비활성 X 염색체에 대 한 Mecp2의 약리학 적 재 활성화를 위한 비 랜덤 마우스 모델

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

여기서, 우리는 비-랜덤 X 염색체 불 활성화와 함께 실행 가능한 여성 뮤 린 모델을 생성 하는 프로토콜을 설명 하 고, 즉 임산부-상속 된 X 염색체는 세포의 100%에서 불활성 이다. 우리는 또한 생체 내에서 비활성 X 염색체의 약리학 적 재 활성화의 타당성, 내성 및 안전성을 테스트 하기 위한 프로토콜을 설명 합니다.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Przanowski, P., Zheng, Z., Wasko, U., Bhatnagar, S. A Non-random Mouse Model for Pharmacological Reactivation of Mecp2 on the Inactive X Chromosome. J. Vis. Exp. (147), e59449, doi:10.3791/59449 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

X 염색체 불 활성화 (XCI)는 남녀 간의 유전자 투약 균형을 달성 하기 위해 암컷에서 1 개의 X 염색체의 랜덤 침묵 이다. 결과적으로, 모든 암컷은 X-연결 유전자 발현에 대 한 이종 접합 이다. XCI의 주요 규제 기관 중 하나는 XCI의 시작과 유지 보수에 필수적인 Xist입니다. 이전 연구는 큰 규모의 기능 손실 유전 화면을 사용 하 여 13 개의 트랜스 행 X 염색체 불 활성화 인자 (XCIFs)를 확인 했습니다. ACVR1 및 PDPK1와 같은 XCIFs의 억제는 짧은 헤어핀 RNA 또는 소 분자 억제제를 사용 하 여 배양 된 세포에서 X 염색체 연결 유전자를 재 활성화 합니다. 그러나 생체 내에서 비활성 X 염색체를 재 활성화 시키는 타당성 및 내성이 결정 될 수 있다. 이 목표를 향하여, Xistδ: Mecp2/Xist: Mecp2-Gfp 마우스 모형은 1 개의 X 염색체에 xist 의 삭제 때문에 비 랜덤 xci로 생성 되었습니다. 이 모델을 사용 하 여 비활성 X 재 활성화의 정도는 마우스 뇌에서 XCIF 억제제로 처리 된 다음에 양자화 되었다. 최근 발표 된 결과에 따르면, 처음으로 XCIFs의 약리학 적 저해는 살아있는 마우스 뇌의 대뇌 피 질의 뉴런에서의 비활성 X 염색체 로부터 Mecp2 을 재 활성화 시킨다.

Introduction

X 염색체 불 활성화 (XCI)는 x 염색체의 1 카피를 여성에 게 침묵 시켜 서 X-연결 된 유전자 발현을 균형 조정하는 투약 보상의 과정 이다. 그 결과, 비활성 X 염색체 (Xi)는 히스톤 H3-리 신 27 trimethylation (H3K27me3) 및 히스톤 H2A 유비퀴틴 화와 같은 DNA 메 틸 화 및 억제 히스톤을 포함 하는 이종 염색 질의 특징을 축적 한다 (H2Aub) 2. x 염색체 침묵의 마스터 조절기는 x 염색체의 카운팅 및 쌍을 제어 하는 약 100500kb의 x-불 활성화 센터 (Xic) 영역, 비활성화를 위한 x 염색체의 무작위 선택 및 개시 및 X 염색체를 따라 침묵의 확산3. X 불 활성화의 과정은 x 염색체 전체의 침묵을 매개 하 고 3 차원 구조를 리 모델링 하 여 ci 에 Xi를 코팅 하는 비활성 특이 적 전사체 (xist) x에 의해개시 된다. 최근에, 몇몇 프로테오 믹 및 유전 성 스크리닝은 xci,예컨대 xist 상호작용 단백질5,6,8,9 등의 추가의 조절기를 동정 하였다 , 10 , 11 , 12. 예를 들어, 이전에는 편견 된 게놈 전체의 RNA 간섭 화면을 이용 하 여 13 개 트랜스-작용 Xci 팩터 (xci)12를 확인 하였다. 기계적으로 XCIFs는 Xist 표현식을 조절 하므로 xcifs 기능을 방해 하면 결함이 있는 xcifs12가 발생 합니다. 이 분야의 최근 진보는 XCI를 시작 하 고 유지 하는 데 필요한 분자 기계에 대 한 중요 한 통찰을 제공 했습니다.

Xci 레 귤 레이 터의 식별 및이의 메커니즘을 이해 하는 것은 rett 일으키는 증후군 (RTT)13과 같은 X 연결 인간 질병과 직접적으로 관련이 있습니다. RTT는 주로 여자15에 영향을 미치는 X-결합 메 틸-CpG 결합 단백질 2 (MECP2)에서의 이성애 변이에 의해 발생 하는 드문 신경 발달 장애입니다. MECP2 는 X 염색체에 위치 하기 때문에, RTT 소녀는 MECP2 변이 MECP2를 발현 하는 야생 형 및 ~ 50%를 발현 하는 세포 ~ 50%의 결핍에 의존 하 고 있다. 특히, RTT 돌연변이 세포는 시 Mecp2 의 휴면 하지만 야생 형 카피를 항구에 정박 하 여, 활성화 된 경우 잠재적으로 질병의 증상을 완화 시킬 수 있는 기능적 유전자의 공급원을 제공 합니다. RTT 외에도 Xi의 재 활성화는 DDX3X 증후군과 같은 잠재적인 치료 접근법을 나타내는 여러 가지 다른 X 연결 인간 질환이 있습니다.

XCIFs의 억제, 3 phosphoinositide 의존적인 단백질 키나 제 PDPK1) 및 액티 빈 수용 체 타입 1(ACVR1), 짧은 헤어핀 RNA (shRNA) 또는 소 분자 억제제에 의해, Xi-연결 된 유전자를 재 활성화 시킨다12. Xi-연결 된 유전자의 약리학 적 재 활성화는 RTT 환자 (12) 로부터 유래 된 마우스 섬유 아 세포 주, 성체 마우스 피 질 뉴런, 마우스 배아 섬유 모 세포 및 섬유 모 세포 주를 포함 하는 다양 한 전 생체 모델에서 관찰 된다. 그러나, Xi에 연결 된 유전자의 약리학 적 재 활성화 여부는 생체 내에서 입증 될 수 있다. 한 가지 제한 요인은 재 활성화 된 Xi에서 유전자의 발현을 정확 하 게 측정 하는 효과적인 동물 모델의 부족 이다. 이 목표를 향하여, Xistδ: Mecp2/Xist: Mecp2-Gfp 마우스 모형은 모계 X 염색체16에 있는 xist 에 있는 이성애에 있는 다 수 적 삭제 때문에 모든 세포에서 Xi에 유전자로 표지 된 Mecp2 를 운반 하는 생성 되었습니다. 이 모형을 사용 하 여, Xi에서 Mecp2 의 표현은 살아있는 쥐의 두뇌에 있는 xcifs 억제제를 가진 처리 다음에 정량화 되었습니다. 여기서, 상기 Xistδ의 생성은: Mecp2/Xist: Mecp2-Gfp 마우스 모델과 면역 형광 기반 분석 법을 사용 하 여 피 질 뉴런에서의 양자화 된 Xi 재 활성화 방법을 설명 한다.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

마우스와 관련 된 작업 버지니아 대학 기관 동물 관리 및 사용 위원회에 의해 승인 되었다 (IACUC; #4112).

1. Mecp2 에 유전으로 표시 된 비 랜덤 Xci 마우스 모델 생성

참고: 연구에 사용 되는 마우스 균 주는 다음과 같이 하였다: Mecp2-gfp/Mecp2-gfp (Mecp2 tm는 새, 물자의 테이블) 및 xist/δ xist (B6 > <;를 제공 합니다. 안토니오 베다로 브, 프레드 허 친 슨 암 센터, 시애틀). 각각의 균 주 들 중에서 사육 전략은 각각의 균 주에 대 한 마우스 콜로 니를 확장 하도록 설계 되었다.

  1. 표 1에 열거 된 유전자 특이 적 프라이 머를 사용 하 여 사육 후 얻어진 모든 생쥐 균 주와 각각의 양성자에 대 한 PCR 유전형 분석을 수행 한다.

2. 생성 하는 마우스 사육 전략을 설계 합니다. Mecp2/Xist: Mecp2-Gfp

  1. Mecp2-Gfp/Y 수 컷과 XistΔ-Mecp2/Xist-Mecp2 여성을 함께 하우징 하 여 번 식 쌍을 설정 합니다 (그림 1a). 이상적으로, 실행 가능 하 고 비옥한 쥐를 사용 하 여 한 번에 적어도 5 번 사육 쌍을 설정 합니다. 임신 한 여성이 출산 후, 그녀는 남성과 그녀의 첫 번째 쓰레기를 인상 할 수 있습니다.
    참고: 때문에 아버지의 xist 녹아웃 손상 된 xci, 복용량 보상, 그리고 분화 경로17, 사육에서 xistδ-Mecp2/Y 마우스의 사용은 필요한 유전자 형으로 여성 새끼를 생산 하는 데 실패 합니다.
  2. 후 산 후 일 21 (P21)에서 쓰레기를 본 후에는 Xistδ: Mecp2/Xist: Mecp2-Gfp 여성 새끼는 PCR 기반 유전형 분석 법을 사용 하 여 식별 하 고 태그를 지정 합니다 (그림 1b).
    참고: 그룹 당 필요한 동물의 수 측면에서, 아래에 보고 된 결과를 위해, 5 번의 사육 쌍은 약 10 여성 Xistδ: Mecp2/Xist: Mecp2-Gfp 마우스를 생성 하는 설정 되었다.
  3. 모든 제안 된 실험에 대 한 여성 마우스 모델을 사용 합니다.
    참고: 섹스는 XCI 연구에 대 한 중요 한 생물 학적 변수 이며, 남성 모델은 랜덤 XCI의 혼동 효과를 고려 하지 않습니다.
  4. 동물 연구를 통해 일관 되 고 동물 연령의 모든 효과를 배제 하기 위해, 5-8 주 령 여성 Xistδ: Mecp2/Xist: Mecp2-Gfp 쥐의 모든 실험을 수행 한다.

3. 분리 여성 Xistδ: Mecp2/Xist: Mecp2-Gfp 마우스 배아 섬유 아 세포 (mefs)

  1. Mecp2-Gfp/Y 수 컷과 Xistδ-Mecp2/Xist-Mecp2 여성 사이의 시간 결합을 설정 합니다. 임신 가능성을 높이기 위해 최소 3 개의 결합 케이지를 설정 하십시오.
  2. 짝짓기 후 아침에 질 플러그를 확인 한 후, 여성을 분리 하 고이 날은 배아 날 0.5 (E 0.5)로 간주 됩니다. 장래 임산부의 체중 증가를 모니터링 하 고 생쥐의 복 부를 육안으로 검사 하 여 임신을 확인 합니다. E 14.5-15.5에서 경 추 탈 구를 통해 임신 한 여성 마우스를 안락사 시킵니다.
  3. 층 류 후드 아래에 70% 에탄올로 임산부의 복 부를 닦아 냅니다. 무 균가 위를 사용 하 여 복 강을 분해 하 고 배아를 포함 하는 자 궁 뿔을 제거 합니다. 핀셋을 사용 하 여 남은 복 부 조직을 절단 하는 동안 배아를 부드럽게 꺼내 냅니다 (6-12 배아는 일반적으로 예상 됨).
  4. 배아를 포함 하는 자 궁 뿔을 10mm 조직 배양 접시에 넣습니다. 무 균가 위 및 집게를 사용 하 여 배아를 운반 하는 개별 낭을 분리 하기 위해 자 궁 뿔을 따라 절 개 하십시오. 신중 하 게, 나머지 배아를 포함 하는 자 궁 뿔을 얼음 위에 30ml의 멸 균 된 하 Ks의 균형잡힌 염 용액 (HBSS)에 넣습니다.
  5. 부드럽게 자른 낭을 열고 무 균가 위 및 집게를 사용 하 여 배아를 분리 합니다. 탯 줄을 절단 하 여 태 반을 제거 하십시오.
  6. 배아를 욕 한다.
    참고: 배아 조직의 나머지 부분은 더 처리 될 것 이지만, 배아 머리의 조직은 유전형 분석을 위한 DNA를 분리 하는 데 사용 됩니다.
  7. 무 균가 위 및 집게를 사용 하 여 배아의 중간 선을 절단 하 여 복 부를 엽 니 다. 심장, 간, 폐와 같은 내장 기관을 제거 하십시오.
  8. 남은 배아 조직을 멸 균 60 mm 조직 배양 플레이트로 옮겨가 위나 면도날을 사용 하 여 작은 조각으로 자릅니다. 세포 덩어리를 열기 위해 트립 신-EDTA 3 mL를 추가 하십시오 (0.05%). 15 분 동안 37 ° c에서 배양 한다.
  9. 10%의 태아 소 혈 청 (FBS)과 10 µ G/ml 페니실린/streptomycin (펜/스 트리 트)를 첨가 하 여 트립 신-EDTA를 중화 하 고 반복적 피 펫 팅 (약 DMEM 배)으로 조직을 해리 합니다.
  10. 300 x g 에서 세포를 5 분간 스핀 다운 하 고 DMEM 4ml의 셀 펠 렛을 10% FBS 및 10 µ의 펜/스 트 렙으로 다시 정지 시킵니다. 60 mm 배양 접시에 세포를 플레이트 하 고, 5% CO2의 존재 하에 37 ° c에서 세포를배양 한다.
  11. 각 배아에 대해 3.5-3.10 단계를 수행 하십시오.
  12. 배양 된 MEFs는 적어도 3-4 일 동안 3.11 단계에서 얻어진 다.
    참고: 이 단계에서, MEFs는 또한 미래의 실험을 위해 냉동 보존 될 수 있다.
  13. 각 배아의 성별 및 유전자 형을 확인 하기 위해, 표 1에 열거 된 프라이 머 및 PCR 조건을 이용 하 여 배아의 머리 로부터 분리 된 DNA를 이용 하 여 유전형 분석 pcr을 수행 한다.

4. Xistδ의 뇌에서 녹색 형광 단백질 (GFP) 발현의 부족을 확인 하십시오 : Mecp2/Xist: Mecp2 활성 세포 선별 기반 분석을 사용 하는-GFP 생쥐

  1. 가 위를 사용 하 여 뇌 반구의 나머지 부분에서 대뇌 피 질을 분리 하 고 250 mM 자당, 25mm 염화 칼륨 (KCl), 5mm 염화 마그네슘 (MgCl2), 10mm 트리 스 cl의 얼음-차가운 핵 분리 미디어 (NIM) 버퍼의 1 mL에 위치, 2% 파라 포름알데히드 (PFA) 및 0.1% 비 이온 성 계면 활성 제 (재료 표)로 보충 됩니다.
  2. 얼음-차가운 유리 균질 화기를 사용 하 여 균질 화.
  3. 600 x g, 4°c에서 5 분간 균질 화 된 조직을 스핀 다운 한다.
  4. NIM 용액에서 상 등 액 및 소생 펠 렛을 25%의 iodi황색 올의 1Ml에서 제거 한다.
  5. 4 mL ultracentrifuge 튜브에 NIM 용액에 29%의로 디 산 졸 1 mL을 넣고 (샘플이 준비 될 때까지 얼음 위에 보관) 시료 1Ml를 조심 스럽게 레이어 합니다 (25%로 디 산 놀).
  6. Ultracentrifuge에서 10 분 동안 9000 x g, 4°c에서 원심 분리기.
  7. 500 μ l의 형광 활성 세포 선별 (FACS) 완충 액 (인산 완충 식 염 수가 1Mmedta, 0.05% 나트륨 아 지 드 및 2% 소 혈 청 알 부 민 [BSA])로 보충 된 상 청 및 소생 펠 렛을 흡 인 한다.
    참고: 샘플은 4°c 또는 최대 1 주일에 보관할 수 있습니다.
  8. 상 온에서 5 분 동안 7-아미노 액티 50 D의 5 μ l를 첨가 하 여 DNA 얼룩을 냅니다.
  9. 유 세포 분석을 사용 하 여 7-AAD 및 녹색 형광 단백질 (GFP) 신호에 대 한 샘플을 분석 합니다.

5. Xistδ의 타당성 결정: Mecp2/Xist: Xi 재 활성화를 위한 Mecp2-Gfp 마우스 모형

  1. 종자 1 x 105cell/mL 여성 Xistδ: Mecp2/Xist: Mecp2 에서 3.12 단계에서 얻어진 Mecp2/Mecp2-GfpXist-Mecp2/Y mefs를 10% DMEM 및 10 FBS 펜/스 트 렙과 함께 µ에서 37 ° c에서 5% CO2의 존재.
    참고: Mecp2/Mecp2-GfpXist-Mecp2/Y mefs는 실험에서 양성 및 음성 대조 군으로 사용 된다.
  2. 24 시간 후에 세포에 신선한 배지를 추가 하십시오. Xistδ: Mecp2/Xist: Mecp2-Gfp Mefs는 xcifs 억제제 (예를 들어, 0.5 μ m LDN193189 및 2.5 μ m GSK650394) 또는 단독 차량으로 보충 된 배지를 추가 합니다. 2 일 마다 신선한 억제제 또는 차량을 단독으로 보충 하는 배지를 교체 하십시오. Mecp2/Mecp2Xist-Mecp2/Y mefs의 경우 2 일에 한 번씩 신선한 배지를 추가 하십시오.
  3. 1 주 후에 억제제 치료를 하 고, MEFs를 RNA 분리 (6 웰 플레이트) 또는 면역 형광 (챔버 슬라이드)을 위해 고정 합니다. Mecp2/Mecp2 배아 로부터 분리 된 mefs를 각각 네거티브 컨트롤로 서 양성 및 Xist-Mecp2/Y 배아로 사용 한다.
    1. RNA 분리의 경우, 이세티 기반 RNA 추출 시 약으로 총 RNA를 분리 하 고 역 역전사를 사용 하 여 역 변환 합니다. 앞서 설명한 바와 같이 Mecp2-WTMecp2-gfp를 사용 하 고 표 1에 열거 된 프라이 머를 이용 하 여 정량적 역 역전사 (qrt-pcr)에의 한 Mecp2 발현을 측정 하였다.
    2. 면역 형광 염색을 위해, 항-GFP 일차 항 체 (1:100)를 가진 얼룩 mefs는,16이전에 기술 한 바와 같이. 이전에 설명 된 바와 같이 약물 처리 된 Xistδ: Mecp2/Xist: Mecp2-gfp mefs에서 정량적 면역 형광 화에의해 GFP 강도를 측정 합니다.

6. Xistδ의 뇌에서 약리학 적 Xi 재 활성화를 입증 하십시오: Mecp2/Xist: Mecp2-Gfp 마우스 모형

  1. 약물 및 차량 제어를 준비 합니다.
    1. 뇌 주사를 위해 0.9% 염화 나트륨, 0.5% 메 틸 셀 룰로 오 스, 4.5% 디 메 틸 설 폭 사이드의 신선한 멸 균 용액을 준비 합니다.
    2. 1.5 mM LDN193189 (ACVR1의 소 분자 억제제) 및 1.6 mM GSK650394 (SGK1의 소 분자 저 해제, PDPK1의 다운스트림 이펙터)를 포함 한 화학 억제제를 제조 하 여 차량에 재 부유 (0.9% 염화 나트륨, 0.5% 메 틸 셀 룰로 오 스, 4.5% DMSO) 또는 차량 혼자. 화학 억제제 또는 주입 된 차량의 총 부피는 동물 당 투여 량 당 10 µ L 이다.
  2. 뇌 주사를 위한 동물을 준비 합니다.
    1. 벤치와가 열 패드를 소독 제 (10% 차 아 염소 산 나트륨 용액)로 닦아 수술 부위를 준비 합니다.
    2. 4 주 오래 된 마우스를 각각 140 mg/kg 및 10mg/kg의 용량으로 케 타 민/자일 린 혼합물의 복 강 내 주입으로 마 취 시켰다. 마 취의 수준을 결정 하기 위해 페달 철수 반사를 사용 합니다.
    3. 각 막 건조를 방지 하기 위해 마 취의 유도 다음 눈에 안과 연 고를 적용 합니다.
    4. 목에서 마우스의 머리 꼭대기까지 털을 깎아 냅니다.
    5. 주 둥이 제한 수단은의 물린 막대에 마우스의 절 개를 후 킹 하 고 마우스의 머리가 레벨 평면에 있는지 확인 하면서 코 클램프를 조여 서 정위 플랫폼에 마우스를 놓습니다.
    6. 필요에 따라 귀 바의 높이를 조정 하 여 외이도의 꼬리 부분에 도달 하 고 마우스의 머리가 레벨 평면에 있고 손가락 터치에 고정 되도록 합니다.
    7. 포 비 돈-요오드와 70% 에탄올과 같은 국 소 방부 제를 번갈아 사용 하 여 마우스의 머리를 소독 합니다.
  3. 마약을 관리 하십시오.
    1. 무 균 메스를 사용 하 여, 두 피 중반에 0.75 센티미터의 수평 절 개를 하십시오.
    2. 0.45 mm 버를 사용 하 여 오른쪽 및 왼쪽 대뇌 피 질 반구 위의 두 개의 대칭 구멍을 뚫습니다 (시상 봉합 사에서 2mm와 양 정 뼈의 중심에서 약 2mm).
    3. 10 μ l 주사기를 정위 플랫폼에 단단히 부착 합니다.
    4. 화학 억제제의 용액을 혼합 하 고 주사기에 용액 10 μ l를 그리십시오. 주사기의 기포를 피하십시오.
    5. 바늘을 두개골에 수직 (90 °)으로 유지 하는 버 구멍에 주사기 바늘을 전진 시킵니다. 바늘이 두개골을 통과 할 때, 정위 디지털 디스플레이에 좌표를 0 2.5 mm의 깊이에 도달 할 때까지 바늘의 끝을 전진.
    6. 2mm에 대 한 깊이 바늘 0.5 mm을 철회.
    7. 용액 10 μ l를 서서히 주입 한다 (~ 1 분). 주사가 완료 된 후, 뇌의 바늘을 1 분 동안 두고 바늘을 철회 하십시오.
    8. 두 번째 반구에 대 한 주입을 반복 합니다 (차량 전용 제어).
    9. 봉합 사 또는 "피부 접착제"를 사용 하 여 마우스의 피부를 닫습니다 (상처가 > 0.5 cm 인 경우 봉합과 "피부 접착제"를 사용 해야 합니다).
    10. 귀 바를 느슨하게 하 고 정위 장치에서 마우스를 제거 합니다.
    11. 진통제 (부 프레 노르 핀 SR 0.5 밀리 그램/kg IP)를 투여 하 고 동물이 의식이 회복 될 때까지 37 ° c로 설정 된가 열 패드 위에 마우스를 놓습니다.
    12. 마우스가 경고 하 고 반응 하면, 원래 케이지에 동물을 다시 전송 합니다.
    13. 20 일 동안 2 일 마다 절차를 반복 합니다. 후속 주사에는 영역의 반복 드릴링이 필요 하지 않습니다.
  4. 마우스 뇌를 분리 합니다.
    1. 투여 식이 완료 되 면, CO2 챔버에서 마우스를 안락사 시켰다.
    2. 바늘을 사용 하 여 표면에 마우스를 고정 시킵니다.
    3. 가 위 및 집게를 사용 하 여 늑 골 케이지 바로 아래에 외피와 복 벽을 통해 측면 절 개를 하십시오. 간을 다이어 프 램에서 조심 스럽게 분리 합니다.
    4. 가 위를 사용 하 여 다이어 프 램을 자르고 늑 골 케이지의 전체 길이를 따라 절단 하 여 흉 막 강을 노출 시킵니다.
    5. 가 위를 사용 하 여 좌 심 실의 후부 끝을 절 개 하십시오.
    6. 즉시, ~ 약 15 mL의 PBS로 오른쪽 심장 챔버를 주입 시작 ~ 2 분. 간 색은 적색에서 옅은 분홍색으로 변화 하 여 양호한 관류를 나타냅니다.
    7. 마우스 심장의 우측 챔버를 PBS에 4%의 파라 포 르 말린 ~ 약 10 mL를 넣고 2 분 동안 주입 합니다.
    8. 마우스를 욕 하 고가 위를 사용 하 여 두개골을 노출 하는 두 피의 중간 선 절 개를 만듭니다.
    9. 가 위 한쪽 끝을 포 아 멘 매그넘에 넣고 두개골을 눈 쪽으로 옆으로 자릅니다. 반대쪽을 반복 합니다. 뇌의 부상을 방지 하기 위해 가능한 피상적으로가 위 끝을 유지 하려고 합니다.
    10. 가 위를 사용 하 여 눈과 마우스의 코 위로 영역을 자릅니다.
    11. 집게를 사용 하 여 뇌 반구에서 두개골 뼈를 부드럽게 벗 겨 냅니다.
    12. 주걱으로 뇌를 들어 올리고,가 위를 사용 하 여 두개골에 고정 하는 두개골 신경 섬유를 조심 스럽게 분해 합니다.
    13. 뇌를 플라스틱 접시에 놓고 소 뇌와 후 각 전구를 자르고 4% PFA 인 PBS로 채워진 15 mL 튜브에 뇌를 놓습니다.
  5. 크라이 오-섹션 마우스 브레인.
    1. 4%의 파라 포 름 알 데히드를 4°c에서 하룻밤에 4%의 뇌에 고정 시킵니다.
    2. 각각 5 분 동안 4 ° c 이상에서 PBS로 뇌를 헹 구 십시오.
    3. 티슈를 냉동 보존 하기 위한 일회용 몰드에 라벨을 부착 합니다.
    4. 가 위 및 집게를 사용 하 여 뇌의 전면을 잘라 (사출 사이트에서 ~ 5mm 섹션을 만들기 시작).
    5. 뇌의 앞면을 아래로 향하게 하 여 두뇌를 동결 금형으로 옮겨 코로나 섹션을 얻습니다. 최적의 절삭 온도 화합물 (OCT)에서 뇌가 포함 된 몰드를 서브 머지 한다.
    6. 액체 질소를 10mm 플라스틱 페 트리 접시에 붓고 cryo 몰드에 뇌를 질소로 넣습니다.
      참고: 6.5.5 단계에서 설명한 바와 같이 조직의 방향을 조정 하 여 뇌의 절편을 안내 하는 것이 중요 하다.
    7. OCT가 흰색으로 고정 되 면 냉동 된 뇌를-80 ° c 냉동 고에 넣어 보관 하십시오.
    8. 동결 상태 및 동결 부 (5-6 μ m 두께)로 절편 하기 전에 적어도 30 분 동안 뇌를-20°c로 평형 하 여 슬라이드 당 2-3 섹션을 장착 합니다. 슬라이드는 나중에 사용 하기 위해-80 ° c에서 저장할 수 있습니다.
  6. 면역 형광 기반 접근법을 사용 하 여 Xi 재 활성화를 결정 합니다.
    1. 염색 절차를 시작 하기 전에, 4 ° c에서 밤새 뇌 부분을 건조.
    2. 항 원 검색 용액 (0.1 M 구 연산, 0.1 M 트리 스 베이스, ph=6.0)에 슬라이드를 담가 5 분간의 100 온도 블록.
    3. 실 온에서 5 분간 각각 1x PBS로 슬라이드를 4 배로 씻으십시오.
    4. 블로킹 용액에 슬라이드를 담 그 십시오 (0.1 M NH 4CL/PBS/0.2% 젤라틴/0.05% 비 이온 성 계면 활성 제) 실 온에서 20 분 동안.
    5. 3 분 동안 실 온에서 세척 완충 액 (PBS/0.2% 젤라틴)을 사용 하 여 슬라이드 3x을 세척 하십시오.
    6. 항-GFP-AlexaFluor647 (1:100) 및 항 MAP2을 가진 항 체를 배양 배지 (PBS/0.2% 젤라틴/1% BSA)로 염색 하 고 4°c에서 밤새 배양 한다.
    7. 1 차 항 체를 수집 하십시오 (재사용할 수 있음). 실 온에서 총 30 분간 세척 완충 제를 사용 하 여 슬라이드 4x를 세척 하십시오.
    8. 염소 항-닭고기 형광 추적용 (FITC)로 라벨링 된 2 차 항 체 (1:1000)를 배양 하 고 어두운 곳에서 실 온에서 1-2 시간 인큐베이션 한다.
    9. 실 온에서 총 30 분간 세척 완충 제를 사용 하 여 슬라이드 4x를 세척 하십시오.
    10. 22mm x 50 mm 커버 슬립에 4 ', 6DIDINO-2-페니 린 돌을 장착 매 질 한 방울을 놓은 다음 커버 슬립을 슬라이드에 뒤집어 모든 티슈 섹션을 덮으 십시오.
    11. 이미지를 현미경으로 조정 하 고 명암 및 밝기에 맞게 이미지를 조절 합니다. 이미지를 캡처하고 약물 처리 및 차량 처리 모두에 대 한 GFP 양성 세포의 수를 정량화 : Mecp2/Xist: Mecp2-GFP 마우스 뇌 반구.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Xistδ의 타당성을 입증 하기 위해 : Mecp2/Xist: xi 재 활성화 연구를 위한 Mecp2 마우스 모델, xcif 억제제-xi-연결 된 Mecp2-gfp 의 매개 된 재 활성화는 마우스 배아 섬유 아 세포 (mefs)에서 시험 되었다. 여성 MEFs는 제 3 항 (도 1a)에 기재 된 바와 같은 15.5 Xistδ: Mecp2/xist 에서 분리 되었다. 여성 Xistδ의 유전형: Mecp2/Xist: Mecp2-Gfp mefs는 앞서 설명한 바와 같이 유전형 분석 PCR에 의해 확인 되었다 (도 1b), 및 FACS 계 검정 법 (도 1c). MEFs는 7 일 동안 DMSO 또는 2 개의 약물 LDN193189 및 GSK650394 (각각 0.5 μ m 및 2.5 μ m)로 처리 하였다. 약물 치료 후, Mecp2 의 발현을 QRT-PCR에 의해 모니터링 하였다. 도 1d에 나타난 바와 같이, 약물 치료는 DMSO가 아니고,Mecp2-Gfp 의 발현을 재 활성화 시켰다. 다음으로, 단계 5.3.2에서 설명한 바와 같이 개별 MEFs에서Mecp2-Gfp 발현의 정도를 결정 하기 위해 정량적 면역 형광 발광을 수행 하였다. 남성의 배아 로부터 분리 된 음성 제어 MEFs 로부터의 신호 (Mecp2/Y)는 양성 대조 군 Mecp2-gfp/Mecp2 mefs의 배경 및 ~ 66%로 설정 되어 핵 Gfp 신호를 가졌다. 예상 대로, Xistδ: Mecp2를 투여 한 Mecp2-gfp mefs는 매우 낮은 수준의 핵 gfp를 가졌다 (~ 3%). 대조적으로, 약물 처리 된 Xistδ의 ~ 31% : Mecp2/Xist: Mecp2 mefs는 핵 GFP에 대 한 양성 이었다 (도 1e). 이러한 결과는 XCIF 억제제가 MEFs에서 Xi-연결 된 Mecp2 를 재 활성화 한다는 것을 보여주고 있지만 xi 재 활성화의 정도는 세포 집단에 따라 달라 집니다.

약리학 적 Xi 재 활성화-기반 접근법의 타당성을 평가 하기 위해, 약물 치료가 Xistδ의 뇌에서 Xi-연결 된 Mecp2 를 재 활성화 하는지 여부 : Mecp2/Xist: Mecp2-Gfp 여성 마우스를 조사 하였다. 10 μ l의 비 히 클 또는 10 μ l의 XCIF 억제제 (1.5 mM LDN193189 및 1.6 mM GSK650394)는 정위 된 외과 수술을 사용 하 여 인트라 실 주사에 의해 4 주- Mecp2-Gfp 암컷 마우스의 반대 뇌 반구에 투여 되었다 ( 도 2a , B). 이 절차는 매초 마다 (그림 2c) 반복 되었고, 3 주 후에 동물을 안락사 시키고 뇌는 고립 시켰다. 하나의 서브 세트는 qRT-PCR에 사용 되었고 또 다른 서브셋은 면역 조직 화학에 의해 분석 되었다. 비 히 클-및 약물-함유 반구에서 야생 형 Mecp2Mecp2-Gfp 의 발현은 Qrt PCR ( 표 1에 열거 된 프라이 머의 서 열)에 의해 결정 되었다. 도 2d에 나타난 바와 같이, 약물 치료는 약물 주입 된 뇌 반구에 있는 세포의 ~ 30%에서Mecp2-gfp 를 재 활성화 한 반면, Xi- Mecp2-gfp 는 차량 주입 된 반구에서 검출 되지 않았다. 다 수의 MAP2, 뉴런 마커, 양성 뉴런은 또한 GFP 양성 이었다 (~ 45%) 약물 처리 된 반구에서,Mecp2-Gfp 발현을 지시 한다. 약 20%의 MAP2 음성 뇌 세포가 비 신경 세포에서 Xi-Mecp2-gfp 재 활성화를 확인 하는 gfp를 발현 했습니다 (도 2e).

Figure 1
그림 1:Mecp2 마우스 모델 생성 및 유효성 검사 (A) 생성에 대 한 사육 전략의 개략 : Mecp2/xist: Mecp2-Gfp 마우스. (B) Xist: Mecp2의 PCR 유전형 분석: Mecp2/xist: Mecp2 및 xistδ: Mecp2-gfp 생쥐. 마우스는 Mecp2, Mecp2 및 성별 결정 영역 Y (sry)의 존재를 모니터링 하였다. (C) 마우스 피 질 로부터 분리 된 핵의 유 세포 분석기 분석. Mecp2/Mecp2 마우스 외피는 Xistδ: Mecp2/Xist: Mecp2-gfp 는 gfp 양성 핵을 보여주지 않는 동안 gfp 양성 핵의 50%를 보여줍니다. (D) QRT-PCR 분석 여성 Xistδ에서 Mecp2 및 야생 형 Mecp2 전사체의 발현을 모니터링 하는 방법: Mecp2/xist: DMSO 또는 약물 (LDN193189 및 GSK650394)을 이용한 치료 후의 Mecp2-gfp mefs. 갭 dh 는 로딩 컨트롤로 모니터링 되었다. (E) 여성 Xistδ에 대 한 정량적 면역 형광 모니터링 GFP 강도 : Mecp2/Xist: Mecp2- DMSO 또는 약물 LDN193189 및 GSK650394를 사용한 치료 후에. Mecp2/Y 또는 Mecp2/Mecp2-Gfp 마우스 로부터 분리 된 mefs는 각각 음성 및 양성 대조 군으로 사용 되었다. 각 점은 MEF를 나타내고 대시 선은 1로 설정 된 Mecp2/Y 에서 얻은 최대 배경 신호를 나타냅니다. 아래 패널은 핵의 대표 사진을 보여줍니다. 이 그림은 Przanowski 외16에서 수정 되었습니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 2
도 2: 살아있는 쥐의 대뇌 피 질 뉴런에서 X-링크 된 Mecp2 의 약리학 적 재 활성화. (A) 뇌의 좌측 또는 우측 반구에서 차량 또는 약물에 대 한 주사 부위를 나타내는 마우스 두개골 및 (B) 브레인의 개략. (C) 약물 요법의 개략. (D) 차량-또는 약물 처리 반구에서 코로나 뇌 절편 내 인 성 GFP 신호 (녹색)를 보여주는 대표적인 면역 형광 이미지. DAPI 염색은 청색으로 나타난다. (E) 약물 처리 된 반구의 gfp (항-gfp; 적색) 및 MAP2 (녹색)의 발현을 모니터링 하는 코로나 뇌 섹션의 대표적인 면역 형광 이미지. DAPI 염색은 청색으로 나타난다. 이 그림은 Przanowski 외16에서 수정 되었습니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

리버스 프라이 머 (5 ' > 3 ') 아 네모 링 온도/PCR 제품 길이
한 입에 고양이 60 ° c/87 bp
이은 고의 지 62 ° c/137 bp
TGTCAGAGCCCTACCCATAAG 62 ° c/140 bp
탕에 하 라, 아이다호 62 ° c/364 bp
탕에 하 라, 아이다호 62 ° c/250 bp
AATTGCCCTAACGAGCACAC 62 ° c/436 bp
이은 고이 62 ° c/217 bp
CTCCTCTGTGACACTTTAGCCCTCCGA 66 ° c/270 bp

표 1: 유전형 분석 및 정량적 실시간 RT-PCR에 사용 되는 프라이 머 목록.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

이전에, 포유동물 여성 세포에서 Xi-연결 된 유전자의 침묵을 위해 선택적으로 요구 되는 XCIFs는12를 동정 하였다. 우리는 마우스 섬유 아 세포 주, 마우스 대뇌 피 질의 뉴런 및 인간 섬유 모 세포에서 Xi-연결 된 Mecp2 을 효율적으로 재 활성화 하는 PDPK1의 ACVR1 및 다운스트림 이펙터와 같은 xcifs를 대상으로 하는 강력한 소 분자 억제제를 추가로 최적화 했습니다. RTT 환자에서 파생 된 라인입니다. 이러한 결과는 Xi 재 활성화가 X-연결 된 질병 환자의 유전자 결핍을 구출 하는 그럴듯한 치료 적 접근법 임을 시사 한다. 그러나 생체 내 실현 가능성은 결정 되어야 한다. 최근에, XCIF 억제제는 Mecp2 의 Xi-연결 된 생체 내를 재 활성화 시키는 것으로 나타났다,이는 비 랜덤 Xistδ: Mecp2/Xist: Mecp2-Gfp 마우스 모델을 생성 하였다.

Xistδ의 매력적인 특징: Mecp2/Xist: Mecp2 모델은 여러 가지 이유로 Xi-연결 된 Mecp2 재 활성화의 정확한 정량화를 허용 한다는 것입니다. 첫째, 모계 X 염색체에 대 한 xist 의 결실으로 인해, Xistδ: Mecp2/Xist: Mecp2 마우스는 비 랜덤 xci를 가진다. 그 결과, 유전적으로 표지 된 Mecp2 은 100%의 세포 (도 1C)에서 X-연결 유전자의 예상 50:50와 달리 Xist: Mecp2/xist: MECP2 와 같은 임의의 xci 마우스 모델에서 침묵 된다. 따라서, 결과는 GFP의 모자이크 발현에 의해 배제 되지 않으며, 100% 세포는 Xistδ에서 Xi Mecp2-gfp 를 운반 한다 : Mecp2/xist: Mecp2-gfp 모형. 둘째, Mecp2 의 유전 적 라벨링은 활성화 된 GFP로 개별 뉴런의 직접적인 가시화를 허용 하 여 뉴런 분석에서 실험적 조작을 최소화 합니다.

최근 연구에의 하면 마우스 뇌 반구에 있는 XCIF 억제제의 심 실 주입이 마우스 뇌 (16)의 면역 형광 분석을 이용 하 여 Xi-연결 된 Mecp2 을 재 활성화 시키는 것을 발견 했습니다. 중요 하 게는, 약물 치료는 체중, 그루 밍, 또는 이동성 (16)과 같은 일반적인 건강에 악영향을 미치지 않았다. 더욱이, 간 또는 비장에서 약물 치료에 의해 검출 된 독성은 없다. 함께,이 연구는 XCIFs의 기능을 방해 하는 것은 생체에서 Xi의 억압에 이르게 입증 하기 위해 필수적인 증명을 제공 합니다.

요약 하자면, 민감한 마우스 모델을 사용 하 여 Xi의 재 활성화를 평가할 수 있습니다. 이 동물 모델 디자인은 또한 모든 세포에서 Xi에 활성 X 염색체 및 야생 형 Mecp2Mecp2 돌연변이 (아마 덜 징후)를 항구 하는 개선 된 RTT 마우스 모델을 생성 하기 위해 적응 될 수 있다. 비 랜덤 XCI로 인해, 표현 형 증상이 더 뚜렷할 수 있지만,이 모델은 또한 Xi 재 활성화로 인 한 증상의 역전의 더 나은 평가 및 정확한 평가를 허용 할 것으로 예상 된다. 추가적으로, Xistδ: Mecp2/Xist: Mecp2 는 또한 DDX3X 증후군과 같은 그밖 X 연결 질병 모형에 있는 Xi 재 활성화를 공부 하기 위하여 수정 될 수 있습니다.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

저자는 공개 할 것이 없습니다.

Acknowledgments

저자는 시 약을 제공 하기 위한 안토니오 Bedalov 감사 합니다; 냉동 절편에 대 한 버지니아 조직 조직학 코어 대학; 유 세포 분석을 위한 버지니아 대학교 유 세포 분석기 코어; 크리스천 블루와 샐로 니 싱은 유전형 분석에 대 한 기술 지원을 제공 합니다. 이 작품은 Z.Z.에 더블 후 연구 보조금에 의해 지원 되었다, 및 S.B.에 대학 버지니아 테크 종자 펀드 상 및 Hartwell 재단 개별 생물 의학 연구 상에서 파일럿 프로젝트 프로그램 상 수상

Materials

Name Company Catalog Number Comments
MICE
Mecp2tm3.1Bird The Jackson Laboratory #014610
B6;129-Xist (tm5Sado) provided by Antonio Bedalov, Fred Hutchinson Cancer Center, Seattle
REAGENTS
22x22 mm coverslip FISHERfinest (Fisher Scientific) 125488
32% Paraformaldehyde Electron Microscopy Sciences 15714-S
50 ml syringe Medline Industries NPMJD50LZ
60mm culture dish CellStar 628160
7-AAD BioLegend 420403
ammonium chloride (NH4Cl) Fisher Chemical A661-3
anti-GFP-AlexaFluor647 Invitrogen A-31852
anti-MAP2 Aves Labs MAP
BSA Promega R396D
Buprenorphine SR Zoopharm
citric acid Sigma C-1857
DMSO Fisher Bioreagents BP231-100
Dulbecco's Modified Eagle Medium (DMEM) Corning Cellgro 10-013-CV
Ethanol Decon Labs 2701
fetal bovine serum (FBS) VWR Life Science 89510-198
gelatin Sigma-Aldrich G9391
glass slides Fisherbrand 22-034-486
goat anti-chicken FITC-labeled secondary antibody Aves Labs F-1005
GSK650394 ApexBio B1051
hamilton 10μl syringe Hamilton Sigma-Aldrich 28615-U
Hank's Balanced Salt Solution (HBSS) Gibco 14025-092
Ketamine Ketaset NDC 0856-2013-01
Large blunt/blunt curved scissors Fine Science Tools 14519-14
LDN193189 Cayman Chemicals 11802
lodixanol Sigma 1343517
magnesium chloride (MgCl2) Fisher Chemical M35-212
Methylcelulose Sigma M0262-100G
mounting medium with DAPI Vectashield H-1200
Needle tip, 26 GA x 1.25" PrecisionGlide 305111
ophthalmic ointment Refresh Lacri-Lube 93468
optimal cutting temperature (O.C.T.) ThermoFisher
PCR mix
Penicillin/Streptomycin (Pen/Strep) Corning 30-002-Cl
Phosphate buffered saline pH 7.4 (PBS) Corning Cellgro 46-103-CM
Potassium chloride (KCl) Fisher Scientific P330-500
scalpel blades
Shallow glass or plastic tray
skin glue/tissue adhesive 3M Vetbond 1469SB
sodium azide Fisher Scientific CAS 26628-22-8
Sodium chloride (NaCl) Fisher Chemical S642-212
standard hemostat forceps Fine Science Tools 13013-14
Standard tweezers Fine Science Tools 11027-12
Straight iris scissors Fine Science Tools 14058-11
sucrose Fisher Scientific BP220-1
Tris-base Fisher Bioreagents BP152-5
Triton X-100 Fisher Bioreagents BP151-500
Trypsin-EDTA Gibco 15400-054
Xylazine Akorn NDC: 59399-111-50
EQUIPMENT
Zeiss AxioObserver Live-Cell microscope Zeiss Zeiss AxioObserver
0.45mm burr IDEAL MicroDrill 67-1000
BD FACScalibur
centrifuge
glass homogenizer
cell culture incubator Thermo Scientific HERACELL VIOS 160i 13-998-213
Leica 3050S research cryostat
stereotactic platform
thermocycler
Timer
ultracentrifuge Beckman Coulter Optima L-100 XP
Water bath (37 ºC) Fisher Scientific Isotemp 2239

DOWNLOAD MATERIALS LIST

References

  1. Lyon, M. F. X-chromosome inactivation as a system of gene dosage compensation to regulate gene expression. Progress in Nucleic Acid Research and Molecular Biology. 36, 119-130 (1989).
  2. Heard, E. Delving into the diversity of facultative heterochromatin: the epigenetics of the inactive X chromosome. Current Opinion in Genetics Development. 15, (5), 482-489 (2005).
  3. Augui, S., Nora, E. P., Heard, E. Regulation of X-chromosome inactivation by the X-inactivation centre. Nature Review Genetics. 12, (6), 429-442 (2011).
  4. Pontier, D. B., Gribnau, J. Xist regulation and function explored. Human Genetics. 130, (2), 223-236 (2011).
  5. Barnes, C., Kanhere, A. Identification of RNA-Protein Interactions Through In Vitro RNA Pull-Down Assays. Methods in Molecular Biology. 1480, 99-113 (2016).
  6. McHugh, C. A., et al. The Xist lncRNA interacts directly with SHARP to silence transcription through HDAC3. Nature. 521, (7551), 232-236 (2015).
  7. Minajigi, A., et al. Chromosomes. A comprehensive Xist interactome reveals cohesin repulsion and an RNA-directed chromosome conformation. Science. 349, (6245), (2015).
  8. Mira-Bontenbal, H., Gribnau, J. New Xist-Interacting Proteins in X-Chromosome Inactivation. Current Biology. 26, (8), R338-R342 (2016).
  9. Mira-Bontenbal, H., Gribnau, J. New Xist-Interacting Proteins in X-Chromosome Inactivation. Curren Biology. 26, (10), 1383 (2016).
  10. Ridings-Figueroa, R., et al. The nuclear matrix protein CIZ1 facilitates localization of Xist RNA to the inactive X-chromosome territory. Genes and Development. 31, (9), 876-888 (2017).
  11. Sunwoo, H., Colognori, D., Froberg, J. E., Jeon, Y., Lee, J. T. Repeat E anchors Xist RNA to the inactive X chromosomal compartment through CDKN1A-interacting protein (CIZ1). Proceedings of National Academy of Sciences of the United States of America. (2017).
  12. Bhatnagar, S., et al. Genetic and pharmacological reactivation of the mammalian inactive X chromosome. Proceedings of National Academy of Sciences of the United States of America. 111, (35), 12591-12598 (2014).
  13. Zoghbi, H. Y., Percy, A. K., Schultz, R. J., Fill, C. Patterns of X chromosome inactivation in the Rett syndrome. Brain Development. 12, (1), 131-135 (1990).
  14. Anvret, M., Wahlstrom, J. Rett syndrome: random X chromosome inactivation. Clinical Genetics. 45, (5), 274-275 (1994).
  15. Amir, R. E., et al. Rett syndrome is caused by mutations in X-linked MECP2, encoding methyl-CpG-binding protein 2. Nature Genetics. 23, (2), 185-188 (1999).
  16. Przanowski, P., et al. Pharmacological reactivation of inactive X-linked Mecp2 in cerebral cortical neurons of living mice. Proceedings of Natlional Academy of Sciences of the United States of America. 115, (31), 7991-7996 (2018).
  17. Borensztein, M., et al. Xist-dependent imprinted X inactivation and the early developmental consequences of its failure. Nature Structural and Molecular Biology. 24, (3), 226-233 (2017).
  18. Jensen, E. C. Quantitative analysis of histological staining and fluorescence using ImageJ. Anatomical Record (Hoboken). 296, (3), 378-381 (2013).
  19. Cseke, L. J., Talley, S. M. A PCR-based genotyping method to distinguish between wild-type and ornamental varieties of Imperata cylindrica. Journal of Visualized Experiments. (60), (2012).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics