In this study, we describe a detailed protocol for inducing liver vesicular steatosis in differentiated HepaRG cells with the fatty acid salt sodium oleate and employ methods for detection and quantification of lipid accumulation, including coherent anti-Stokes Raman scattering (CARS) microscopy, cytofluorimetric analysis, Oil red O staining, and qPCR.
Hepatic steatosis represents a metabolic dysfunction that results from an accumulation of triglyceride-containing lipid droplets in hepatocytes. Excessive fat accumulation leads to non-alcoholic fatty liver disease (NAFLD), which is potentially reversible and may evolve into non-alcoholic steatohepatitis (NASH) and eventually cirrhosis and hepatocellular carcinoma (HCC). The molecular mechanisms linking lipid accumulation in hepatocytes with the progression to NASH, irreversible liver damage, fibrosis, cirrhosis, and even HCC still remains unclear. To this end, several in vitro and in vivo models have been developed to elucidate the pathological processes that cause NAFLD. In the present study, we describe a cellular model for the induction of liver vesicular steatosis that consists of DMSO-differentiated human hepatic HepaRG cells treated with the fatty acid salt sodium oleate. Indeed, sodium oleate-treated HepaRG cells accumulate lipid droplets in the cytoplasm and show typical features of steatosis. This in vitro human model represents a valuable alternative to in vivo mice models as well as to the primary human hepatocytes. We also present a comparison of several methods for the quantification and evaluation of fat accumulation in HepaRG cells, including Oil Red O staining, cytofluorimetric Bodipy measurement, metabolic gene expression analysis by qPCR, and coherent anti-Stokes Raman scattering (CARS) microscopy. CARS imaging combines the chemical specificity of Raman spectroscopy, a chemical analysis technique well-known in materials science applications, with the benefits of high-speed, high-resolution non-linear optical microscopies to allow precise quantification of lipid accumulation and lipid droplet dynamics. The establishment of an efficient in vitro model for the induction of vesicular steatosis, alongside an accurate method for the quantification and characterization of lipid accumulation, could lead to the development of early stage diagnosis of NAFLD via the identification of molecular markers, and to the generation of new treatment strategies.
Hepatic steatosis is defined as intrahepatic fat accumulation, within triglyceride-containing lipid droplets, of at least 5% of liver weight. Prolonged hepatic lipid storage is a potentially reversible process, however, it can lead to liver metabolic dysfunction, inflammation and advanced forms of nonalcoholic fatty liver disease (NAFLD), the predominant cause of chronic liver disease in many parts of the world1,2. NAFLD is a multifactorial disease that may evolve to the more aggressive non-alcoholic steatohepatitis (NASH), which in turn can progress to cirrhosis and, in a small percentage of patients, to hepatocellular carcinoma (HCC)1,3. No approved therapy is currently available as a specific treatment for NAFLD and the combination of diet and lifestyle modifications remains the pillar of NAFLD and NASH management4,5,6.
The molecular mechanisms leading to the development of hepatic steatosis in the pathogenesis of NAFLD still remain to be elucidated7. In this context, mouse models have been developed to study human steatosis disease progression. A myriad of different models exists, and each one has its advantages and disadvantages, including genetic, nutritional and chemically induced models combining different approaches. Genetically modified (transgenic or knockout) mice spontaneously develop liver disease. However, it should be noted that these mutations are very rare in humans and deletion or over-expression of a single gene (e.g., ob/ob mouse) may not mimic the etiology of the multifactorial human disease at the molecular level8,9. Likewise, the disease acquired by mice after dietary or pharmacological manipulation may not mimic the effects of human diets associated with development of NAFLD in man8. Animal models have, however, facilitated developments in the understanding of NAFLD and this approach is currently the most frequently used strategy in laboratory research. Nevertheless, the replication in humans of results obtained in animal models has repeatedly failed, causing poor translation into the clinic10.
Therefore, in vitro models of NAFLD may play a fundamental role in elucidating the molecular mechanisms of NAFLD progression, and they represent a valuable tool to screen a large number of compounds. Primary cell cultures, immortalized cell lines and liver biopsies have been extensively used for research purposes11. Primary human hepatocytes closely resemble human clinical conditions, but there is a limited number of donors, and primary cell cultures show poor reproducibility due to the variability of the cells. These observations, together with ethical and logistic issues, have resulted in the use of human primary hepatocytes being limited12. Thus, hepatic cell lines represent a convenient alternative, having several essential advantages over primary culture, as hepatic cell lines grow steadily, have an almost unlimited life-span, and have a stable phenotype. Moreover, cell lines are easily accessible and the culture conditions of hepatic cell lines are simpler than those of primary hepatocytes and are standardized among different laboratories.
Here, we describe in detail an in vitro cell-based model of liver vesicular steatosis, represented by hepatic differentiated HepaRG cells treated with the fatty acid sodium oleate. The HepaRG cell line was established from a female patient affected by hepatitis C infection and an Edmondson grade I well-differentiated liver tumor14. The HepaRG cell line is a human bipotent progenitor cell line capable of differentiating upon exposure to 2% dimethyl sulfoxide (DMSO) toward two different cell phenotypes: biliary-like and hepatocyte-like cells. Differentiated HepaRG cells (dHepaRG) share some features and properties with adult hepatocytes and possess the ability to stably express liver-specific genes such as Albumin, AldolaseB, Cytochrome P450 2E1 (CYP2E1), and Cytochrome P450 3A4 (CYP3A4)13 (step 3). Treatment of dHepaRG cells with the fatty acid salt sodium oleate (250 μM) for 5 days lead to the generation of cytoplasmic lipid droplets, mimicking the effects of fatty liver14,15,17,18 (step 4). Accumulation of lipid droplets can be easily detected by Oil Red O staining (step 5), a lysochrome fat-soluble dye that stains neutral triglycerides and lipids red-orange. To efficiently quantify lipids in fatty dHepaRG, here we illustrate cytofluorimetric analysis after staining with 4,4-difluoro-1,3,5,7-tetramethyl-4-bora-3a,4a-diaza-s-indacene (Bodipy 505/515) (step 6), a lipophilic fluorescent probe that localizes to intracellular lipid bodies and has been used to label lipid droplets19. Moreover, here we show how to evaluate steatosis by quantitative polymerase chain reaction (qPCR) (step 7) gene expression deregulation of several metabolic genes in dHepaRG cells. To further characterize and quantify the accumulation of lipid droplets after sodium oleate treatment, we performed coherent anti-Stokes Raman scattering (CARS) microscopy (step 8), an innovative technique that enables the visualization and quantification of lipid droplets without labeling20,21.
1. Preparation of Culture Media and Reagents
2. Thawing, Amplification, and Cryopreservation of HepaRG Cells
3. Differentiation of HepaRG Cells (Day 0–21) (Figure 1A)
4. Induction of Vesicular Steatosis (Day 21–26)
5. Evaluation ofLipid Overloading and Steatosis Induction: Oil Red O Staining
6. Evaluation of Lipid Overloading and Steatosis Induction: Bodipy Staining and Cytofluorimetric Analysis
7. Evaluation of Lipid Overloading and Steatosis Induction: qPCR
8. Evaluation of Lipid Overloading and Steatosis Induction: CARS
9. MTT Cell Viability Assay
This protocol describes an efficient method to induce and characterize vesicular steatosis in DMSO-differentiated HepaRG cells by sodium oleate treatment (Figure 1A).
Differentiation of HepaRG cells.
To efficiently induce differentiation, proliferating cells must be seeded at a low density (2.5 x 104 cells/cm2) in the proliferation medium. When seeded at low density, the cells actively divide and acquire an elongated undifferentiated morphology (Figure 1B). The cells should be left to grow in the proliferation medium for 7 days, until 100% confluency is reached (Figure 1C). After exposure to 2% DMSO, cells start to differentiate and to form typical hepatocyte-like colonies surrounded by biliary epithelial-like cells (Figure 1D). Differentiated HepaRG cells express hepato-specific markers, such as Albumin, Cyp3A4 and Aldolase B. To verify proper differentiation, the expression levels of these hepatic marker genes in the differentiated cells (Day 21) and in the proliferating cells (Day 0) were analyzed by qPCR (Figure 1E). Albumin, Cyp3A4 and Aldolase B genes should be upregulated in the differentiated HepaRG cells as compared to the proliferating HepaRG cells, and we observed this trend, confirming the effectiveness of our differentiation protocol.
Induction of vesicular steatosis in HepaRG cells by sodium oleate treatment.
Sodium oleate treatment of dHepaRG cells induces fat accumulation, visible under an optical microscope as lipid droplets in the cytoplasms (Figure 2A). To verify efficient induction of steatosis, oleate-treated and control HepaRG cells were stained with Oil Red O dye. After staining, lipid droplets are easily visible as red droplets (Figure 2B) and can be quantified by spectrophotometric measurement of Oil Red O dye eluted with isopropanol (Figure 2C). Absorbance of eluted Oil Red O from the cells is directly proportional to cytoplasmic lipid droplet accumulation.
Sodium oleate concentration and exposure time were determined by MTT colorimetric cell viability assay (step 9). Sodium oleate treatment was compared to sodium palmitate treatment and the apoptotic drug doxorubucin (2 µM) was used as a control (Figure 2D). Cytoxicity of the compounds was evaluated by MTT, taking advantage of a commercial compound (Table of Materials), that contains the MTT tetrazolium. The water-soluble yellow MTT tetrazolium compound is bioreduced by metabolically active cells into a purple water-insoluble formazan product. The formazan product is quantified by its absorbance at 490 nm and the amount is directly proportional to the number of living cells in culture (Figure 2D).
Quantification of vesicular steatosis in sodium oleate-treated HepaRG cells
To quantify the increase of cellular lipid content after sodium oleate treatment, we performed staining with Bodipy dye, a probe that labels lipid droplets. Using cytofluorimetric analysis, it is possible to quantify the triglyceride content by Bodipy mean fluorescent intensity, which is higher in oleate-treated cells as compared to control cells (Figure 3A,B), indicating efficient fat accumulation after oleate treatment. Indeed, images of Bodipy-stained cells show bright green fluorescent lipid droplets in oleate-treated cells that are not visible in the control cells (Figure 3C).
Sodium oleate treatment of dHepaRG cells deregulates lipid metabolism and inflammatory gene expression. To evaluate efficient induction of vesicular steatosis, we analyzed by qPCR the expression levels of selected genes in sodium oleate-treated cells as compared to those of control cells (Figure 4). Acetyl-CoA carboxylase beta (ACACB), glycerol-3-phosphate acyltransferase mitochondrial (GPAM), perilipins (PLIN2, PLIN4), apolipoprotein B (APOB), pyruvate dehydrogenase kinase isozyme 4 (PDK4), carnitine palmitoyltransferase 1A (CPT1A) and interleukin 6 (IL6) were upregulated in oleate-treated dHepaRG cells, whereas solute carrier family 2 member 1 (SLC2A1), apolipoprotein C-III (APOC3), and stearoyl-CoA desaturase (SCD) were downregulated (Figure 4). To further characterize and quantify lipid storage in droplets upon addition of sodium oleate to differentiated HepaRG cells, we utilized an innovative microscopy technique, coherent anti-Stokes Raman scattering (CARS) microscopy, which enables visualization and quantification of lipid droplets without labeling (Figure 5A). Lipid droplets were statistically quantified in terms of numbers, distribution and morphology at the single-cell level using CARS images. Treatment with sodium oleate (250 μM) induced a significant increase in the number of lipid droplets (Figure 5B), which led to a higher total droplet area per cell (Figure 5C) and a higher percentage droplet area per cell (Figure 5D), as compared to control cells, indicating that dHepaRG cells efficiently accumulated fat after sodium oleate treatment.
Figure 1: Differentiation of HepaRG cells. (A) Representative diagram showing HepaRG cell differentiation/treatment protocol as described in steps 3 and 4. (B–D) Images showing unstained proliferating HepaRG cells at Day 0 after seeding (B), at confluence Day 7 after seeding (C), and differentiated HepaRG (dHepaRG) at Day 21 after seeding (D). (E) Total RNA was extracted from proliferating and dHepaRG cells, cDNA was synthesized and analyzed by qPCR using primers specific for the indicated genes (Table of Materials). Samples were normalized to the mean of GAPDH, actinB and ribosomal 18S housekeeping genes. Histograms show fold induction of proliferating (Day 0) versus differentiated cells (Day 21) (bars indicate S.D.; p-values were computed by Student’s t-tests). Please click here to view a larger version of this figure.
Figure 2: Sodium oleate treatment of dHepaRG cells induced lipid droplet accumulation. (A) Images of unstained differentiated HepaRG (dHepaRG) cells treated for 5 days with vehicle (control) (left image) or with 250 μM sodium oleate (right image). (B) After treatment, the cells were stained with Oil Red O dye; lipid droplets are visible in red. (C) Oil Red O dye was eluted and OD was measured at 570 nm. Results are expressed as means of three independent experiments (bars indicate S.D.; p-value by Student’s t-test). (D) Cell viability evaluation of dHepaRG cells vehicle (99% methanol) treated (Ctrl) or treated for 5 days with sodium oleate and sodium palmitate (100 μM, 250 μM, or 500 μM), or treated 18 h with doxorubucin (2 μM). Assessment of cytotoxicity was performed using an MTT assay kit (Table of Materials), recording absorbance at 490 nm, according to the manufacturer's instruction. Results are expressed as means of three independent experiments (bars indicate S.D.; p-values were determined using Student's t-test: *0.01 ≤ p < 0.05; **0.001 ≤ p < 0.01; ***p < 0.001). Please click here to view a larger version of this figure.
Figure 3: Quantification of fat accumulation after sodium oleate treatment by Bodipy staining. Differentiated HepaRG (dHepaRG) cells were treated with vehicle (control) or with 250-μM sodium oleate for 5 days. After treatment, dHepaRG cells were stained with Bodipy dye and analyzed by flow cytometry. (A) Representative overlay profiles (% of max: percentage of maximum staining intensity). (B) Histograms show mean fluorescence intensity (MFI) as a percentage of treated cells over control from three independent experiments (bars indicate S.D.; p-values were determined using Student's t-test: *0.01 ≤ p < 0.05; **0.001 ≤ p < 0.01; ***p < 0.001). (C) Cells were fixed with 4% paraformaldehyde. Images show Bodipy-stained lipid droplets in green. Please click here to view a larger version of this figure.
Figure 4: Sodium oleate treatment of dHepaRG cells induces deregulation of lipid metabolism and inflammatory gene expression. Differentiated HepaRG (dHepaRG) cells were treated with vehicle (control) or with 250-μM sodium oleate for 5 days. cDNAs were analyzed by qPCR with primers specific for the indicated genes and results were normalized to the mean of GAPDH, actinB and ribosomal 18S housekeeping genes; the primers are given in the Table of Materials. The histogram shows expression levels of indicated genes as fold inductions of treated cells over control (bars indicate S.D.; p-values were computed by Student's t-test). Please click here to view a larger version of this figure.
Figure 5: Characterization of lipid droplet accumulation after sodium oleate treatment by CARS microscopy. Differentiated HepaRG (dHepaRG) cells were treated with vehicle (control) or with 250 μM sodium oleate for 5 days and were analyzed by CARS microscopy. (A) Representative images showing lipid droplet CARS contrast in red. (B) Histogram showing the numbers of lipid droplets per cell. (C) Histograms showing total image area covered by droplets per cell. (D) Histogram showing % droplet area covered by droplets per cell. All results are expressed as means of three independent experiments (bars indicate S.E.; p-values were determined by Student's t-test: *0.01 ≤ p < 0.05; **0.001 ≤ p < 0.01; ***p < 0.001). Please click here to view a larger version of this figure.
Reagents | Volume (μL) for a single reaction |
2x SYBR Green fluorescent dye | 10 |
PCR grade H2O | 6 |
Forward primer (μM) | 1 |
Reverse primer (μM) | 1 |
Table 1: qPCR master mix.
This protocol describes how to differentiate HepaRG cells and how to induce vesicular steatosis by sodium oleate treatment (Figure 1A). Indeed, compared to other human hepatocellular carcinoma (HCC) cell lines, the HepaRG cell line exhibits features of adult human hepatocytes, representing a valuable alternative to ex vivo cultivated primary human hepatocytes13,14,15. The HepaRG cell line has been widely used for liver cytotoxicity studies, drug metabolism, and virology studies15,16,22.
In comparison with HepaRG cells, other HCC cell lines such as HepG2, HUH7, HUH6 and Hep3B display lower metabolic capacities, lacking a substantial set of liver-specific functions23,24, and exhibiting a higher basal level of cytosolic fat accumulation stored in lipid droplets. Thus, these HCC cell lines are less useful as models for the induction of vesicular steatosis after lipid overloading than the HepaRG cell line.
Critical steps within the protocol
When seeded at low density (2.5 x 104 cells/cm2), HepaRG cells acquire an elongated undifferentiated morphology, actively dividing; after having reached 100% confluency, they are capable of differentiating upon exposure to 2% DMSO and they form typical hepatocyte-like colonies surrounded by biliary epithelial-like cells (Figure 1D). This mixed biliary/hepatocyte cell culture recapitulates features of liver tissue, resembling a physiological condition, despite lacking other liver cell types (sinusoidal or Kupffer).
A critical step in the differentiation process is the confluency of cells. The cells must be seeded at low density (2.5 x 104 cells/cm2) (Figure 1B) and allowed to actively grow in the proliferation medium for at least 1 week (Day 0-7). At Day 7, before adding 2% DMSO to start the differentiation process, the cells must be at 100% confluence (Figure 1C). If at Day 7 (step 2.2) complete confluency has not been reached, it is highly recommended that the cells are allowed to continue growing in the proliferation medium for some additional days, until 100% confluence is achieved.
Limitations of the protocol
It has been observed that after adding differentiation medium, some cells suffer, and typically 10% of cells die during the subsequent 2-3 days. At this stage, daily washing and medium changing (step 2.4) must be continued to discard floating dead cells. The usage of a specific FBS (Table of Materials) to supplement both the differentiation and proliferation media, should increase differentiation efficiency and lower cell death during Days 7-21 (step 2.4). It is highly recommended to maintain cells up to passage 20, and to choose lower passages (<20) for differentiating cells: less cells death occurs for the youngest HepaRG cells. Moreover, HepaRG differentiation seems to be more efficacious in 35 mm and 60 mm dishes, whereas cells tend to suffer more when seeded in the 100 mm and 150 mm dishes.
Modifications and troubleshooting
Exposure to different ratios of both palmitic and oleic fatty acids has been shown to result in the formation of intracytoplasmatic lipid droplets25,26. However, we observed that sodium oleate treatment of differentiated HepaRG cells exhibited better results than palmitic acid exposure, in terms of efficient induction of lipid accumulation and cell viability (Figure 2D). Indeed, palmitic acid treatment proved to be toxic for differentiated HepaRG cells (Figure 2D), in agreement with literature data on hepatoma cell lines and on human and rat hepatocyte primary cultures that describe palmitic acid as a considerably cytotoxic agent25,26,27,28,29. Moreover, the utilization of palmitate in cell-based assays is challenging due to its low solubility. Nevertheless, due to the intrinsic variability of cell lines, it is recommended to verify the sodium oleate working concentration and treatment time length, testing different concentrations in a time-course experiment with a cell viability assay.
Significance and comparison of lipid detection techniques
Accurate determination of lipid amounts in cells was established via a number of different approaches in this study. Qualitative and also approximately quantitative agreement was observed between the results obtained via Oil Red O staining, Bodipy staining, and CARS imaging. For a rapid estimation of lipid quantities in cell populations, the use of Bodipy-flow cytometry or a stain such as Oil Red O is ideal. For a more detailed examination of the lipid droplet content of cells, an imaging modality is preferred. Furthermore, specificity problems have been reported for lipid stains such as Oil Red O20,30, and we have observed that in some cases, the Bodipy stain has a lower capacity than CARS to exclusively label lipid droplets among other cell organelles (data not shown). Therefore, the use of a label-free microscopic imaging technique such as CARS provides significant advantages for steatosis quantification and characterization. The avoidance of the use of a large fluorescent label makes CARS imaging favorable due to the small size of lipid molecules compared to typical fluorophores; hence, for the detection of lipids, label-free methods are desirable, even more so than for observing large protein molecules. The lipid CARS signal is an optical emission that is generated only when a nonlinear interaction occurs in the sample. This interaction can only be detected when the difference between the frequencies of the two excitation lasers focused onto the sample matches the methylene (CH2) stretching vibrational frequency. The abundance of methylene groups in lipids results in a very intense signals with high signal-to-noise ratios, and the nonlinearity of the optical interaction also means that high spatial resolution is possible in CARS microscopy. The excellent quality of CARS images in general allows the collection of statistics on the sizes and numbers of lipid droplets, as demonstrated in this study. In addition, other studies have demonstrated the use of CARS microscopy to correlate different subcellular localizations and sizes of lipid droplets with different treatments18, and by using supplementary CARS measurements at different wavelengths, or a broadband CARS or similar stimulated Raman approach, researchers have shown that it is possible to characterize different types of fatty acids within lipid droplets31,32. Furthermore, the rapidity of CARS image collection has enabled in-situ imaging of live cells to examine the temporal evolution of lipid droplet growth and aggregation33.
Future applications
In recent decades, views on the roles and functions of lipid droplets in cell biology have evolved. Previously thought to be basically inert storage vesicles, they are now understood to be highly dynamic cellular organelles, and their role in disease is increasingly being recognized34,35,36. Although in the case of liver disease, lipid accumulation (steatosis) has long been known to be a critical aspect, the precise mechanism of the involvement of lipid droplets in disease progression is not completely clear. Therefore, methods such as CARS that can characterize the dynamic behavior of lipid droplets are of critical importance to the development of a molecular understanding of diseases including NAFLD. Metabolic gene expression analysis by qPCR is highly complementary to molecular imaging of lipids via CARS, as demonstrated in previous studies17,18, allowing deeper insights into disease mechanisms. In the present study, we observe fatty acid accumulation with deregulation of lipid metabolism and inflammatory gene expression, which may contribute to the construction of a panel of bio-markers for early disease diagnosis.
The sodium oleate-treated dHepaRG cell-based model may increase knowledge of the molecular mechanisms involved not only in the onset but also in the progression of NAFLD, providing a basis for the development of better therapeutic approaches to the disease.
The authors have nothing to disclose.
We thank prof. Christian Trepo (INSERM U871, Lyon, France), who kindly provided HepaRG cells. We are grateful to Rita Appodia for administrative help. This work was supported by MIUR- Ministero dell’istruzione, dell'università e della ricerca (FIRB 2011–2016 RBAP10XKNC) and Sapienza University of Rome (prot. C26A13T8PS; prot. C26A142MCH; prot. C26A15LSXL).
Hyclone HyClone Fetal Clone II | GE Healthcare | SH30066 | |
William’s E medium with GlutaMAX | Thermofisher | 32551087 | |
Penicillin/streptomycin | SIGMA | P4333 | |
Insulin | SIGMA | I9278 | |
hydrocortisone hemisuccinate | SIGMA | H2270 | |
DMSO, dimethyl sulfoxide | SIGMA | D2438 | |
Sodium Oleate | SIGMA | O7501 | |
Methanol | SIGMA | 179337 | |
Isopropanol | SIGMA | 278475 | |
BODIPY 505/515 | Thermofisher | D3921 | |
PBS | Thermofisher | 14190-250 | |
Formaldehyde solution | SIGMA | 252549 | |
RNAse free DNAseI | Promega | M198A | |
Glass-bottomed dishes | Willco Wells | GWST-5040 | |
Oil Red solution | SIGMA | O625 | |
CellTiter 96 AQueous One Solution | Promega | G3582 | |
q-PCR oligo name | Sequence | ||
ACACB FOR | CAAGCCGATCACCAAGAGTAAA | ||
ACACB REV | CCCTGAGTTATCAGAGGCTGG | ||
b-actin FOR | GCACTCTTCCAGCCTTCCT | ||
b-actin REV | AGGTCTTTGCGGATGTCCAC | ||
ALBUMIN FOR | TGCTTGAATGTGCTGATGACAGG | ||
ALBUMIN REV | AAGGCAAGTCAGCAGGCATCTCATC | ||
ALDOB FOR | GCATCTGTCAGCAGAATGGA | ||
ALDOB REV | TAGACAGCAGCCAGGACCTT | ||
APOB FOR | CCTCCGTTTTGGTGGTAGAG | ||
APOB REV | CCTAAAAGCTGGGAAGCTGA | ||
APOC3 FOR | CTCAGCTTCATGCAGGGTTA | ||
APOC3 REV | GGTGCTCCAGTAGTCTTTCAG | ||
CPT1A FOR | TCATCAAGAAATGTCGCACG | ||
CPT1A REV | GCCTCGTATGTGAGGCAAAA | ||
CYP2E1 FOR | TTGAAGCCTCTCGTTGACCC | ||
CYP2E1 REV | CGTGGTGGGATACAGCCAA | ||
CYP3A4 FOR | CTTCATCCAATGGACTGCATAAAT | ||
CYP3A4 REV | TCCCAAGTATAACACTCTACACAGACAA | ||
GAPDH FOR | TGACAACTTTGGTATCGTGGAAGG | ||
GAPDH REV | AGGGATGATGTTCTGGAGAGCC | ||
GPAM FOR | TCTTTGGGTTTGCGGAATGTT | ||
GPAM REV | ATGCACATCTCGCTCTTGAATAA | ||
IL6 FOR | CCTGAACCTTCCAAAGATGGC | ||
IL6 REV | ACCTCAAACTCCAAAAGACCAGTG | ||
PDK4 FOR | ACAGACAGGAAACCCAAGCCAC | ||
PDK4 REV | TGGAGGTGAGAAGGAACATACACG | ||
PLIN2 FOR | TTGCAGTTGCCAATACCTATGC | ||
PLIN2 REV | CCAGTCACAGTAGTCGTCACA | ||
PLIN4 FOR | AATGAGTTGGAGGGGCTGGGGGACATC | ||
PLIN4 REV | GGTCACCTAAACGAACGAAGTAGC | ||
SCD FOR | TCTAGCTCCTATACCACCACCA | ||
SCD REV | TCGTCTCCAACTTATCTCCTCC | ||
SLC2A1 FOR | TGCTCATCAACCGCAACGAG | ||
SLC2A1 REV | CCGACTCTCTTCCTTCATCTCCTG | ||
18S FOR | CGCCGCTAGAGGTGAAATTC | ||
18S REV | TTGGCAAATGCTTTCGCTC |