Een niet-willekeurig muis model voor farmacologische reactivering van Mecp2 op het inactieve X-chromosoom

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Hier beschrijven we een protocol voor het genereren van een levensvatbare vrouwelijke muizenmodel met niet-Random X-chromosoom inactivatie, dat wil zeggen, de moederlijke erfelijke X-chromosoom is inactief in 100% van de cellen. We beschrijven ook een protocol om de haalbaarheid, tolerantie, en de veiligheid van farmacologische reactivering van het inactieve X-chromosoom in vivo te testen.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Przanowski, P., Zheng, Z., Wasko, U., Bhatnagar, S. A Non-random Mouse Model for Pharmacological Reactivation of Mecp2 on the Inactive X Chromosome. J. Vis. Exp. (147), e59449, doi:10.3791/59449 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

X-chromosoom inactivatie (XCI) is de willekeurige silencing van een X-chromosoom bij vrouwen te bereiken gen dosering evenwicht tussen de geslachten. Als gevolg hiervan zijn alle vrouwen zygoot voor X-gebonden genexpressie. Een van de belangrijkste regulatoren van XCI is xist, wat essentieel is voor de initiatie en het onderhoud van XCI. Eerdere studies hebben geïdentificeerd 13 trans Acting X-chromosoom inactivatie factoren (XCIFs) met behulp van een grootschalige, verlies-of-functie genetische scherm. Remming van XCIFs, zoals ACVR1 en PDPK1, met behulp van kort haarspeld RNA of kleine molecule inhibitoren, reactiveert X chromosoom-gebonden genen in gekweekte cellen. Maar de haalbaarheid en tolerantie van het reactiveren van het inactieve X-chromosoom in vivo moet nog worden bepaald. Naar dit doel, een XistΔ: Mecp2/xist: Mecp2-GFP muismodel is gegenereerd met niet-Random XCI als gevolg van schrapping van xist op een X-chromosoom. Met behulp van dit model, de omvang van inactief X reactivering werd quantitated in de muis hersenen na behandeling met XCIF remmers. Onlangs gepubliceerde resultaten tonen, voor de eerste keer, dat de farmacologische remming van XCIFs reactiveert Mecp2 van de inactieve X-chromosoom in corticale neuronen van de levende muis hersenen.

Introduction

X-chromosoom inactivatie (XCI) is een proces van dosering compensatie die X-gebonden genexpressie door silencing een kopie van het X-chromosoom in vrouwen1balanceert. Dientengevolge, accumuleert het inactieve X-chromosoom (XI) kenmerkende eigenschappen van heterochromatin met inbegrip van Methylation van DNA en remmende histone wijzigingen, zoals histone H3-lysine 27 trimethylation (H3K27me3) en histone H2A Ubiquitination (H2Aub) 2. de kapitein regulator van x-chromosoom silencing is de x-inactivatie Center (Xic) regio, ongeveer 100 − 500 KB, die het tellen en koppelen van de x-chromosomen, de willekeurige keuze van het x-chromosoom voor inactivatie controles, en de initiatie en uitspreiden van silencing langs het X-chromosoom3. Het proces van X inactivatie wordt geïnitieerd door X inactief specifieke transcriptie (xist) dat jassen de XI in CIS te bemiddelen chromosoom-brede silencing en remodelleren de driedimensionale structuur van het X-chromosoom4. Onlangs hebben verschillende Proteomic en genetische schermen geïdentificeerd extra regulatoren van XCI, zoals xist interactie eiwitten5,6,7,8,9 , 10 , 11 , 12. bijvoorbeeld, een eerdere studie met behulp van een onbevooroordeelde genoom-Wide RNA interferentie scherm geïdentificeerd 13 trans-Acting XCI factoren (XCIFs)12. Mechanistically, XCIFs reguleren xist expressie en dus interfereren met XCIFs functie veroorzaakt defecte XCI12. Samen, hebben de recente vooruitgang op het gebied belangrijke inzichten in de moleculaire machines verstrekt die nodig zijn om XCI in werking te stellen en te handhaven.

Identificatie van XCI regulators en het begrijpen van hun mechanisme in XCI is direct relevant voor X-gebonden ziekten van de mens, zoals RETT syndroom (RTT)13,14. RTT is een zeldzame neurologische aandoening veroorzaakt door een zygoot mutatie in de X-gebonden methyl-CpG bindende proteïne 2 (MECP2) die hoofdzakelijk van invloed op meisjes15. Omdat MECP2 is gelegen op het X-CHROMOSOOM, RTT meisjes zijn zygoot voor MECP2 deficiëntie met ~ 50% cellen uitdrukken wild-type en ~ 50% uitdrukken Mutant MECP2. Met name, RTT mutantcellen Harbor een slapende maar wild-type kopie van Mecp2 op de XI, het verstrekken van een bron van het functionele gen, die, indien gereactiveerd, zou kunnen verlichten de symptomen van de ziekte. Naast RTT, zijn er verscheidene andere X-verbonden menselijke ziekten, waarvoor de reactivering van XI een potentiële therapeutische benadering, zoals DDX3X syndroom vertegenwoordigt.

Remming van XCIFs, 3-phosphoinositide afhankelijke proteïne kinase-1 (PDPK1), en activin een receptortype 1 (ACVR1), of door korte haarspeld RNA (shRNA) of kleine molecule inhibitors, reactiveert XI-verbonden genen12. Farmacologische reactivering van XI-gebonden genen wordt waargenomen in verschillende ex vivo modellen die muis fibroblast cel lijnen, volwassen muis corticale neuronen, muis embryonale fibroblasten, en fibroblast cel lijnen afgeleid van een RTT patiënt12omvatten. Echter, of farmacologische reactivering van XI-gelinkte genen haalbaar is in vivo nog moet worden aangetoond. Één beperkende factor is het gebrek aan efficiënte dierlijke modellen om de uitdrukking van genen van gereactiveerd XI nauwkeurig te meten. Naar dit doel, een XistΔ: Mecp2/xist: Mecp2-GFP muismodel is gegenereerd dat draagt een genetisch gelabelde Mecp2 op XI in alle cellen als gevolg van zygoot schrapping in xist op de moeder X-chromosoom16. Gebruikend dit model, is de uitdrukking van Mecp2 van XI quantitated na behandeling met XCIFs inhibitors in de hersenen van het leven muizen geweest. Hier, de generatie van de XistΔ: Mecp2/xist: Mecp2-GFP muismodel en methodologie om quantitate XI reactivering in corticale neuronen met behulp van immunofluorescentie-gebaseerde assays wordt beschreven.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Het werk dat muizen impliceert werd goedgekeurd door de Universiteit van Virginia Institutional de zorg van het dier en het gebruiks Comité (DEC; #4112).

1. Genereer een niet-Random XCI muis model met genetisch gelabelde Mecp2 op XI

Opmerking: De stammen van de muis die in de studie worden gebruikt waren als volgt: Mecp2-GFP/Mecp2-GFP (Mecp2TM 3.1 vogel, lijst van materialen) en xist/ΔXist (B6; 129-xist < tm5Sado >; geleverd door Antonio Bedalov, Fred Het centrum van kanker van Hutchinson, Seattle). De strategieën van het fokken onder de respectieve spanningen zijn ontworpen om de muis kolonies voor elke spanning uit te breiden.

  1. Voer PCR-genotypen uit op alle muizenstammen en de respectieve progenieën verkregen na het fokken met behulp van Gene specifieke primers vermeld in tabel 1.

2. ontwerp de muis kweek strategie om XistΔ te genereren : Mecp2/xist: Mecp2-GFP

  1. Een kweek paar opzetten door een Mecp2-GFP/Y mannetje en een XistΔ-Mecp2/xist-Mecp2 vrouw samen te wonen (12 h/12 h: licht/donker cyclus) (Figuur 1a). Idealiter, het opzetten van ten minste 5 broedparen op een moment met behulp van levensvatbare en vruchtbare muizen. Na de zwangere vrouw geeft geboorte, laat haar haar eerste nestje te verhogen met de man.
    Opmerking: Omdat vaderlijke xist knock-out schaadt gestempeld XCI, doserings compensatie, en differentiatie trajecten17, zal het gebruik van XistΔ-Mecp2/Y muizen in het fokken niet aan de vrouwelijke pups te produceren met de vereiste genotype.
  2. Na het spenen van het nest bij post-Natal dag 21 (P21), Identificeer en tag de XistΔ: Mecp2/xist: Mecp2-GFP vrouwelijke pups met behulp van een PCR-based genotypen assay (Figuur 1b).
    Opmerking: In termen van het aantal dieren per groep, voor de hieronder gemelde resultaten, werden 5 kweekparen opgezet die ongeveer 10 vrouwelijke XistΔ produceerden : Mecp2/xist: Mecp2-GFP muizen.
  3. Gebruik vrouwelijke Muismodellen voor alle voorgestelde experimenten.
    Opmerking: Seks is een belangrijke biologische variabele voor XCI studies, en het mannelijke model is niet verantwoordelijk voor de verwarrende effecten van willekeurige XCI.
  4. Om consistent te zijn gedurende de dierstudies en uit te sluiten eventuele gevolgen van de dierlijke leeftijd, uit te voeren alle experimenten in 5 − 8-week-oude vrouwelijke XistΔ: Mecp2/xist: Mecp2-GFP muizen.

3. Isoleer vrouwelijke XistΔ: Mecp2/xist: Mecp2-GFP muis embryonale fibroblasten (MEFs)

  1. Instellen getimede paring tussen de Mecp2-GFP/Y Male en XistΔ-Mecp2/xist-Mecp2 vrouwelijk. Opstelling minstens 3 − 4 het koppelen kooien om de waarschijnlijkheid van zwangerschap te verhogen.
  2. Na bevestiging van de vaginale stekker de ochtend na de paring, scheiden de vrouwelijke en deze dag wordt beschouwd als embryonale dag 0,5 (E 0.5). Monitor de gewichtstoename van de aspirant-zwangere vrouw en visueel inspecteren de buik van de muizen om de zwangerschap te bevestigen. Op E 14.5 − 15.5, euthanaseren de zwangere vrouwelijke muizen via cervicale dislocatie.
  3. Onder een laminaire kap, veeg de buik van de zwangere vrouw met 70% ethanol. Met behulp van steriele schaar, ontleden de buikholte en verwijder de baarmoeder hoorns met de embryo's. Met behulp van een tang, voorzichtig nemen van de embryo's, terwijl het afsnijden van de resterende buik weefsel (6 − 12 embryo's wordt meestal verwacht).
  4. Plaats de baarmoeder hoorns met de embryo's in een 10 mm weefsel-cultuur schotel. Met behulp van steriele schaar en Tang, maak een incisie langs de baarmoeder hoorns te isoleren individuele zakjes die een embryo. Voorzichtig, plaats de baarmoeder hoorns met de rest van de embryo's in 30 mL van steriele Hanks ' evenwichtige zoutoplossing (Peeters) op ijs.
  5. Snijd de zak voorzichtig open en Isoleer het embryo met steriele scharen en tangen. Verwijder de placenta door het snijden van de navelstreng.
  6. Het embryo onthoofden.
    Opmerking: Terwijl de rest van het embryonale weefsel verder zal worden verwerkt, zal het weefsel van het embryo hoofd gebruikt worden om DNA te isoleren voor genotypen.
  7. Open de buik door het snijden van de middellijn van het embryo met steriele schaar en Tang. Verwijder de viscerale organen, zoals het hart, de lever, en de longen.
  8. Breng de resterende embryonale weefsel in een steriele 60 mm weefsel-cultuur plaat en snijd in kleine stukjes met behulp van een schaar of een scheermesje. Om te breken Open de cel bosjes, voeg 3 mL trypsine-EDTA (0,05%) en Incubeer bij 37 °C voor 15 min.
  9. Neutraliseer trypsine-EDTA door toevoeging van 5 mL Dulbecco gemodificeerde Eagle medium (DMEM) met 10% foetale boviene serum (FBS) en 10 µ g/mL penicilline/streptomycine (pen/keelontsteking) op de plaat en scheiden het weefsel door repetitieve pipetten (ongeveer 20 − 30 keer).
  10. Spin down cellen op 300 x g voor 5 min en re-Suspend de cel pellet in 4 ml van DMEM met 10% FBS en 10 µ g/ml pen/keelontsteking. Plaat de cellen op een 60 mm kweekschaal, en de cultuur van de cellen op 37 ° c in de aanwezigheid van 5% CO2.
  11. Voer stappen 3.5 − 3.10 uit voor elk embryo.
  12. Cultuur MEFs verkregen in stap 3,11 voor minstens 3 − 4 dagen.
    Opmerking: In dit stadium kan MEFs ook worden gecryopreserveerde voor toekomstige experimenten.
  13. Om het geslacht en het genotype van elk embryo te bepalen, voert men genotype-PCR uit met behulp van DNA dat geïsoleerd is van de hoofden van de embryo's met gebruikmaking van primers en PCR-voorwaarden vermeld in tabel 1.

4. Bevestig het gebrek aan groene fluorescente proteïne (GFP) uitdrukking in de hersenen van XistΔ: Mecp2/xist: Mecp2-GFP muizen gebruikend een Ffluorescence geactiveerde cel Sorteren-gebaseerde analyse

  1. Met behulp van een schaar, scheiden de hersenschors van de rest van de hersenhelften, en plaats in 1 mL van ijskoude kernen isolatie media (NIM) buffer met 250 mM sacharose, 25 mM kaliumchloride (KCl), 5 mM magnesiumchloride (MgCl2), 10 mm tris-cl, aangevuld met 2% Paraformaldehyde (topplatform), en 0,1% niet-ionische oppervlakteactieve stof (tabel van materialen).
  2. Meng met behulp van een ijskoud glas homogeniseer.
  3. Spin down gehomogeniseerd weefsel bij 600 x g, 4 °c voor 5 min.
  4. Verwijder bovendrijvende en opnieuw op te schorten pellet in 1 mL van 25% iodixanolgradiënten in NIM oplossing.
  5. Voeg 1 mL van 29% lodixanol in NIM oplossing toe aan een 4 mL ultracentrifuge buis (opslag op ijs tot de monsters klaar zijn) en zorgvuldig laag 1 mL monster (in 25% lodixanol).
  6. Centrifugeer bij 9.000 x g, 4 °c gedurende 10 min in een ultracentrifuge.
  7. Aspireren bovendrijvende en opnieuw op te schorten pellet in 500 l van fluorescentie geactiveerd cel sorteren (FACS) buffer (fosfaat-gebufferde zoutoplossing [PBS] aangevuld met 1 mM EDTA, 0,05% natrium azide, en 2% boviene serum albumine [BSA]).
    Opmerking: Monsters kunnen worden opgeslagen bij 4 °C of tot 1 week.
  8. Voeg 5 l van 7-amino-actinomycine D (7-AAD; 50 mg/mL) 5 min bij kamertemperatuur toe om DNA te bevlekken.
  9. Analyseer monsters voor 7-AAD en groene fluorescerende eiwit (GFP) signaal met behulp van flow Cytometry.

5. Bepaal haalbaarheid van de XistΔ: Mecp2/xist: Mecp2-GFP muis model voor XI reactivering

  1. Zaad 1 x 105 cellen/ml vrouwelijke XistΔ: Mecp2/xist: Mecp2-GFP MEFs, Mecp2/Mecp2-GFP en xist-Mecp2/Y MEFs verkregen in stap 3,12 in een 6-goed formaat en in kamer dia's, in DMEM met 10% FBS en 10 µ g/ml pen/keelontsteking, bij 37 °c in de aanwezigheid van 5% CO2.
    Opmerking: Mecp2/Mecp2-GFP en xist-Mecp2/Y MEFs worden gebruikt als positieve en negatieve controles in de experimenten.
  2. Voeg na 24 uur een nieuw medium toe aan de cellen. Voor XistΔ: Mecp2/xist: Mecp2-GFP MEFs, voeg medium aangevuld met XCIFs remmers (bijv. 0,5 μm LDN193189 en 2,5 μm GSK650394), of voertuig alleen. Vervang medium aangevuld met verse remmer of voertuig alleen om de 2 dagen. Voor Mecp2/Mecp2-GFP en xist-Mecp2/Y MEFs, voeg vers medium om de 2 dagen.
  3. Post 1 week van inhibitor behandeling, oogst MEFs of voor de isolatie van RNA (6-goed plaat) of moeilijke situatie cellen voor immunofluorescentie (kamer dia's). Gebruik MEFs geïsoleerd van Mecp2/Mecp2-GFP embryo's als positieve en xist-Mecp2/Y embryo's als negatieve controles respectievelijk.
    1. Voor de isolatie van RNA, Isoleer totaal RNA door guanidinium AMMONIUMTHIOCYANAATOPLOSSING-based RNA extractie reagens, en omgekeerde transcribeer gebruikend omgekeerde transcriptase. Meet Mecp2-GFP uitdrukking door kwantitatieve omgekeerde TRANSCRIPTASE-PCR (qRT-PCR) gebruikend Mecp2-WT en Mecp2-GFP, en inleidingen vermeld in tabel 1, zoals eerder beschreven12.
    2. Voor immunofluorescentie, vlek MEFs met een anti-GFP primair antilichaam (1:100), zoals eerder beschreven12,16. Meet GFP intensiteit door kwantitatieve immunofluorescentie in drug behandeld XistΔ: Mecp2/xist: Mecp2-GFP MEFs, zoals eerder beschreven18.

6. demonstreren van de farmacologische XI reactivering in de hersenen van de XistΔ: Mecp2/xist: Mecp2-GFP muis model

  1. Bereid drugs en voertuig controle.
    1. Bereid een verse, steriele oplossing van het voertuig (0,9% NaCl, 0,5% cellulose, 4,5% Dimethyl sulfoxide [DMSO]) voor hersen injecties.
    2. Bereid chemische inhibitors met inbegrip van 1,5 mM LDN193189 (kleine molecule Inhibitor van ACVR1) en 1,6 mM GSK650394 (kleine molecule Inhibitor van SGK1, een stroomafwaartse effect van PDPK1) opnieuw opgeschort in voertuig (0,9% NaCl, 0,5% cellulose, 4,5% DMSO), of voertuig voor Alleen. Het totale volume van de chemische remmers of het ingespoten voertuig is 10 µ L per dosis per dier.
  2. Bereid het dier voor de hersenen injecties.
    1. Bereid het chirurgische gebied door het afvegen van de Bank en verwarming pad met ontsmettingsmiddel (10% natrium hypochloriet oplossing).
    2. Verdoven de 4 weken oude muis met een intraperitoneale injectie van ketamine/xylazine mengsel bij een dosis van 140 mg/kg en 10 mg/kg, respectievelijk. Gebruik de pedaal terugtrekking reflex om het niveau van de anesthesie te bepalen.
    3. Breng oogheelkundige zalf aan de ogen na inductie van de anesthesie om het hoornvlies drogen te voorkomen.
    4. Scheren van de vacht van de nek naar de bovenkant van het hoofd van de muis.
    5. Plaats de muis in de stereotactische platform door het aansluiten van de muis incisie tanden in de Bite bar van de snuit beteugelen en aanscherping van de neusklem over de snuit, terwijl ervoor te zorgen dat het hoofd van de muis is op een niveau vlak.
    6. Pas de hoogte van de oordopjes, indien nodig, om de caudale gedeelte van het gehoorkanaal te bereiken, zodat ze zodanig dat het hoofd van de muis is in een level vliegtuig en immobiled op de vinger te raken.
    7. Desinfecteer het hoofd van de muis met afwisselende doekjes van een actueel antiseptische, zoals Povidon-jodium en 70% ethanol.
  3. Drugs beheren.
    1. Met behulp van een steriel scalpel, maak een 0,75 cm horizontale incisie in het midden van de hoofdhuid.
    2. Met behulp van een 0,45 mm Braam, boor twee symmetrische gaten boven de rechter en linker corticale halfronden (2 mm van de sagittale hechting en 2 mm van de lambdoid hechting, ongeveer het midden van pariëtale bot).
    3. Bevestig een 10 l-spuit aan het stereotactische-platform stevig.
    4. Meng de oplossing van chemische remmers, en trek 10 l van de oplossing in de spuit. Vermijd luchtbellen in de spuit.
    5. Advance de injectienaald in de Braam gat handhaven van de naald loodrecht (90 °) aan de schedel. Wanneer de naald doorkruist de schedel, nul uit de coördinaten op de stereotactische digitale display en dan vooraf het topje van de naald tot het een diepte van 2,5 mm bereikt.
    6. Trek de naald 0,5 mm in de diepte voor 2 mm.
    7. Injecteer langzaam 10 l van de oplossing (~ 1 min). Na de injectie is voltooid, laat de naald in de hersenen voor ~ 1 min en dan trekken de naald.
    8. Herhaal de injectie voor het tweede halfrond (voertuig alleen controle).
    9. Met behulp van hechtingen of "huidlijm" Sluit de huid van de muis (als wond is > 0,5 cm zowel hechtingen en "huidlijm" moet worden gebruikt).
    10. Maak de oordopjes los en verwijder de muis uit het stereotactische apparaat.
    11. Beheer pijnstillende middelen (buprenorfine SR 0,5 mg/kg IP) en plaats de muis op een het verwarmen stootkussen dat aan 37 °C wordt geplaatst tot het dier het bewustzijn herwint.
    12. Zodra de muis is alert en responsieve, de overdracht van het dier terug naar zijn oorspronkelijke kooi.
    13. Herhaal de procedure om de 2 dagen gedurende 20 dagen. Herhaalde boringen van het gebied zijn niet vereist voor verdere injecties.
  4. Isoleer de muis hersenen.
    1. Zodra de dosis regime is voltooid, euthanaseren de muis in een CO2 kamer.
    2. Immobiliseren de muis op een oppervlak met behulp van naalden.
    3. Maak een laterale incisie door de Integument en buikwand net onder de ribben kooi met behulp van een schaar en een tang. Scheid de lever voorzichtig van het middenrif.
    4. Met behulp van een schaar, snijd het middenrif en blijven snijden langs de gehele lengte van de ribben kooi om de pleuraholte bloot te leggen.
    5. Met behulp van een schaar, maak een incisie aan de achterste uiteinde van de linker ventrikel.
    6. Onmiddellijk, beginnen met het injecteren van de rechter hartkamer met ~ 15 mL PBS meer dan ~ 2 min. lever kleur veranderen van rood naar lichtroze is een indicatie van goede doorbloeding.
    7. Injecteer de rechterkamer van de muis hart met ~ 10 mL van 4% Paraformaldehyde in PBS meer dan ~ 2 min.
    8. Onthoofd de muis, en het gebruik schaar om een middellijn incisie van de hoofdhuid te maken aan de schedel bloot te leggen.
    9. Plaats een tip van de schaar in het foramen magnum, en snijd lateraal in de schedel in de richting van het oog. Herhaal voor de andere kant. Probeer het einde van de schaar zo oppervlakkig mogelijk te houden om letsel van de hersenen te voorkomen.
    10. Gebruik een schaar om de regio tussen de ogen en boven de neus van de muis te snijden.
    11. Gebruik een tang om voorzichtig schil de schedel botten van de hersenhelften.
    12. Til de hersenen met een spatel, en gebruik een schaar om zorgvuldig ontleden de schedelzenuw vezels die het vast te stellen aan de schedel.
    13. Plaats de hersenen op een plastic schaal, knip de kleine hersenen en reuk bollen, en plaats de hersenen in een 15 mL buis gevuld met 4% van de werkplek is PBS.
  5. Cryo-sectie de muis hersenen.
    1. Fix Brain in 4% Paraformaldehyde in PBS bij 4 ° c 's nachts.
    2. Spoel de hersenen met PBS bij 4 °C minstens 3x voor 5 min elk af.
    3. Label de wegwerp matrijzen voor cryopreserving de weefsels.
    4. Knip de voorkant van de hersenen met behulp van een schaar en een tang (beginnen met het maken ~ 5 mm secties van injectie sites).
    5. Breng de hersenen naar de cryomold met de voorkant van de hersenen naar beneden naar coronale secties te verkrijgen. Dompel de mal met de hersenen in de optimale snij temperatuur Compound (okt).
    6. Giet vloeibare stikstof in een 10 mm plastic petrischaaltje en plaats de hersenen in de Cryo-mal in de stikstof.
      Opmerking: Het is belangrijk om het weefsel te oriënteren zoals beschreven in stap 6.5.5 om de sectie van de hersenen te begeleiden.
    7. Wanneer de LGO is solide wit, plaats de bevroren hersenen in een-80 °C vriezer voor opslag.
    8. Equilibrate de hersenen tot-20 ° c voor ten minste 30 minuten voorafgaand aan de afdeling met cryostat en cryosection (5 − 6 μm dikte) de hersenen, montage 2 − 3 secties per dia. Dia's kunnen worden opgeslagen bij-80 °C voor later gebruik.
  6. Bepaal XI reactivering gebruikend een immunofluorescentie-gebaseerde benadering.
    1. Voordat u begint met de kleuring procedure, droog de hersenen secties overnachting bij 4 ° c.
    2. Dompel dia's in de oplossing van het antigeen herwinning (0,1 M citroenzuur, 0,1 M Tris-basis, pH = 6,0) op een 100 °C hitte blok voor 5 min onder.
    3. Was dia's 4x met 1x PBS voor 5 min elk bij kamertemperatuur.
    4. Dompel dia's in het blokkeren van oplossing (0,1 M NH4cl/PBS/0.2% gelatine/0.05% niet-ionische oppervlakteactieve stof) voor 20 min bij kamertemperatuur.
    5. Was dia's 3x met Wash buffer (PBS/0.2% gelatine) bij kamertemperatuur voor 5 min elk.
    6. De secties van de hersenen van de vlek met anti-GFP-AlexaFluor647 (1:100) en anti-MAP2 (1:1000) antilichamen in incubatie middel (PBS/0.2% gelatine/1% BSA) en Incubeer bij 4 °C 's nachts.
    7. Verzamel primaire antilichamen (kan worden hergebruikt). Was dia's 4x met was buffer voor een totaal van 30 min bij kamertemperatuur.
    8. Incubeer hersen secties met geit anti-kip fluoresceïne isothiocyanaat (FITC)-geëtiketteerd secundair antilichaam (1:1000) in incubatiemedium en Incubeer 1 − 2 h bij kamertemperatuur in het donker.
    9. Was dia's 4x met was buffer voor een totaal van 30 min bij kamertemperatuur.
    10. Plaats een druppel van de montage medium met 4 ', 6-diamidino-2-phenylindole (DAPI) op een 22 mm x 50 mm dekglaasje, dan omkeren de dekglaasje op een dia, die alle weefselsecties.
    11. Beeld op een microscoop en aan te passen beelden voor contrast en helderheid. Capture beelden en kwantificeren van het aantal GFP-positieve cellen voor zowel drugs behandeld en voertuig behandeld XistΔ: Mecp2/xist: Mecp2-GFP muis hersenhelften.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Om aan te tonen de haalbaarheid van de XistΔ: Mecp2/xist: Mecp2-GFP muismodel voor XI reactivering studies, XCIF remmer-gemedieerde reactivering van XI-gebonden Mecp2-GFP werd getest in muis embryonale fibroblasten (MEFs). Vrouwelijke MEFs werden geïsoleerd vanaf dag 15,5 XistΔ: Mecp2/xist: Mecp2-GFP embryo's zoals beschreven in punt 3 (Figuur 1a). De genotypen van vrouwelijke XistΔ: Mecp2/xist: Mecp2-GFP MEFs werden bevestigd door GENOTYPE-PCR, zoals eerder beschreven19 (Figuur 1b), en FACS-based assay (figuur 1c). MEFs werden behandeld met ofwel DMSO of de twee geneesmiddelen LDN193189 en GSK650394 (0,5 μM en 2,5 μM, respectievelijk) voor 7 dagen. Na drugbehandeling, werd de uitdrukking van Mecp2-GFP gecontroleerd door QRT-PCR. Zoals weergegeven in figuur 1d, de medicamenteuze behandeling, maar niet DMSO, gereactiveerd expressie van XI-Mecp2-GFP. Vervolgens werd kwantitatieve immunofluorescentie uitgevoerd om de omvang van de XI-Mecp2-GFP expressie in individuele MEFs te bepalen, zoals beschreven in stap 5.3.2. Signaal van negatieve-controle MEFs geïsoleerd van mannelijke embryo's (Mecp2/Y) werd ingesteld als de achtergrond, en ~ 66% van de positieve controle Mecp2-GFP/Mecp2 MEFS had een nucleaire GFP signaal. Zoals verwacht, XistΔ: Mecp2/xist: Mecp2-GFP MEFs behandeld met DMSO had een zeer laag niveau van nucleaire GFP (~ 3%). In tegenstelling, ~ 31% van de drugs behandelde XistΔ: Mecp2/xist: Mecp2 MEFs waren positief voor nucleaire GFP (Figuur 1e). Samen, tonen deze resultaten aan dat XCIF inhibitors XI-verbonden Mecp2 in MEFs opnieuw activeren, maar de omvang van XI reactivering varieert in de cel bevolking.

Om de haalbaarheid van farmacologische XI reactivering-gebaseerde benadering in vivo te beoordelen, of de drugbehandeling XI-verbonden Mecp2 in de hersenen van XistΔ reactiveert : Mecp2/xist: Mecp2-GFP vrouwelijke muizen werd onderzocht. 10 l van voertuig of 10 l van XCIF remmers (1,5 mM LDN193189 en 1,6 mM GSK650394) werd toegediend in tegenovergestelde hersenhelften van 4-week-oude XI-Mecp2-GFP vrouwelijke muizen door intracerebroventricular injectie met behulp van stereotactische chirurgische procedures ( Figuur 2a , B). De procedure werd herhaald elke tweede dag (figuur 2c), en drie weken later, dieren werden euthanized, en de hersenen werden geïsoleerd. Één ondergroep werd gebruikt voor qRT-PCR en een andere werd geanalyseerd door immunohistochemistry. De uitdrukking van wild-type Mecp2 en XI-Mecp2-GFP in de voertuig-en drug-geïnfundeerde halfronden werd bepaald door QRT-PCR (opeenvolgingen van inleidingen die in lijst 1worden vermeld). Zoals aangetoond in figuur 2D, medicamenteuze behandeling gereactiveerd XI-Mecp2-GFP in ~ 30% van de cellen in de drug-infuus hersenhelft, terwijl XI- Mecp2-GFP werd niet gedetecteerd in het voertuig-infuus halfrond. Een groot aantal MAP2, een neuronale marker, positieve neuronen waren ook GFP positief (~ 45%) in de drug-behandelde hemisfeer, indicatief van XI-Mecp2-GFP uitdrukking. Ongeveer 20% van MAP2 negatieve hersencellen uitgedrukt GFP, bevestiging van XI-Mecp2-GFP reactivering in niet-neuronale cellen (figuur 2e).

Figure 1
Figuur 1: generatie en validatie XI-Mecp2 muismodel. (A) schema van de kweek strategie voor het genereren van XistΔ: Mecp2/xist: Mecp2-GFP muizen. (B) PCR genotypen van xist: Mecp2-GFP/Y, XistΔ: Mecp2/xist: Mecp2 en XistΔ: Mecp2/xist: Mecp2-GFP muizen. Muizen werden bewaakt voor de aanwezigheid van Mecp2-GFP, Mecp2 en geslacht-bepalende regio Y (sry). (C) flow Cytometry analyse van de kernen geïsoleerd van de muis cortex. Mecp2/Mecp2-GFP de schors van de muis toon ~ 50% van GFP-positieve kernen terwijl XistΔ: Mecp2/xist: Mecp2-GFP toont geen GFP-positieve kernen. DQRT-PCR-analyse monitoring van de expressie van Mecp2-GFP en wild-type Mecp2 transcripten in vrouwelijke XistΔ: Mecp2/xist: MECP2-GFP MEFS volgende behandeling met DMSO of drugs (LDN193189 en GSK650394). Gapdh werd bewaakt als een Ladingscontrole. Ekwantitatieve IMMUNOFLUORESCENTIE monitoring GFP intensiteit bij vrouwelijke XistΔ: Mecp2/xist: Mecp2- GFP MEFS na behandeling met DMSO of de drugs LDN193189 en GSK650394. MEFs geïsoleerd van Mecp2/Y of Mecp2/Mecp2-GFP muizen werden gebruikt als negatieve en positieve controles, respectievelijk. Elke stip vertegenwoordigt een MEF, en de stippellijn geeft de maximale achtergrond signaal verkregen in Mecp2/Y, die is ingesteld op 1. Het lagere paneel toont representatieve beelden van kernen. Dit cijfer is gewijzigd van Przanowski et al.16. Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 2
Figuur 2: farmacologische reactivering van X-gebonden Mecp2 in cerebrale corticale neuronen van levende muizen. (A) schematische van een muis schedel en (B) de hersenen met de site van de injectie voor voertuig of medicijn in de linker-of rechter hersenhelften van de hersenen. (C) schema van het drug regime. (D) representatieve immunofluorescentie beelden tonen endogene GFP signaal (groen) in coronale hersen secties van voertuig-of drugs behandelde halfronden. DAPI kleuring wordt blauw weergegeven. (E) representatieve immunofluorescentie beelden van de coronale hersen secties toezicht op de expressie van GFP (anti-GFP; rood) en map2 (groen) in het geneesmiddel behandelde halfrond. DAPI kleuring wordt blauw weergegeven. Dit cijfer is gewijzigd van Przanowski et al.16. Klik hier om een grotere versie van dit cijfer te bekijken.

Omgekeerde primer (5 '-> 3 ') Anealing temperatuur/PCR de lengte van het product
GGCATGGACTGTGGTCATGAG 60 °C/87 BP
GCTGAACTTGTGGCCGTTTA 62 °C/137 BP
TGTCAGAGCCCTACCCATAAG 62 °C/140 BP
GCACAACCCCGCAAATGCTA 62 °C/364 BP
GCACAACCCCGCAAATGCTA 62 °C/250 BP
AATTGCCCTAACGAGCACAC 62 °C/436 BP
GAACTTCAGGGTCAGCTTGC 62 °C/217 BP
CTCCTCTGTGACACTTTAGCCCTCCGA 66 °C/270 BP

Tabel 1: lijst van primers gebruikt voor genotypen en kwantitatieve real-time RT-PCR.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Eerder, XCIFs die selectief worden vereist voor het silencing van XI-gelinkte genen in zoogdieren vrouwelijke cellen werden geïdentificeerd12. We verder geoptimaliseerd krachtige kleine molecule-remmers te richten XCIFs, zoals ACVR1 en downstream-effects van PDPK1, die efficiënt opnieuw activeren XI-linked Mecp2 in de muis fibroblast cel lijnen, muis corticale neuronen, en een menselijke fibroblast cel lijn afgeleid van een RTT patiënt. Deze resultaten suggereren dat XI reactivering is een plausibele therapeutische benadering van het gen tekortkomingen in X-gebonden ziektepatiënten te redden; de in vivo haalbaarheid moet echter nog worden bepaald. Onlangs, XCIF inhibitors werden getoond om XI-verbonden Mecp2 in vivo opnieuw te activeren, waarvoor een niet-willekeurige XistΔ: Mecp2/xist: Mecp2-GFP muismodel werd geproduceerd.

Een aantrekkelijk kenmerk van de XistΔ: Mecp2/xist: Mecp2-GFP model is dat het mogelijk maakt een nauwkeurige kwantificatie van de XI-gebonden Mecp2 reactivering om verschillende redenen. Ten eerste, als gevolg van de schrapping van xist op de moeder X-chromosoom, de XistΔ: Mecp2/xist: Mecp2-GFP muis heeft niet-Random XCI. Als gevolg daarvan, de genetisch gelabelde Mecp2 is stil in 100% van de cellen (figuur 1c), in tegenstelling tot een verwachte 50:50 expressie van X-gebonden genen in willekeurige XCI muizenmodellen, zoals xist: Mecp2/xist: Mecp2-GFP. Daarom zijn de resultaten niet uitgesloten door de mozaïek expressie van GFP, en 100% cellen dragen Mecp2-GFP op XI in de XistΔ: Mecp2/xist: Mecp2-GFP model. Ten tweede, de genetische etikettering van Mecp2 vergunningen directe visualisatie van individuele neuronen met gereactiveerd GFP, waardoor het minimaliseren van de experimentele manipulaties in neuronale analyse.

Een recente studie bleek dat intracerebroventricular injectie van de XCIF remmers in de muis hersenhelft reactiveert XI-gebonden Mecp2 met behulp van immunofluorescentie analyse van de muis hersenen16. Belangrijk, drugsbehandeling had geen nadelig effect op de algemene gezondheid, zoals gewicht, Grooming, of mobiliteit16. Bovendien is er geen toxiciteit gedetecteerd door de behandeling van geneesmiddelen in de lever of milt. Samen, deze studie biedt een essentieel bewijs-van-principe aan te tonen dat interfereren met de functie van XCIFs leidt tot de-onderdrukking van XI in vivo.

Samengevat, kan een gevoelig muismodel worden gebruikt om de reactivering van XI te evalueren. Dit diermodel ontwerp kan ook worden aangepast voor het genereren van een verbeterde RTT muismodel dat havens Mecp2 mutaties (waarschijnlijk minder symptomatisch) op de actieve X-chromosoom en wild-type Mecp2 op de XI in alle cellen. Wegens niet-willekeurige XCI, terwijl de fenotypische symptomen meer uitgesproken kunnen zijn, verwacht men dat dit model ook voor betere evaluatie en nauwkeurige beoordeling van de omkering van symptomen toe te schrijven aan XI reactivering zal toestaan. Bovendien, XistΔ: Mecp2/xist: Mecp2-GFP kan ook worden gewijzigd om te studeren XI reactivering in andere X-gebonden ziektemodellen, zoals het DDX3X syndroom.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

De auteurs hebben niets te onthullen.

Acknowledgments

De auteurs bedanken Antonio Bedalov voor het verstrekken van reagentia; Universiteit van Virginia weefsel de kern van de histologie voor cryosectioning; Universiteit van Virginia flow Cytometry core voor flow Cytometry analyse; Christian Blue en de van de technische hulp bij het genotypen Singh. Dit werk werd ondersteund door een dubbele Hoo Research Grant aan Z.Z., en een pilot project programma Award van de Universiteit van Virginia-Virginia Tech Seed Fund Award en de Hartwell Foundation individuele biomedische onderzoek Award aan S.B.

Materials

Name Company Catalog Number Comments
MICE
Mecp2tm3.1Bird The Jackson Laboratory #014610
B6;129-Xist (tm5Sado) provided by Antonio Bedalov, Fred Hutchinson Cancer Center, Seattle
REAGENTS
22x22 mm coverslip FISHERfinest (Fisher Scientific) 125488
32% Paraformaldehyde Electron Microscopy Sciences 15714-S
50 ml syringe Medline Industries NPMJD50LZ
60mm culture dish CellStar 628160
7-AAD BioLegend 420403
ammonium chloride (NH4Cl) Fisher Chemical A661-3
anti-GFP-AlexaFluor647 Invitrogen A-31852
anti-MAP2 Aves Labs MAP
BSA Promega R396D
Buprenorphine SR Zoopharm
citric acid Sigma C-1857
DMSO Fisher Bioreagents BP231-100
Dulbecco's Modified Eagle Medium (DMEM) Corning Cellgro 10-013-CV
Ethanol Decon Labs 2701
fetal bovine serum (FBS) VWR Life Science 89510-198
gelatin Sigma-Aldrich G9391
glass slides Fisherbrand 22-034-486
goat anti-chicken FITC-labeled secondary antibody Aves Labs F-1005
GSK650394 ApexBio B1051
hamilton 10μl syringe Hamilton Sigma-Aldrich 28615-U
Hank's Balanced Salt Solution (HBSS) Gibco 14025-092
Ketamine Ketaset NDC 0856-2013-01
Large blunt/blunt curved scissors Fine Science Tools 14519-14
LDN193189 Cayman Chemicals 11802
lodixanol Sigma 1343517
magnesium chloride (MgCl2) Fisher Chemical M35-212
Methylcelulose Sigma M0262-100G
mounting medium with DAPI Vectashield H-1200
Needle tip, 26 GA x 1.25" PrecisionGlide 305111
ophthalmic ointment Refresh Lacri-Lube 93468
optimal cutting temperature (O.C.T.) ThermoFisher
PCR mix
Penicillin/Streptomycin (Pen/Strep) Corning 30-002-Cl
Phosphate buffered saline pH 7.4 (PBS) Corning Cellgro 46-103-CM
Potassium chloride (KCl) Fisher Scientific P330-500
scalpel blades
Shallow glass or plastic tray
skin glue/tissue adhesive 3M Vetbond 1469SB
sodium azide Fisher Scientific CAS 26628-22-8
Sodium chloride (NaCl) Fisher Chemical S642-212
standard hemostat forceps Fine Science Tools 13013-14
Standard tweezers Fine Science Tools 11027-12
Straight iris scissors Fine Science Tools 14058-11
sucrose Fisher Scientific BP220-1
Tris-base Fisher Bioreagents BP152-5
Triton X-100 Fisher Bioreagents BP151-500
Trypsin-EDTA Gibco 15400-054
Xylazine Akorn NDC: 59399-111-50
EQUIPMENT
Zeiss AxioObserver Live-Cell microscope Zeiss Zeiss AxioObserver
0.45mm burr IDEAL MicroDrill 67-1000
BD FACScalibur
centrifuge
glass homogenizer
cell culture incubator Thermo Scientific HERACELL VIOS 160i 13-998-213
Leica 3050S research cryostat
stereotactic platform
thermocycler
Timer
ultracentrifuge Beckman Coulter Optima L-100 XP
Water bath (37 ºC) Fisher Scientific Isotemp 2239

DOWNLOAD MATERIALS LIST

References

  1. Lyon, M. F. X-chromosome inactivation as a system of gene dosage compensation to regulate gene expression. Progress in Nucleic Acid Research and Molecular Biology. 36, 119-130 (1989).
  2. Heard, E. Delving into the diversity of facultative heterochromatin: the epigenetics of the inactive X chromosome. Current Opinion in Genetics Development. 15, (5), 482-489 (2005).
  3. Augui, S., Nora, E. P., Heard, E. Regulation of X-chromosome inactivation by the X-inactivation centre. Nature Review Genetics. 12, (6), 429-442 (2011).
  4. Pontier, D. B., Gribnau, J. Xist regulation and function explored. Human Genetics. 130, (2), 223-236 (2011).
  5. Barnes, C., Kanhere, A. Identification of RNA-Protein Interactions Through In Vitro RNA Pull-Down Assays. Methods in Molecular Biology. 1480, 99-113 (2016).
  6. McHugh, C. A., et al. The Xist lncRNA interacts directly with SHARP to silence transcription through HDAC3. Nature. 521, (7551), 232-236 (2015).
  7. Minajigi, A., et al. Chromosomes. A comprehensive Xist interactome reveals cohesin repulsion and an RNA-directed chromosome conformation. Science. 349, (6245), (2015).
  8. Mira-Bontenbal, H., Gribnau, J. New Xist-Interacting Proteins in X-Chromosome Inactivation. Current Biology. 26, (8), R338-R342 (2016).
  9. Mira-Bontenbal, H., Gribnau, J. New Xist-Interacting Proteins in X-Chromosome Inactivation. Curren Biology. 26, (10), 1383 (2016).
  10. Ridings-Figueroa, R., et al. The nuclear matrix protein CIZ1 facilitates localization of Xist RNA to the inactive X-chromosome territory. Genes and Development. 31, (9), 876-888 (2017).
  11. Sunwoo, H., Colognori, D., Froberg, J. E., Jeon, Y., Lee, J. T. Repeat E anchors Xist RNA to the inactive X chromosomal compartment through CDKN1A-interacting protein (CIZ1). Proceedings of National Academy of Sciences of the United States of America. (2017).
  12. Bhatnagar, S., et al. Genetic and pharmacological reactivation of the mammalian inactive X chromosome. Proceedings of National Academy of Sciences of the United States of America. 111, (35), 12591-12598 (2014).
  13. Zoghbi, H. Y., Percy, A. K., Schultz, R. J., Fill, C. Patterns of X chromosome inactivation in the Rett syndrome. Brain Development. 12, (1), 131-135 (1990).
  14. Anvret, M., Wahlstrom, J. Rett syndrome: random X chromosome inactivation. Clinical Genetics. 45, (5), 274-275 (1994).
  15. Amir, R. E., et al. Rett syndrome is caused by mutations in X-linked MECP2, encoding methyl-CpG-binding protein 2. Nature Genetics. 23, (2), 185-188 (1999).
  16. Przanowski, P., et al. Pharmacological reactivation of inactive X-linked Mecp2 in cerebral cortical neurons of living mice. Proceedings of Natlional Academy of Sciences of the United States of America. 115, (31), 7991-7996 (2018).
  17. Borensztein, M., et al. Xist-dependent imprinted X inactivation and the early developmental consequences of its failure. Nature Structural and Molecular Biology. 24, (3), 226-233 (2017).
  18. Jensen, E. C. Quantitative analysis of histological staining and fluorescence using ImageJ. Anatomical Record (Hoboken). 296, (3), 378-381 (2013).
  19. Cseke, L. J., Talley, S. M. A PCR-based genotyping method to distinguish between wild-type and ornamental varieties of Imperata cylindrica. Journal of Visualized Experiments. (60), (2012).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics