विभेदित हेपाआरजी कोशिकाओं में वेसिकुलर स्टेटोसिस को प्रेरित और विशेषता

Medicine

Your institution must subscribe to JoVE's Medicine section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

इस अध्ययन में, हम फैटी एसिड नमक सोडियम oleate के साथ विभेदित HepaRG कोशिकाओं में जिगर vesicular steatosis inducing के लिए एक विस्तृत प्रोटोकॉल का वर्णन और लिपिड संचय का पता लगाने और परिमाणीकरण के लिए तरीकों को रोजगार, सुसंगत विरोधी स्टोक्स सहित रमन प्रकीर्णन (सीएआरएस) माइक्रोस्कोपी, साइटोफ्लोरीमीट्रिक विश्लेषण, तेल लाल हे धुंधला, और क्यूपीसीआर।

Cite this Article

Copy Citation | Download Citations

Di Cocco, S., Belloni, L., Nunn, A. D., Salerno, D., Piconese, S., Levrero, M., Pediconi, N. Inducing and Characterizing Vesicular Steatosis in Differentiated HepaRG Cells. J. Vis. Exp. (149), e59843, doi:10.3791/59843 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

हेपेटिक स्टेटासिस एक चयापचय रोग का प्रतिनिधित्व करता है जो ट्राइग्लिसराइड के संचय से परिणाम देता है जिसमें हेपेटोसाइट्स में लिपिड बूंदें होती हैं। अत्यधिक वसा संचय गैर शराबी फैटी लीवर रोग (NAFLD) की ओर जाता है, जो संभावित रूप से प्रतिवर्ती है और गैर शराबी steatohepatitis (NASH) और अंत में सिरोसिस और hepatotocellular कार्सिनोमा (एचसीसी) में विकसित हो सकता है। नैश, अपरिवर्तनीय जिगर की क्षति, फाइब्रोसिस, सिरोसिस, और यहां तक कि एचसीसी की प्रगति के साथ हेपाटोसाइट्स में लिपिड संचय को जोड़ने वाले आणविक तंत्र अभी भी स्पष्ट नहीं है। यह अंत करने के लिए, कई इन विट्रो और विवो मॉडल में NAFLD कारण रोग प्रक्रियाओं को स्पष्ट करने के लिए विकसित किया गया है. वर्तमान अध्ययन में, हम जिगर vesicular steatosis है कि DMSO-अलग मानव यकृत HepaRG कोशिकाओं फैटी एसिड नमक सोडियम oleate के साथ इलाज के होते हैं के प्रेरण के लिए एक सेलुलर मॉडल का वर्णन. वास्तव में, सोडियम ओलेट-उपचारित हेपाआरजी कोशिकाओं कोशिकाद्रव्य में लिपिड बूंदों जमा और स्टेटोसिस की विशिष्ट विशेषताएं दिखा. यह इन विट्रो मानव मॉडल में विवो चूहों मॉडल के रूप में के रूप में अच्छी तरह से प्राथमिक मानव hepatocytes के लिए एक मूल्यवान विकल्प का प्रतिनिधित्व करता है. हम भी परिमाणीकरण और HepaRG कोशिकाओं में वसा संचय के मूल्यांकन के लिए कई तरीकों की तुलना प्रस्तुत, तेल लाल ओ धुंधला सहित, cytofluorimetric Bodipy माप, चयापचय जीन अभिव्यक्ति विश्लेषण द्वारा QPCR, और सुसंगत विरोधी स्टोक्स रमन प्रकीर्णन (सीएआरएस) माइक्रोस्कोपी। CARS इमेजिंग रमन स्पेक्ट्रोस्कोपी की रासायनिक विशिष्टता को जोड़ती है, एक रासायनिक विश्लेषण तकनीक सामग्री विज्ञान अनुप्रयोगों में अच्छी तरह से जाना जाता है, उच्च गति के लाभों के साथ, उच्च संकल्प गैर रेखीय ऑप्टिकल microscopies सटीक अनुमति देने के लिए लिपिड संचय और लिपिड छोटी बूंद गतिशीलता का परिमाणीकरण। vesicular steatosis के प्रेरण के लिए एक कुशल इन विट्रो मॉडल की स्थापना, परिमाणीकरण और लिपिड संचय की विशेषता के लिए एक सटीक विधि के साथ, के माध्यम से NAFLD के प्रारंभिक चरण निदान के विकास के लिए नेतृत्व कर सकते हैं आणविक मार्करों की पहचान, और नए उपचार रणनीतियों की पीढ़ी के लिए.

Introduction

हेपेटिक स्टेएटोसिस को इंट्राहेपेटिक वसा संचय के रूप में परिभाषित किया गया है, ट्राइग्लिसराइड युक्त लिपिड बूंदों के भीतर, जिगर के वजन का कम से कम 5%। लंबे समय तक यकृत लिपिड भंडारण एक संभावित प्रतिवर्ती प्रक्रिया है, हालांकि, यह जिगर चयापचय रोग, सूजन और nonalcoholic फैटी लीवर रोग के उन्नत रूपों के लिए नेतृत्व कर सकते हैं (NAFLD), के कई भागों में पुरानी जिगर की बीमारी का प्रमुख कारण दुनिया1,2. NAFLD एक बहुकारक रोग है कि अधिक आक्रामक गैर शराबी steatohepatitis (NASH) के लिए विकसित हो सकता है, जो बारी में सिरोसिस के लिए प्रगति कर सकते हैं और, रोगियों का एक छोटा सा प्रतिशत में, hepatotocellular कार्सिनोमा (एचसीसी)1,3. वर्तमान में एनएएफएलडी के लिए एक विशिष्ट उपचार के रूप में कोई अनुमोदित चिकित्सा उपलब्ध नहीं है और आहार और जीवन शैली में संशोधनों का संयोजन NAFLD और नैश प्रबंधन4,5,6 का स्तंभ बना हुआहै.

एनएएफएलडी के रोगजनन में यकृत स्तरावता के विकास के लिए अग्रणी आणविक तंत्र अभी भी स्पष्ट रूप से स्पष्ट हैं7. इस संदर्भ में, मानव स्थिति रोग प्रगति का अध्ययन करने के लिए माउस मॉडल विकसित किए गए हैं। विभिन्न मॉडलों के असंख्य मौजूद है, और हर एक अपने फायदे और नुकसान है, आनुवंशिक सहित, पोषण और रासायनिक प्रेरित मॉडल विभिन्न दृष्टिकोण के संयोजन. आनुवंशिक रूप से संशोधित (ट्रांसजेनिक या नॉकआउट) चूहों को सहज रूप से जिगर की बीमारी का विकास होता है। तथापि, यह ध्यान दिया जाना चाहिए कि ये उत्परिवर्तन मनुष्यों में बहुत दुर्लभ हैं और किसी एकल जीन (उदा., ob/ob माउस) के अधिक-अभिव्यक्ति में आणविक स्तर8,9पर बहुकारक मानव रोग के ईटियोलॉजी की नकल नहीं कर सकता है। इसी तरह, आहार या औषधीय हेरफेर के बाद चूहों द्वारा प्राप्त रोग मानव 8 मेंNAFLD के विकास के साथ जुड़े आहार के प्रभाव की नकल नहीं कर सकते हैं. पशु मॉडल, तथापि, NAFLD की समझ में विकास की सुविधा है और इस दृष्टिकोण वर्तमान में प्रयोगशाला अनुसंधान में सबसे अक्सर इस्तेमाल किया रणनीति है. फिर भी, पशु मॉडल में प्राप्त परिणामों के मनुष्यों में प्रतिकृति बार बार विफल रहा है, क्लिनिक में गरीब अनुवाद के कारण10.

इसलिए, NAFLD के इन विट्रो मॉडल NAFLD प्रगति के आणविक तंत्र स्पष्ट करने में एक मौलिक भूमिका निभा सकते हैं, और वे यौगिकों की एक बड़ी संख्या स्क्रीन करने के लिए एक मूल्यवान उपकरण का प्रतिनिधित्व करते हैं. प्राथमिक कोशिका संस्कृतियों, अमर कोशिका लाइनों और जिगर बायोप्सी बड़े पैमाने पर अनुसंधान प्रयोजनों के लिए इस्तेमाल किया गया है11. प्राथमिक मानव hepatocytes बारीकी से मानव नैदानिक स्थितियों के समान है, लेकिन वहाँ दाताओं की एक सीमित संख्या है, और प्राथमिक सेल संस्कृतियों कोशिकाओं की परिवर्तनशीलता के कारण गरीब reproducibility दिखा. इन प्रेक्षणों के साथ-साथ नैतिक और संभारतंत्रीय मुद्दों के कारण मानव प्राथमिक हेपाटासाइट्स का उपयोग सीमित12हुआ है। इस प्रकार, यकृत सेल लाइनों एक सुविधाजनक विकल्प का प्रतिनिधित्व करते हैं, प्राथमिक संस्कृति पर कई आवश्यक लाभ होने, के रूप में यकृत सेल लाइनों तेजी से बढ़ने, एक लगभग असीमित जीवन-विस्तार है, और एक स्थिर phenotype है. इसके अलावा, सेल लाइनों आसानी से सुलभ हैं और यकृत सेल लाइनों की संस्कृति की स्थिति प्राथमिक hepatocytes के उन लोगों की तुलना में सरल कर रहे हैं और विभिन्न प्रयोगशालाओं के बीच मानकीकृत कर रहे हैं.

यहाँ, हम विस्तार से जिगर vesicular steatosis के एक इन विट्रो सेल आधारित मॉडल का वर्णन, फैटी एसिड सोडियम oleate के साथ इलाज hepatic विभेदित HepaRG कोशिकाओं द्वारा प्रतिनिधित्व किया. HepaRG सेल लाइन हेपेटाइटिस सी संक्रमण से प्रभावित एक महिला रोगी और एक एडमंडसन ग्रेड मैं अच्छी तरह से अलग जिगर ट्यूमर14से स्थापित किया गया था. HepaRG सेल लाइन एक मानव द्विशक्तिजनक जनक कोशिका लाइन दो अलग सेल phenotypes की ओर 2% dimethyl sulfoxide (DMSO) के संपर्क में अंतर करने में सक्षम है: पित्त की तरह और hepatocyte की तरह कोशिकाओं. विभेदित हेपाआरजी कोशिकाओं (dHepaRG) वयस्क hepatocytes के साथ कुछ सुविधाओं और गुणों का हिस्सा है और इस तरह के Albumin, AldolaseB, Cytochrome P450 2E1 ( CYP2E1) के रूप में जिगर विशिष्ट जीन stably व्यक्त करने की क्षमता के अधिकारी13 (चरण 3).। 5 दिनों के लिए फैटी एसिड नमक सोडियम ओलेट (250 डिग्री सेल्सियस) के साथ dHepaRG कोशिकाओं का उपचार साइटोप्लाज्मिक लिपिड बूंदों की पीढ़ी के लिए नेतृत्व, फैटी लीवर के प्रभाव की नकल14,15,17,18 ( चरण 4). लिपिड बूंदों का संचय आसानी से तेल लाल ओ धुंधला द्वारा पता लगाया जा सकता है (कदम 5), एक lysochrome वसा में घुलनशील डाई कि तटस्थ ट्राइग्लिसराइड्स और लिपिड लाल नारंगी दाग. फैटी dHepaRG में लिपिड को कुशलता से परिमाणित करने के लिए, यहां हम 4,4-difluoro-1,3,5,7-tetraethyl-4-bora-3a,4a-diaza-s-indacene (py Bodi 505/515) (step Bodicent) (step 6) के साथ धुंधला करने के बाद साइटोफ्लोरीमीट्रिक विश्लेषण वर्णन करते हैं। इंट्रासेल्यूलर लिपिड निकायों के लिए और लिपिड बूंदों19लेबल करने के लिए इस्तेमाल किया गया है। इसके अलावा, यहाँ हम बताते हैं कि कैसे मात्रात्मक polymerase श्रृंखला प्रतिक्रिया द्वारा steatosis का मूल्यांकन करने के लिए (QPCR) (चरण 7) जीन अभिव्यक्ति dHepaRG कोशिकाओं में कई चयापचय जीन के विनियमन. सोडियम ओलेट उपचार के बाद लिपिड बूंदों के संचय की और विशेषता और मात्रा निर्धारित करने के लिए, हमने सुसंगत एंटी-स्टोक्स रमन प्रकीर्णन (सीएआरएस) माइक्रोस्कोपी (चरण 8) का प्रदर्शन किया, एक अभिनव तकनीक जो दृश्य और परिमाणीकरण में सक्षम बनाती है 20,21लेबलिंग के बिना लिपिड बूंदें .

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. संस्कृति मीडिया और अभिकर्मकों की तैयारी

  1. प्रसार माध्यम: GlutaMAX के साथ पूरक विलियम ई माध्यम, 10% भ्रूण गोजातीय सीरम (FBS), 1% पेनिसिलिन /
  2. विभेदमाध्यम: पूरक विलियम के ई माध्यम के साथ GlutaMAX, 10% FBS, 1% पेनिसिलिन /
  3. बर्फ़ीली माध्यम: 10% DMSO के साथ मध्यम प्रसार पूरक.
  4. सोडियम ओलेट: 100 एमएम एकाग्रता में 99% मेथनॉल में भंग, O/N हलचल, और -20 डिग्री सेल्सियस पर स्टोर।
  5. तेल लाल हे: एक शेयर समाधान तैयार करते हैं. तेल लाल हे के 0.35 ग्राम वजन और आइसोप्रोपेनोल के 100 एमएल में भंग। हिलाओ O/N, फिल्टर (0.2 डिग्री मी), और RT. पर स्टोर करें एक कार्य समाधान तैयार करें: 6 एमएल तेल लाल हे स्टॉक समाधान को 4 एमएल डीडीएच2हे के साथ मिलाएं। 20 मिनट के लिए कमरे के तापमान (आरटी) पर बैठते हैं, और फिर एक 0.2 डिग्री फिल्टर के साथ फिल्टर करते हैं। पृष्ठभूमि से बचने के लिए सफल धुंधला के लिए उचित निस्पंदन अत्यधिक अनुशंसित है।
  6. Bodipy (505/515): भंग Bodipy (505/515) DMSO में एक 100 डिग्री सेल्सियस स्टॉक एकाग्रता पर डाई, अंधेरे में -20 डिग्री सेल्सियस पर दुकान, और एक अंतिम 100 एनएम एकाग्रता पर उपयोग करें.
  7. CARS प्रयोगों के लिए पारदर्शी ग्लास-नीचे व्यंजन प्राप्त करें।

2. थावे, प्रवर्धन, और हेपाआरजी कोशिकाओं का क्रायोप्रेक्षण

  1. थाव नाइट्रोजन क्रायोप आरक्षित हेपाआरजी कोशिकाओं को 37 डिग्री सेल्सियस स्नान में एक बैच को डुबोकर जब तक defrosted. एक कम मार्ग बैच का चयन करें (और lt;20). हेपाआरजी सेल वाणिज्यिक रूप से उपलब्ध हैं।
  2. कोशिकाओं को 15 एमएल ट्यूब में स्थानांतरित करें जिसमें 10 एमएल का प्रसार मध्यम और अपकेंद्रित्र 5 मिनट (200 x ग्राम, 4 डिग्री सेल्सियस) के लिए होता है।
  3. सुपरनेंट को त्याग ें और 5 एमएल के साथ कोशिकाओं को प्रसारित करने वाले माध्यम के साथ पुन: निलंबित करें।
  4. कोशिकाओं की गणना करें और 2ण्5 x 104 कोशिकाओं/सेमी2को प्लेट करने के लिए पतला करें।
  5. माध्यम को हर 2 या 3 दिन में नवीनीकृत करें। कोशिकाएं लगभग 24 ज के दोहरीकरण समय के साथ बढ़ जाती हैं।
  6. Detach HepaRG कोशिकाओं जब trypsin समाधान 0.05% के साथ 3-5 मिनट ऊष्मायन द्वारा 80% संगम पर. 5 मिनट (200 x g, 4 डिग्री सेल्सियस) के लिए मध्यम और अपकेंद्रण में कोशिकाओं को एकत्र करें।
  7. सुपरनेंट को त्याग ें और 5 एमएल के साथ कोशिकाओं को प्रसारित करने वाले माध्यम के साथ पुन: निलंबित करें।
  8. कोशिकाओं की गणना करें और 2ण्5 x 104 कोशिकाओं/सेमी2को प्लेट करने के लिए पतला करें।
  9. इस स्तर पर, प्रयोगों को शुरू करने के लिए कोशिकाओं की एक उचित संख्या तक पहुँचने के लिए चरण 2.5-2.8 दोहराकर कोशिकाओं को बढ़ाना, या चरण 2.10 के रूप में cryopreserve.
  10. क्राइवोरपेरपोर हेपाआरजी कोशिकाओं के लिए, ट्रिप्सिन समाधान 0.05% के साथ 3-5 मिनट ऊष्मायन द्वारा चढ़ाना के बाद कोशिकाओं को 24 ज अलग करें। 5 मिनट (200 x g, 4 डिग्री सेल्सियस) के लिए मध्यम और अपकेंद्रण में कोशिकाओं को एकत्र करें। अधिनांत को त्यागें, हिमण माध्यम के 1 एमएल/बैच में कोशिकाओं को पुनः निलंबित करें, 1.5 x 106 कोशिकाओं/

3. हेपाआरजी सेल का भेदभाव (दिन 0-21) (चित्र 1)

  1. दिन 0. कम घनत्व पर बीज हेपाआरजी कोशिकाएं (2.5 x 104 कोशिकाएं/ दो व्यंजन प्रत्येक परख के लिए चढ़ाया जा करने की जरूरत है (तेल लाल ओ धुंधला, FACS विश्लेषण, QPCR): नियंत्रण कोशिकाओं के लिए एक और oleate इलाज कोशिकाओं के लिए एक. यदि प्रदर्शन CARS माप (चरण 8), पारदर्शी कांच नीचे व्यंजनों में समानांतर में कोशिकाओं बीज. एक नियंत्रण के रूप में, एक अनुपचारित पकवान फसल (कोशिकाओं दिवस 0) भेदभाव मार्कर जीन के जीन अभिव्यक्ति विश्लेषण प्रदर्शन करने के लिए (चरण 3.6 देखें).
  2. दिन 2 और दिन 4. प्रसार माध्यम की उचित मात्रा के साथ माध्यम बदलें और कोशिकाओं को संगम तक बढ़ने दें।
  3. दिन 7. कोशिकाओं का होना 100% संप्रवाह होना चाहिए (चित्र 1ब्) कोशिकाओं को एक बार 1x फॉस्फेट-बफर्ड नमकीन (पीबीएस) से धो लें। 1x PBS निकालें और भेदभाव माध्यम का एक उपयुक्त मात्रा जोड़ें.
  4. दिन 8, 9, 12, 15, 18.  कोशिकाओं को 1x PBS के साथ एक बार धो लें। 1x PBS निकालें और भेदभाव माध्यम का एक उपयुक्त मात्रा जोड़ें.
  5. दिन 21. सूक्ष्मदर्शी के अंतर्गत हेपाआरजी कोशिकाओं का प्रेक्षण कीजिए तथा यह सुनिश्चित कीजिए कि कोशिकाएं विभेदित विभेदित संस्कृतियों (चित्र 1छ)हैं।
  6. एक नियंत्रण के रूप में, एक नियंत्रण पकवान फसल (अलग कोशिकाओं दिवस 21) जीन अभिव्यक्ति विश्लेषण करने के लिए (चरण 7) भेदभाव मार्कर जीन के (चित्र 1ई).
  7. 21 दिन में, विभेदित हेपाआरजी कोशिकाओं को तरल-नाइट्रोजन में क्रायोपआरक्षित किया जा सकता है।

4. वेसिकुलर स्टेटोसिस का प्रेरण (दिन 21-26)

  1. दिन 21. 250 डिग्री सेल्सियस (1:400) की अंतिम सांद्रता के लिए पूर्ण विभेदन माध्यम की एक उपयुक्त मात्रा के साथ सोडियम ओलेट (100 उ)। वाहन नियंत्रण उपचार बनाने के लिए भेदभाव माध्यम के एक और aliquot में 99% मेथनॉल 1:400 (सोडियम oleate के रूप में एक ही मात्रा) जोड़ें। (उदाहरण के लिए: सोडियम oleate के 25 डिग्री एल मध्यम के 10 एमएल में जोड़ें और समानांतर में 99% मेथनॉल के 25 डिग्री एल मध्यम के 10 एमएल में जोड़ें। कोशिकाओं को 1x पीबीएस के साथ एक बार धो लें और वाहन या सोडियम ओलेट माध्यम जोड़ें।
  2. दिन 23 और दिन 25. चरण 4.1 के अनुसार ताजा तैयार माध्यम की उचित मात्रा के साथ माध्यम को बदलें।
  3. 26 दिन. ऑप्टिकल माइक्रोस्कोप द्वारा प्रेक्षण कीजिए कि लिपिड की बूंदें सोडियम ओलेट-उपचारित कोशिकाओं में संचित होती हैं और चित्र 2क के अनुसार कोशिकाद्रव्य में पारदर्शी बूंदों के रूप में आसानी से दिखाई देतीहैं।

5. लिपिड ओवरलोडिंग और स्टेटोसिस प्रेरण का मूल्यांकन: तेल लाल हे दाग

  1. वह 1x पीबीएस के साथ एक बार कोशिकाओं को धो लें और 1x पीबीएस पूरी तरह से हटा दें।
  2. 4% पैराफॉर्मेल्डिहाइड जोड़ें (1x पीबीएस में पतला) और आरटी में 15 मिनट के लिए इनक्यूबेट करें।
    चेतावनी: Paraformaldehyde विषाक्त है, तो इस कदम को एक धूआं हुड में प्रदर्शन किया जाना चाहिए, सुरक्षात्मक उपकरणों के साथ, दस्ताने सहित, एक प्रयोगशाला कोट, और एक मुखौटा.
  3. पैराफॉर्मेल्डिहाइड निकालें और कोशिकाओं को 1x पीबीएस के साथ दो बार धोएं। कोशिकाओं को धुंधला करने से पहले कुछ दिनों के लिए 4 डिग्री सेल्सियस पर 1x पीबीएस में रखा जा सकता है। पैराफिल्म के साथ लपेटें और एल्यूमीनियम पन्नी के साथ कवर करने के लिए सुखाने से कोशिकाओं को रोकने के लिए.
  4. 1x पीबीएस निकालें. आरटी में 5 मिनट के लिए 60% आइसोप्रोपेनोल के साथ कोशिकाओं को इनक्यूबेट करें।
  5. आइसोप्रोपेनोल निकालें और कोशिकाओं को आरटी पर पूरी तरह से सूखने दें।
  6. तेल लाल हे काम कर समाधान जोड़ें और 30 मिनट के लिए आरटी पर इनक्यूबेट। प्रत्येक नमूने के लिए आवश्यक कार्य समाधान की मात्रा कक्षों को culturing के लिए उपयोग किया गया मीडिया की मात्रा से संबंधित है।
  7. तेल लाल हे घोल निकालें और तुरंत डीडीएच2ओ जोड़ें। कोशिकाओं को डीडीएच2हे के साथ 4 बार धोएं।
  8. विश्लेषण के लिए सूक्ष्मदर्शी के अधीन छवियों को प्राप्त करें (चित्र 2)।
  9. तेल लाल हे डाई को हल करने के लिए: सभी पानी को हटा दें और सूखने की अनुमति दें; आरटी पर कोमल मिलाते हुए के साथ 10 मिनट के लिए 100% आइसोप्रोपेनोल और इनक्यूबेट का 1 एमएल जोड़ें।
  10. तेल लाल ओ डाई के साथ आइसोप्रोपेनोल को कई बार पाइप करें, यह सुनिश्चित करना कि सभी तेल लाल ओ समाधान में है। एक cuvette करने के लिए समाधान स्थानांतरण. स्पेक्ट्रोफोटोमिति द्वारा OD500 एनएम को मापें और 100% आइसोप्रोपेनॉल को रिक्त के रूप में उपयोग करें (चित्र 2ब्)

6. लिपिड ओवरलोडिंग और स्टेटोसिस प्रेरण का मूल्यांकन: बोडीप दाग और साइटोफ्लोरीमीट्रिक विश्लेषण

  1. कोशिकाओं को 1x PBS के साथ एक बार धो लें। 37 डिग्री सेल्सियस पर 40 मिनट के लिए अंधेरे में 1x पीबीएस में पतला Bodipy के 100 एनएम के साथ इनक्यूबेट। एक बेदाग नियंत्रण प्रवाह साइटोमेट्री माप में शामिल किया जाना चाहिए। इस बिंदु से, जितना संभव हो प्रकाश से नमूनों की रक्षा करें।
    नोट: प्रत्येक नमूने के लिए आवश्यक धुंधला समाधान की मात्रा कोशिकाओं culturing के लिए इस्तेमाल किया मीडिया की मात्रा से मेल खाती है.
  2. धुंधला समाधान निकालें और कोशिकाओं को 1x पीबीएस के साथ एक बार धो लें। चरण 6.3-6.6 पर आगे बढ़ें. FACS के लिए (Fluorscence-सक्रिय सेल छँटाई) विश्लेषण या माइक्रोस्कोप इमेजिंग के लिए 6.7 कदम.
  3. 1x पीबीएस के साथ कोशिकाओं को धीरे से स्क्रैप करें और इसे 15 एमएल ट्यूब में स्थानांतरित करें। 10 मिनट (200 x g, 4 डिग्री सेल्सियस) के लिए सेंट्रीफ्यूज।
  4. धीरे से छर्रों परेशान बिना supernatants निकालें और 1x पीबीएस के 3 एमएल के साथ धो लो. 5 मिनट (200 x g, 4 डिग्री सेल्सियस) के लिए सेंट्रीफ्यूज।
  5. supernatants निकालें और 1x पीबीएस के 300 डिग्रीएल में फिर से निलंबित, तो एक FACS ट्यूब में स्थानांतरण.
  6. 505/515 एनएम के उत्तेजना/उत्सर्जन तरंगदैर्ध्य के साथ साइटोफ्लोरिमितीय विश्लेषण द्वारा बोडिपी फ्लोरोसेंट तीव्रता को तुरंत मापें (चित्र 3ए,बी)।
  7. कोशिकाओं को 1x पीबीएस के साथ एक बार धो लें और पीबीएस को पूरी तरह से हटा दें।
  8. 4% पैराफॉर्मेल्डिहाइड जोड़ें (1x पीबीएस में पतला) और आरटी में 15 मिनट के लिए इनक्यूबेट करें।
    चेतावनी: Paraformaldehyde विषाक्त है, तो इस कदम को एक धूआं हुड में प्रदर्शन किया जाना चाहिए, सुरक्षात्मक उपकरणों के साथ, दस्ताने सहित, एक प्रयोगशाला कोट, और एक मुखौटा.
  9. पैराफॉर्मेल्डिहाइड निकालें और पीबीएस में 5 मिनट के लिए 3x नमूने धो एं। कोशिकाओं को 1x पीबीएस में 4 डिग्री सेल्सियस पर रखा जा सकता है या तुरंत छविबद्ध किया जा सकता है (चित्र 3ब्) भंडारण के लिए, parafilm के साथ लपेटो और एल्यूमीनियम पन्नी के साथ कवर करने के लिए सुखाने से कोशिकाओं को रोकने के.

7. लिपिड ओवरलोडिंग और स्टेटोसिस प्रेरण का मूल्यांकन: क्यूपीसीआर

  1. कोशिकाओं को 1x PBS के साथ एक बार धो लें। 1x पीबीएस के साथ कोशिकाओं को स्क्रैप, 200 x ग्रामपर अपकेंद्रित्र, और supernatant त्यागें. इस चरण में, कोशिकाओं को -80 डिग्री सेल्सियस पर काटा जा सकता है या चरण 7-2 के रूप में संसाधित किया जा सकता है।
  2. निर्माता के निर्देशों का पालन वाणिज्यिक अभिकर्मकों का उपयोग कर मानक तरीकों द्वारा कुल आरएनए अलगाव प्रदर्शन करते हैं।
  3. यूवी स्पेक्ट्रोफोटोमिट्रिक माप द्वारा आरएनए एकाग्रता का आकलन, यह सुनिश्चित करना कि आरएनए शुद्धता उच्च है (2.0 के करीब) A260/A280 पढ़ने के आधार पर.
  4. एक मानक cDNA संश्लेषण किट के साथ कुल आरएनए के 1 डिग्री ग्राम से cDNA सिंथेज़ करें।
  5. एक अंतिम 50 डिग्री सेल्सियस मात्रा के साथ एच2हे के साथ एक डिल्यूट सीडीएएनए।
  6. QPCR द्वारा triplicate में प्रत्येक cDNA नमूना का विश्लेषण करें: एक QPCR मास्टर मिश्रण तैयार (तालिका 1) कि प्रत्येक प्राइमर के लिए आवश्यक प्रतिक्रियाओं के लिए पर्याप्त है, नियंत्रण के रूप में तीन गृहव्यवस्था जीन के लिए विशिष्ट प्राइमर सहित: gliceraldeidede-3-fosfato deidrogenasi (GAPDH), actinB और राइबोसोमल 18S (प्राइमर दृश्यों के लिए सामग्री की तालिका देखें):
  7. एक पीसीआर मल्टीवॉल प्लेट में प्रति अच्छी तरह से मास्टर मिश्रण के 18 डिग्री एल वितरित करें।
  8. प्रत्येक कुएं में 2 डिग्री सेल्सियस का सी डीएनए नमूना जोड़ें। प्लेट को सील करें।
  9. थर्मल साइकिलर अनुदेश के अनुसार नमूने चलाते हैं।

8. लिपिड ओवरलोडिंग और स्टेटोसिस प्रेरण का मूल्यांकन: CARS

  1. पहले कांच के नीचे बर्तन पर तैयार कोशिकाओं को ठीक करें, के रूप में चरण 5.1-5.3 में वर्णित.
  2. एक वाणिज्यिक टूबल picosecond स्पंदित लेजर प्रणाली पर स्विच, यह ट्यूनिंग विभिन्न तरंगदैर्ध्य के दो outputs प्राप्त करने के लिए. outputs के बीच आवृत्ति अंतर होना चाहिए 2,840 सेमी-1 तीव्र CARS प्रकाश संकेत मेथिलीन सममित खींच करने के लिए इसी उत्पन्न करने के लिए; 1,064 एनएम ("स्टोक्स" प्रकाश) पर एक निश्चित-तरंगदैर्ध्य उत्पादन के लिए, अन्य तरंगदैर्ध्य 817 एनएम ("पंप" प्रकाश) के लिए tuned किया जाना चाहिए।
  3. सुनिश्चित करें कि 817 एनएम उत्पादन स्थानिक और लौकिक रूप से 1,064 एनएम उत्पादन के साथ ओवरलैप किया जाता है: एक उपयुक्त डाइक्रोइक दर्पण का उपयोग करें (यानी, 817 और 1,064 एनएम के बीच कटौती के साथ) स्थानिक रूप से बीम गठबंधन करने के लिए और लेजर के अस्थायी ओवरलैप प्राप्त करने के लिए एक ऑप्टिकल देरी लाइन का उपयोग करें दालों.
  4. सुनिश्चित करें कि दो copropagating बीम दोनों collimated रहे हैं और उनके व्यास समान मूल्यों है कि माइक्रोस्कोप है कि उन्हें नमूने पर ध्यान केंद्रित करेंगे भीतर ऑप्टिकल प्रणाली के लिए उपयुक्त हैं; यदि आवश्यक हो, तो अलग से उन्हें जोड़ती है कि dichroic दर्पण से पहले बीम collimate.
  5. एक वाणिज्यिक उल्टे माइक्रोस्कोप प्रणाली है, जो एक अवरक्त लेजर स्कैनिंग इकाई और एक दोहरे चैनल लाल / हरी एपिक डिटेक्शन यूनिट शामिल करना चाहिए और स्कैनिंग इकाई में copropagating लेजर बीम संरेखित पर स्विच करें.
  6. दोहरे चैनल एपी डिटेक्शन यूनिट खोलने, फिल्टर घन को हटाने और एक bandpass फिल्टर है कि 2,840 सेमी-1 CARS संकेत है कि 817/1,064 एनएम पंप के लिए 663 एनएम पर केंद्रित है का चयन कर सकते हैं के साथ अपने लाल तरंग लंबाई का पता लगाने फिल्टर की जगह / योजना. एक संकीर्ण बैंडविड्थ (20 एनएम) फिल्टर फ्लोरोसेंट पृष्ठभूमि संकेतों के उच्च स्तर के संग्रह से बचने के लिए पसंद किया जाता है।
  7. उल्टे CARS माइक्रोस्कोप के मंच पर एक डिश रखें, और एक 100x तेल विसर्जन उद्देश्य का उपयोग कर, कोशिकाओं पर ध्यान केंद्रित करने के उद्देश्य की ऊर्ध्वाधर स्थिति बदलाव.
  8. 127 m x 127 $m फैले दृश्य के एक क्षेत्र पर उच्च संकल्प (1024 x 1024 पिक्सल) छवियों को इकट्ठा करने के लिए माइक्रोस्कोप सॉफ्टवेयर सेट करें।
  9. देखने के 127 डिग्री मीटर x 127 डिग्री मीटर क्षेत्र की छवियों को लगातार प्राप्त करने और प्रदर्शित करने के लिए माइक्रोस्कोप सॉफ्टवेयर सेट करें और छवि संग्रह पैरामीटर का अनुकूलन करते हुए प्रदर्शित छवियों की जांच करें। सुनिश्चित करें कि लेजर शक्तियों तेजी से छवि संग्रह और कम से कम नुकसान के लिए संतुलित कर रहे हैं, आवश्यक के रूप में बीम रास्तों में उपयुक्त तटस्थ घनत्व फिल्टर डालने, और एक पिक्सेल रहने का समय है कि एक अच्छा संकेत करने के लिए शोर के साथ छवियों के संग्रह की अनुमति देता है का चयन चयनित लेजर बिजली की स्थिति के तहत अनुपात.
  10. प्राप्त करें और अनुकूलित शर्तों के तहत पकवान के भीतर देखने के कई अलग अलग क्षेत्रों की छवियों को बचाने के। वैकल्पिक रूप से, multiphoton फ्लोरोसेंट छवियों, एक हरे रंग की तरंग लंबाई उत्सर्जन द्वारा उत्पन्न (ज्यादातर 817 एनएम पर दो-फोटोन उत्तेजना से), एक साथ अन्य एपी डिटेक्टर के माध्यम से एकत्र किया जा सकता है. प्रत्येक डिश के लिए चरण 8.7-8.10 दोहराएँ.
  11. CARS छवि विश्लेषण के लिए, ImageJ के FIJI कार्यान्वयन का उपयोग कर छवियों की प्रक्रिया. विस्तार के नुकसान के बिना संकेत करने के लिए शोर अनुपात में सुधार करने के लिए आगे विश्लेषण से पहले प्रत्येक छवि पर Despeckle समारोह (या एक समान denoising उपकरण) संचालित.
  12. मैन्युअल रूप से कोशिकाओं का चयन करने के लिए FIJI का उपयोग करें और फिर स्वचालित रूप से लिपिड बूंदों को विभाजित अलग-अलग कोशिकाओं के भीतर गिनती करने के लिए प्रत्येक सेल के लिए और प्रत्येक डिश के लिए पूरी छवि डेटासेट के लिए लिपिड छोटी बूंदों पर आंकड़े का उत्पादन.

9. एमटीटी सेल Viability परख

  1. विभेदक संस्कृति माध्यम के अंतिम 100 डिग्री सेल्सियस आयतन में 1 x 105 कोशिकाओं/
  2. बीज बोने के बाद 24 ज, 99% मेथनॉल (वाहन) के साथ कोशिकाओं का इलाज और 100 डिग्री सेल्सियस, 250 डिग्री सेल्सियस और 500 डिग्री सेल्सियस सोडियम ओलेट और सोडियम पामिटेट के साथ भेदभाव संस्कृति मध्यम के 100 $L में पतला /
  3. 99% मेथनॉल के साथ और 100 डिग्री सेल्सियस, 250 डिग्री सेल्सियस और 500 डिग्री एम सोडियम ओलेट और सोडियम पामिटेट के साथ माध्यम को बदलें जो भेदभाव संस्कृति माध्यम के 100 डिग्री एल में पतला /
  4. 96 ज मेथनॉल/सोडियम ओलेएट/सोडियम पामिटेट उपचार के बाद, कोशिकाओं को 100 डिग्री अंतरीकरण संस्कृति माध्यम/अच्छी तरह से त्रिलोकी में नियंत्रण के रूप में पतला 2 डिग्री सेल्सियस के साथ इलाज करें।
  5. 18 ज doxorubucin उपचार के बाद, भेदभाव संस्कृति माध्यम के 100 डिग्री सेल्सियस के साथ माध्यम बदल जाते हैं।
  6. 3 के 20 डिग्री सेल्सियस (4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenil)-2H-tetrazolium अभिकर्मक एमटीटी (सामग्रीकीतालिका) 96-वेल परास प्लेट में प्रत्येक अच्छी तरह से जिसमें विभिन्न संस्कृति के 100L में कोशिकाओं युक्त . त्रिफला में भेदभाव संस्कृति माध्यम के 100 डिग्री सेल्सियस में कोशिकाओं के बिना अच्छी तरह से एक नियंत्रण में अभिकर्मक के 20 डिग्री सेल्सियल पाइपिंग द्वारा एक पृष्ठभूमि नियंत्रण शामिल करें।
  7. एक आर्द्र, 5% सीओ2 वातावरण में 37 डिग्री सेल्सियस पर प्लेट को इनक्यूबेट करें।
  8. 30, 60, और एमटीटी tetrazolium अभिकर्मक के साथ 90 मिनट के लिए incubating के बाद, एक 96 अच्छी तरह से प्लेट रीडर का उपयोग कर 490 एनएम पर अवशोषण रिकॉर्ड. अन्य नमूनों के लिए अवशोषण मूल्यों से कोई सेल नियंत्रण कुओं की पृष्ठभूमि अवशोषण घटाना.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

यह प्रोटोकॉल सोडियम ओलेट उपचार द्वारा DMSO-अलग HepaRG कोशिकाओं में vesicular steatosis को प्रेरित करने और उसकी विशेषता के लिए एक कुशल विधि का वर्णन करता है (चित्र 1)।

हेपाआरजी कोशिकाओं का विभेद।
भेदभाव को कुशलता से प्रेरित करने के लिए, प्रसार माध्यम में कोशिकाओं को कमघनत्व (2.5 x 104 कोशिकाओं/ जब कम घनत्व पर बीजित हो जाते हैं, तो कोशिकाएं सक्रिय रूप से विभाजित हो जाती हैं और लम्बी अपृथक्कृत आकृतिविज्ञान (चित्र 1ठ) प्राप्त कर ली जातीहैं। कोशिकाओं को 7 दिनों के लिए प्रसार माध्यम में विकसित करने के लिए छोड़ दिया जाना चाहिए, जब तक 100% संगम तक पहुँच गया है (चित्र 1ब्) . 2% DMSO के संपर्क में आने के बाद, कोशिकाओं में अंतर करने के लिए और पित्त उपकला की तरह कोशिकाओं से घिरा ठेठ hepatocyte की तरह कालोनियों बनाने के लिए शुरू (चित्र 1डी)। विभेदित हेपाआरजी कोशिकाएं हेपाटो-विशिष्ट मार्कर व्यक्त करती हैं, जैसे एल्बुमिन, Cyp3A4 और Aldolase B. उचित विभेदकी पुष्टि करने के लिए, विभेदित कोशिकाओं (दिन 21) में इन यकृत मार्कर जीनों के अभिव्यक्ति स्तर (दिन 21) और बढ़ते कोशिकाओं (दिन 0) में ुपीसीआर द्वारा विश्लेषण किया गया (चित्र 1)। Albumin, Cyp3A4 और Aldolase बी जीन विभेदित HepaRG कोशिकाओं में विनियमित किया जाना चाहिए के रूप में बढ़ HepaRG कोशिकाओं की तुलना में, और हम इस प्रवृत्ति को देखा, हमारे भेदभाव प्रोटोकॉल की प्रभावशीलता की पुष्टि.

सोडियम ओलेट उपचार द्वारा हेपाआरजी कोशिकाओं में वेसिकुलर स्टेटोसिस का प्रेरण।
डीईपीएआरजी कोशिकाओं का सोडियम ओलेट उपचार वसा संचय को प्रेरित करता है, जो ऑप्टिकल माइक्रोस्कोप के नीचे साइटोप्लाज्म में लिपिड बूंदों के रूप में दिखाई देता है (चित्र 2)। स्टेटोसिस के कुशल प्रेरण को सत्यापित करने के लिए, ओलेट-उपचार ित और नियंत्रण हेपाआरजी कोशिकाओं को तेल लाल हे डाई के साथ दाग दिया गया था। दागने के बाद लिपिड की बूंदें लाल बूंदों के रूप में आसानी से दिखाई देती हैं (चित्र 2) और तेल लाल हे डाई के स्पेक्ट्रोफोटोमीट्रिक माप द्वारा आइसोप्रोपेनॉल (चित्र 2ब्) के साथ निर्धारित किया जा सकता है। कोशिकाओं से एल्यूटेड तेल लाल ओ का अवशोषण सीधे कोशिकाद्रव्यी लिपिड बूंद संचय के लिए आनुपातिक है।

सोडियम oleate एकाग्रता और जोखिम समय MTT colorimetric सेल व्यवहार्यता परख (चरण 9) द्वारा निर्धारित किए गए थे. सोडियम ओलेट उपचार की तुलना सोडियम पामिटेट उपचार से की गई थी और एपोटोटिक औषध डोक्सोरूबुसिन (2 उम) का प्रयोग नियंत्रण के रूप में किया गया था (चित्र 2) । यौगिकों की Cytoxicity MTT द्वारा मूल्यांकन किया गया था, एक वाणिज्यिक यौगिक का लाभ लेने (सामग्री कीतालिका), कि MTT tetrazolium शामिल हैं. पानी में घुलनशील पीले एमटीटी tetrazolium यौगिक एक बैंगनी पानी में घुलनशील formazan उत्पाद में चयापचय सक्रिय कोशिकाओं द्वारा bioreduced है. फोर्मज़ान उत्पाद को इसके अवशोषण द्वारा 490 दउ पर निर्धारित किया जाता है और यह राशि संस्कृति में जीवित कोशिकाओं की संख्या के अनुपात में प्रत्यक्ष रूप से समानुपाती होती है (चित्र 2) ।

सोडियम ओलेट-उपचारित हेपाआरजी कोशिकाओं में वेसिकुलर स्टेटोसिस का परिमाणीकरण
सोडियम oleate उपचार के बाद सेलुलर लिपिड सामग्री की वृद्धि की मात्रा निर्धारित करने के लिए, हम Bodipy डाई के साथ धुंधला प्रदर्शन किया, एक जांच है कि लिपिड बूंदों लेबल. cytofluorimetric विश्लेषण का उपयोग करना, यह Bodipy मतलब फ्लोरोसेंट तीव्रता, जो नियंत्रण कोशिकाओं की तुलना में oleate इलाज कोशिकाओं में अधिक है द्वारा ट्राइग्लिसराइड सामग्री की मात्रा निर्धारित करने के लिए संभव है (चित्र 3ए, बी), कुशल वसा का संकेत ओलेट उपचार के बाद संचय। वास्तव में, बोडिपी-सना हुआ कोशिकाओं की छवियों में ओलेट-उपचारित कोशिकाओं में चमकीले हरे फ्लोरोसेंट लिपिड की बूंदें दिखाई देती हैं जो नियंत्रण कोशिकाओं में दिखाई नहीं देती हैं (चित्र 3ब्)।

dHepaRG कोशिकाओं के सोडियम oleate उपचार लिपिड चयापचय और भड़काऊ जीन अभिव्यक्ति को नियंत्रित करता है। वेसिकुलर स्टेटोसिस के कुशल प्रेरण का मूल्यांकन करने के लिए, हमने नियंत्रण कोशिकाओं की तुलना में सोडियम ओलेट-उपचारित कोशिकाओं में चयनित जीनों के अभिव्यक्ति स्तरों का मूल्यांकन किया है (चित्र4)। एसिटिल-सीओए कार्बोक्सिलेस बीटा (एसीबीबी), ग्लिसरोल-3-फॉस्फेट ऐसिलट्रांसफरेस माइटोकोंड्रियाल (जीपीएएम), पेरिपिन्स (PLIN2, PLIN4), एपोलिपोप्रोटीन बी (एपीओबी), पायरुवाट डिहाइड्रोजेनेज किनेस आइसोजीम 4 (पीडीके4), कार्निटाइन पामिटोलिट्रायल ट्रांसफरेज 1ए ए ए ए और ए.पी.टी.1ए interleukin 6 (IL6) oleate-उपचारd dHepaRG कोशिकाओं में विनियमित किया गया, जबकि विलेय वाहक परिवार 2 सदस्य 1 (SLC2A1), apolipoप्रोटीन सी-III (APOC3), और स्टेरोयल-कोए desaturase (SCD) नीचे विनियमित थे (चित्र 4). विभेदित हेपाआरजी कोशिकाओं के लिए सोडियम ओलेट के अलावा बूंदों में लिपिड भंडारण की और विशेषता और मात्रा निर्धारित करने के लिए, हमने एक अभिनव माइक्रोस्कोपी तकनीक, सुसंगत एंटी-स्टोक्स रमन प्रकीर्णन (सीएआरएस) माइक्रोस्कोपी का उपयोग किया, जो सक्षम बनाता है लेबलिंग के बिना लिपिड बूंदों का दृश्य और परिमाणीकरण (चित्र 5)। लिपिड बूंदों को कार्स छवियों का उपयोग करते हुए एकल-सेल स्तर पर संख्याओं, वितरण और आकृति विज्ञान के संदर्भ में सांख्यिकीय रूप से मात्रा निर्धारित की गई थी। सोडियम ओलेट (250 डिग्री सेल्सियस) के साथ उपचार लिपिड बूंदों की संख्या में एक महत्वपूर्ण वृद्धि प्रेरित (चित्र 5बी), जो एक उच्च कुल छोटी बूंद क्षेत्र प्रति सेल के लिए नेतृत्व (चित्र 5ब्) और एक उच्च प्रतिशत छोटी बूंद क्षेत्र प्रति सेल ( चित्र 5D), नियंत्रण कोशिकाओं की तुलना में, यह दर्शाता है कि dHepaRG कोशिकाओं कुशलतापूर्वक सोडियम oleate उपचार के बाद वसा जमा.

Figure 1
चित्र 1 : HepaRG कोशिकाओं का भेदभाव. (क) प्रतिनिधि आरेख जिसमें हेपाआरजी सेल विभेद/उपचार प्रोटोकॉल को दर्शाने वाला चित्र है, जैसा कि चरण 3 और 4 में वर्णित है। (बी-डी) बीज बोने के बाद दिन 0 में बिना दागदार HepaRG कोशिकाओं को दिखाने वाली छवियाँ (बी), संगम दिवस 7 पर बीज बोने के बाद (सी), और विभेदित हेपाआरजी (dHepaRG ) दिन में 21 के बाद (डी) () कुल आरएनए को प्रसारी और dHepaRG कोशिकाओं से निकाला गया था , सी डी एन ए को संश्लेषित किया गया था और ुपीसीआर द्वारा संकेतित जीनों (सामग्री तालिका) के लिए विशिष्ट प्राइमर का उपयोग करके उसका विश्लेषण किया गया था . नमूने GAPDH, actinB और राइबोसोमल 18S हाउसकीपिंग जीन के मतलब को सामान्यीकृत किया गया. हिस्टोग्राम शो गुना बढ़ रहा है (दिन 0) बनाम विभेदित कोशिकाओं (दिन 21) (बार से संकेत मिलता है S.D.; p-मान छात्र के टी-परीक्षण द्वारा गणना की गई). कृपया इस चित्र का एक बड़ा संस्करण देखने के लिए यहाँ क्लिक करें.

Figure 2
चित्र 2 : dHepaRG कोशिकाओं के सोडियम oleate उपचार लिपिड छोटी बूंद संचय प्रेरित. (ए) वाहन (नियंत्रण) (बाएं छवि) के साथ या 250 डिग्री सोडियम ओलेट (दाएं छवि) के साथ 5 दिनों के लिए इलाज किया unstained विभेदित HepaRG (dHepaRG) कोशिकाओं की छवियाँ। (बी) उपचार के बाद, कोशिकाओं को तेल लाल हे डाई के साथ दाग दिया गया; लिपिड बूंदें लाल रंग में दिखाई देती हैं। () तेल लाल ओ डाई को एलिट किया गया था और ओडी को 570 द.उ. पर मापा गया था। परिणाम तीन स्वतंत्र प्रयोगों के साधन के रूप में व्यक्त कर रहे हैं (बार S.D.; p-मान छात्र के t-परीक्षण द्वारा इंगित करते हैं). (डी) डीएचईआरजी कोशिकाओं के वाहन (99% मेथनॉल) का सेल व्यवहार्यता मूल्यांकन (99% मेथनॉल) का इलाज किया गया या सोडियम ओलेट और सोडियम पामिटेट (100 डिग्री सेल्सियस, 250 डिग्री सेल्सियस, या 500 डिग्री सेल्सियस) के साथ 5 दिनों के लिए इलाज किया गया, या डॉक्सोरूबुसिन (2 डिग्री सेल्सियस) के साथ 18 एच का इलाज किया गया।  cytotoxicity का आकलन एक एमटीटी परख किट (सामग्रीकीतालिका) का उपयोग कर प्रदर्शन किया गया था , 490 एनएम पर रिकॉर्डिंग अवशोषण, निर्माता के निर्देश के अनुसार. परिणाम तीन स्वतंत्र प्रयोगों के साधन के रूप में व्यक्त कर रहे हैं (बार संकेत मिलता है S.D.; पी मूल्यों छात्र t-परीक्षण का उपयोग कर निर्धारित किया गया: * 0.01 p और lt; 0.05; * * 0.001 ] p और lt; 0.01; * * p और lt; 0.001). कृपया इस चित्र का एक बड़ा संस्करण देखने के लिए यहाँ क्लिक करें.

Figure 3
चित्र 3 : Bodipy धुंधला द्वारा सोडियम oleate उपचार के बाद वसा संचय की मात्रा. अलग HepaRG (dHepaRG) कोशिकाओं वाहन (नियंत्रण) के साथ या 5 दिनों के लिए 250-$M सोडियम oleate के साथ इलाज किया गया. उपचार के बाद, dHepaRG कोशिकाओं Bodipy डाई के साथ दाग और प्रवाह साइटोमेट्री द्वारा विश्लेषण किया गया. (क) प्रतिनिधि ओवरले प्रोफाइल (अधिकतम का%: अधिकतम धुंधला तीव्रता का प्रतिशत)। (बी) हिस्टोग्राम शो मतलब फ्लोरोसेंट तीव्रता (MFI) तीन स्वतंत्र प्रयोगों से नियंत्रण पर इलाज कोशिकाओं के प्रतिशत के रूप में (बार्स से संकेत मिलता है S.D.; पी मूल्यों छात्र के t-परीक्षण का उपयोग कर निर्धारित किया गया: * 0.01 ] p और lt; 0.001 p;lt; 0.01; **p (lt; 0.001). (ग) कोशिकाओं को 4% पैराफॉर्मेल्डिहाइड के साथ निर्धारित किया गया था। छवियाँ हरे रंग में Bodipy-सना हुआ लिपिड बूंदों दिखाते हैं. कृपया इस चित्र का एक बड़ा संस्करण देखने के लिए यहाँ क्लिक करें.

Figure 4
चित्र 4 : dHepaRG कोशिकाओं के सोडियम oleate उपचार लिपिड चयापचय और भड़काऊ जीन अभिव्यक्ति के विनियमन लाती है. अलग HepaRG (dHepaRG) कोशिकाओं वाहन (नियंत्रण) के साथ या 5 दिनों के लिए 250-$M सोडियम oleate के साथ इलाज किया गया. CDNAs संकेत जीन के लिए विशिष्ट प्राइमर के साथ QPCR द्वारा विश्लेषण किया गया और परिणाम GAPDH, actinB और रिबोसोमल 18S हाउसकीपिंग जीन के मतलब को सामान्यीकृत किया गया; प्राइमर सामग्री के तालिकामें दिए जाते हैं। हिस्टोग्राम संकेत जीनों के अभिव्यक्ति स्तर को नियंत्रण पर उपचारित कोशिकाओं के गुना प्रेरण के रूप में दिखाता है (बार्स से संकेत मिलता है कि एस.डी.; पी-मूल्यों की गणना छात्र के टी-परीक्षण द्वारा की गई थी)। कृपया इस चित्र का एक बड़ा संस्करण देखने के लिए यहाँ क्लिक करें.

Figure 5
चित्र 5 : CARS माइक्रोस्कोपी द्वारा सोडियम oleate उपचार के बाद लिपिड छोटी बूंद संचय की विशेषता. विभेदित हेपाआरजी (dHepaRG) कोशिकाओं वाहन (नियंत्रण) के साथ या 5 दिनों के लिए 250 डिग्री मीटर सोडियम oleate के साथ इलाज किया गया और CARS माइक्रोस्कोपी द्वारा विश्लेषण किया गया. (ए) प्रतिनिधि चित्र लाल रंग में लिपिड छोटी बूंद CARS इसके विपरीत दिखा. (ठ) हिस्टोग्राम प्रति सेल लिपिड बूंदों की संख्या दर्शाता है। (ग) हिस्टोग्राम जिसमें प्रति सेल बूंदों द्वारा कवर किए गए कुल प्रतिबिंब क्षेत्र को दिखाया गया है। (घ) हिस्टोग्राम में प्रति सेल बूंदों से ढकी % छोटी-छोटी क्षेत्रदर्शी दर्शाए गए हैं। सभी परिणाम तीन स्वतंत्र प्रयोगों के साधन के रूप में व्यक्त कर रहे हैं (बार संकेत मिलता है S.E.; पी मूल्यों छात्र के t-परीक्षण द्वारा निर्धारित किए गए थे: * 0.01 ] p और lt; 0.05; * * 0.001 ] p और lt; 0.01; * * पी और lt; 0.001). कृपया इस चित्र का एक बड़ा संस्करण देखने के लिए यहाँ क्लिक करें.

अभिकर्मकों किसी एकल प्रतिक्रिया के लिए वॉल्यूम ($L)
2x SYBR ग्रीन फ्लोरोसेंट डाई 10
पीसीआर ग्रेड एच2हे 6
फॉरवर्ड प्राइमर (जेडएम) 1
रिवर्स प्राइमर (जेडएम) 1

तालिका 1: QPCR मास्टर मिश्रण.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

इस प्रोटोकॉल में वर्णन किया गया है कि हेपाआरजी कोशिकाओं में अंतर कैसे करें और सोडियम ओलेट उपचार द्वारा वेसिकुलर स्टेटोसिस को कैसे प्रेरित करें (चित्र 1)। वास्तव में, अन्य मानव hepatotocellular कार्सिनोमा (एचसीसी) सेल लाइनों की तुलना में, HepaRG सेल लाइन वयस्क मानव hepatocytes की सुविधाओं को दर्शाती है, पूर्व vivo खेती प्राथमिक मानव hepatocytes के लिए एक मूल्यवान विकल्प का प्रतिनिधित्व13,14 ,15. हेपाआरजी सेल लाइन का व्यापक रूप से यकृत साइटोटॉक्सिसिटी अध्ययन, औषध चयापचय और विषाणु विज्ञान अध्ययन15,16,22के लिए प्रयोग किया जाता रहा है .

HepaRG कोशिकाओं के साथ तुलना में, इस तरह के HepG2 के रूप में अन्य एचसीसी सेल लाइनों, HUH7, HUH6 और Hep3B कम चयापचय क्षमता प्रदर्शित, जिगर विशेष कार्यों का एक पर्याप्त सेट की कमी23,24, और एक उच्च बेसल स्तर का प्रदर्शन साइटोसोलिक वसा संचय लिपिड बूंदों में संग्रहीत किया जाता है। इस प्रकार, ये एचसीसी सेल लाइनें हेपाआरजी सेल लाइन की तुलना में लिपिड अधिभारके शलभ के बाद वेसिकुलर स्टेटोसिस को शामिल करने के लिए मॉडल के रूप में कम उपयोगी होती हैं।

प्रोटोकॉल के भीतर महत्वपूर्ण कदम
जब कम घनत्व पर बीज (2.5 x104 कोशिकाओं/ 100% संगम तक पहुंचने के बाद, वे 2% DMSO के संपर्क में आने पर अंतर करने में सक्षम होते हैं और वे पित्त उपकला जैसी कोशिकाओं से घिरे विशिष्ट हेपेटोसाइट जैसे कालोनियों का निर्माण करते हैं (चित्र 1D)। यह मिश्रित पित्त/हेपाटासाइट सेल संस्कृति यकृत ऊतक की विशेषताओं को फिर से दोहराती है, जो अन्य यकृत कोशिका प्रकार (साइनॉइडया या कुफर) की कमी के बावजूद एक शारीरिक स्थिति जैसी होती है।

विभेदन प्रक्रिया में एक महत्वपूर्ण कदम कोशिकाओं का संगम है। कोशिकाओं को कम घनत्व (2.5 x 104 कोशिकाओं/सेमी2) (चित्र 1) पर बीजित किया जाना चाहिए और कम से कम 1 सप्ताह (दिन 0-7 ) के लिए प्रसार माध्यम में सक्रिय रूप से बढ़ने की अनुमति दी जानी चाहिए। 7 दिन में, भेदभाव प्रक्रिया शुरू करने के लिए 2% DMSO जोड़ने से पहले, कोशिकाओं 100% संगम पर होना चाहिए (चित्र 1ब्)। यदि दिन 7 (चरण 2.2) पूर्ण संगम तक नहीं पहुँचा गया है, यह अत्यधिक की सिफारिश की है कि कोशिकाओं को कुछ अतिरिक्त दिनों के लिए प्रसार माध्यम में बढ़ रही जारी रखने के लिए अनुमति दी जाती है, जब तक 100% संगम हासिल की है.

प्रोटोकॉल की सीमाएं
यह देखा गया है कि भेदभाव माध्यम जोड़ने के बाद, कुछ कोशिकाओं को पीड़ित करते हैं, और आमतौर पर 10% कोशिकाएं बाद के 2-3 दिनों के दौरान मर जाती हैं। इस स्तर पर, दैनिक धोने और मध्यम बदलते (कदम 2.4) अस्थायी मृत कोशिकाओं को छोड़ने के लिए जारी रखा जाना चाहिए. एक विशिष्ट FBS के उपयोग (सामग्री की तालिका) दोनों भेदभाव और प्रसार मीडिया के पूरक के लिए, अंतरीकरण दक्षता और दिन 7-21 के दौरान कम सेल मौत में वृद्धि करनी चाहिए (चरण 2.4). यह अत्यधिक 20 पारित करने के लिए कोशिकाओं को बनाए रखने के लिए सिफारिश की है, और कम मार्ग का चयन करने के लिए (lt;20) अलग कोशिकाओं के लिए: कम कोशिकाओं मौत सबसे कम HepaRG कोशिकाओं के लिए होता है. इसके अलावा, HepaRG भेदभाव 35 मिमी और 60 मिमी व्यंजन में अधिक प्रभावशाली लगता है, जबकि कोशिकाओं को अधिक पीड़ित जब 100 मिमी और 150 मिमी व्यंजन में बीज करते हैं.

संशोधन और समस्या निवारण
पामिटिक और ओलिक फैटी अम्लदोनों के विभिन्न अनुपातों के संपर्क में आने से इंट्रासाइटोप्लाज्माटिक लिपिड की बूंदों का निर्माण25,26हुआ . तथापि, हमने देखा कि विभेदित हेपाआरजी कोशिकाओं के सोडियम ओलेट उपचार ने लिपिड संचय तथा सेलव्यवहार्यता के कुशल प्रेरण के संदर्भ में पामिटिक अम्ल जोखिम की तुलना में बेहतर परिणाम प्रदर्शित किए हैं । वास्तव में, पामिटिक एसिड उपचार विभेदित हेपाआरजी कोशिकाओं के लिए विषाक्त साबित हुआ (चित्र 2डी), हेपेटोमा सेल लाइनों पर साहित्य डेटा के साथ समझौते में और मानव और चूहे hepatocyte प्राथमिक संस्कृतियों है कि एक के रूप में पामिटिक एसिड का वर्णन काफी cytotoxic एजेंट25,26,27,28,29. इसके अलावा, सेल आधारित परख में पामिटेट का उपयोग इसकी कम घुलनशीलता के कारण चुनौतीपूर्ण है। फिर भी, सेल लाइनों की आंतरिक परिवर्तनशीलता के कारण, यह सोडियम oleate काम एकाग्रता और उपचार समय लंबाई सत्यापित करने के लिए सिफारिश की है, एक सेल व्यवहार्यता परख के साथ एक समय पाठ्यक्रम प्रयोग में विभिन्न सांद्रता परीक्षण.

लिपिड का पता लगाने की तकनीक का महत्व और तुलना
कोशिकाओं में लिपिड मात्रा का सटीक निर्धारण इस अध्ययन में विभिन्न तरीकों की एक संख्या के माध्यम से स्थापित किया गया था. गुणात्मक और भी लगभग मात्रात्मक समझौते तेल लाल ओ धुंधला, Bodipy धुंधला, और CARS इमेजिंग के माध्यम से प्राप्त परिणामों के बीच मनाया गया. सेल आबादी में लिपिड मात्रा के एक तेजी से अनुमान के लिए, Bodipy प्रवाह साइटोमेट्री या तेल लाल हे जैसे एक दाग का उपयोग आदर्श है. कोशिकाओं की लिपिड छोटी बूंद सामग्री की अधिक विस्तृत जांच के लिए, एक इमेजिंग मोडलिटी को पसंद किया जाता है। इसके अलावा, विशिष्टता समस्याओं जैसे तेल लाल ओ20,30के रूप में लिपिड दाग के लिए सूचित किया गया है , और हमने देखा है कि कुछ मामलों में, Bodipy दाग विशेष रूप से अन्य सेल के बीच लिपिड बूंदों लेबल करने के लिए CARS की तुलना में एक कम क्षमता है organelles (डेटा नहीं दिखाया गया है). इसलिए, एक लेबल मुक्त सूक्ष्म इमेजिंग तकनीक का उपयोग जैसे CARS steatosis परिमाणीकरण और विशेषता के लिए महत्वपूर्ण लाभ प्रदान करता है. एक बड़े फ्लोरोसेंट लेबल के उपयोग से बचने के कारण विशिष्ट फ्लोरोफोर की तुलना में लिपिड अणुओं के छोटे आकार के कारण सीएआरएस इमेजिंग अनुकूल बनाता है; इसलिए, लिपिड का पता लगाने के लिए, लेबल मुक्त तरीके वांछनीय हैं, बड़े प्रोटीन अणुओं को देखने के लिए की तुलना में अधिक। लिपिड CARS संकेत एक ऑप्टिकल उत्सर्जन है कि केवल उत्पन्न होता है जब एक nonlinear बातचीत नमूना में होता है. इस बातचीत केवल पता लगाया जा सकता है जब नमूने पर ध्यान केंद्रित दो उत्तेजना लेज़रों की आवृत्तियों के बीच अंतर methylene से मेल खाता है (CH2) कंपन आवृत्ति खींच. लिपिड में मेथिलीन समूहों की बहुतायत उच्च संकेत से शोर अनुपात के साथ एक बहुत ही तीव्र संकेतों में परिणाम है, और ऑप्टिकल बातचीत के nonlinearity भी मतलब है कि उच्च स्थानिक संकल्प CARS माइक्रोस्कोपी में संभव है. सामान्य में CARS छवियों के उत्कृष्ट गुणवत्ता के आकार और लिपिड बूंदों की संख्या पर आँकड़े के संग्रह की अनुमति देता है, के रूप में इस अध्ययन में प्रदर्शन किया. इसके अलावा, अन्य अध्ययनों से विभिन्न subcellular स्थानीयकरण और विभिन्न उपचार18के साथ लिपिड बूंदों के आकार सहसंबंधित करने के लिए CARS माइक्रोस्कोपी के उपयोग का प्रदर्शन किया है, और विभिन्न तरंगदैर्ध्य में पूरक CARS माप का उपयोग करके, या एक ब्रॉडबैंड CARS या इसी तरह प्रेरित रमन दृष्टिकोण, शोधकर्ताओं ने पता चला है कि यह लिपिड बूंदों के भीतर फैटी एसिड के विभिन्न प्रकार की विशेषता संभव है31,32. इसके अलावा, CARS छवि संग्रह की तेजी से लिपिड छोटी बूंद विकास और एकत्रीकरण33के लौकिक विकास की जांच करने के लिए जीवित कोशिकाओं की स्थिति में इमेजिंग सक्षम किया गया है।

भविष्य अनुप्रयोगों
हाल के दशकों में, सेल जीव विज्ञान में लिपिड बूंदों की भूमिकाओं और कार्यों पर विचार विकसित हुए हैं। पहले मूल रूप से अक्रिय भंडारण vesicles माना जाता था, वे अब अत्यधिक गतिशील सेलुलर organelles समझा जाता है, और रोग में उनकी भूमिका तेजी से मान्यता प्राप्त किया जा रहा है34,35,36. हालांकि जिगर की बीमारी के मामले में, लिपिड संचय (स्टेटोसिस) लंबे समय से एक महत्वपूर्ण पहलू के रूप में जाना जाता रहा है, रोग प्रगति में लिपिड बूंदों की भागीदारी का सटीक तंत्र पूरी तरह से स्पष्ट नहीं है। इसलिए, ऐसे CARS कि लिपिड बूंदों के गतिशील व्यवहार की विशेषता कर सकते हैं के रूप में तरीकों NAFLD सहित रोगों की एक आणविक समझ के विकास के लिए महत्वपूर्ण महत्व के हैं. QPCR द्वारा मेटाबोलिक जीन अभिव्यक्ति विश्लेषण अत्यधिक CARS के माध्यम से लिपिडकी आणविक इमेजिंग के लिए पूरक है, के रूप में पिछले अध्ययनों में प्रदर्शन 17,18, रोग तंत्र में गहरी अंतर्दृष्टि की अनुमति. वर्तमान अध्ययन में, हम लिपिड चयापचय और भड़काऊ जीन अभिव्यक्ति के विनियमन के साथ फैटी एसिड संचय का निरीक्षण करते हैं, जो प्रारंभिक रोग निदान के लिए जैव-मार्कर के पैनल के निर्माण में योगदान दे सकता है।

सोडियम oleate इलाज dHepaRG सेल आधारित मॉडल न केवल शुरुआत में शामिल आणविक तंत्र के ज्ञान में वृद्धि हो सकती है, लेकिन यह भी NAFLD की प्रगति में, रोग के लिए बेहतर चिकित्सीय दृष्टिकोण के विकास के लिए एक आधार प्रदान.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

लेखक घोषणा करते हैं कि उनका कोई प्रतिस्पर्धी वित्तीय हित नहीं है।

Acknowledgments

हम prof. ईसाई Trepo (INSERM U871, Lyon, फ्रांस), जो कृपया HepaRG कोशिकाओं प्रदान धन्यवाद. हम प्रशासनिक मदद के लिए रीता Appodia के आभारी हैं. इस काम को MIUR- Ministero dell'istruzione, dell'universit] ई डेला ricerca (FIRB 2011-2016 RBAP10XKNC) और Sapienza रोम विश्वविद्यालय (प्रोट) द्वारा समर्थित किया गया था. C26A13T8PS; Prot. C26A142MCH; Prot. C26A15LSXL).

Materials

Name Company Catalog Number Comments
Hyclone HyClone Fetal Clone II  GE Healthcare SH30066
William’s E medium with GlutaMAX  Thermofisher 32551087
Penicillin/streptomycin  SIGMA P4333
Insulin  SIGMA I9278
Hydrocortisone hemisuccinate SIGMA H2270
DMSO, dimethyl sulfoxide SIGMA D2438   
Sodium Oleate SIGMA O7501 
Methanol SIGMA 179337
Isopropanol SIGMA 278475
BODIPY 505/515 Thermofisher D3921
PBS Thermofisher 14190-250
Formaldehyde solution SIGMA 252549
RNAse free DNAseI Promega M198A 
Glass-bottomed dishes Willco Wells GWST-5040
Oil Red solution SIGMA O625
CellTiter 96 AQueous One Solution Promega  G3582
q-PCR oligo name Sequence
ACACB FOR CAAGCCGATCACCAAGAGTAAA
ACACB REV CCCTGAGTTATCAGAGGCTGG
β-actin FOR GCACTCTTCCAGCCTTCCT
β-actin REV AGGTCTTTGCGGATGTCCAC
ALBUMIN FOR TGCTTGAATGTGCTGATGACAGG
ALBUMIN REV AAGGCAAGTCAGCAGGCATCTCATC
ALDOB FOR GCATCTGTCAGCAGAATGGA 
ALDOB REV TAGACAGCAGCCAGGACCTT
APOB FOR CCTCCGTTTTGGTGGTAGAG
APOB REV  CCTAAAAGCTGGGAAGCTGA
APOC3 FOR CTCAGCTTCATGCAGGGTTA
APOC3 REV GGTGCTCCAGTAGTCTTTCAG
CPT1A FOR TCATCAAGAAATGTCGCACG
CPT1A REV GCCTCGTATGTGAGGCAAAA
CYP2E1 FOR TTGAAGCCTCTCGTTGACCC
CYP2E1 REV CGTGGTGGGATACAGCCAA
CYP3A4 FOR CTTCATCCAATGGACTGCATAAAT
CYP3A4 REV TCCCAAGTATAACACTCTACACAGACAA
GAPDH FOR TGACAACTTTGGTATCGTGGAAGG
GAPDH REV AGGGATGATGTTCTGGAGAGCC
GPAM FOR TCTTTGGGTTTGCGGAATGTT
GPAM REV ATGCACATCTCGCTCTTGAATAA
IL6 FOR CCTGAACCTTCCAAAGATGGC
IL6 REV ACCTCAAACTCCAAAAGACCAGTG
PDK4 FOR ACAGACAGGAAACCCAAGCCAC
PDK4 REV TGGAGGTGAGAAGGAACATACACG
PLIN2 FOR TTGCAGTTGCCAATACCTATGC
PLIN2 REV CCAGTCACAGTAGTCGTCACA
PLIN4 FOR AATGAGTTGGAGGGGCTGGGGGACATC
PLIN4 REV GGTCACCTAAACGAACGAAGTAGC
SCD FOR TCTAGCTCCTATACCACCACCA
SCD REV TCGTCTCCAACTTATCTCCTCC
SLC2A1 FOR TGCTCATCAACCGCAACGAG
SLC2A1 REV CCGACTCTCTTCCTTCATCTCCTG
18S FOR CGCCGCTAGAGGTGAAATTC
18S REV TTGGCAAATGCTTTCGCTC

DOWNLOAD MATERIALS LIST

References

  1. Starley, B. Q., Calcagno, C. J., Harrison, S. A. Nonalcoholic fatty liver disease and hepatocellular carcinoma: a weighty connection. Hepatology. 51, (5), 1820-1832 (2010).
  2. Byrne, C. D., Targher, G. NAFLD: a multisystem disease. Journal of Hepatology. 62, (1), Suppl 47-64 (2015).
  3. Marra, F., Gastaldelli, A., Svegliati Baroni, G., Tell, G., Tiribelli, C. Molecular basis and mechanisms of progression of non- alcoholic steatohepatitis. Trends in Molecular Medicine. 14, 72-81 (2008).
  4. Chalasani, N., et al. The diagnosis and management of nonalcoholic fatty liver disease: Practice guidance from the American Association for the Study of Liver Diseases. Hepatology. 67, (1), 328-357 (2018).
  5. Banini, B. A., Sanyal, A. J. Current and future pharmacologic treatment of nonalcoholic steatohepatitis. Current Opinion in Gastroenterology. 33, (3), 134-141 (2017).
  6. Takahashi, Y., Sugimoto, K., Inui, H., Fukusato, T. Current pharmacological therapies for nonalcoholic fatty liver disease/nonalcoholic steatohepatitis. World Journal of Gastroenterology. 21, (13), 3777-3785 (2015).
  7. Younossi, Z., et al. Global burden of NAFLD and NASH: trends, predictions, risk factors and prevention. Nature Reviews Gastroenterology & Hepatology. 15, (1), 11-20 (2018).
  8. Santhekadur, P. K., Kumar, D. P., Sanyal, A. J. Preclinical models of non-alcoholic fatty liver disease. Journal of Hepatology. 68, (2), 230-237 (2018).
  9. Nagarajan, P., Mahesh Kumar, M. J., Venkatesan, R., Majundar, S. S., Juyal, R. C. Genetically modified mouse models for the study of nonalcoholic fatty liver disease. World Journal of. Gastroenterology. 18, (11), 1141-1153 (2012).
  10. Oseini, A. M., Cole, B. K., Issa, D., Feaver, R. E., Sanyal, A. J. Translating scientific discovery: the need for preclinical models of nonalcoholic steatohepatitis. Hepatology International. 12, (1), 6-16 (2018).
  11. Ramboer, E., Vanhaecke, T., Rogiers, V., Vinken, M. Immortalized human hepatic cell lines for in vitro testing and research purposes. Methods in Molecular Biology. 1250, 53-76 (2015).
  12. Gómez-Lechón, M. J., Donato, M. T., Castell, J. V., Jover, R. Human hepatocytes in primary culture: the choice to investigate drug metabolism in man. Current Drug Metabolism. 5, (5), 443-462 (2004).
  13. Marion, M. J., Hantz, O., Durantel, D. The HepaRG cell line: biological properties and relevance as a tool for cell biology, drug metabolism, and virology studies. Methods in Molecular Biology. 640, 261-272 (2010).
  14. Gripon, P., et al. Infection of a human hepatoma cell line by hepatitis B virus. Proceedings of the National Academy of Sciences. 99, (24), 15655-15660 (2002).
  15. Anthérieu, S., Rogue, A., Fromenty, B., Guillouzo, A., Robin, M. A. Induction of vesicular steatosis by amiodarone and tetracycline is associated with up-regulation of lipogenic genes in HepaRG cells. Hepatology. 53, (6), 1895-1905 (2011).
  16. Rouge, A., et al. PPAR agonists reduce steatosis in oleic acid-overloaded HepaRG cells. Toxicology and Applied Pharmacology. 276, (1), 73-81 (2014).
  17. Belloni, L., et al. Targeting a phospho-STAT3-miRNAs pathway improves vesicular hepatic steatosis in an in vitro and in vivo model. Scientific Reports. 8, 13638 (2018).
  18. Nunn, A. D. G., et al. The histone deacetylase inhibiting drug Entinostat induces lipid accumulation in differentiated HepaRG cells. Scientific Reports. 6, 28025 (2016).
  19. Donato, M. T., et al. Cytometric analysis for drug-induced steatosis in HepG2 cells. Chemico-Biological Interactions. 181, (3), 417-423 (2009).
  20. Hellerer, T., Axäng, C., Brackmann, C., Hillertz, P., Pilon, M., Enejder, A. Monitoring of lipid storage in Caenorhabditis elegans using coherent anti-Stokes Raman scattering (CARS) microscopy. Proceedings of the National Academy of Sciences. 104, (37), 14658-14663 (2007).
  21. Le, T. T., Ziemba, A., Urasaki, Y., Brotman, S., Pizzorno, G. Label-free evaluation of hepatic microvesicular steatosis with multimodal coherent anti-Stokes Raman scattering microscopy. PLoS One. 7, (11), 51092 (2012).
  22. Guillouzo, A., Corlu, A., Aninat, C., Glaise, D., Morel, F., Guguen-Guillouzo, C. The human hepatoma HepaRG cells: a highly differentiated model for studies of liver metabolism and toxicity of xenobiotics. Chemico-Biological Interactions. 168, (1), 66-73 (2007).
  23. Nelson, L. J., et al. Human hepatic HepaRG cells maintain an organotypic phenotype with high intrinsic CYP450 Activity/metabolism and significantly outperform standard HepG2/C3A cells for pharmaceutical and therapeutic applications. Basic & Clinical Pharmacology & Toxicology. 120, (1), 30-37 (2017).
  24. Gerets, H. H. J., Tilmant, K., Gerin, B., Chanteux, H., Depelchin, B. O., Dhalluin, S., Atienzar, F. A. Characterization of primary human hepatocytes, HepG2 cells, and HepaRG cells at the mRNA level and CYP activity in response to inducers and their predictivity for the detection of human hepatotoxins. Cell Biology and Toxicology. 28, (2), 69-87 (2012).
  25. Pusl, T., et al. Free fatty acids sensitize hepatocytes to bile acid-induced apoptosis. Biochemical and Biophysical Research Communications. 371, (3), 441-445 (2008).
  26. Gentile, C. L., Pagliassotti, M. J. The role of fatty acids in the development and progression of nonalcoholic fatty liver disease. The Journal of Nutritional Biochemistry. 19, (9), 567-576 (2008).
  27. Mei, S., et al. Differential roles of unsaturated and saturated fatty acids on autophagy and apoptosis in hepatocytes. Journal of Pharmacological Experimental Therapy. 339, 487-498 (2011).
  28. Malhi, H., Bronk, S. F., Werneburg, N. W., Gores, G. J. Free fatty acids induce JNK-dependent hepatocyte lipoapoptosis. Journal of Biological Chemistry. 281, 12093-12101 (2006).
  29. Moravcová, A., Červinková, Z., Kučera, O., Mezera, V., Rychtrmoc, D., Lotková, H. The effect of oleic and palmitic acid on induction of steatosis and cytotoxicity on rat hepatocytes in primary culture. Physiological Research. 64, Suppl 5 627-636 (2015).
  30. Ohsaki, Y., Shinohara, Y., Suzuki, M., Fujimoto, T. A pitfall in using BODIPY dyes to label lipid droplets for fluorescence microscopy. Histochemistry and Cell Biology. 133, (4), 477-480 (2010).
  31. Rinia, H. A., Burger, K. N., Bonn, M., Müller, M. Quantitative label-free imaging of lipid composition and packing of individual cellular lipid droplets using multiplex CARS microscopy. Biophysical Journal. 95, (10), 4908-4914 (2008).
  32. Waschatko, G., Billecke, N., Schwendy, S., Jaurich, H., Bonn, M., Vilgis, T. A., Parekh, S. H. Label-free in situ imaging of oil body dynamics and chemistry in germination. Journal of The Royal Society Interface. 13, (123), (2016).
  33. Jüngst, C., Winterhalder, M. J., Zumbusch, A. Fast and long term lipid droplet tracking with CARS microscopy. Journal of Biophotonics. 4, (6), 435-441 (2011).
  34. Welte, M. A., Gould, A. P. Lipid droplet functions beyond energy storage. Biochimica et Biophysica Acta - Molecular and Cell Biology of Lipids. 1862, (10), Pt B 1260-1272 (2017).
  35. Cohen, S. Lipid droplets as organelles. International Review of Cell and Molecular Biology. 337, 83-110 (2018).
  36. Farese, R. V., Walther, T. C. Lipid droplets finally get a little R-E-S-P-E-C-T. Cell. 139, (5), 855-860 (2009).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics