Um modelo de mouse não aleatório para reativação farmacológica de Mecp2 no cromossomo X inativo

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Aqui, nós descrevemos um protocolo para gerar um modelo murino fêmea viável com inactivation não-aleatório do cromossoma de x, isto é, o cromossoma de x maternally-herdado é inativo em 100% das pilhas. Nós igualmente descrevemos um protocolo para testar a viabilidade, a tolerabilidade, e a segurança da reactivação farmacológica do cromossoma de X inativo in vivo.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Przanowski, P., Zheng, Z., Wasko, U., Bhatnagar, S. A Non-random Mouse Model for Pharmacological Reactivation of Mecp2 on the Inactive X Chromosome. J. Vis. Exp. (147), e59449, doi:10.3791/59449 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

A inactivação do cromossoma de x (XCI) é o silenciamento aleatório de um cromossoma de X nas fêmeas para conseguir o equilíbrio da dosagem do gene entre os sexos. Em conseqüência, todas as fêmeas são heterozygous para a expressão X-lig do gene. Um dos principais reguladores da XCI é o Xist, que é essencial para a iniciação e manutenção da XCI. Estudos prévios identificaram 13 fatores de inativação do cromossomo X de ação trans (XCIFs) usando uma tela genética de grande escala e perda de função. A inibição de XCIFs, tais como ACVR1 e PDPK1, usando o RNA Short-hairpin ou os inibidores pequenos da molécula, reativa genes cromossomo X-lig em pilhas cultivadas. Mas a viabilidade e tolerabilidade da reativação do cromossomo X inativo in vivo continua a ser determinada. Para este objetivo, um modelo Xistδ: Mecp2/Xist: Mecp2-GFP mouse foi gerado com XCI não aleatório devido à exclusão de Xist em um cromossomo X. Usando este modelo, a extensão da reativação inativa de X foi quantificados no cérebro do rato depois do tratamento com nervos inibidores de xcif. Os resultados recentemente publicados mostram, pela primeira vez, que a inibição farmacológica de XCIFs reativa Mecp2 do cromossoma de X inativo em neurônios corticais do cérebro vivo do rato.

Introduction

O inativação do cromossoma de x (XCI) é um processo da compensação de dosagem que equilibra a expressão de gene x-lig silenciando uma cópia do cromossoma de x nas fêmeas1. Como resultado, o cromossomo X inativo (XI) acumula características da heterocromatina incluindo metilação do DNA e alterações inibitórias da histona, como a histona H3-lisina 27 trimetilação (H3K27me3) e a histona H2A ubiquitinação (H2Aub) o regulador 2. The mestre do silenciamento do cromossoma de x é a região do centro da x-inactivação (xic), ao redor 100-500 KB, que controla a contagem e o emparelhamento dos cromossomas de x, a escolha aleatória do cromossoma de x para a inactivação, e a iniciação e propagação do silenciamento ao longo do cromossomo X3. O processo de inactivação de X é iniciado pelo transcrito específico inativo de X (Xist) que reveste o XI em cis para mediar o silenciamento do cromossoma-largo e remodela a estrutura tridimensional do cromossoma de x4. Recentemente, diversas telas proteômica e genéticas identificaram reguladores adicionais de XCI, tais como proteínas interagindo do Xist 5,6,7,8,9 , 10 de , 11 anos de , 12. por exemplo, um estudo prévio usando uma tela de interferência de RNA em todo o genoma não tendencioso identificou 13 fatores de XCI Trans-acting (xcifs)12. Mecanisticamente, XCIFs regulam a expressão Xist e, portanto, interferir com a função xcifs causa XCI defeituoso12. Juntos, avanços recentes no campo forneceram insights importantes sobre a maquinaria molecular que é necessária para iniciar e manter o XCI.

A identificação de reguladores de XCI e a compreensão de seu mecanismo em XCI são diretamente relevantes às doenças humanas X-lig, tais como a síndrome de Rett (RTT)13,14. RTT é uma desordem rara do neurodesenvolvimento causada por uma mutação heterozygous na proteína de ligação X-lig de methyl-CpG 2 (MeCP2) que afeta predominantly meninas15. Porque MeCP2 é ficada situada no cromossoma de X, as meninas de RTT são heterozygous para a deficiência de MeCP2 com as pilhas do ~ 50% que expressam o selvagem-tipo e o ~ 50% que expressam o mutante MeCP2. Notàvelmente, as pilhas do mutante de RTT abrigam uma cópia dormente mas selvagem-tipo de Mecp2 no XI, fornecendo uma fonte do gene funcional, que se reactivated, poderia potencial aliviar sintomas da doença. Além do que o RTT, há diversas outras doenças humanas lig X, para que o reativação de Xi representa uma aproximação terapêutica potencial, tal como a síndrome de DDX3X.

A inibição de XCIFs, A proteína quinase-1 dependente de 3-Fosfoinositídeo (PDPK1), e o tipo 1 do receptor do activina A (ACVR1), pelo RNA curto do hairpin (shRNA) ou pelos inibidores pequenos da molécula, reativam genes XI-lig12. O reativação farmacológico de genes XI-lig é observado em vários modelos ex vivo que incluem linhas de pilha do fibroblasto do rato, neurônios corticais adultos do rato, fibroblasto embrionário do rato, e as linhas de pilha do fibroblasto derivadas de um paciente de RTT12. Entretanto, se a reactivação farmacológica de genes XI-lig é viável in vivo permanece ser demonstrado. Um fator limitante é a falta de modelos animais eficazes para medir com precisão a expressão de genes de Xi reativado. Para este objetivo, um Xistδ: Mecp2/Xist: modelo do rato de Mecp2-GFP foi gerado que carreg um Mecp2 genetically etiquetado em XI em todas as pilhas devido ao apagamento heterozygous em Xist no cromossoma de X materno16. Usando este modelo, a expressão de Mecp2 de Xi foi quantificados depois do tratamento com nervos inibidores de xcifs no cérebro de ratos vivos. Aqui, a geração do modelo xistδ: Mecp2/Xist: Mecp2-GFP mouse e metodologia para quantificar XI reativação em neurônios corticais usando ensaios baseados em imunofluorescência é descrita.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

O trabalho envolvendo camundongos foi aprovado pelo Comitê institucional de cuidados e uso de animais da Universidade de Virginia (IACUC; #4112).

1. gere um modelo de mouse XCI não aleatório com Mecp2 geneticamente rotulado em Xi

Nota: As cepas de camundongo utilizadas no estudo foram as seguintes: Mecp2-GFP/Mecp2-GFP (Mecp2TM 3.1 Bird, tabela de materiais) e Xist/δxist (B6; 129-Xist < tm5Sado >; fornecido por Antonio bedalov, Fred Centro do cancer de Hutchinson, Seattle). Estratégias de reprodução entre as respectivas cepas foram projetadas para expandir as colônias de camundongo para cada cepa.

  1. Realize a genotipagem de PCR em todas as cepas de camundongos e respectivas progênies obtidas após a reprodução utilizando primers específicos do gene listados na tabela 1.

2. projetar a estratégia de criação de mouse para gerar Xistδ: Mecp2/Xist: Mecp2-GFP

  1. Montar um par de reprodução, abrigando um macho Mecp2-GFP/Y e uma fêmea XistΔ-Mecp2/Xist-Mecp2 juntas (12 h/12 h: ciclo claro/escuro) (Figura 1a). Idealmente, configurar pelo menos 5 pares reprodutores de cada vez usando ratos viáveis e férteis. Depois que a fêmea grávida dá o nascimento, permita que levante sua primeira maca com o macho.
    Nota: Porque o nocaute Xist paternal prejudica a XCI impressa, a compensação de dosagem e as vias de diferenciação17, o uso de camundongos xistδ-Mecp2/Y na reprodução não produzirá os filhotes fêmeas com o genótipo necessário.
  2. Após o desmame da serapilheira no dia pós-natal 21 (P21), identificar e etiquetar os filhotes Xistδ: Mecp2/Xist: Mecp2-GFP fêmeas usando um ensaio de genotipagem baseado em PCR (Figura 1b).
    Nota: Em relação ao número de animais necessários por grupo, para os resultados relatados abaixo, foram criados 5 pares reprodutores que geraram aproximadamente 10 ratas Xistδ: Mecp2/Xist: Mecp2-GFP .
  3. Use modelos fêmeas do rato para todos os experimentos propostos.
    Nota: O sexo é uma variável biológica importante para os estudos de XCI, e o modelo masculino não conta os efeitos confundidores do XCI aleatório.
  4. Para ser consistente ao longo dos estudos em animais e descartar quaisquer efeitos da idade animal, realizar todos os experimentos em 5 − 8-week-old feminino Xistδ: Mecp2/Xist: Mecp2-GFP camundongos.

3. isolar Xistδ fêmea: Mecp2/Xist: Mecp2-GFP fibroblastos embrionários do rato (mefs)

  1. Ajuste o acoplamento cronometrado entre o macho Mecp2-GFP/Y e a fêmea de Xistδ-Mecp2/Xist-Mecp2 . Configurar pelo menos 3 − 4 gaiolas de acasalamento para aumentar a probabilidade de gravidez.
  2. Depois de confirmar o plugue vaginal na manhã após o acasalamento, separe a fêmea e este dia é considerado dia embrionário 0,5 (E 0,5). Monitore o ganho de peso da fêmea grávida em perspectiva e inspecione visualmente o abdômen dos ratos para confirmar a gravidez. Em E 14.5 − 15.5, eutanizar os camundongos fêmeas grávidas via luxação cervical.
  3. uma capa laminar, limpe o abdômen da fêmea grávida com o etanol 70%. Usando tesouras estéreis, dissecar a cavidade abdominal e remover os chifres uterinos contendo os embriões. Usando o fórceps, retire delicadamente os embriões ao cortar o tecido abdominal restante (os embriões 6 − 12 são esperados geralmente).
  4. Coloc os chifres uterine que contêm os embriões em um prato da tecido-cultura de 10 milímetros. Usando tesouras e fórceps estéreis, faça uma incisão ao longo dos chifres uterine para isolar os sacos individuais que carreg um embrião. Cuidadosamente, coloque os chifres uterinos contendo o resto dos embriões em 30 mL de solução salina equilibrada de Hanks (HBSS) no gelo.
  5. Corte suavemente abrir o saco e isolar o embrião usando tesouras estéreis e fórceps. Retire a placenta cortando o cordão umbilical.
  6. Decapitar o embrião.
    Nota: Enquanto o resto do tecido embrionário será processado, o tecido da cabeça do embrião será usado para isolar o DNA para genotipagem.
  7. Abra o abdômen cortando a linha média do embrião usando tesouras e fórceps estéreis. Remova os órgãos viscerais, tais como o coração, o fígado, e os pulmões.
  8. Transfira o tecido embrionário remanescente para uma placa de cultura de tecido estéril de 60 mm e corte em pedaços pequenos usando uma tesoura ou uma lâmina de barbear. Para quebrar abrir os aglomerantes de células, adicione 3 mL de tripsina-EDTA (0, 5%) e incubar a 37 ° c durante 15 min.
  9. Neutralize o tripsina-EDTA adicionando 5 mL de meio de Eagle modificado de Dulbecco (DMEM) com soro bovino fetal a 10% (FBS) e 10 μg/mL de penicilina/estreptomicina (caneta/Strep) na placa e dissociar o tecido por pipetagem repetitiva (aproximadamente 20 − 30 vezes).
  10. Gire para baixo as pilhas em 300 x g por 5 minutos e Resuspenda a pelota da pilha em 4 ml de DMEM com 10% FBS e 10 μg/ml de pena/Strep. Placa as pilhas em um prato da cultura de 60 milímetros, e cultura as pilhas em 37 ° c na presença de 5% CO2.
  11. Realize as etapas 3.5 − 3.10 para cada embrião.
  12. MEFs de cultura obtidos na etapa 3,11 por pelo menos 3 − 4 dias.
    Nota: Nesta fase, os MEFs também podem ser criopreservados para experimentos futuros.
  13. Para determinar o sexo e o genótipo de cada embrião, realizar Genotyping-PCR usando DNA isolado das cabeças dos embriões utilizando primers e condições de PCR listados na tabela 1.

4. Confirme a falta de expressão de proteína verde fluorescente (GFP) no cérebro de Xistδ: Mecp2/Xist: camundongos Mecp2-GFP usando um ensaio baseado em classificação de células ativadas por Ffluorescência

  1. Usando tesouras, separe o córtex cerebral do resto dos hemisférios cerebrais, e coloque em 1 mL de meio frio de isolamento de núcleos (NIM) buffer contendo 250 mM de sacarose, 25 mM de cloreto de potássio (KCl), 5 mM de cloreto de magnésio (MgCl2), 10 mm Tris-Cl, suplementado com 2% paraformaldeído (PFA) e 0,1% surfactante não iônico (tabela de materiais).
  2. Homogeneizar usando um homogeneizador de vidro gelado.
  3. Gire para baixo o tecido homogeneizado em 600 x g, 4 ° c por 5 min.
  4. Retire o sobrenadante e ressuspender a pelota em 1 mL de iodixanol a 25% em solução de NIM.
  5. Adicione 1 mL de lodixanol 29% em solução NIM a um tubo de 4 mL de ultracentlee (armazene no gelo até que as amostras estejam prontas) e cuidadosamente Mergulhe 1 mL de amostra (em 25% lodixanol).
  6. Centrifugador em 9.000 x g, 4 ° c por 10 minutos em um ultracentlee.
  7. Aspirar o sobrenadante e resuspender a pelota em 500 μL de tampão de triagem celular ativada por fluorescência (FACS) (solução salina tamponada por fosfato [PBS] suplementado com EDTA de 1 mM, azida sódica 0, 5% e albumina sérica bovina de 2% [BSA]).
    Nota: As amostras podem ser armazenadas a 4 ° c ou até 1 semana.
  8. Adicionar 5 μL de 7-amino-actinomycin D (7-AAD; 50 mg/mL) durante 5 min à temperatura ambiente para manchar o ADN.
  9. Analise amostras para o sinal de 7-AAD e proteína verde fluorescente (GFP) usando citometria de fluxo.

5. Determine a viabilidade do modelo Xistδ: Mecp2/Xist: Mecp2-GFP mouse para XI reactivation

  1. Semente 1 x 105 células/ml fêmea Xistδ: Mecp2/Xist: Mecp2-GFP Mefs, Mecp2/Mecp2-GFP e Xist-Mecp2/Y mefs obtidos na etapa 3,12 em um formato de 6 poços e em lâminas de câmara, em DMEM com 10% FBS e 10 μg/ml Pen/strep, a 37 ° c no presença de 5% de CO2.
    Nota: Mecp2/Mecp2-GFP e Xist-Mecp2/Y mefs são usados como controles positivos e negativos nos experimentos.
  2. Adicionar meio fresco para as células após 24 h. Para Xistδ: Mecp2/Xist: Mecp2-GFP mefs, adicione o meio suplementado com os nervos inibidores de XCIFs (por exemplo, 0,5 μm LDN193189 e 2,5 μm GSK650394), ou veículo sozinho. Substitua o meio suplementado com o inibidor fresco ou o veículo sozinho cada 2 dias. Para Mecp2/Mecp2-GFP e Xist-Mecp2/Y mefs, adicione meio fresco a cada 2 dias.
  3. Pós 1 semana de tratamento com inibidores, colher MEFs para isolamento de RNA (placa de 6 poços) ou fixar células para imunofluorescência (lâminas de câmara). Use MEFs isolados de embriões Mecp2/Mecp2-GFP como embriões positivos e Xist-Mecp2/Y como controles negativos, respectivamente.
    1. Para o isolamento de RNA, isolar o RNA total por guanidínio Thiocyanate-baseou o reagente da extração do RNA, e transcrito reverso usando o transcriptase reverso. Meça a expressão Mecp2-GFP pela transcriptase-PCR quantitativa reversa (qRT-PCR) usando Mecp2-WT e Mecp2-GFP, e primers listados na tabela 1, como descrito anteriormente12.
    2. Para a imunofluorescência, mefs da mancha com um anticorpo preliminar do anti-GFP (1:100), como descrito previamente12,16. Medir a intensidade de GFP pela imunofluorescência quantitativa na medicina tratada Xistδ: Mecp2/Xist: Mecp2-GFP mefs, como descrito previamente18.

6. demonstrar a reativação farmacológica do XI no cérebro do modelo Xistδ: Mecp2/Xist: Mecp2-GFP mouse

  1. Prepare drogas e controle de veículos.
    1. Prepare uma solução fresca e estéril de veículo (0,9% NaCl, 0,5% metilcelulose, 4,5% dimetil sulfóxido [DMSO]) para injeções cerebrais.
    2. Prepare os inibidores químicos que incluem 1,5 milímetros LDN193189 (inibidor pequeno da molécula de ACVR1) e 1,6 milímetros GSK650394 (inibidor pequeno da molécula de SGK1, um efetoras a jusante de PDPK1) resuspendido no veículo (0,9% NaCl, 0,5% methylcellulose, 4,5% DMSO), ou veículo Sozinho. O volume total de inibidores químicos ou do veículo injetado é de 10 μL por dose por animal.
  2. Prepare o animal para injeções cerebrais.
    1. Prepare a área cirúrgica limpando o banco e a almofada de aquecimento com desinfetante (solução de hipoclorito de sódio a 10%).
    2. Anestesie o rato de 4 semanas de idade com uma injecção intraperitoneal de mistura de cetamina/xilazina numa dose de 140 mg/kg e 10 mg/kg, respetivamente. Use o reflexo de retirada do pedal para determinar o nível de anestesia.
    3. Aplique a pomada oftálmica aos olhos depois da indução da anestesia para impedir a secagem córnea.
    4. Raspar a pele do pescoço para o topo da cabeça do mouse.
    5. Posicione o mouse na plataforma estereotáxica conectando os dentes incisivos do mouse na barra de mordida da contenção de focinho e apertando a braçadeira do nariz sobre o focinho, assegurando que a cabeça do mouse esteja em um plano de nível.
    6. Ajuste a altura das barras da orelha, conforme necessário, para alcançar a porção caudal do canal auditivo, fixando-os de tal forma que a cabeça do mouse esteja em um plano nivelado e imobilizada no toque do dedo.
    7. Desinfete a cabeça do rato com toalhetes alternados de um anti-séptico tópico, como o povidona-iodo e o etanol a 70%.
  3. Administrar drogas.
    1. Usando um bisturi estéril, faça uma incisão horizontal de 0,75 cm no mid-scalp.
    2. Usando uma rebarba de 0,45 mm, perfure dois furos simétricos acima dos hemisférios corticais direito e esquerdo (2 mm da sutura sagital e 2 mm da sutura lambdóide, aproximadamente no meio do osso parietal).
    3. Fixe firmemente uma seringa de 10 μL à plataforma estereotáxica.
    4. Misture a solução de inibidores químicos e desenhe 10 μL de solução na seringa. Evite quaisquer bolhas de ar na seringa.
    5. Avance a agulha da seringa para dentro do orifício de rebarba, mantendo a agulha perpendicular (90 °) ao crânio. Quando a agulha atravessa o crânio, zerar as coordenadas no visor digital estereotáxica e, em seguida, avançar a ponta da agulha até atingir uma profundidade de 2,5 mm.
    6. Retire a agulha 0,5 mm até à profundidade por 2 mm.
    7. Injete lentamente 10 μL de solução (~ 1 min). Após a injeção estiver completa, deixe a agulha no cérebro por ~ 1 min e, em seguida, retire a agulha.
    8. Repita a injeção para o segundo hemisfério (controle do veículo somente).
    9. Usando suturas ou "cola de pele" fechar a pele do mouse (se a ferida é > 0.5 cm tanto suturas e "cola de pele" deve ser usado).
    10. Afrouxe as barras da orelha e retire o rato do aparelho estereotáxico.
    11. Administrar analgésicos (buprenorfina SR 0,5 mg/kg IP) e colocar o mouse sobre uma almofada de aquecimento definido para 37 ° c até que o animal recupera a consciência.
    12. Uma vez que o mouse está alerta e responsivo, transfira o animal de volta para sua gaiola original.
    13. Repita o procedimento a cada 2 dias durante 20 dias. A perfuração da repetição da área não é exigida para injeções subseqüentes.
  4. Isole o cérebro do rato.
    1. Uma vez que o regime de dose é terminado, eutanizar o rato em uma câmara de CO2 .
    2. Imobilize o mouse sobre uma superfície usando agulhas.
    3. Faça uma incisão lateral através do tegumento e da parede abdominal logo abaixo da caixa torácica usando tesouras e fórceps. Separe cuidadosamente o fígado do diafragma.
    4. Usando tesouras, corte o diafragma e continue cortando ao longo do comprimento inteiro da gaiola da costela para expor a cavidade pleural.
    5. Usando tesouras, faça uma incisão na extremidade posterior do ventrículo esquerdo.
    6. Imediatamente, começar a injetar a câmara do coração direito com ~ 15 mL de PBS mais de ~ 2 min. mudança de cor do fígado de vermelho para rosa pálido é indicativo de boa perfusão.
    7. Injete a câmara direita do coração do rato com ~ 10 mL de paraformaldeído a 4% em PBS acima de ~ 2 min.
    8. Decapitar o mouse, e usar tesouras para fazer uma incisão Midline do couro cabeludo para expor o crânio.
    9. Coloque uma ponta da tesoura no forame Magnum, e corte lateralmente no crânio em direção ao olho. Repita para o outro lado. Tente manter a extremidade da tesoura tão superficial quanto possível para evitar ferimento do cérebro.
    10. Use tesouras para cortar a região entre os olhos e acima do nariz do mouse.
    11. Use fórceps para descascar suavemente os ossos cranianos dos hemisférios cerebrais.
    12. Levante o cérebro com uma espátula, e use uma tesoura para dissecar cuidadosamente as fibras nervosas cranianas que fixá-lo ao crânio.
    13. Coloc o cérebro em um prato plástico, corte o cerebelo e os bulbos olfactory, e coloc o cérebro em um tubo de 15 mL enchido com o PFA de 4% é PBS.
  5. Cryo-section o cérebro do rato.
    1. Corrigir o cérebro em 4% paraformaldeído em PBS a 4 ° c durante a noite.
    2. Enxague o cérebro com PBS a 4 ° c pelo menos 3x por 5 min cada.
    3. Rotule os moldes descartáveis para cryopreserve os tecidos.
    4. Corte a parte dianteira do cérebro usando tesouras e fórceps (Comece fazer seções de ~ 5 milímetros dos locais da injeção).
    5. Transfira o cérebro para o criomolde com a frente do cérebro voltada para baixo para obter seções coronais. Mergulhe o molde que contém o cérebro no composto de temperatura de corte ideal (OCT).
    6. Derrame o nitrogênio líquido em um prato de Petri plástico de 10 milímetros e coloc o cérebro no Cryo-molde no nitrogênio.
      Nota: É importante orientar o tecido como descrito na etapa 6.5.5 para guiar o seccionamento do cérebro.
    7. Quando o OCT é branco sólido, coloque o cérebro congelado em um freezer de-80 ° c para armazenamento.
    8. Equilibrar o cérebro a-20 ° c por pelo menos 30 minutos antes de seccionamento com criostato e crioseção (5 − 6 μm de espessura) o cérebro, montando 2 − 3 seções por slide. Os slides podem ser armazenados em-80 ° c para uso posterior.
  6. Determine a reativação de Xi usando uma abordagem baseada em imunofluorescência.
    1. Antes de iniciar o procedimento de coloração, seque as secções cerebrais durante a noite a 4 ° c.
    2. Mergulhe as lâminas na solução de recuperação de antígenos (0,1 M de ácido cítrico, 0,1 M Tris-base, pH = 6,0) em um bloco de calor de 100 ° c por 5 min.
    3. Lave as lâminas 4x com 1X PBS por 5 min cada à temperatura ambiente.
    4. Mergulhe as lâminas na solução de bloqueio (0,1 M NH4CL/PBS/0,2% gelatina/0,05% surfactante não iônico) por 20 min à temperatura ambiente.
    5. Lave as lâminas 3x com tampão de lavagem (PBS/0,2% de gelatina) à temperatura ambiente durante 5 min cada.
    6. Seções do cérebro da mancha com anti-GFP-AlexaFluor647 (1:100) e anti-MAP2 (1:1000) anticorpos no meio de incubação (PBS/0.2% gelatina/1% BSA) e incubar a 4 ° c durante a noite.
    7. Colete anticorpos primários (pode ser reutilizado). Lave as lâminas 4x com tampão de lavagem para um total de 30 min à temperatura ambiente.
    8. Incubar seções cerebrais com anti-frango de cabra isotiocianato de fluoresceina (FITC)-rotulado anticorpo secundário (1:1000) em meio de incubação e incubar 1 − 2 h à temperatura ambiente no escuro.
    9. Lave as lâminas 4x com tampão de lavagem para um total de 30 min à temperatura ambiente.
    10. Coloc uma gota do meio de montagem com 4 ′, 6-diamidino-2-phenylindole (DAPI) em uma lamínula de 22 milímetros x 50 mm, a seguir inverta o lamela em uma corrediça, cobrindo todas as seções do tecido.
    11. Imagem em um microscópio e ajustar imagens para contraste e brilho. Capture imagens e quantifique o número de células GFP-positivas para ambos os tratados com medicamentos e tratados com o veículo Xistδ: Mecp2/Xist: Mecp2-GFP mouse cerebral hemisférios.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Para demonstrar a viabilidade do modelo Xistδ: Mecp2/Xist: Mecp2-GFP mouse para estudos de reativação XI, a reativação mediada pelo inibidor de Xcif de Mecp2-GFP ligada a XI foi testada em fibroblastos embrionários do camundongo (mefs). Os MEFs fêmeas foram isolados do dia 15,5 Xistδ: Mecp2/Xist: embriões de Mecp2-GFP como descrito na seção 3 (Figura 1a). Os genótipos das fêmeas Xistδ: Mecp2/Xist: Mecp2-GFP mefs foram confirmados por genotipagem-PCR, como descrito anteriormente19 (Figura 1b) e ensaio baseado em FACS (Figura 1C). Os MEFs foram tratados com DMSO ou os dois fármacos LDN193189 e GSK650394 (0,5 μM e 2,5 μM, respectivamente) por 7 dias. Após o tratamento medicamentoso, a expressão de Mecp2-GFP foi monitorada por qRT-PCR. Como mostrado na Figura 1D, o tratamento medicamentoso, mas não o DMSO, reativou a expressão de Xi-Mecp2-GFP. Em seguida, realizou-se a imunofluorescência quantitativa para determinar a extensão da expressão de Xi-Mecp2-GFP em mefs individuais, conforme descrito na etapa 5.3.2. O sinal dos MEFs do negativo-controle isolados dos embriões masculinos (Mecp2/Y) foi ajustado como o fundo, e ~ 66% do controle positivo Mecp2-GFP/Mecp2 mefs teve um sinal nuclear de GFP. Como esperado, Xistδ: Mecp2/Xist: Mecp2-GFP mefs tratados com DMSO tiveram um nível muito baixo de GFP nuclear (~ 3%). Pelo contrário, ~ 31% de Xistδ medicamentoso: Mecp2/Xist: Mecp2 mefs eram positivos para o GFP nuclear (Figura 1e). Juntos, esses resultados demonstram que os inibidores da XCIF reativam os Mecp2 em mefs, mas a extensão da reativação do XI varia na população celular.

Para avaliar a viabilidade da abordagem farmacológica com base na reativação de Xi in vivo, se o tratamento medicamentoso reativa Mecp2 no cérebro de Xistδ: Mecp2/Xist: camundongos fêmeas Mecp2-GFP foram investigados. 10 μL de veículo ou 10 μL de inibidores de XCIF (1,5 mM LDN193189 e 1,6 mM GSK650394) foram administrados em hemisférios cerebrais opostos de camundongos fêmeas XI-Mecp2-GFP de 4 semanas de idade por injeção intracerebroventricular utilizando procedimentos cirúrgicos estereotáticos ( Figura 2a , B). O procedimento foi repetido a cada segundo dia (Figura 2C), e três semanas depois, os animais foram eutanasiados, e os cérebros foram isolados. Um subconjunto foi utilizado para a qRT-PCR e outro foi analisado por imuno-histoquímica. A expressão do selvagem-tipo Mecp2 e XI-Mecp2-GFP nos hemisférios veículo-e droga-infundido foi determinada pelo qRT-PCR (seqüências dos primers alistados na tabela 1). Como mostrado na Figura 2D, o tratamento medicamentoso reativou XI-Mecp2-GFP em ~ 30% das células no hemisfério cerebral com infusão de drogas, enquanto que XI- Mecp2-GFP não foi detectado no hemisfério com infusão de veículos. Um grande número de MAP2, um marcador neuronal, neurônios positivos também foram GFP positivo (~ 45%) no hemisfério tratado com drogas, indicativo de expressão de Xi-Mecp2-GFP . Aproximadamente 20% das células cerebrais negativas MAP2 expressaram GFP, confirmando a reativação de Xi-Mecp2-GFP em células não neuronais (Figura 2e).

Figure 1
Figura 1: geração e validação modelo de mouse XI-Mecp2 . (A) esquema da estratégia de melhoramento para a geração de camundongos Xistδ: Mecp2/Xist: Mecp2-GFP . (B) genotipagem de PCR de Xist: Mecp2-GFP/Y, xistδ: Mecp2/Xist: Mecp2 e Xistδ: Mecp2/Xist: Mecp2-GFP MICE. Os camundongos foram monitorados quanto à presença de Mecp2-GFP, Mecp2 e região de determinação do sexo Y (sry). (C) análise citométrica de fluxo de núcleos isolados do córtex do camundongo. Mecp2/Mecp2-GFP mouse Cortex show ~ 50% de núcleos GFP-positivos enquanto Xistδ: Mecp2/Xist: Mecp2-GFP não mostra nenhum núcleo GFP-positivo. (D) análise de qRT-PCR monitorando a expressão de transcrições Mecp2-GFP e Wild-Type Mecp2 em Xistδ feminino: Mecp2/Xist: Mecp2-GFP mefs após o tratamento com DMSO ou fármaco (LDN193189 e GSK650394). GAPDH foi monitorado como um controle de carga. (E) intensidade quantitativa do GFP da monitoração da imunofluorescência no xistδ fêmea: Mecp2/Xist: Mecp2-GFP mefs depois do tratamento com DMSO ou as drogas LDN193189 e GSK650394. Os MEFs isolados de camundongos Mecp2/Y ou Mecp2/Mecp2-GFP foram utilizados como controles negativos e positivos, respectivamente. Cada ponto representa um MEF e a linha tracejada indica o sinal de plano de fundo máximo Obtido em Mecp2/Y, que foi definido como 1. O painel inferior mostra retratos representativos dos núcleos. Este número foi modificado de Przanowski et al.16. Por favor clique aqui para ver uma versão maior desta figura.

Figure 2
Figura 2: reativação farmacológica de Mecp2 ligada ao X em neurônios corticais cerebrais de camundongos vivos. (A) esquemático de um crânio do rato e (B) cérebro que mostra o local da injeção para o veículo ou a droga nos hemisférios esquerdos ou direito do cérebro. (C) esquema do regime medicamentoso. D) imagens de imunofluorescência representativas que demonstrem sinal GFP endógeno (verde) em secções cerebrais coronais de hemisférios tratados com veículos ou medicamentos. A coloração DAPI é mostrada em azul. (E) imagens representativas da imunofluorescência das seções coronais do cérebro que monitoram a expressão de GFP (anti-GFP; vermelho) e de map2 (verde) no hemisfério droga-Tratado. A coloração DAPI é mostrada em azul. Este número foi modificado de Przanowski et al.16. Por favor clique aqui para ver uma versão maior desta figura.

Primer reverso (5 '-> 3 ') Temperatura de anealing/comprimento do produto do PCR
GGCATGGACTGTGGTCATGAG 60 ° c/87 BP
O GCTGAACTTGTGGCCGTTTA 62 ° c/137 BP
TGTCAGAGCCCTACCCATAAG 62 ° c/140 BP
GCACAACCCCGCAAATGCTA 62 ° c/364 BP
GCACAACCCCGCAAATGCTA 62 ° c/250 BP
AATTGCCCTAACGAGCACAC 62 ° c/436 BP
GAACTTCAGGGTCAGCTTGC 62 ° c/217 BP
CTCCTCTGTGACACTTTAGCCCTCCGA 66 ° c/270 BP

Tabela 1: lista de primers utilizados para genotipagem e RT-PCR em tempo real quantitativo.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Previamente, os XCIFs que são seletivamente exigidos para silenciar de genes XI-lig em pilhas fêmeas mamíferas foram identificados12. Nós otimizamos ainda mais potentes inibidores de moléculas pequenas para direcionar XCIFs, como ACVR1 e efetores a jusante de PDPK1, que reativam eficientemente Mecp2 em linhas de células de fibroblastos do mouse, neurônios corticais do mouse e uma célula de fibroblastos humanos linha derivada de um paciente com RTT. Estes resultados sugerem que o reativação de Xi seja uma aproximação terapêutica plausível para resgatar as deficiências do gene em pacientes X-lig da doença; no entanto, a viabilidade in vivo continua a ser determinada. Recentemente, os inibidores de XCIF foram mostrados para reativar XI-lig o Mecp2 in vivo, para que um modelo não-aleatório do rato de Xistδ: Mecp2/Xist: Mecp2-GFP foi gerado.

Uma característica atrativa do modelo de xistδ: Mecp2/Xist: Mecp2-GFP é que permite uma quantificação exata da reactivação XI-lig Mecp2 para diversas razões. Primeiramente, devido à deleção de Xist no cromossomo X materno, o Xistδ: Mecp2/Xist: Mecp2-GFP mouse tem XCI não aleatório. Como resultado, o Mecp2 geneticamente rotulado é silencioso em 100% das células (Figura 1C), diferentemente de uma expressão 50:50 esperada de genes vinculados ao X em modelos de camundongos XCI aleatórios, como Xist: Mecp2/Xist: Mecp2-GFP. Portanto, os resultados não são impróprios pela expressão mosaica do GFP, e 100% das células carregam Mecp2-GFP em XI no modelo xistδ: Mecp2/Xist: Mecp2-GFP . Em segundo lugar, a rotulagem genética de Mecp2 permite a visualização direta de neurônios individuais com GFP reativado, minimizando assim as manipulações experimentais na análise neuronal.

Um estudo recente encontrou que a injeção intracerebroventricular dos nervos inibidores de XCIF no hemisfério do cérebro do rato reativa Mecp2 XI-lig usando a análise da imunofluorescência do cérebro16do rato. Importante, o tratamento medicamentoso não teve nenhum efeito adverso na saúde geral, tal como o peso, a preparação, ou a mobilidade16. Além disso, não há toxicidade detectada pelo tratamento medicamentoso no fígado ou no baço. Juntos, este estudo fornece uma prova-de-princípio essencial para demonstrar que interferir com a função de XCIFs leva à repressão de Xi in vivo.

Em resumo, um modelo de mouse sensível pode ser usado para avaliar a reativação de XI. Este projeto modelo animal pode igualmente ser adaptado para gerar um modelo melhorado do rato de RTT que abriga mutações Mecp2 (provavelmente menos sintomáticas) no cromossoma X ativo e no selvagem-tipo Mecp2 no XI em todas as pilhas. Devido ao XCI não aleatório, enquanto os sintomas fenotípicos podem ser mais pronunciados, espera-se que este modelo também permita uma melhor avaliação e uma avaliação precisa da reversão dos sintomas devido à reativação de XI. Adicionalmente, Xistδ: Mecp2/Xist: Mecp2-GFP também pode ser modificada para estudar a reativação de XI em outros modelos de doenças ligadas ao X, como a síndrome de DDX3X.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Os autores não têm nada a revelar.

Acknowledgments

Os autores agradecem a Antonio Bedalov por fornecer reagentes; Universidade do núcleo da histologia do tecido de Virgínia para cryosectioning; Núcleo de citometria de fluxo da Universidade de Virginia para análise de citometria de fluxo; Christian Blue e SALONI Singh para assistência técnica com genotipagem. Este trabalho foi apoiado por uma concessão da pesquisa dobro do hoo a Z.Z., e por um prêmio do programa piloto do projeto da Universidade do prêmio da semente do fundo da tecnologia de Virgínia-Virgínia e do prêmio de pesquisa biomédico individual da Fundação de Hartwell a SB

Materials

Name Company Catalog Number Comments
MICE
Mecp2tm3.1Bird The Jackson Laboratory #014610
B6;129-Xist (tm5Sado) provided by Antonio Bedalov, Fred Hutchinson Cancer Center, Seattle
REAGENTS
22x22 mm coverslip FISHERfinest (Fisher Scientific) 125488
32% Paraformaldehyde Electron Microscopy Sciences 15714-S
50 ml syringe Medline Industries NPMJD50LZ
60mm culture dish CellStar 628160
7-AAD BioLegend 420403
ammonium chloride (NH4Cl) Fisher Chemical A661-3
anti-GFP-AlexaFluor647 Invitrogen A-31852
anti-MAP2 Aves Labs MAP
BSA Promega R396D
Buprenorphine SR Zoopharm
citric acid Sigma C-1857
DMSO Fisher Bioreagents BP231-100
Dulbecco's Modified Eagle Medium (DMEM) Corning Cellgro 10-013-CV
Ethanol Decon Labs 2701
fetal bovine serum (FBS) VWR Life Science 89510-198
gelatin Sigma-Aldrich G9391
glass slides Fisherbrand 22-034-486
goat anti-chicken FITC-labeled secondary antibody Aves Labs F-1005
GSK650394 ApexBio B1051
hamilton 10μl syringe Hamilton Sigma-Aldrich 28615-U
Hank's Balanced Salt Solution (HBSS) Gibco 14025-092
Ketamine Ketaset NDC 0856-2013-01
Large blunt/blunt curved scissors Fine Science Tools 14519-14
LDN193189 Cayman Chemicals 11802
lodixanol Sigma 1343517
magnesium chloride (MgCl2) Fisher Chemical M35-212
Methylcelulose Sigma M0262-100G
mounting medium with DAPI Vectashield H-1200
Needle tip, 26 GA x 1.25" PrecisionGlide 305111
ophthalmic ointment Refresh Lacri-Lube 93468
optimal cutting temperature (O.C.T.) ThermoFisher
PCR mix
Penicillin/Streptomycin (Pen/Strep) Corning 30-002-Cl
Phosphate buffered saline pH 7.4 (PBS) Corning Cellgro 46-103-CM
Potassium chloride (KCl) Fisher Scientific P330-500
scalpel blades
Shallow glass or plastic tray
skin glue/tissue adhesive 3M Vetbond 1469SB
sodium azide Fisher Scientific CAS 26628-22-8
Sodium chloride (NaCl) Fisher Chemical S642-212
standard hemostat forceps Fine Science Tools 13013-14
Standard tweezers Fine Science Tools 11027-12
Straight iris scissors Fine Science Tools 14058-11
sucrose Fisher Scientific BP220-1
Tris-base Fisher Bioreagents BP152-5
Triton X-100 Fisher Bioreagents BP151-500
Trypsin-EDTA Gibco 15400-054
Xylazine Akorn NDC: 59399-111-50
EQUIPMENT
Zeiss AxioObserver Live-Cell microscope Zeiss Zeiss AxioObserver
0.45mm burr IDEAL MicroDrill 67-1000
BD FACScalibur
centrifuge
glass homogenizer
cell culture incubator Thermo Scientific HERACELL VIOS 160i 13-998-213
Leica 3050S research cryostat
stereotactic platform
thermocycler
Timer
ultracentrifuge Beckman Coulter Optima L-100 XP
Water bath (37 ºC) Fisher Scientific Isotemp 2239

DOWNLOAD MATERIALS LIST

References

  1. Lyon, M. F. X-chromosome inactivation as a system of gene dosage compensation to regulate gene expression. Progress in Nucleic Acid Research and Molecular Biology. 36, 119-130 (1989).
  2. Heard, E. Delving into the diversity of facultative heterochromatin: the epigenetics of the inactive X chromosome. Current Opinion in Genetics Development. 15, (5), 482-489 (2005).
  3. Augui, S., Nora, E. P., Heard, E. Regulation of X-chromosome inactivation by the X-inactivation centre. Nature Review Genetics. 12, (6), 429-442 (2011).
  4. Pontier, D. B., Gribnau, J. Xist regulation and function explored. Human Genetics. 130, (2), 223-236 (2011).
  5. Barnes, C., Kanhere, A. Identification of RNA-Protein Interactions Through In Vitro RNA Pull-Down Assays. Methods in Molecular Biology. 1480, 99-113 (2016).
  6. McHugh, C. A., et al. The Xist lncRNA interacts directly with SHARP to silence transcription through HDAC3. Nature. 521, (7551), 232-236 (2015).
  7. Minajigi, A., et al. Chromosomes. A comprehensive Xist interactome reveals cohesin repulsion and an RNA-directed chromosome conformation. Science. 349, (6245), (2015).
  8. Mira-Bontenbal, H., Gribnau, J. New Xist-Interacting Proteins in X-Chromosome Inactivation. Current Biology. 26, (8), R338-R342 (2016).
  9. Mira-Bontenbal, H., Gribnau, J. New Xist-Interacting Proteins in X-Chromosome Inactivation. Curren Biology. 26, (10), 1383 (2016).
  10. Ridings-Figueroa, R., et al. The nuclear matrix protein CIZ1 facilitates localization of Xist RNA to the inactive X-chromosome territory. Genes and Development. 31, (9), 876-888 (2017).
  11. Sunwoo, H., Colognori, D., Froberg, J. E., Jeon, Y., Lee, J. T. Repeat E anchors Xist RNA to the inactive X chromosomal compartment through CDKN1A-interacting protein (CIZ1). Proceedings of National Academy of Sciences of the United States of America. (2017).
  12. Bhatnagar, S., et al. Genetic and pharmacological reactivation of the mammalian inactive X chromosome. Proceedings of National Academy of Sciences of the United States of America. 111, (35), 12591-12598 (2014).
  13. Zoghbi, H. Y., Percy, A. K., Schultz, R. J., Fill, C. Patterns of X chromosome inactivation in the Rett syndrome. Brain Development. 12, (1), 131-135 (1990).
  14. Anvret, M., Wahlstrom, J. Rett syndrome: random X chromosome inactivation. Clinical Genetics. 45, (5), 274-275 (1994).
  15. Amir, R. E., et al. Rett syndrome is caused by mutations in X-linked MECP2, encoding methyl-CpG-binding protein 2. Nature Genetics. 23, (2), 185-188 (1999).
  16. Przanowski, P., et al. Pharmacological reactivation of inactive X-linked Mecp2 in cerebral cortical neurons of living mice. Proceedings of Natlional Academy of Sciences of the United States of America. 115, (31), 7991-7996 (2018).
  17. Borensztein, M., et al. Xist-dependent imprinted X inactivation and the early developmental consequences of its failure. Nature Structural and Molecular Biology. 24, (3), 226-233 (2017).
  18. Jensen, E. C. Quantitative analysis of histological staining and fluorescence using ImageJ. Anatomical Record (Hoboken). 296, (3), 378-381 (2013).
  19. Cseke, L. J., Talley, S. M. A PCR-based genotyping method to distinguish between wild-type and ornamental varieties of Imperata cylindrica. Journal of Visualized Experiments. (60), (2012).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics