מודל עכבר שאינו אקראי עבור ההפעלה הפרמקולוגית של Mecp2 על כרומוזום X לא פעיל

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

כאן, אנו מתארים פרוטוקול כדי ליצור מודל קיימא נשי מורטין עם כרומוזום לא אקראי הפעלה X, כלומר, maternally בירושה כרומוזום X אינו פעיל ב 100% של התאים. כמו כן, אנו מתארים פרוטוקול לבדיקת היתכנות, סבילות, ובטיחות של ההפעלה הפרמקולוגית של כרומוזום X לא פעיל ב vivo.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Przanowski, P., Zheng, Z., Wasko, U., Bhatnagar, S. A Non-random Mouse Model for Pharmacological Reactivation of Mecp2 on the Inactive X Chromosome. J. Vis. Exp. (147), e59449, doi:10.3791/59449 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

כרומוזום x הפעלה (XCI) הוא אקראי השתקה של כרומוזום X אחד אצל נקבות כדי להשיג איזון המינון הגנטי בין המינים. כתוצאה מכך, כל הנקבות מheterozygous ביטוי גנטי מקושר ל-X. אחד הרגולטורים המפתח של XCI הוא Xist, אשר חיוני עבור ייזום ותחזוקה של xci. מחקרים קודמים זיהו 13 משחק טרנס כרומוזום X בכרומוזום הפעלה (XCIFs) באמצעות בקנה מידה גדול, אובדן הפונקציה של המסך הגנטי. עיכוב של XCIFs, כגון ACVR1 ו-PDPK1, באמצעות מעכבי מולקולת ה-RNA או מולקולה קטנה, מפעיל מחדש את הגנים המקושרים כרומוזום X בתאים מתורבתים. אבל הכדאיות והסבילות של הפעלה מחדש של כרומוזום X לא פעיל בvivo שרידים להיקבע. לקראת מטרה זו, XistΔ: Mecp2/Xist: Mecp2-Gfp מודל העכבר נוצר עם xci שאינם אקראיים בשל מחיקה של xist על כרומוזום X אחד. באמצעות מודל זה, היקף ההפעלה הפעילה של X לא פעיל היה כימות במוח העכבר לאחר הטיפול עם מעכבי XCIF. תוצאות שפורסמו לאחרונה להראות, בפעם הראשונה, כי עיכוב תרופתי של XCIFs מפעיל מחדש Mecp2 מן כרומוזום X לא פעיל בנוירונים בקליפת המוח של העכבר החי.

Introduction

כרומוזום x הפעלה (XCI) הוא תהליך של פיצוי המינון המאזן ביטוי גנים מקושר X על ידי השתקה עותק אחד של כרומוזום X אצל נקבות1. כתוצאה מכך, כרומוזום X לא פעיל (Xi) מצטבר תכונות אופייניות של הטרוכרוטין כולל מתילציה DNA ומעכבות שינויים היסטון, כגון היסטון H3-ליזין 27 הטריתילציה (H3K27me3) ו H2A ההיסטון (H2Aub) 2. הרגולטור הראשי של כרומוזום x השתקה הוא מרכז x-inactivation פעלה (Xic) אזור, סביב 100 לערך 500 kb, אשר שולט את הספירה ואת הזיווג של כרומוזומים X, הבחירה האקראית של כרומוזום x עבור inactivation פעלה, ואת החניכה ו הפצת שהשתקה לאורך כרומוזום X3. התהליך של הפעלת X מופעל על ידי תעתיק ספציפי X לא פעיל (Xist) כי מעילים את Xi ב- cis כדי לתווך כרומוזום-רחב השתקה לשפץ את המבנה תלת מימדי של כרומוזום X4. לאחרונה, כמה מסכי פרוטאומית וגנטית זיהו הרגולטורים נוספים של xci, כגון שישי אינטראקציה חלבונים5,6,7,8,9 , מיכל עשור , מיכל בן 11 , 12. למשל, מחקר הקודם באמצעות הגנום משוחדת כלל הפרעה RNA התערבות מזוהה 13 משחק טרנסמפעל גורמי Xci (xcifs)12. מכונאי, XCIFs להסדיר ביטוי Xist ולכן, הפרעה עם הפונקציה xcifs גורם לפגום xci12. יחד, ההתקדמות האחרונה בתחום סיפקו תובנות חשובות לתוך המנגנון המולקולרי הנדרש ליזום ולתחזק XCI.

זיהוי של הרגולטורים xci והבנת המנגנון שלהם ב-xci רלוונטי ישירות למחלות אנושיות המקושרות באמצעות X, כגון תסמונת רט (rtt)13,14. RTT היא הפרעה נוירוהתפתחותית נדירה הנגרמת על ידי מוטציה heterozygous בחלבון כריכת מתיל-CpG מקושר-X 2 (MECP2) המשפיעה בעיקר על בנות15. מכיוון MECP2 ממוקם על כרומוזום X, בנות rtt הם Heterozygous עבור MECP2 מחסור עם ~ 50% תאים המבטא פראי סוג ו ~ 50% להביע MECP2מוטציה. במיוחד, RTT תאי מוטציה הנמל העתק רדום אך פראי של Mecp2 על Xi, מתן מקור של הגן הפונקציונלי, אשר אם מופעל מראש, עלול להקל על סימפטומים של המחלה. בנוסף RTT, יש כמה מחלות אחרות הקשורות ל-X, שעבורן ההפעלה החוזרת של Xi מייצגת גישה טיפולית פוטנציאלית, כגון תסמונת DDX3X.

עיכוב של XCIFs, 3-פוספהונותזול חלבון קינאז-1 (PDPK1), ופעילות מסוג קולטן 1 (ACVR1), או על ידי מעכבי מולקולה קטנה (שרין) או מולקולת מולקולות קטנות, מפעיל מחדש את הגנים המקושרים Xi12. ההפעלה הפרמקולוגית של גנים מקושרים Xi הוא נצפתה בדגמי vivo ex שונים הכוללים את העכבר לתאי הפיצוץ קווים, נוירונים למבוגרים העכבר הקליפת המין, העכבר העובריים מתחלקים, ואת קווי התאים פיברובפיצוץ נגזר מחולה RTT12. עם זאת, אם ההפעלה הפרמקולוגית של גנים מקושרים Xi הוא אפשרי vivo שרידים להיות הפגינו. גורם מגביל אחד הוא חוסר של מודלים יעילים בעלי חיים כדי למדוד במדויק את הביטוי של גנים מופעל מראש Xi. לקראת מטרה זו, XistΔ: Mecp2/Xist: Mecp2-Gfp מודל העכבר נוצר כי נושאת גנטית מתויג Mecp2 על Xi בכל התאים בשל Heterozygous מחיקה ב Xist על כרומוזום X אימהי16. באמצעות מודל זה, הביטוי של Mecp2 מ Xi כבר כימות בעקבות הטיפול עם מעכבי XCIFs במוח של עכברים חיים. כאן, הדור של הXistΔ: Mecp2/Xist: Mecp2-Gfp מודל העכבר ומתודולוגיה כדי כימות ההפעלה הראשונה של נוירונים בקליפת הסביבה המבוססת על מבוססי immunofluorescence מבוססת מתוארת.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

עבודה מעורבים עכברים אושרה על ידי הוועדה לטיפול בבעלי חיים מוסדיים של אוניברסיטת וירג (IACUC;4112).

1. ליצור מודל מסוג XCI עכבר שאינו אקראי עם התווית גנטית Mecp2 על Xi

הערה: זנים העכבר המשמשים במחקר היו כדלקמן: Mecp2-gfp/Mecp2-gfp (Mecp2tm 3.1 ציפור, שולחן חומרים) ו xist/ΔXist (B6; 129-xist < tm5Sado >; שסופקו על ידי אנטוניו בדפורלוב, פרד האצ המרכז לסרטן, סיאטל). אסטרטגיות רבייה בין הזנים המתאימים עוצבו כדי להרחיב את מושבות העכבר על כל זן.

  1. לבצע PCR-הקלדה על כל זני עכברים הprogenies שהתקבלו לאחר הרבייה באמצעות התחל הספציפי ג'ין המפורטים בטבלה 1.

2. עיצוב אסטרטגיית רבייה העכבר כדי ליצור XistΔ: Mecp2/Xist: Mecp2-Gfp

  1. הגדר זוג הרבייה על ידי דיור Mecp2-Gfp/Y זכר XistΔ-Mecp2/Xist-Mecp2 נקבה יחד (12 h/12 h: מחזור אור/כהה) (איור 1A). באופן אידיאלי, להגדיר לפחות 5 זוגות רבייה בכל פעם באמצעות עכברים קיימא ופורה. אחרי שהנקבה ההרה יולדת, הרשי לה לגדל את האשפה הראשונה שלה עם הזכר.
    הערה: בגלל הנוקאאוט האבהי Xist פוגע מוטבע xci, מינון פיצוי, ובידול מסלולים17, השימוש XistΔ-Mecp2/Y עכברים ברבייה לא יצליחו לייצר את הגורים הנקביים עם גנוטיפ נדרש.
  2. לאחר הגמילה המלטה ביום לאחר לידה 21 (P21), לזהות ולתייג את XistΔ: Mecp2/Xist: גורי נשים Mecp2-Gfp באמצעות שיטת ה-PCR המבוססת על הקלדה (איור 1b).
    הערה: במונחים של מספר בעלי החיים הדרושים לכל קבוצה, עבור התוצאות שדווחו להלן, 5 זוגות רבייה הוגדרו שנוצרו כ 10 נקבה XistΔ: Mecp2/Xist: עכברים Mecp2-Gfp .
  3. השתמש מודלים העכבר הנשי עבור כל הניסויים המוצעים.
    הערה: סקס הוא משתנה ביולוגי חשוב למחקרים XCI, והמודל הגברי אינו מסביר את ההשפעות הקונקקריות של XCI אקראיים.
  4. להיות עקביים במהלך לימודי החיות ולשלול את כל ההשפעות של גיל החי, לבצע את כל הניסויים ב-5 XistΔ נקבה בת 8 שבועות : Mecp2/Xist: עכברים Mecp2-Gfp .

3. לבודד נקבה XistΔ: Mecp2/Xist: Mecp2-Gfp העכבר העובריים (mefs)

  1. להגדיר ההזדווגות מתוזמן בין Mecp2-Gfp/Y זכר ו XistΔ-Mecp2/Xist-Mecp2 נקבה. הגדר לפחות 3-4 כלובי ההזדווגות כדי להגדיל את הסבירות של ההריון.
  2. לאחר אישור תקע הנרתיק בבוקר לאחר ההזדווגות, הפרד את הנקבה ואת היום הזה נחשב יום עובריים 0.5 (E 0.5). לפקח על העלייה במשקל של האישה ההרה פוטנציאליים ולבדוק חזותית את הבטן של העכברים כדי לאשר הריון. ב-14.5 בבוקר הייתה המתת החסד של העכברים הנשיים באמצעות נקע בצוואר הרחם.
  3. מתחת למכסה המנוע, נגב את הבטן של האישה ההרה עם 70% אתנול. באמצעות מספריים סטרילי, לנתח את חלל הבטן ולהסיר את הקרניים הרחם המכיל את העוברים. באמצעות מלקחיים, בעדינות להוציא את העוברים בזמן לחתוך את רקמת הבטן שנותרה (6-12 עוברים בדרך כלל צפוי).
  4. הניחו את קרני הרחם המכילות את העוברים בצלחת של 10 מ"מ ברקמת הרקמה. באמצעות מספריים סטרילי מלקחיים, לבצע חתך לאורך קרני הרחם כדי לבודד שקי בודדים נושאת העובר. בזהירות, במקום קרניים הרחם המכיל את שאר העוברים ב 30 מ ל של תמיסת מלח סטרילי מאוזנת של הנקס (HBSS) על הקרח.
  5. לחתוך בעדינות את השק לבודד את העובר באמצעות מספריים סטרילי מלקחיים. להסיר את השליה על ידי חיתוך חבל הטבור.
  6. . לערוף את ראשו של העובר
    הערה: בעוד שאר הרקמה העובריים יהיה מעובד נוסף, הרקמה מהראש העובר ישמש לבידוד ה-DNA עבור גנוהקלדה.
  7. פתח את הבטן על ידי חיתוך קו האמצע של העובר באמצעות מספריים סטרילי מלקחיים. הסירו את אברי הקרביים, כגון הלב, הכבד והריאות.
  8. להעביר את הרקמה העובארית הנותרים לתוך לוחית סטרילית 60 מ"מ רקמות רקמה וחותכים לחתיכות קטנות באמצעות מספריים או סכין גילוח. כדי לשבור את המקבצים לפתוח את התאים, להוסיף 3 מ ל טריפסין-EDTA (0.05%) ו הדגירה ב 37 ° צ' צלזיוס עבור 15 דקות.
  9. לנטרל את טריפסין-EDTA על ידי הוספת 5 מ ל של מדיום הנשר שונה של Dulbecco (DMG) עם 10% סרום העובר העוברי (FBS) ו 10 μx/mL פניצילין/סטרפטומיצין (עט/דלקת) לצלחת והנתק את הרקמה על ידי ליטוף חוזר (כ 20-30 פעמים).
  10. לסובב את התאים ב 300 x g עבור 5 דקות ו-מחדש להשעות את הגלולה התא ב 4 מ ל של DMEM זיכרון עם 10% fbs ו 10 Μg/mL עט/דלקת. צלחת התאים על הצלחת תרבות 60 מ"מ, ותרבות התאים ב 37 ° c בנוכחות של 5% CO2.
  11. בצע את השלבים 3.5-3.10 עבור כל עובר.
  12. התרבות MEFs השיגה בשלב 3.11 לפחות 3-4 ימים.
    הערה: בשלב זה, MEFs יכול גם להיות הקפאת שמורות לניסויים עתידיים.
  13. כדי לקבוע את המין ואת הגנוטיפ של כל עובר, לבצע את ה-גנוהקלדה-PCR באמצעות דנ א מבודדים מראשי העוברים באמצעות תנאי התחל ו-PCR המפורטים בטבלה 1.

4. לאשר את העדר חלבון פלורסנט ירוק (GFP) ביטוי במוח של XistΔ: Mecp2/Xist: עכברים Mecp2-Gfp באמצעות מיון מבוסס תא המופעל בשיטת המיון

  1. באמצעות מספריים, הפרד את קליפת המוח משאר האונות המוחית, ובמקום 1 מ ל של הקרח קר גרעיני מדיה בידוד (נים) מאגר המכיל 250 mM סוכות, 25 מ"מ אשלגן כלוריד (KCl), 5 מ"מ מגנזיום כלוריד (MgCl2), 10 מ"מ טריס-Cl, שיושלם עם 2% פראפורמלדהיד (בתחתית), ו 0.1% nonionic החומר (טבלת חומרים).
  2. הומוגון באמצעות מכשיר זכוכית קר-קרח.
  3. ספין למטה רקמת הומוגניים ב 600 x g, 4 ° צ' עבור 5 דקות.
  4. הסר supernatant ולהשהות את הגלולה ב 1 מ ל של 25% יודיקסנול בפתרון נים.
  5. להוסיף 1 מ ל של 29% lodixanol בפתרון נים ל 4 מ"ל ultracentrifuge tube (חנות על הקרח עד הדגימות מוכנים) ובזהירות שכבה 1 מ ל של מדגם (ב 25% lodixanol).
  6. צנטריפוגה ב 9,000 x g, 4 ° צ' עבור 10 דקות ב ultracentrifuge.
  7. ולאחר מכן השעיית מחדש את הגלולה ב-500 μL של מיון תאים המופעל על ידי הפלואורסצנטית (FACS) מאגר (מלוחים המלח באגירה [PBS] שיושלם עם 1 מ"מ EDTA, 0.05% נתרן azide, ו 2% סרום שיסמין [BSA]).
    הערה: ניתן לאחסן דגימות ב-4 ° צ' או עד 1 שבוע.
  8. הוסף 5 μL של 7-אמינו-אקטינומיצין D (7-עמ מ; 50 mg/mL) עבור 5 דקות בטמפרטורת החדר כדי להכתים דנ א.
  9. לנתח דגימות עבור 7-עמ ' חלבון פלורסנט ירוק (GFP) האות באמצעות הזרימה cy, לנסות.

5. קביעת הכדאיות של XistΔ: Mecp2/Xist: Mecp2-Gfp מודל העכבר עבור ההפעלה הראשונה של Xi

  1. Seed 1 x 105 תאים/mL נקבה XistΔ: Mecp2/xist: Mecp2-gfp mefs, Mecp2/Mecp2-gfp ו xist-Mecp2/Y mefs שהתקבל בשלב 3.12 בפורמט 6-טוב ובשקופיות קאמרית, ב-dmem עם 10% fbs ו 10 μg/mL עט/דלקת, ב 37 ° c ב נוכחות של 5% CO2.
    הערה: Mecp2/Mecp2-Gfp ו Xist-Mecp2/Y mefs משמשים כפקדים חיוביים ושליליים בניסויים.
  2. הוסף מדיום טרי לתאים לאחר 24 שעות. עבור XistΔ: Mecp2/Xist: Mecp2-Gfp mefs, להוסיף בינוני בתוספת עם מעכבי XCIFs (למשל, 0.5 ΜM LDN193189 ו 2.5 ΜM GSK650394), או רכב לבד. החלף בינוני בתוספת עם מעכב או רכב טרי לבדו כל יומיים. עבור Mecp2/Mecp2-Gfp ו Xist-Mecp2/Y mefs, להוסיף מדיום טרי כל יומיים.
  3. פוסט 1 שבוע של טיפול מעכב, הקציר MEFs גם עבור בידוד RNA (6-באר צלחת) או לתקן תאים לאימונולואואורנציה (שקופיות קאמרית). השתמש ב-MEFs בודד מ- Mecp2/Mecp2-Gfp כאשר עוברים חיובי ו -Xist-Mecp2/Y כפקדים שליליים בהתאמה.
    1. עבור בידוד RNA, לבודד RNA הכולל על ידי guanidinium מבוסס רנ א החילוץ מבוססי RNA, ולהפוך את הפוך באמצעות היפוך הטרנססקריפט. למדוד ביטוי Mecp2-Gfp על ידי היפוך כמותי הטרנססקריפט-Pcr (רביעיית-pcr) באמצעות Mecp2-WT ו Mecp2-gfp, ו התחל בלוח 1, כפי שמתואר בעבר12.
    2. עבור immunofluorescence, כתם הכתמים עם נוגדן ראשוני אנטי gfp (1:100), כפי שמתואר בעבר12,16. למדוד את עוצמת GFP על ידי אימונוXistΔ כמותיים לטיפול תרופתי : Mecp2/Xist: Mecp2-gfp mefs, כפי שמתואר בעבר18.

6. להדגים את ההפעלה הפרמקולוגית במוח של XistΔ: Mecp2/Xist: Mecp2-Gfp מודל העכבר

  1. . הכן סמים ושליטה ברכב
    1. הכינו פתרון טרי וסטרילי של הרכב (0.9% הנאגל, 0.5% מתיל תאית, 4.5% diמתיל סולפוקסיד [DMSO]) עבור זריקות המוח.
    2. הכנת מעכבי כימיים כולל 1.5 mM LDN193189 (מולקולה קטנה מעכב של ACVR1) ו 1.6 mM GSK650394 (מולקולה קטנה מעכב של SGK1, המורד הזרם של PDPK1) מושעה מחדש ברכב (0.9% הנאגל, 0.5% מתילתאית, 4.5% DMSO), או רכב לבד. הנפח הכולל של מעכבי כימיים או רכב הוזרק הוא 10 μL לכל מינון לכל חיה.
  2. . הכן חיה לזריקות מוחית
    1. הכן את אזור כירורגי על ידי ניגוב הספסל ומשטח חימום עם חיטוי (10% נתרן היפוכלוניט הפתרון).
    2. מורדם העכבר 4 השבוע עם הזרקה התוך הצפק של תערובת קטמין/xylazine במינון של 140 מ"ג/ק"ג ו 10 מ"ג/ק"ג, בהתאמה. השתמש ברפלקס הדוושה כדי לקבוע את רמת ההרדמה.
    3. החלת משחה אופטלמולוגית לעיניים בעקבות אינדוקציה של הרדמה כדי למנוע ייבוש הקרנית.
    4. לגלח את הפרווה מהצוואר עד ראש העכבר.
    5. למקם את העכבר בפלטפורמת סטריאוטקטיקה על ידי חיבור השיניים חותכת של העכבר בתוך החטיף של הרסן החוטם והידוק מהדק האף על החוטם תוך הבטחת כי הראש של העכבר הוא על מישור רמה.
    6. כוונן את גובה פסי האוזן, בהתאם לצורך, כדי להגיע לחלק caudal של תעלת האוזן, ומאבטח אותם כך שראש העכבר נמצא במישור ברמה ומתכוונן על מגע האצבע.
    7. לחטא את הראש של העכבר עם מגבונים לסירוגין של חיטוי אקטואלי, כגון povidone-יוד ו 70% אתנול.
  3. . מנהל סמים
    1. באמצעות אזמל סטרילי, לעשות חתך אופקי 0.75 ס מ באמצע הקרקפת.
    2. באמצעות בר 0.45 מ"מ, לקדוח שני חורים סימטריים מעל האונות הימנית והשמאלית (2 מ"מ מן תפר משונן 2 מ"מ מתפר המדוגת, בערך באמצע עצם הקודקוד).
    3. הצמד מזרק של 10 μL לפלטפורמת הסטריאוטקטיקה בחוזקה.
    4. לערבב את הפתרון של מעכבי כימיים, ולצייר 10 μL של פתרון לתוך המזרק. הימנע בועות אוויר במזרק.
    5. מראש את המחט מזרק לתוך חור בגולגולת שמירה על המחט בניצב (90 °) לגולגולת. כאשר המחט החוצה את הגולגולת, לאפס את נקודות הציון על התצוגה הדיגיטלית סטריאוטקטיקה ולאחר מכן לקדם את קצה המחט עד שהוא מגיע לעומק של 2.5 מ"מ.
    6. משיכת המחט 0.5 מ"מ לעומק עבור 2 מ"מ.
    7. הכנס לאט את 10 μL של פתרון (~ 1 דקות). לאחר ההזרקה הושלמה, להשאיר את המחט במוח עבור ~ 1 דקות ולאחר מכן למשוך את המחט.
    8. חזרו על הזריקה לחצי הכדור השני (בקרת הרכב בלבד).
    9. באמצעות תפרים או "דבק עור" לסגור את העור של העכבר (אם הפצע הוא > 0.5 ס"מ שני תפרים ו" דבק העור "יש להשתמש).
    10. שחרר את פסי האוזן והסר את העכבר ממנגנון הסטריאוטקטיקה.
    11. ניהול משככי כאבים (בוטאורפין SR 0.5 mg/ק"ג) ומניחים את העכבר על כרית חימום שנקבעה ל-37 ° c עד שהחיה תחזור להכרה.
    12. ברגע שהעכבר הוא ערני ומגיב, העבר את החיה חזרה לכלוב המקורי.
    13. חזור על ההליך מדי יומיים במשך 20 יום. הקידוח החוזר של האזור אינו נדרש לזריקות הבאות.
  4. . תבודד את מוח העכבר
    1. לאחר משטר המינון הושלמה, המתת החסד העכבר בחדר CO2 .
    2. לשתק את העכבר על פני השטח באמצעות מחטים.
    3. לעשות חתך לרוחב דרך הקיר עור והבטן ממש מתחת לכלוב הצלעות באמצעות מספריים מלקחיים. . הפרידו בזהירות את הכבד מהסרעפת
    4. באמצעות מספריים, חותכים את הסרעפת וממשיכים לחתוך לאורך כל כלוב הצלעות כדי לחשוף את חלל הצפק.
    5. באמצעות מספריים, לבצע חתך לקצה האחורי של החדר השמאלי.
    6. מיד, התחל להזריק את חדר הלב הימני עם ~ 15 מ ל של PBS מעל ~ 2 דקות. צבע הכבד שינוי מאדום כדי ורוד בהיר מעיד על perfusion טוב.
    7. הכנס את התא הימני של לב העכבר עם ~ 10 mL של 4% פאראפורמלדהיד ב PBS מעל ~ 2 דקות.
    8. ערוף את ראשו של העכבר, ולהשתמש במספריים לעשות חתך באמצע קו של הקרקפת כדי לחשוף את הגולגולת.
    9. הניחו קצה אחד של המספריים לתוך מגנום האמן, וחתכו אותו לתוך הגולגולת לכיוון העין. . אני חוזר לצד השני נסו לשמור על סוף המספריים שטחיות ככל האפשר כדי למנוע פגיעה במוח.
    10. להשתמש במספריים כדי לחתוך את האזור בין העיניים ומעל האף של העכבר.
    11. השתמש מלקחיים כדי לקלף בעדינות את עצמות הגולגולת מהמיאונות במוח.
    12. הרם את המוח במרית, והשתמש במספריים כדי לנתח בזהירות את סיבי העצב הגולגולתית שיתקנו אותה לגולגולת.
    13. מניחים את המוח על צלחת פלסטיק, לגזור את נורות המוח ואת הריח, ולמקם את המוח לתוך 15 מ ל שפופרת מלא עם 4% בתחתית הוא PBS.
  5. . מחלקת ההקפאה במוח העכבר
    1. לתקן את המוח ב 4% פאראפורמלדהיד ב-PBS ב 4 ° c בלילה.
    2. לשטוף את המוח עם PBS ב 4 ° צ' לפחות 3 x עבור 5 דקות כל אחד.
    3. סמן את התבניות החד החד-פעמיות עבור הקפאת הרקמות.
    4. חותכים את החלק הקדמי של המוח באמצעות מספריים מלקחיים (להתחיל לעשות ~ 5 מ"מ סעיפים מאתרי הזרקה).
    5. להעביר את המוח לקריוזקן עם החזית של המוח הפונה כלפי מטה כדי להשיג סעיפים ילתית. טבול את העובש המכיל את המוח בתרכובת טמפרטורת החיתוך האופטימלית (OCT).
    6. יוצקים חנקן נוזלי לצלחת מפלסטיק 10 מ"מ ומניחים את המוח בתבנית ההקפאה לתוך החנקן.
      הערה: חשוב לכוון את הרקמה כמתואר בשלב 6.5.5 כדי להנחות את הכיוון של המוח.
    7. כאשר OCT הוא לבן מוצק, מניחים את המוח הקפוא לתוך a-80 מקפיא ° c לאחסון.
    8. המוח עד 20 ° c לפחות 30 דקות לפני הפסקה עם קריוסטט ו קריומטר (5-6 יקרומטר עובי) המוח, הרכבה 2-3 סעיפים לכל שקופית. ניתן לאחסן שקופיות ב-80 ° צ' לשימוש מאוחר יותר.
  6. לקבוע את ההפעלה העצמית באמצעות הגישה המבוססת על immunofluorescence.
    1. לפני שמתחילים בהליך ההכתמים, מייבשים את חתכי המוח ללילה ב -4 ° c.
    2. שקופיות לטבול בפתרון אחזור אנטיגן (0.1 m חומצת לימון, 0.1 M טריס-base, pH = 6.0) 100 על בלוק חום בגובה ° c עבור 5 דקות.
    3. לשטוף את השקופיות 4x עם 1x PBS עבור 5 דקות כל אחד בטמפרטורת החדר.
    4. לטבול שקופיות בפתרון חסימה (0.1 M NH4CL/PBS/0.2% ג'לטין/0.05% nonionic) עבור 20 דקות בטמפרטורת החדר.
    5. לשטוף שקופיות 3 x עם מאגר לשטוף (PBS/0.2% ג'לטין) בטמפרטורת החדר עבור 5 דקות כל אחד.
    6. כתם המוח סעיפים עם anti-GFP-AlexaFluor647 (1:100) ו anti-MAP2 (1:1000) נוגדנים ב דגירה בינונית (PBS/0.2% ג'לטין/1% BSA) ו דגירה ב 4 ° c לילה.
    7. לאסוף נוגדנים עיקריים (ניתן לעשות שימוש חוזר). לשטוף שקופיות 4x עם מאגר לשטוף עבור סך של 30 דקות בטמפרטורת החדר.
    8. דגירה סעיפים המוח עם עז נגד עוף Fluorescein isothiocyanate (FITC)-מסומן נוגדן משני (1:1000) ב דגירה בינונית ו דגירה 1-2-h בטמפרטורת החדר בחושך.
    9. לשטוף שקופיות 4x עם מאגר לשטוף עבור סך של 30 דקות בטמפרטורת החדר.
    10. מקום טיפה של בינוני הרכבה עם 4 ′, 6-diamidino-2-פניינילידול (DAPI) על מחליק 22 מ"מ x 50 מ"מ, ואז להפוך את coverslip על שקופית, כיסוי כל מקטעי רקמות.
    11. תמונה על מיקרוסקופ ולהתאים תמונות לניגודיות ובהירות. לכידת תמונות ולכמת את מספר התאים GFP-חיוביים עבור תרופות מטופלים והרכב שטופלו XistΔ: Mecp2/Xist: Mecp2-Gfp המוח העכבר אונות.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

כדי להדגים את הכדאיות של XistΔ: Mecp2/Xist: Mecp2-Gfp מודל העכבר עבור לימודי ההפעלה מראש של XI, xcif מעכבי-בתיווך ההפעלה של xi מקושרים Mecp2-gfp נבדק העכבר מעובריים מתחלקים (mefs). הנקבה MEFs היו מבודדים מיום 15.5 XistΔ: Mecp2/Xist: Mecp2-Gfp העוברים כמתואר בסעיף 3 (איור 1a). הגנוטיפים של הנקבה XistΔ: Mecp2/Xist: Mecp2-Gfp mefs אושרו על ידי הגנואיות-PCR, כמתואר בעבר19 (איור 1B), ו-facs מבוססי שיטת (איור 1b). MEFs טופלו גם עם DMSO או שתי תרופות LDN193189 ו GSK650394 (0.5 μM ו 2.5 μM, בהתאמה) במשך 7 ימים. בעקבות טיפול תרופתי, הביטוי של Mecp2-Gfp היה במעקב על ידי רביעיית ה-PCR. כפי שמוצג באיור 1D, טיפול תרופתי, אך לא dmso, ביטוי מופעל מראש של Xi-Mecp2-gfp. לאחר מכן, החיסונית כמותית בוצעה כדי לקבוע את היקף הביטוי Xi-Mecp2-Gfp ב- mefs בודדים, כפי שמתואר בשלב 5.3.2. האות מ-MEFs בקרה שלילית מבודדים מעוברי זכר (Mecp2/Y) הוגדר כרקע, ו-~ 66% של שליטה חיובית Mecp2-Gfp/Mecp2 MEFS היה אות gfp גרעיני. כצפוי, XistΔ: Mecp2/Xist: Mecp2-Gfp mefs שטופלו עם dmso היה רמה נמוכה מאוד של gfp גרעיניים (~ 3%). לעומת זאת, ~ 31% של תרופות שטופלו XistΔ: Mecp2/Xist: Mecp2 mefs היו חיוביים gfp גרעיניים (איור 1e). יחד, התוצאות האלה מוכיחים כי מעכבי XCIF מחדש מחדש Xi Mecp2 ב mefs, אבל בהיקף של xi הפעלה מחדש משתנה באוכלוסיית התא.

כדי להעריך את הכדאיות של הגישה המבוססת על הפעלת ההפעלה הראשונה של פרמקולוגית ב-vivo, האם טיפול תרופתי מפעיל מחדש את Mecp2 במוח של XistΔ: Mecp2/Xist: Mecp2-gfp עכברים נקבה נחקרו. 10 μL של הרכב או 10 μL של מעכבי XCIF (1.5 mM LDN193189 ו 1.6 mM GSK650394) היה מנוהל באונות המוח הנגדית של 4-שבוע-הישן Xi-Mecp2-Gfp עכברים על ידי הזרקה תאיים באמצעות הליכים כירורגיים סטריאוטקטיקה ( איור 2A , B). הנוהל חזר בכל יום שני (איור 2C), ושלושה שבועות לאחר מכן הורדמים בעלי חיים, והמוחות היו מבודדים. קבוצת משנה אחת שימשו לרביעיית היכל-PCR ואחרת נותחה על ידי אימונוהיסטוכימיה. הביטוי של Mecp2 ומסוג פראי-Mecp2-gfp באונות הרכב-והתרופות, נקבע על ידי רביעיית ה-PCR (רצפי התחל המפורטים בטבלה 1). כפי שמוצג באיור 2D, הטיפול בתרופות מופעל מראש Xi-Mecp2-gfp ~ 30% של תאים בחצי הכדור המוח המוחדרת, בעוד Xi- Mecp2-gfp לא זוהה בחצי הכדור בתוך הרכב. מספר גדול של MAP2, סמן עצבי, נוירונים חיוביים היו גם GFP חיובי (~ 45%) בחצי הכדור שטופלו בסמים, מעיד על הביטוי Xi-Mecp2-Gfp . כ 20% של תאי המוח MAP2 שליליים הביע GFP, מאשרת Xi-Mecp2-Gfp ההפעלה מראש בתאים שאינם עצביים (איור 2e).

Figure 1
איור 1: הדור והאימות Xi-Mecp2 מודל העכבר. (א) סכמטי של אסטרטגיית הרבייה להפקת XistΔ: Mecp2/Xist: עכברים Mecp2-gfp . (ב) PCR הקלדה של Xist: Mecp2-Gfp/Y, XistΔ: Mecp2/Xist: Mecp2 ו XistΔ: Mecp2/xist: Mecp2-gfp עכברים. עכברים היו תחת פיקוח על נוכחות של Mecp2-Gfp, Mecp2 ובאזור קביעת מין Y (sry). (ג) זרימה cy, לנסות ניתוח של גרעינים מבודדים מקליפת העכבר. Mecp2/Mecp2-gfp קליפת העכבר להראות ~ 50% של גרעיני gfp-בעוד XistΔ: Mecp2/Xist: Mecp2-gfp מראה לא גרעיני gfp-חיובי. (ד) רביעיית-PCR ניתוח מעקב אחר הביטוי של Mecp2-gfp ומסוג פראי Mecp2 ב נקבה XistΔ: Mecp2/xist: Mecp2-gfp mefs בעקבות הטיפול עם dmso או תרופות (LDN193189 ו GSK650394). . בקרת העמסה הייתה תחת פיקוח (ה) מעקב כמותי לניטור בעוצמה מלאה בXistΔ נקבה : Mecp2/Xist: Mecp2-gfp mefs בעקבות הטיפול עם DMSO או תרופות LDN193189 ו GSK650394. MEFs מבודדים מ Mecp2/Y או Mecp2/Mecp2-gfp שימשו פקדים חיוביים שליליים, בהתאמה. כל נקודה מייצגת את ה-MEF, והקו המקווקו מציין את אות הרקע המירבי שהתקבל ב- Mecp2/Y, שהוגדר כ-1. החלונית התחתונה מציגה תמונות מייצגות של גרעינים. דמות זו שונתה מפרזנבסקי ואח '16. אנא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

Figure 2
איור 2: ההפעלה הפרמקולוגית של Mecp2 מקושרים ב-X בנוירונים בקליפת המוח של עכברים חיים. (א) סכימטי של גולגולת העכבר ו (ב) במוח מראה את האתר של הזרקה עבור הרכב או התרופה באונות השמאלית או הימנית של המוח. (ג) סכמטי של משטר התרופות. (ד) מייצג את התמונות החיסוריאליות המציגות את אות gfp (ירוק) בחלקים במוח ילתית מהמידורים או התרופות שטופלו על-ידי הרכב. צביעת DAPI מוצגת בכחול. (ה) הנציגה החיסונית של מקטעי המוח הקורולית מפקחת על הביטוי של gfp (אנטי-gfp; אדום) ו MAP2 (ירוק) בחצי הכדור שטופלו בסמים. צביעת DAPI מוצגת בכחול. דמות זו שונתה מפרזנבסקי ואח '16. אנא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

פריימר הפוכה (5 '-> 3 ') אורך מוצר בטמפרטורה/PCR
מיכל ברקת 60 ° צ'/87 bp
מיכאל ברקת 62 ° c/137 bp
מיכל הלוי 62 ° צ'/140 bp
GCACAACCCCGCAAATGCTA 62 ° צ'/364 bp
GCACAACCCCGCAAATGCTA 62 ° c/250 bp
ליאת שגיא 62 ° צ'/436 bp
כרומטוגרפיה 62 ° צ'/217 bp
CTCCTCTGTGACACTTTAGCCCTCCGA 66 ° c/270 bp

שולחן 1: רשימה של צבעי יסוד המשמשים להקלדת הגנוזה וכמותי בזמן אמת-PCR.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

בעבר, XCIFs כי הם נדרשים באופן סלקטיבי עבור השתקה של גנים מקושרים Xi בתאי נשים ביונקים זוהו12. אנחנו עוד אופטימיזציה מולקולה קטנה חזקה מעכבי כדי XCIFs היעד, כגון ACVR1 ו המורד הזרם של PDPK1, אשר ביעילות הפעלה מחדש של Xi Mecp2 בעכבר פיברוההדף קווים תא, נוירונים בקליפת העכבר, ו תא האדם פיברוביסט קו שנגזר מחולה RTT. תוצאות אלה מרמזות כי Xi ההפעלה העצמית היא גישה טיפולית סבירה כדי להציל את הליקויים גנים בחולים מקושרים X מחלות; עם זאת, בvivo הכדאיות נותר להיקבע. לאחרונה, XCIF מעכבי הוכחו להפעיל מחדש את Mecp2 מקושרים של Xi ב vivo, שעבורם מודל שאינו אקראי XistΔ: Mecp2/xist: הדגם Mecp2-gfp של העכבר נוצר.

תכונה אטרקטיבית של הXistΔ : Mecp2/Xist: דגם Mecp2-Gfp הוא שהוא מאפשר כימות מדויקת של הMecp2 המקושרים של Xi ההפעלה מספר סיבות. ראשון, בשל מחיקת xist על כרומוזום X אימהי, XistΔ: Mecp2/Xist: Mecp2-gfp העכבר יש לא אקראי xci. כתוצאה מכך, Mecp2 מבחינה גנטית הוא שותק ב 100% של תאים (איור 1c), בניגוד צפוי 50:50 ביטוי של גנים מקושרים X בדגמים אקראיים xci עכברים, כגון Xist: Mecp2/Xist: Mecp2-gfp. לכן, התוצאות אינן מנעה על ידי ביטוי הפסיפס של GFP, ו 100% תאים לשאת Mecp2-gfp על Xi XistΔ: Mecp2/Xist: Mecp2-gfp המודל. שנית, התיוג הגנטי של Mecp2 מאפשר ויזואליזציה ישירה של נוירונים בודדים עם gfp מופעל מראש, ובכך למזער את המניפולציות ניסיוני בניתוח עצבי.

מחקר שנערך לאחרונה מצא כי הזרקה תאיים של מעכבי XCIF באונה המוח העכבר מפעיל מחדש Xi מקושרים Mecp2 באמצעות ניתוח immunofluorescence המוח העכבר16. וחשוב מכך, לטיפול בסמים לא הייתה השפעה שלילית על הבריאות הכללית, כגון משקל, טיפוח או ניידות16. כמו-כן, אין רעילות שזוהתה על-ידי טיפול תרופתי בכבד או בטחול. יחד, מחקר זה מספק הוכחה מהותית של עקרון להפגין כי הפרעה לפונקציה של XCIFs מוביל דה דיכוי של Xi ב vivo.

לסיכום, ניתן להשתמש במודל עכבר רגיש כדי להעריך את ההפעלה מראש של Xi. עיצוב מודל זה חיה יכול גם להיות מותאם ליצירת מודל משופר העכבר RTT הנמלים מוטציות Mecp2 (כנראה פחות סימפטומטי) על כרומוזום X פעיל פראי-סוג Mecp2 על Xi בכל התאים. בשל xci לא אקראי, בעוד הסימפטומים גמישות פנוטיפית עשוי להיות מבוטא יותר, הוא צפוי כי מודל זה יאפשר גם הערכה טובה יותר והערכה מדויקת של היפוך הסימפטומים בשל Xi ההפעלה מראש. בנוסף, XistΔ: Mecp2/Xist: Mecp2-Gfp ניתן גם לשנות כדי לחקור את ההפעלה הראשונה של מודלים אחרים הקשורים ב-X, כגון תסמונת DDX3X.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

. למחברים אין מה לגלות

Acknowledgments

המחברים מודים אנטוניו בדפורלוב על מתן ריאגנטים; אוניברסיטת וירג היסטולוגיה רקמות הליבה להקפאה; האוניברסיטה של וירג זרימה Cyהליבה ליבה עבור הניתוח cy, הזרמת הזרימה; כריסטיאן בלו ו Saloni סינג לקבלת סיוע טכני עם הדפס. עבודה זו היתה נתמכת על ידי מענק כפול מחקר Z.Z., ואת התוכנית פיילוט פרויקט פרס מאוניברסיטת וירג-וירג טק הקרן הטכנולוגי הקרן הארטבאר בודדים במחקר ביו פרס על S.B.

Materials

Name Company Catalog Number Comments
MICE
Mecp2tm3.1Bird The Jackson Laboratory #014610
B6;129-Xist (tm5Sado) provided by Antonio Bedalov, Fred Hutchinson Cancer Center, Seattle
REAGENTS
22x22 mm coverslip FISHERfinest (Fisher Scientific) 125488
32% Paraformaldehyde Electron Microscopy Sciences 15714-S
50 ml syringe Medline Industries NPMJD50LZ
60mm culture dish CellStar 628160
7-AAD BioLegend 420403
ammonium chloride (NH4Cl) Fisher Chemical A661-3
anti-GFP-AlexaFluor647 Invitrogen A-31852
anti-MAP2 Aves Labs MAP
BSA Promega R396D
Buprenorphine SR Zoopharm
citric acid Sigma C-1857
DMSO Fisher Bioreagents BP231-100
Dulbecco's Modified Eagle Medium (DMEM) Corning Cellgro 10-013-CV
Ethanol Decon Labs 2701
fetal bovine serum (FBS) VWR Life Science 89510-198
gelatin Sigma-Aldrich G9391
glass slides Fisherbrand 22-034-486
goat anti-chicken FITC-labeled secondary antibody Aves Labs F-1005
GSK650394 ApexBio B1051
hamilton 10μl syringe Hamilton Sigma-Aldrich 28615-U
Hank's Balanced Salt Solution (HBSS) Gibco 14025-092
Ketamine Ketaset NDC 0856-2013-01
Large blunt/blunt curved scissors Fine Science Tools 14519-14
LDN193189 Cayman Chemicals 11802
lodixanol Sigma 1343517
magnesium chloride (MgCl2) Fisher Chemical M35-212
Methylcelulose Sigma M0262-100G
mounting medium with DAPI Vectashield H-1200
Needle tip, 26 GA x 1.25" PrecisionGlide 305111
ophthalmic ointment Refresh Lacri-Lube 93468
optimal cutting temperature (O.C.T.) ThermoFisher
PCR mix
Penicillin/Streptomycin (Pen/Strep) Corning 30-002-Cl
Phosphate buffered saline pH 7.4 (PBS) Corning Cellgro 46-103-CM
Potassium chloride (KCl) Fisher Scientific P330-500
scalpel blades
Shallow glass or plastic tray
skin glue/tissue adhesive 3M Vetbond 1469SB
sodium azide Fisher Scientific CAS 26628-22-8
Sodium chloride (NaCl) Fisher Chemical S642-212
standard hemostat forceps Fine Science Tools 13013-14
Standard tweezers Fine Science Tools 11027-12
Straight iris scissors Fine Science Tools 14058-11
sucrose Fisher Scientific BP220-1
Tris-base Fisher Bioreagents BP152-5
Triton X-100 Fisher Bioreagents BP151-500
Trypsin-EDTA Gibco 15400-054
Xylazine Akorn NDC: 59399-111-50
EQUIPMENT
Zeiss AxioObserver Live-Cell microscope Zeiss Zeiss AxioObserver
0.45mm burr IDEAL MicroDrill 67-1000
BD FACScalibur
centrifuge
glass homogenizer
cell culture incubator Thermo Scientific HERACELL VIOS 160i 13-998-213
Leica 3050S research cryostat
stereotactic platform
thermocycler
Timer
ultracentrifuge Beckman Coulter Optima L-100 XP
Water bath (37 ºC) Fisher Scientific Isotemp 2239

DOWNLOAD MATERIALS LIST

References

  1. Lyon, M. F. X-chromosome inactivation as a system of gene dosage compensation to regulate gene expression. Progress in Nucleic Acid Research and Molecular Biology. 36, 119-130 (1989).
  2. Heard, E. Delving into the diversity of facultative heterochromatin: the epigenetics of the inactive X chromosome. Current Opinion in Genetics Development. 15, (5), 482-489 (2005).
  3. Augui, S., Nora, E. P., Heard, E. Regulation of X-chromosome inactivation by the X-inactivation centre. Nature Review Genetics. 12, (6), 429-442 (2011).
  4. Pontier, D. B., Gribnau, J. Xist regulation and function explored. Human Genetics. 130, (2), 223-236 (2011).
  5. Barnes, C., Kanhere, A. Identification of RNA-Protein Interactions Through In Vitro RNA Pull-Down Assays. Methods in Molecular Biology. 1480, 99-113 (2016).
  6. McHugh, C. A., et al. The Xist lncRNA interacts directly with SHARP to silence transcription through HDAC3. Nature. 521, (7551), 232-236 (2015).
  7. Minajigi, A., et al. Chromosomes. A comprehensive Xist interactome reveals cohesin repulsion and an RNA-directed chromosome conformation. Science. 349, (6245), (2015).
  8. Mira-Bontenbal, H., Gribnau, J. New Xist-Interacting Proteins in X-Chromosome Inactivation. Current Biology. 26, (8), R338-R342 (2016).
  9. Mira-Bontenbal, H., Gribnau, J. New Xist-Interacting Proteins in X-Chromosome Inactivation. Curren Biology. 26, (10), 1383 (2016).
  10. Ridings-Figueroa, R., et al. The nuclear matrix protein CIZ1 facilitates localization of Xist RNA to the inactive X-chromosome territory. Genes and Development. 31, (9), 876-888 (2017).
  11. Sunwoo, H., Colognori, D., Froberg, J. E., Jeon, Y., Lee, J. T. Repeat E anchors Xist RNA to the inactive X chromosomal compartment through CDKN1A-interacting protein (CIZ1). Proceedings of National Academy of Sciences of the United States of America. (2017).
  12. Bhatnagar, S., et al. Genetic and pharmacological reactivation of the mammalian inactive X chromosome. Proceedings of National Academy of Sciences of the United States of America. 111, (35), 12591-12598 (2014).
  13. Zoghbi, H. Y., Percy, A. K., Schultz, R. J., Fill, C. Patterns of X chromosome inactivation in the Rett syndrome. Brain Development. 12, (1), 131-135 (1990).
  14. Anvret, M., Wahlstrom, J. Rett syndrome: random X chromosome inactivation. Clinical Genetics. 45, (5), 274-275 (1994).
  15. Amir, R. E., et al. Rett syndrome is caused by mutations in X-linked MECP2, encoding methyl-CpG-binding protein 2. Nature Genetics. 23, (2), 185-188 (1999).
  16. Przanowski, P., et al. Pharmacological reactivation of inactive X-linked Mecp2 in cerebral cortical neurons of living mice. Proceedings of Natlional Academy of Sciences of the United States of America. 115, (31), 7991-7996 (2018).
  17. Borensztein, M., et al. Xist-dependent imprinted X inactivation and the early developmental consequences of its failure. Nature Structural and Molecular Biology. 24, (3), 226-233 (2017).
  18. Jensen, E. C. Quantitative analysis of histological staining and fluorescence using ImageJ. Anatomical Record (Hoboken). 296, (3), 378-381 (2013).
  19. Cseke, L. J., Talley, S. M. A PCR-based genotyping method to distinguish between wild-type and ornamental varieties of Imperata cylindrica. Journal of Visualized Experiments. (60), (2012).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics