक xistδ: Mecp2/xist: Mecp2-gfp माउस मॉडल है कि ग्यारहवीं पर आनुवंशिक रूप से लेबल Mecp2 xist में मातृक एक्स गुणसूत्र16पर विषम युग्मज विलोपन के कारण सभी कोशिकाओं में किया जाता है । इस मॉडल का उपयोग करना, ग्यारहवीं से Mecp2 की अभिव्यक्ति जीवित चूहों के मस्तिष्क में XCIFs inhibitors के साथ उपचार के बाद quantitated किया गया है. यहाँ, xistδ की पीढ़ी : Mecp2/xist: Mecp2-gfp माउस मॉडल और विधि immunofluorescence-आधारित assays हैं का उपयोग कर वल्कुट ंयूरॉंस में quantitate ग्यारहवीं रिनोवेशन करने के लिए वर्णित है ।

Subscription Required. Please recommend JoVE to your librarian.

Protocol

चूहों से जुड़े कार्य को वर्जीनिया इंस्टीट्यूशनल एनिमल केयर एंड यूज कमेटी (IACUC; #4112) द्वारा अनुमोदित किया गया ।

1. उत्पंन एक गैर यादृच्छिक XCI माउस मॉडल के साथ आनुवंशिक रूप से लेबल Mecp2 पर ग्यारहवीं

नोट: अध्ययन में प्रयुक्त माउस उपभेदों इस प्रकार थे: Mecp2-gfp/Mecp2-gfp (Mecp2tm 3.1 बर्ड, सामग्री की तालिका) और xist/δxist (B6; 129-xist < tm5Sado >; द्वारा प्रदान की गई एंटोनियो bedalov, फ्रेड हचिंसन कैंसर केंद्र, सिएटल) । संबंधित उपभेदों के बीच प्रजनन रणनीतियों के लिए प्रत्येक तनाव के लिए माउस कालोनियों का विस्तार करने के लिए डिजाइन किया गया है ।

  1. तालिका 1में सूचीबद्ध जीन विशिष्ट प्राइमर्स का उपयोग करके प्रजनन के बाद प्राप्त सभी चूहों उपभेदों और संबंधित संतति पर पीसीआर-genotyping प्रदर्शन ।

2. डिजाइन माउस प्रजनन रणनीति Xistδ उत्पंन करने के लिए : Mecp2/

  1. एक Mecp2-Gfp/Y पुरुष और एक XistΔ-Mecp2/Xist-Mecp2 महिला को एक साथ आवास द्वारा एक प्रजनन जोड़ी सेट (12 एच/ आदर्श रूप में, व्यावहारिक और उपजाऊ चूहों का उपयोग कर एक समय में कम से 5 प्रजनन जोड़े की स्थापना की । गर्भवती महिला के बाद जंम देता है, उसे पुरुष के साथ अपने पहले कूड़े को बढ़ाने के लिए अनुमति देते हैं ।
    नोट: क्योंकि पैतृक Xist पीटा IMPAIRS xist, खुराक मुआवजा, और भेदभाव रास्तों17, प्रजनन में xistδ-Mecp2/Y चूहों के उपयोग के लिए आवश्यक जीनोटाइप के साथ मादा पिल्ले का उत्पादन विफल हो जाएगा ।
  2. बाद के जंम के दिन 21 (P21) में कूड़े को प्रातः, पहचान और xistδ टैग: Mecp2 xist: Mecp2-gfp महिला पिल्ले एक पीसीआर आधारित जीनोटाइपिंग परख (चित्र 1b) का उपयोग कर ।
    नोट: प्रति समूह की जरूरत जानवरों की संख्या के संदर्भ में, नीचे की रिपोर्ट के परिणाम के लिए, 5 प्रजनन जोड़े जो लगभग 10 महिला Xistδ उत्पंन किया गया : Mecp2/
  3. सभी प्रस्तावित प्रयोगों के लिए महिला माउस मॉडल का उपयोग करें ।
    नोट: सेक्स XCI अध्ययन के लिए एक महत्वपूर्ण जैविक चर है, और पुरुष मॉडल यादृच्छिक XCI के confounding प्रभाव के लिए खाता नहीं है ।
  4. पशु अध्ययन भर में संगत हो और पशु उम्र के किसी भी प्रभाव बाहर नियम, 5 − 8 सप्ताह की उम्र की महिला Xistδ में सभी प्रयोगों प्रदर्शन : Mecp2/Xist: Mecp2-Gfp चूहों.

3. अलग महिला xistδ: Mecp2/Xist: Mecp2-Gfp माउस भ्रूणीय फाइब्रोब्लास्ट (mefs)

  1. Mecp2-Gfp/Y पुरुष और xistδ-Mecp2/Xist-Mecp2 महिला के बीच समयबद्ध संभोग सेट करें । गर्भावस्था की संभावना को बढ़ाने के लिए कम से 3 − 4 संभोग पिंजरों की स्थापना करें ।
  2. संभोग के बाद सुबह योनि प्लग की पुष्टि के बाद, अलग महिला और इस दिन भ्रूणीय दिवस ०.५ (E 0.5) माना जाता है । भावी गर्भवती महिला के वजन की निगरानी और नेत्रहीन गर्भावस्था की पुष्टि के लिए चूहों के पेट का निरीक्षण किया । E 14.5 − 15.5 पर, सर्विकल च्युइंगम के माध्यम से गर्भवती मादा चूहों को euthanize ।
  3. एक स्तरीय हुड के तहत, ७०% इथेनॉल के साथ गर्भवती महिला के पेट पोंछ । बाँझ कैंची का उपयोग, उदर गुहा काटना और भ्रूण युक्त गर्भाशय सींग हटा दें । संदंश का उपयोग करते हुए, पेट के बचे हुए ऊतकों को काटते समय भ्रूण को धीरे से बाहर निकालिए (6 − 12 भ्रूणों की अपेक्षा आमतौर पर होती है) ।
  4. 10 एमएम के टिश्यू-कल्चर डिश में भ्रूण वाले गर्भाशय सीन्स रखें । बाँझ कैंची और संदंश का उपयोग कर, गर्भाशय के सींग के साथ एक चीरा बनाने के लिए व्यक्तिगत sacs एक भ्रूण ले जाने को अलग करने के लिए । ध्यान से, गर्भाशय के सींग रखें जिसमें भ्रूण के शेष भाग को 30 मिलीलीटर बाँझ हैंक्स के संतुलित लवण विलयन (HBSS) में बर्फ पर रख दें ।
  5. धीरे से थैली खुला काट और बाँझ कैंची और संदंश का उपयोग कर भ्रूण को अलग । नाल को काटकर नाल निकाल लें ।
  6. भ्रूण का सिर काटना ।
    नोट: जबकि भ्रूणीय ऊतक के बाकी आगे संसाधित किया जाएगा, भ्रूण सिर से ऊतक genotyping के लिए डीएनए को अलग करने के लिए इस्तेमाल किया जाएगा ।
  7. बाँझ कैंची और संदंश का उपयोग करके भ्रूण की मध्यरेखा को काटकर उदर को खोलें । आंत अंगों, जैसे दिल, जिगर, और फेफड़ों को हटा दें ।
  8. एक बाँझ ६० mm ऊतक-संस्कृति प्लेट में शेष भ्रूण ऊतक हस्तांतरण और कैंची या एक उस्तरा ब्लेड का उपयोग कर छोटे टुकड़ों में कटौती । सेल clumps खुला तोड़ने के लिए, trypsin के 3 मिलीलीटर जोड़ें-EDTA (०.०५%) और 15 मिनट के लिए ३७ ° c पर सेते ।
  9. Trypsin-EDTA को 10% भ्रूण गोजातीय सीरम (FBS) और 10 μg/mL पेनिसिलिन/स्ट्रेप्टोमाइसिन (पेन/स्ट्रेप) के साथ Dulbecco के मोडिफाइड ईगल मीडियम (डीएमईएम) के 5 मिलीलीटर को जोड़कर बेअसर कर देते हैं
  10. 5 मिनट के लिए ३०० एक्स जी में कोशिकाओं नीचे स्पिन और फिर से निलंबित 10% fbs और 10 μg के साथ dmem के 4 मिलीलीटर में सेल गोली/ एक ६० मिमी संस्कृति पकवान पर कोशिकाओं को थाली, और संस्कृति ३७ डिग्री सेल्सियस पर 5% CO2की उपस्थिति में कोशिकाओं ।
  11. प्रत्येक भ्रूण के लिए 3.5 − 3.10 चरण पूरा करना ।
  12. संस्कृति MEFs के लिए कदम ३.११ में प्राप्त की ंयूनतम 3 − 4 दिन ।
    नोट: इस स्तर पर, MEFs भी भविष्य के प्रयोगों के लिए cryopreserved जा सकता है.
  13. प्रत्येक भ्रूण के लिंग और जीनोटाइप को निर्धारित करने के लिए, जीनोटाइप-पीसीआर एक तालिकामें सूचीबद्ध प्राइमरों और पीसीआर शर्तों का उपयोग कर भ्रूण के सिर से अलग डीएनए का उपयोग कर बाहर ले ।

4. Xistδ के मस्तिष्क में ग्रीन फ्लोरोसेंट प्रोटीन (GFP) अभिव्यक्ति की कमी की पुष्टि : Mecp2/Mecp2-gfp एक Ffluorescence सक्रिय का उपयोग कर चूहों सेल छंटाई आधारित परख

  1. कैंची का प्रयोग, मस्तिष्क गोलार्द्धों के आराम से सेरेब्रल प्रांतस्था अलग, और बर्फ की 1 मिलीलीटर में जगह ठंड नाभिक अलगाव मीडिया (nim) २५० मिमी sucrose युक्त बफर, 25 मिमी पोटेशियम क्लोराइड (kcl), 5 मिमी मैग्नीशियम क्लोराइड (mgcl2), 10 मिमी Tris-Cl, 2% पैराफॉर्मैल्डिहाइड (पीएफए), और ०.१% nonionic सर्फेक्टेंट (सामग्री तालिका) के साथ पूरक ।
  2. एक आइस-कोल्ड ग्लास homogenize का उपयोग homogenize ।
  3. 5 मिनट के लिए ६०० x g, 4 ° c पर homogenized ऊतक नीचे स्पिन ।
  4. NIM समाधान में 25% iodixanol के 1 मिलीलीटर में supernatant और फिर से निलंबित गोली निकालें ।
  5. NIM समाधान में एक 4 मिलीलीटर ultracentrifuge ट्यूब के लिए 29% lodixanol के 1 मिलीलीटर जोड़ें (नमूने तैयार कर रहे हैं जब तक बर्फ पर दुकान) और ध्यान से नमूना के 1 मिलीलीटर परत (में 25% lodixanol).
  6. ९,००० x gपर अपकेंद्रित्र, एक ultracentrifuge में 10 मिनट के लिए 4 ° c ।
  7. महाप्राण अधिजायाकार और ५०० μl फ्लोरेसेंस सक्रिय सेल सॉर्टिंग (facs) बफर (फॉस्फेट-buffered खारा [pbs] में 1 मिमी edta, ०.०५% सोडियम azide, और 2% गोजातीय सीरम एल्बुमिन [BSA]) के साथ पूरक गोली ।
    नोट: नमूनों को 4 डिग्री सेल्सियस या 1 सप्ताह तक संग्रहित किया जा सकता है ।
  8. कमरे के तापमान पर 5 मिनट के लिए 7-अमीनो-ऐक्टिनोमाइसिन डी (7-AAD; ५० मिलीग्राम/एमएल) के 5 μL जोड़ें डीएनए दाग करने के लिए ।
  9. 7 के लिए नमूनों का विश्लेषण-AAD और हरी फ्लोरोसेंट प्रोटीन (GFP) प्रवाह कोशिका मिति का उपयोग कर संकेत ।

5. Xistδ की व्यवहार्यता का निर्धारण : Mecp2/Xist: Mecp2-Gfp माउस मॉडल Xi पुनः सक्रियण के लिए

  1. बीज 1 x 105 कोशिकाओं/एमएल महिला xistδ: Mecp2/Xist: Mecp2-gfp mefs, Mecp2/Mecp2-gfp और xist-Mecp2 ३७ ३.१२/ 5% सीओ2की उपस्थिति ।
    नोट: Mecp2/Mecp2-जीएफपी और Xist-Mecp2/Y mefs प्रयोग में सकारात्मक और नकारात्मक नियंत्रण के रूप में उपयोग किया जाता है ।
  2. 24 घंटे के बाद कोशिकाओं के लिए ताजा माध्यम जोड़ें । Xistδ के लिए : Mecp2/Xist: Mecp2-Gfp Mefs, XCIFs inhibitors (जैसे, ०.५ ΜM LDN193189 और २.५ ΜM GSK650394), या अकेले वाहन के साथ पूरक मध्यम जोड़ें । बदलें मध्यम ताजा अवरोध करनेवाला या अकेले वाहन हर 2 दिनों के साथ पूरक । Mecp2/Mecp2-Gfp और Xist-Mecp2/Y mefs के लिए, हर 2 दिनों में ताजा माध्यम जोड़ें ।
  3. पोस्ट 1 अवरोध करनेवाला उपचार के सप्ताह, या तो आरएनए अलगाव के लिए फसल mefs (6-खैर प्लेट) या इम्यूनोफ्लोरेसेंस के लिए कोशिकाओं को ठीक (चैंबर स्लाइड). Mecp2/Mecp2-Gfp भ्रूणों से अलग mefs का प्रयोग करें सकारात्मक और Xist-Mecp2/
    1. आर. एन. ए अलगाव के लिए, एक अलग कुल आरएनए guanidinium thiocyanate द्वारा आधारित आरएनए निष्कर्षण अभिकर्मक, और रिवर्स ट्रांसक्रिप्टेस का उपयोग कर उल्टा प्रतिकरण । Mecp2-wt और Mecp2-gfp का उपयोग करके मात्रात्मक रिवर्स ट्रांसक्रिप्टेस-पीसीआर (क्यूआरटी-पीसीआर) द्वारा Mecp2-gfp अभिव्यक्ति को मापने, और पहले12वर्णित के रूप में तालिका 1में सूचीबद्ध प्राइमरों ।
    2. Immunofluorescence के लिए, एक विरोधी gfp प्राथमिक एंटीबॉडी (1:100) के साथ दाग mefs, के रूप में पहले वर्णित12,16. Xistδ: Mecp2/xist: Mecp2-gfp mefs, के रूप में पहले18वर्णित दवा में मात्रात्मक इम्यूनोफ्लोरेसेंस द्वारा gfp तीव्रता को मापने ।

6. Xistδ के मस्तिष्क में औषधीय ग्यारहवीं पुनः सक्रियण प्रदर्शन : Mecp2/Xist: Mecp2-Gfp माउस मॉडल

  1. ड्रग्स और वाहन नियंत्रण तैयार करते हैं ।
    1. मस्तिष्क के इंजेक्शन के लिए वाहन का एक ताजा, बाँझ समाधान (०.९% NaCl, ०.५% methylसेलुलोस, ४.५% डाइमेथिल सल्फॉक्साइड [DMSO]) तैयार करें ।
    2. १.५ मिमी LDN193189 (छोटे अणु अवरोध करनेवाला ACVR1) और १.६ मिमी GSK650394 (SGK1 के छोटे अणु अवरोध करनेवाला, PDPK1 का एक बहाव effector) वाहन में पुन: निलंबित सहित रासायनिक अवरोधकों तैयार (०.९% NaCl, ०.५% methylसेलुलोस, ४.५% DMSO) या वाहन अकेले. रासायनिक अवरोधकों या वाहन इंजेक्शन की कुल मात्रा प्रति पशु 10 μL प्रति खुराक है ।
  2. मस्तिष्क इंजेक्शन के लिए पशु तैयार ।
    1. पीठ पोंछते और कीटाणुनाशक (10% सोडियम हाइपोक्लोराइट समाधान) के साथ पैड हीटिंग द्वारा सर्जिकल क्षेत्र तैयार ।
    2. 4 सप्ताह पुराने माउस का एक intraperitoneal इंजेक्शन ketamine/xylazine मिश्रण की एक खुराक में क्रमशः १४० मिलीग्राम/किलो और 10 मिलीग्राम/ , संज्ञाहरण के स्तर को निर्धारित करने के लिए पेडल निकासी पलटा का उपयोग करें ।
    3. कॉर्निया सुखाने को रोकने के लिए संज्ञाहरण की प्रेरण के बाद आँखों पर नेत्र मरहम लगाएं ।
    4. गर्दन से फर को चूहे के सिर के ऊपर से शेव करें ।
    5. स्टीरियोटैक्टिक प्लेटफ़ॉर्म में माउस के छेदक दांतों को थूंआउट निरोधक के काटने के बार में दबाकर रखना और यह सुनिश्चित करते हुए कि माउस का सिर समतल तल पर है, नाक पर शिकंजा कसना ।
    6. कान सलाखों की ऊंचाई समायोजित करें, आवश्यक के रूप में, कान नहर के पुच्छल भाग तक पहुंचने के लिए, उंहें इस तरह की है कि माउस के सिर एक स्तर के विमान में है और उंगली छूने पर immobilized सुरक्षित ।
    7. एक सामयिक एंटीसेप्टिक, जैसे पोविडन आयोडीन और ७०% इथेनॉल की बारी पोंछे के साथ माउस के सिर कीटाणुरहित ।
  3. ड्रग्स प्रशासन ।
    1. एक बाँझ स्केलपेल का उपयोग करना, मध्य खोपड़ी में एक ०.७५ सेमी क्षैतिज चीरा ।
    2. एक ०.४५ mm burr का उपयोग करना, सही और बाएं वल्कुट गोलार्द्धों के ऊपर दो सममित छेद ड्रिल (2 मितली सीवन से मिमी और lambdoid सीवन से 2 मिमी, पार्श्विका हड्डी के लगभग मध्य).
    3. स्टीरियोटैक्टिक प्लैटफॉर्म पर 10 μL सिरिंज को मजबूती से अटैच करें ।
    4. रासायनिक अवरोधकों के समाधान मिश्रण है, और सिरिंज में समाधान के 10 μL आकर्षित । सिरिंज में किसी भी हवा के बुलबुले से बचें ।
    5. गड़गड़ाहट छेद में सिरिंज सुई अग्रिम सुई सीधा (९० °) खोपड़ी को बनाए रखने । जब सुई खोपड़ी traverses, स्टीरियोटैक्टिक डिजिटल डिस्प्ले पर निर्देशांक बाहर शूंय और फिर सुई की नोक अग्रिम जब तक यह २.५ mm की गहराई तक पहुंचता है ।
    6. 2 मिमी के लिए गहराई के लिए सुई ०.५ mm वापस लेने ।
    7. धीरे से समाधान के 10 μL इंजेक्ट (~ 1 मिनट) । इंजेक्शन के पूरा होने के बाद, ~ 1 मिनट के लिए मस्तिष्क में सुई छोड़ दो और फिर सुई वापस ले ।
    8. दूसरा गोलार्द्ध के लिए इंजेक्शन दोहराएं (वाहन ही नियंत्रण) ।
    9. टांके का उपयोग या "त्वचा गोंद" बंद माउस की त्वचा (यदि घाव > 0.5 सेमी दोनों टांके और "त्वचा गोंद" इस्तेमाल किया जाना चाहिए) ।
    10. कान बार ढीला और स्टीरियोटैक्टिक उपकरण से माउस को हटा दें ।
    11. दर्दनाशक दवाओं (buprenorphine SR ०.५ मिलीग्राम/किलो आईपी) प्रशासन और एक हीटिंग पैड पर माउस प्लेस ३७ ° c करने के लिए सेट जब तक पशु चेतना आएगा ।
    12. एक बार माउस सतर्क और उत्तरदायी है, जानवर अपने मूल पिंजरे में वापस हस्तांतरण ।
    13. 20 दिन के लिए हर 2 दिन में प्रक्रिया दोहराएं । क्षेत्र की पुनरावृत्ति ड्रिलिंग बाद में इंजेक्शन के लिए आवश्यक नहीं है ।
  4. माउस मस्तिष्क को अलग ।
    1. एक बार खुराक आहार पूरा हो गया है, एक CO2 कक्ष में माउस euthanize.
    2. सुई का उपयोग कर एक सतह पर माउस immobilize ।
    3. बस कैंची और संदंश का उपयोग कर रिब पिंजरे के नीचे अध्यावरण और पेट की दीवार के माध्यम से एक पार्श्व चीरा बनाओ । ध्यान से जिगर डायाफ्राम से अलग ।
    4. कैंची का प्रयोग, डायाफ्राम काट और रिब पिंजरे की पूरी लंबाई के साथ काटने के लिए फुफ्फुस गुहा का पर्दाफाश जारी है ।
    5. कैंची का प्रयोग, बाईं वेंट्रिकल के पीछे के अंत करने के लिए एक चीरा बनाते हैं ।
    6. तुरंत, ~ 2 मिनट से अधिक PBS के ~ 15 मिलीलीटर के साथ सही दिल के चैंबर इंजेक्शन शुरू करते हैं । लिवर का रंग लाल से पीला गुलाबी करने के लिए परिवर्तन अच्छा छिड़काव का संकेत है ।
    7. ~ 2 मिनट से अधिक PBS में 4% paraformaldehyde के ~ 10 मिलीलीटर के साथ माउस दिल के सही चैंबर सुई ।
    8. माउस को काटना, और कैंची खोपड़ी का पर्दाफाश करने के लिए खोपड़ी का एक मिडलाइन चीरा बनाने के लिए उपयोग करें ।
    9. कैंची के फोरमेन मैग्नम में एक टिप रखें, और आंख की ओर खोपड़ी में laterally कट । दूसरे पक्ष के लिए दोहराएं । कोशिश करें कि दिमाग की चोट से बचने के लिए कैंची के सिरे को जितना हो सके सतही रखें ।
    10. कैंची का प्रयोग आंखों के बीच और चूहे की नाक के ऊपर के क्षेत्र को काटने के लिए करें ।
    11. संदंश का उपयोग करने के लिए धीरे मस्तिष्क गोलार्द्धों से कपाल हड्डियों को छील ।
    12. मस्तिष्क को एक स्पैटिला से उठाएं, और कैंची का उपयोग सावधानीपूर्वक कपाल तंत्रिका तंतुओं के टुकड़े-टुकड़े करने के लिए करें जो इसे खोपड़ी में ठीक कर देते हैं ।
    13. एक प्लास्टिक की डिश पर मस्तिष्क प्लेस, बाहर सेरिबैलम और घ्राण बल्ब काट, और एक 15 मिलीलीटर 4% के साथ भरा ट्यूब पीबीएस है में मस्तिष्क जगह ।
  5. Cryo-अनुभाग माउस मस्तिष्क.
    1. PBS में 4% पैराफॉर्मलेडिहाइड में मस्तिष्क को 4 ° c रात में ठीक करें ।
    2. 4 डिग्री सेल्सियस पर PBS के साथ मस्तिष्क कुल्ला 5 प्रत्येक के लिए ंयूनतम 3x ।
    3. डिस्पोजेबल molds के ऊतकों cryopशिक्षाप्रद के लिए लेबल ।
    4. कैंची और संदंश का उपयोग कर मस्तिष्क के सामने कट (इंजेक्शन साइटों से ~ 5 मिमी वर्गों बनाने शुरू).
    5. मस्तिष्क के सामने से नीचे का सामना करना पड़ करने के लिए किरीटी वर्गों प्राप्त करने के साथ cryomold करने के लिए दिमाग हस्तांतरण । इष्टतम काटने तापमान यौगिक (अक्टूबर) में मस्तिष्क युक्त मोल्ड submerge.
    6. लिक्विड नाइट्रोजन को 10 एमएम प्लास्टिक पेट्री डिश में डालें और ब्रेन को क्रायो-मोल्ड में नाइट्रोजन में रखें ।
      नोट: यह मस्तिष्क के परिच्छेदन मार्गदर्शन करने के लिए कदम 6.5.5 में वर्णित के रूप में ऊतक उन्मुख करने के लिए महत्वपूर्ण है.
    7. जब अक्टूबर ठोस सफेद है, भंडारण के लिए एक-८० ° c फ्रीजर में जमे हुए मस्तिष्क जगह है ।
    8. मस्तिष्क के लिए-20 डिग्री सेल्सियस cryostat और cryostat (5 − 6 μm मोटाई) मस्तिष्क के साथ परिच्छेदन करने से पहले न्यूनतम 30 मिनट के लिए equilibrate, 2 − 3 खंडों प्रति स्लाइड बढ़ते । स्लाइड्स को बाद में उपयोग के लिए-८० ° c पर संग्रहित किया जा सकता है ।
  6. एक इम्यूनोफ्लोरेसेंस-आधारित प्रकिया का उपयोग करते हुए ग्यारहवीं पुनः सक्रियण निर्धारित करें ।
    1. धुंधला प्रक्रिया शुरू करने से पहले, 4 डिग्री सेल्सियस पर रात भर मस्तिष्क वर्गों सूखी ।
    2. प्रतिजन पुनर्प्राप्ति समाधान में स्लाइड्स विसर्जित (०.१ एम साइट्रिक एसिड, ०.१ मीटर Tris-आधार, पीएच = ६.०) एक १०० ° c हीट ब्लॉक पर 5 मिनट के लिए ।
    3. 5 मिनट के लिए प्रत्येक कमरे के तापमान पर 1x PBS के साथ स्लाइड 4x धोएं ।
    4. कमरे के तापमान पर 20 मिनट के लिए अवरुद्ध समाधान में स्लाइड्स विसर्जित (०.१ M NH4CL/pbs/0.2% जिलेटिन/0.05% nonionic सर्फेक्टेंट) ।
    5. वॉश बफर के साथ 3x स्लाइड्स (PBS/0.2% जिलेटिन) को 5 मिनट के लिए कमरे के तापमान पर धोएं ।
    6. विरोधी के साथ मस्तिष्क वर्गों दाग GFP-AlexaFluor647 (1:100) और विरोधी MAP2 (1:1000) ऊष्मायन मध्यम में एंटीबॉडी (PBS/
    7. प्राथमिक एंटीबॉडी इकट्ठा (reused किया जा सकता है) । कमरे के तापमान पर 30 मिनट की कुल के लिए वॉश बफर के साथ स्लाइड्स को धोएं ।
    8. बकरी के साथ मस्तिष्क वर्गों को सेते हैं एंटी-चिकन फ्लूएसेइन आइसोथियोसायनेट (FITC)-ऊष्मायन माध्यम में माध्यमिक एंटीबॉडी (1:1000) लेबल और अंधेरे में कमरे के तापमान पर 1 − 2 घंटे क्यूबेट ।
    9. कमरे के तापमान पर 30 मिनट की कुल के लिए वॉश बफर के साथ स्लाइड्स को धोएं ।
    10. एक 22 मिमी x ५० मिमी coverslip पर 4 ′, 6-diamidino-2-phenylindole (DAPI) के साथ बढ़ते मध्यम की एक बूंद प्लेस, तो सभी ऊतक वर्गों को कवर, एक स्लाइड पर coverslip पलटो ।
    11. एक खुर्दबीन पर छवि और कंट्रास्ट और चमक के लिए छवियों को समायोजित । छवियों पर कब्जा और दोनों दवा का इलाज और वाहन इलाज Xistδ के लिए GFP-सकारात्मक कोशिकाओं की संख्या मात्रा ठहराना : Mecp2/Xist: Mecp2-gfp माउस मस्तिष्क गोलार्द्धों ।

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Xistδ की व्यवहार्यता का प्रदर्शन करने के लिए : Mecp2/Xist: Mecp2-gfp माउस मॉडल ग्यारहवीं पुनः सक्रियण अध्ययन के लिए, XCIF अवरोध करनेवाला-ग्यारहवीं से जुड़े Mecp2 के mediated पुनः सक्रियण -gfp माउस भ्रूणीय फाइब्रोब्लास्ट (mefs) में परीक्षण किया गया था । महिला MEFs दिन से अलग थे १५.५ xistδ: Mecp2/Xist: Mecp2-Gfp भ्रूण खंड 3 में वर्णित के रूप में (चित्र 1a) । महिला xistδ के जीनोटाइप : Mecp2/xist: Mecp2-gfp mefs जीनोटाइप द्वारा पुष्टि की गई-पीसीआर, के रूप में पहले से19 वर्णित (चित्र 1b), और facs आधारित परख (चित्रा 1 सी) । MEFs या तो DMSO या दो दवाओं के साथ इलाज किया गया LDN193189 और GSK650394 (०.५ μM और २.५ μM, क्रमशः) 7 दिनों के लिए । औषध उपचार के बाद, Mecp2-जीएफपी की अभिव्यक्ति की निगरानी क्यूआरटी-पीसीआर द्वारा की गई थी । के रूप में चित्र 1D, दवा उपचार में दिखाया गया है, लेकिन dmso नहीं, ग्यारहवीं की अभिव्यक्ति-Mecp2-gfp पुनः सक्रिय । आगे, मात्रात्मक इम्यूनोफ्लोरेसेंस, चरण 5.3.2 में वर्णित के रूप में, व्यक्तिगत MEFs में Xi-Mecp2-Gfp अभिव्यक्ति की सीमा निर्धारित करने के लिए किया गया था । नकारात्मक से संकेत नियंत्रण MEFs पुरुष भ्रूण से अलग (Mecp2/Y) पृष्ठभूमि के रूप में स्थापित किया गया था, और ~ सकारात्मक नियंत्रण के ६६% Mecp2-Gfp/Mecp2 MEFS एक परमाणु gfp संकेत था । के रूप में की उंमीद थी, xistδ: Mecp2/Xist: Mecp2-gfp MEFS dmso के साथ इलाज परमाणु gfp का एक बहुत कम स्तर (~ 3%) । इसके विपरीत, ~ दवा के 31% का इलाज xistδ: Mecp2/Xist: Mecp2 mefs परमाणु gfp के लिए सकारात्मक थे (चित्रा 1e) । एक साथ, इन परिणामों को प्रदर्शित करता है कि xcif inhibitors xi-जुड़े Mecp2 mefs में पुनः सक्रिय, लेकिन ग्यारहवीं रिनोवेशन की सीमा सेल आबादी में बदलता रहता है.

को vivo में औषधीय ग्यारहवीं reactivation आधारित दृष्टिकोण की व्यवहार्यता का आकलन करने के लिए, क्या दवा उपचार Xistδ के मस्तिष्क में ग्यारहवीं से जुड़े Mecp2 को पुनः सक्रिय : Mecp2/ वाहन के 10 μL या XCIF inhibitors के 10 μL (१.५ mM LDN193189 and १.६ mM GSK650394) विपरीत मस्तिष्क गोलार्द्धों में प्रशासित किया गया था 4-सप्ताह के पुराने ग्यारहवीं-Mecp2-Gfp महिला चूहों intracerebroventricular इंजेक्शन द्वारा स्टीरियोटैक्टिक सर्जिकल प्रक्रियाओं का उपयोग करके ( चित्र 2a , ख) । प्रक्रिया हर दूसरे दिन दोहराया गया था (चित्र 2c), और तीन हफ्ते बाद, पशुओं euthanized थे, और दिमाग अलग थे । एक सबसेट का इस्तेमाल क्यूआरटी-पीसीआर के लिए किया गया और दूसरा इम्यूनोहिस्टोकेमिस्ट्री द्वारा विश्लेषण किया गया । वाहन और नशीली दवाओं के संचार गोलार्द्धों में वाइल्ड-टाइप Mecp2 और Xi-Mecp2-gfp की अभिव्यक्ति का निर्धारण क्यूआरटी-पीसीआर ( तालिका 1में सूचीबद्ध प्राइमरों के दृश्यों) द्वारा किया गया था । के रूप में चित्रा 2dमें दिखाया गया है, दवा उपचार में ग्यारहवीं-Mecp2-gfp पुनः सक्रिय दवा में कोशिकाओं के ~ 30% मस्तिष्क गोलार्द्ध संचार, जबकि ग्यारहवीं- Mecp2-gfp वाहन में पाया नहीं था-संचार गोलार्द्ध । MAP2, एक न्यूरोनल मार्कर, सकारात्मक ंयूरॉंस की एक बड़ी संख्या में भी थे gfp सकारात्मक (~ ४५%) दवा में इलाज गोलार्द्ध, ग्यारहवीं-Mecp2-Gfp अभिव्यक्ति का संकेत है. MAP2 नकारात्मक मस्तिष्क कोशिकाओं के लगभग 20% GFP व्यक्त की, गैर neuronal कोशिकाओं में ग्यारहवीं-Mecp2-gfp पुनः सक्रियण की पुष्टि (चित्रा 2e) ।

Figure 1
चित्र 1: जनरेशन और मांयता Xi-Mecp2 माउस मॉडल । () xistδ उत्पादन के लिए प्रजनन कार्यनीति की योजनाबद्ध Mecp2/xist: Mecp2-जीएफपी चूहे । () एक्सएसटी का पीसीआर जीनोटाइपिंग : Mecp2-जीएफपी/वाई, xistδ: Mecp2/Xist: Mecp2 और Xistδ: Mecp2/xist: Mecp2-gfp चूहे । चूहों Mecp2-जीएफपी, Mecp2 और लिंग निर्धारण क्षेत्र Y (एसआरके) की उपस्थिति के लिएनिगरानी की गई । () नाभिक का प्रवाह कोशिकामिति विश्लेषण जो माउस प्रांतस्था से पृथक होता है । Mecp2/Mecp2-gfp माउस प्रांतस्था दिखाएं ~ जीएफपी-पॉजिटिव नाभिक का ५०% जबकि xistδ: Mecp2/Xist: Mecp2-GFP कोई gfp पॉजिटिव नाभिक से पता चलता है । () क्यूआरटी-पीसीआर विश्लेषण महिला Xistδ में Mecp2-जीएफपी और वाइल्ड-टाइप Mecp2 ट्रांस्क्रिप्ट की अभिव्यक्ति की निगरानी कर रहा है : Mecp2/xist: MECP2-gfp mefs डीएमएसओ या दवा (LDN193189 और GSK650394) के साथ उपचार । Gapdh एक लोडिंग नियंत्रण के रूप में निगरानी की गई थी । () मात्रात्मक प्रतिरक्षा प्रतिदीप्ति महिला xistδ में जीएफपी तीव्रता की मानीटरिंग Mecp2/Xist: Mecp2-जीएफपी एमईएफएस डीएमएसओ या औषध LDN193189 और GSK650394 के साथ निम्नलिखित उपचार । Mecp2/Y या Mecp2/Mecp2-gfp चूहों से अलग mefs क्रमशः नकारात्मक और सकारात्मक नियंत्रण के रूप में इस्तेमाल किया गया था । प्रत्येक डॉट एक MEF का प्रतिनिधित्व करता है, और डैश्ड रेखा अधिकतम पृष्ठभूमि संकेत Mecp2/Y, जो 1 के लिए सेट किया गया था में प्राप्त इंगित करता है । लोअर पैनल नाभिक की प्रतिनिधि तस्वीरें दिखाता है. यह आंकड़ा Przanowski एट अल.16से संशोधित किया गया है । इस आंकड़े का बड़ा संस्करण देखने के लिए कृपया यहां क्लिक करें ।

Figure 2
चित्रा 2: जीवित चूहों के सेरेब्रल वल्कुट न्यूरॉन्स में एक्स-लिंक्ड Mecp2 के औषधीय पुनः सक्रियण. () एक माउस खोपड़ी की योजनाबद्ध और () मस्तिष्क के बाएं या दाएं गोलार्द्धों में वाहन या दवा के लिए इंजेक्शन की साइट दिखा रहा है । () ड्रग रेजिमेन की योजनाबद्ध । () वाहन या नशीली दवाओं के इलाज गोलार्द्धों से किरीटी मस्तिष्क वर्गों में अंतर्जात gfp संकेत (हरी) दिखा प्रतिनिधि इम्यूनोफ्लोरेसेंस छवियाँ. Dapi धुंधला नीले रंग में दिखाया गया है । () औषध उपचारित गोलार्द्ध में जीएफपी (एंटी जीएफपी; रेड) और MAP2 (ग्रीन) की अभिव्यक्ति की निगरानी करने वाले कोरोनल ब्रेन सेक्शनों की प्रतिनिधिक इम्यूनोफ्लोरेसेंस छवियां । Dapi धुंधला नीले रंग में दिखाया गया है । यह आंकड़ा Przanowski एट अल.16से संशोधित किया गया है । इस आंकड़े का बड़ा संस्करण देखने के लिए कृपया यहां क्लिक करें ।

रिवर्स प्राइमर (5 '-> 3 ') Anealing तापमान/
गाटगगागागाटजीगगातगगागागागागागागागागागागगुद ६० ° c/87 bp
GCTGAACTTGTCCGTTTA ६२ ° c/137 bp
TGTCAGCCCTACCCATAAG ६२ ° c/140 bp
GCACAACCCCGCAAATGCTA ६२ ° c/364 bp
GCACAACCCCGCAAATGCTA ६२ ° c/250 bp
AATTGCCTAACGAGCACAC ६२ ° c/436 बीपी
GAACTTCAGGGTCAGCTTGC ६२ ° c/217 बीपी
CTCCTCTGTGACACTTTAGCCCTCCGA ६६ ° c/270 bp

तालिका 1: जीनोटाइपिंग और मात्रात्मक वास्तविक समय आरटी-पीसीआर के लिए इस्तेमाल किया प्राइमरों की सूची ।

Subscription Required. Please recommend JoVE to your librarian.

Discussion

पहले, XCIFs कि चुनिन्दा स्तनधारी महिला कोशिकाओं में ग्यारहवीं से जुड़े जीन के लिए चयन की आवश्यकता है12की पहचान की गई । हम आगे ACVR1 और PDPK1 के बहाव effectors, जो कुशलतापूर्वक ग्यारहवीं माउस फाइकोब्लास्ट सेल लाइनों, माउस वल्कुट ंयूरॉंस में लिंक Mecp2 को पुनः सक्रिय के रूप में xcifs, लक्ष्य के लिए शक्तिशाली छोटे अणु inhibitors अनुकूलित, और एक मानव रेशकोरक सेल एक आरटीटी रोगी से व्युत्पन्न लाइन । इन परिणामों का सुझाव है कि ग्यारहवीं रिनोवेशन एक प्रशंसनीय उपचारात्मक दृष्टिकोण एक्स से जुड़े रोग रोगियों में जीन की कमी को बचाने के लिए है; तथापि, वीवो में व्यवहार्यता का निर्धारण किया जाना शेष है । हाल ही में, XCIF inhibitors को पुनः सक्रिय करने के लिए दिखाया गया था ग्यारहवीं- Mecp2 vivo में जुड़ा हुआ है, जिसके लिए एक गैर यादृच्छिक xistδ: Mecp2/

Xistδ की एक आकर्षक विशेषता : Mecp2/xist: Mecp2-gfp मॉडल यह है कि यह कई कारणों के लिए ग्यारहवीं से जुड़े Mecp2 रिनोवेशन के एक सटीक quantitation की अनुमति देता है । पहले, मातृ एक्स गुणसूत्र पर xist के विलोपन के कारण, Xistδ: Mecp2 Xist: Mecp2-gfp माउस गैर यादृच्छिक xist है । एक परिणाम के रूप में, आनुवंशिक रूप से लेबल Mecp2 कोशिकाओं के १००% में चुप है (चित्रा 1 सी), एक्स के एक उंमीद 50:50 अभिव्यक्ति के विपरीत यादृच्छिक xci के रूप में एमआईसीई में जीन मॉडल, जीएसटी : Mecp2/ इसलिए, परिणाम नहीं precluded GFP के मोज़ेक अभिव्यक्ति द्वारा, और १००% कक्षों में Mecp2-Gfp Xistδ में Xi पर ले : Mecp2/Xist: Mecp2-gfp मॉडल । दूसरा, Mecp2 के आनुवंशिक लेबलिंग पुनः सक्रिय gfp के साथ व्यक्तिगत ंयूरॉंस के प्रत्यक्ष दृश्य परमिट, जिससे न्यूरोनल विश्लेषण में प्रयोगात्मक जोड़तोड़ कम से कम ।

हाल ही में एक अध्ययन में पाया गया कि माउस मस्तिष्क गोलार्द्ध में XCIF inhibitors के intracerebroventricular इंजेक्शन 11 से जुड़े Mecp2 माउस मस्तिष्क के इम्यूनोफ्लोरेसेंस विश्लेषण का उपयोग कर reactivates16. महत्वपूर्ण बात, दवा उपचार वजन, ग्रूमिंग, या गतिशीलता के रूप में सामांय स्वास्थ्य पर कोई प्रतिकूल प्रभाव था,16। इसके अलावा, जिगर या तिल्ली में दवा उपचार से कोई विषाक्तता का पता चला है. साथ में, इस अध्ययन के एक अनिवार्य सबूत के सिद्धांत को प्रदर्शित करता है कि XCIFs के समारोह के साथ हस्तक्षेप के de-vivo में ग्यारहवीं के दमन की ओर जाता है ।

सारांश में, एक संवेदनशील माउस मॉडल को Xi के पुनः सक्रियण का मूल्यांकन करने के लिए उपयोग किया जा सकता है । इस पशु मॉडल डिजाइन भी एक बेहतर RTT माउस मॉडल है कि बंदरगाहों Mecp2 उत्परिवर्तन (शायद कम रोगसूचक) सक्रिय एक्स गुणसूत्र और पर ग्यारहवीं पर प्रकार Mecp2 के लिए अनुकूलित किया जा सकता है सभी कोशिकाओं में । गैर यादृच्छिक xci के कारण, जबकि लक्षणप्ररूपी लक्षण अधिक स्पष्ट हो सकता है, यह उम्मीद है कि इस मॉडल भी बेहतर मूल्यांकन और ग्यारहवीं reactivation के कारण लक्षण के उलट के सटीक मूल्यांकन के लिए अनुमति देगा । साथ ही, xistδ: Mecp2/xist: Mecp2-gfp भी अंय एक्स से जुड़े रोग मॉडल में ग्यारहवीं रिनोवेशन अध्ययन करने के लिए संशोधित किया जा सकता है, इस तरह के DDX3X सिंड्रोम के रूप में ।

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

लेखकों के पास खुलासा करने के लिए कुछ नहीं है ।

Acknowledgments

लेखकों अभिकर्मक प्रदान करने के लिए एंटोनियो Bedalov धंयवाद; Cryosectioning के लिए वर्जीनिया ऊतक हिस्टोलोजी कोर के विश्वविद्यालय; वर्जीनिया के प्रवाह कोशिका मिति प्रवाह के लिए Cytometry कोर के विश्वविद्यालय के विश्लेषण; जेनोटाइपिंग के साथ तकनीकी सहायता के लिए क्रिश्चियन ब्लू और सलोनी सिंह । इस काम का समर्थन किया गया था एक डबल हू अनुसंधान अनुदान के लिए Z.Z., और एक पायलट परियोजना कार्यक्रम पुरस्कार से वर्जीनिया विश्वविद्यालय-वर्जीनिया टेक बीज कोष पुरस्कार और Hartwell फाउंडेशन व्यक्तिगत जैव चिकित्सा अनुसंधान पुरस्कार के लिए एसबी चव्हाण

Materials

Name Company Catalog Number Comments
MICE
Mecp2tm3.1Bird The Jackson Laboratory #014610
B6;129-Xist (tm5Sado) provided by Antonio Bedalov, Fred Hutchinson Cancer Center, Seattle
REAGENTS
22x22 mm coverslip FISHERfinest (Fisher Scientific) 125488
32% Paraformaldehyde Electron Microscopy Sciences 15714-S
50 ml syringe Medline Industries NPMJD50LZ
60mm culture dish CellStar 628160
7-AAD BioLegend 420403
ammonium chloride (NH4Cl) Fisher Chemical A661-3
anti-GFP-AlexaFluor647 Invitrogen A-31852
anti-MAP2 Aves Labs MAP
BSA Promega R396D
Buprenorphine SR Zoopharm
citric acid Sigma C-1857
DMSO Fisher Bioreagents BP231-100
Dulbecco's Modified Eagle Medium (DMEM) Corning Cellgro 10-013-CV
Ethanol Decon Labs 2701
fetal bovine serum (FBS) VWR Life Science 89510-198
gelatin Sigma-Aldrich G9391
glass slides Fisherbrand 22-034-486
goat anti-chicken FITC-labeled secondary antibody Aves Labs F-1005
GSK650394 ApexBio B1051
hamilton 10μl syringe Hamilton Sigma-Aldrich 28615-U
Hank's Balanced Salt Solution (HBSS) Gibco 14025-092
Ketamine Ketaset NDC 0856-2013-01
Large blunt/blunt curved scissors Fine Science Tools 14519-14
LDN193189 Cayman Chemicals 11802
lodixanol Sigma 1343517
magnesium chloride (MgCl2) Fisher Chemical M35-212
Methylcelulose Sigma M0262-100G
mounting medium with DAPI Vectashield H-1200
Needle tip, 26 GA x 1.25" PrecisionGlide 305111
ophthalmic ointment Refresh Lacri-Lube 93468
optimal cutting temperature (O.C.T.) ThermoFisher
PCR mix
Penicillin/Streptomycin (Pen/Strep) Corning 30-002-Cl
Phosphate buffered saline pH 7.4 (PBS) Corning Cellgro 46-103-CM
Potassium chloride (KCl) Fisher Scientific P330-500
scalpel blades
Shallow glass or plastic tray
skin glue/tissue adhesive 3M Vetbond 1469SB
sodium azide Fisher Scientific CAS 26628-22-8
Sodium chloride (NaCl) Fisher Chemical S642-212
standard hemostat forceps Fine Science Tools 13013-14
Standard tweezers Fine Science Tools 11027-12
Straight iris scissors Fine Science Tools 14058-11
sucrose Fisher Scientific BP220-1
Tris-base Fisher Bioreagents BP152-5
Triton X-100 Fisher Bioreagents BP151-500
Trypsin-EDTA Gibco 15400-054
Xylazine Akorn NDC: 59399-111-50
EQUIPMENT
Zeiss AxioObserver Live-Cell microscope Zeiss Zeiss AxioObserver
0.45mm burr IDEAL MicroDrill 67-1000
BD FACScalibur
centrifuge
glass homogenizer
cell culture incubator Thermo Scientific HERACELL VIOS 160i 13-998-213
Leica 3050S research cryostat
stereotactic platform
thermocycler
Timer
ultracentrifuge Beckman Coulter Optima L-100 XP
Water bath (37 ºC) Fisher Scientific Isotemp 2239

DOWNLOAD MATERIALS LIST

References

  1. Lyon, M. F. X-chromosome inactivation as a system of gene dosage compensation to regulate gene expression. Progress in Nucleic Acid Research and Molecular Biology. 36, 119-130 (1989).
  2. Heard, E. Delving into the diversity of facultative heterochromatin: the epigenetics of the inactive X chromosome. Current Opinion in Genetics Development. 15, (5), 482-489 (2005).
  3. Augui, S., Nora, E. P., Heard, E. Regulation of X-chromosome inactivation by the X-inactivation centre. Nature Review Genetics. 12, (6), 429-442 (2011).
  4. Pontier, D. B., Gribnau, J. Xist regulation and function explored. Human Genetics. 130, (2), 223-236 (2011).
  5. Barnes, C., Kanhere, A. Identification of RNA-Protein Interactions Through In Vitro RNA Pull-Down Assays. Methods in Molecular Biology. 1480, 99-113 (2016).
  6. McHugh, C. A., et al. The Xist lncRNA interacts directly with SHARP to silence transcription through HDAC3. Nature. 521, (7551), 232-236 (2015).
  7. Minajigi, A., et al. Chromosomes. A comprehensive Xist interactome reveals cohesin repulsion and an RNA-directed chromosome conformation. Science. 349, (6245), (2015).
  8. Mira-Bontenbal, H., Gribnau, J. New Xist-Interacting Proteins in X-Chromosome Inactivation. Current Biology. 26, (8), R338-R342 (2016).
  9. Mira-Bontenbal, H., Gribnau, J. New Xist-Interacting Proteins in X-Chromosome Inactivation. Curren Biology. 26, (10), 1383 (2016).
  10. Ridings-Figueroa, R., et al. The nuclear matrix protein CIZ1 facilitates localization of Xist RNA to the inactive X-chromosome territory. Genes and Development. 31, (9), 876-888 (2017).
  11. Sunwoo, H., Colognori, D., Froberg, J. E., Jeon, Y., Lee, J. T. Repeat E anchors Xist RNA to the inactive X chromosomal compartment through CDKN1A-interacting protein (CIZ1). Proceedings of National Academy of Sciences of the United States of America. (2017).
  12. Bhatnagar, S., et al. Genetic and pharmacological reactivation of the mammalian inactive X chromosome. Proceedings of National Academy of Sciences of the United States of America. 111, (35), 12591-12598 (2014).
  13. Zoghbi, H. Y., Percy, A. K., Schultz, R. J., Fill, C. Patterns of X chromosome inactivation in the Rett syndrome. Brain Development. 12, (1), 131-135 (1990).
  14. Anvret, M., Wahlstrom, J. Rett syndrome: random X chromosome inactivation. Clinical Genetics. 45, (5), 274-275 (1994).
  15. Amir, R. E., et al. Rett syndrome is caused by mutations in X-linked MECP2, encoding methyl-CpG-binding protein 2. Nature Genetics. 23, (2), 185-188 (1999).
  16. Przanowski, P., et al. Pharmacological reactivation of inactive X-linked Mecp2 in cerebral cortical neurons of living mice. Proceedings of Natlional Academy of Sciences of the United States of America. 115, (31), 7991-7996 (2018).
  17. Borensztein, M., et al. Xist-dependent imprinted X inactivation and the early developmental consequences of its failure. Nature Structural and Molecular Biology. 24, (3), 226-233 (2017).
  18. Jensen, E. C. Quantitative analysis of histological staining and fluorescence using ImageJ. Anatomical Record (Hoboken). 296, (3), 378-381 (2013).
  19. Cseke, L. J., Talley, S. M. A PCR-based genotyping method to distinguish between wild-type and ornamental varieties of Imperata cylindrica. Journal of Visualized Experiments. (60), (2012).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics