Method Article

Inducing and Characterizing Vesicular Steatosis in Differentiated HepaRG Cells

DOI:

10.3791/59843

July 18th, 2019

In This Article

Summary

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

In this study, we describe a detailed protocol for inducing liver vesicular steatosis in differentiated HepaRG cells with the fatty acid salt sodium oleate and employ methods for detection and quantification of lipid accumulation, including coherent anti-Stokes Raman scattering (CARS) microscopy, cytofluorimetric analysis, Oil red O staining, and qPCR. 

Abstract

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Hepatic steatosis represents a metabolic dysfunction that results from an accumulation of triglyceride-containing lipid droplets in hepatocytes. Excessive fat accumulation leads to non-alcoholic fatty liver disease (NAFLD),  which is potentially reversible and may evolve into non-alcoholic steatohepatitis (NASH) and eventually cirrhosis and hepatocellular carcinoma (HCC). The molecular mechanisms linking lipid accumulation in hepatocytes with the progression to NASH, irreversible liver damage, fibrosis, cirrhosis, and even HCC still remains unclear. To this end, several in vitro and in vivo models have been developed to elucidate the pathological processes that cause NAFLD. In the present study, we describe a cellular model for the induction of liver vesicular steatosis that consists of DMSO-differentiated human hepatic HepaRG cells treated with the fatty acid salt sodium oleate. Indeed, sodium oleate-treated HepaRG cells accumulate lipid droplets in the cytoplasm and show typical features of steatosis. This in vitro human model represents a valuable alternative to in vivo mice models as well as to the primary human hepatocytes. We also present a comparison of several methods for the quantification and evaluation of fat accumulation in HepaRG cells, including Oil Red O staining, cytofluorimetric Bodipy measurement, metabolic gene expression analysis by qPCR, and coherent anti-Stokes Raman scattering (CARS) microscopy. CARS imaging combines the chemical specificity of Raman spectroscopy, a chemical analysis technique well-known in materials science applications, with the benefits of high-speed, high-resolution non-linear optical microscopies to allow precise quantification of lipid accumulation and lipid droplet dynamics. The establishment of an efficient in vitro model for the induction of vesicular steatosis, alongside an accurate method for the quantification and characterization of lipid accumulation, could lead to the development of early stage diagnosis of NAFLD via the identification of molecular markers, and to the generation of new treatment strategies.

Introduction

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Hepatic steatosis is defined as intrahepatic fat accumulation, within triglyceride-containing lipid droplets, of at least 5% of liver weight. Prolonged hepatic lipid storage is a potentially reversible process, however, it can lead to liver metabolic dysfunction, inflammation and advanced forms of nonalcoholic fatty liver disease (NAFLD), the predominant cause of chronic liver disease in many parts of the world1,2. NAFLD is a multifactorial disease that may evolve to the more aggressive non-alcoholic steatohepatitis (NASH), which in turn can progress to cirrhosis and, in a small percentage of patients, to hepatocellular carcinoma (HCC)1,3. No approved therapy is currently available as a specific treatment for NAFLD and the combination of diet and lifestyle modifications remains the pillar of NAFLD and NASH management4,5,6.

The molecu­lar mechanisms leading to the development of hepatic steatosis in the pathogenesis of NAFLD still remain to be elucidated7. In this context, mouse models have been developed to study human steatosis disease progression. A myriad of different models exists, and each one has its advantages and disadvantages, including genetic, nutritional and chemically induced models combining different approaches. Genetically modified (transgenic or knockout) mice spontaneously develop liver disease. However, it should be noted that these mutations are very rare in humans and deletion or over-expression of a single gene (e.g., ob/ob mouse) may not mimic the etiology of the multifactorial human disease at the molecular level8,9. Likewise, the disease acquired by mice after dietary or pharmacological manipulation may not mimic the effects of human diets associated with development of NAFLD in man8. Animal models have, however, facilitated developments in the understanding of NAFLD and this approach is currently the most frequently used strategy in laboratory research. Nevertheless, the replication in humans of results obtained in animal models has repeatedly failed, causing poor translation into the clinic10.

Therefore, in vitro models of NAFLD may play a fundamental role in elucidating the molecular mechanisms of NAFLD progression, and they represent a valuable tool to screen a large number of compounds. Primary cell cultures, immortalized cell lines and liver biopsies have been extensively used for research purposes11. Primary human hepatocytes closely resemble human clinical conditions, but there is a limited number of donors, and primary cell cultures show poor reproducibility due to the variability of the cells. These observations, together with ethical and logistic issues, have resulted in the use of human primary hepatocytes being limited12. Thus, hepatic cell lines represent a convenient alternative, having several essential advantages over primary culture, as hepatic cell lines grow steadily, have an almost unlimited life-span, and have a stable phenotype. Moreover, cell lines are easily accessible and the culture conditions of hepatic cell lines are simpler than those of primary hepatocytes and are standardized among different laboratories.

Here, we describe in detail an in vitro cell-based model of liver vesicular steatosis, represented by hepatic differentiated HepaRG cells treated with the fatty acid sodium oleate. The HepaRG cell line was established from a female patient affected by hepatitis C infection and an Edmondson grade I well-differentiated liver tumor14. The HepaRG cell line is a human bipotent progenitor cell line capable of differentiating upon exposure to 2% dimethyl sulfoxide (DMSO) toward two different cell phenotypes: biliary-like and hepatocyte-like cells. Differentiated HepaRG cells (dHepaRG) share some features and properties with adult hepatocytes and possess the ability to stably express liver-specific genes such as Albumin, AldolaseB, Cytochrome P450 2E1 (CYP2E1), and Cytochrome P450 3A4 (CYP3A4)13 (step 3). Treatment of dHepaRG cells with the fatty acid salt sodium oleate (250 μM) for 5 days lead to the generation of cytoplasmic lipid droplets, mimicking the effects of fatty liver14,15,17,18 (step 4). Accumulation of lipid droplets can be easily detected by Oil Red O staining (step 5), a lysochrome fat-soluble dye that stains neutral triglycerides and lipids red-orange. To efficiently quantify lipids in fatty dHepaRG, here we illustrate cytofluorimetric analysis after staining with 4,4-difluoro-1,3,5,7-tetramethyl-4-bora-3a,4a-diaza-s-indacene (Bodipy 505/515) (step 6), a lipophilic fluorescent probe that localizes to intracellular lipid bodies and has been used to label lipid droplets19. Moreover, here we show how to evaluate steatosis by quantitative polymerase chain reaction (qPCR) (step 7) gene expression deregulation of several metabolic genes in dHepaRG cells. To further characterize and quantify the accumulation of lipid droplets after sodium oleate treatment, we performed coherent anti-Stokes Raman scattering (CARS) microscopy (step 8), an innovative technique that enables the visualization and quantification of lipid droplets without labeling20,21.

Access restricted. Please log in or start a trial to view this content.

Protocol

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

1. Preparation of Culture Media and Reagents

  1. Proliferating medium: supplement William's E medium with GlutaMAX, 10% fetal bovine serum (FBS), 1% penicillin/streptomycin, 5 μg/mL insulin and 0.5 μM hydrocortisone hemisuccinate.
  2. Differentiation medium: supplement William's E medium with GlutaMAX, 10% FBS, 1% penicillin/streptomycin, 5 μg/mL insulin, 50 μM hydrocortisone hemisuccinate and 2% DMSO.
  3. Freezing medium: supplement proliferating medium with 10% DMSO.
  4. Sodium oleate: dissolve in 99% methanol at a 100 mM concentration, stir O/N, and store at -20 °C.
  5. Oil Red O: prepare a stock solution. Weigh 0.35 g of Oil Red O and dissolve in 100 mL of isopropanol. Stir O/N, filter (0.2 µm), and store at RT. Prepare a working solution: mix 6 mL of Oil Red O Stock solution with 4 mL of ddH2O. Let sit at room temperature (RT) for 20 min, and then filter with a 0.2 µm filter. Proper filtration is highly recommended for successful staining to avoid background.
  6. Bodipy (505/515): dissolve Bodipy (505/515) dye in DMSO at a 100 µM stock concentration, store at -20 °C in dark, and use at a final 100 nM concentration.
  7. Acquire transparent glass-bottomed dishes for CARS experiments.

2. Thawing, Amplification, and Cryopreservation of HepaRG Cells

  1. Thaw nitrogen cryopreserved HepaRG cells by immersing a batch in a 37 °C bath until defrosted. Select a low passage batch (<20). HepaRG cells are commercially available.
  2. Rapidly transfer the cells into a 15 mL tube containing 10 mL of proliferating medium and centrifuge for 5 min (200 x g, 4 °C).
  3. Discard the supernatant and resuspend the cells with 5 mL of proliferating medium.
  4. Count the cells and dilute in order to plate 2.5 x 104 cells/cm2.
  5. Renew the medium every 2 or 3 days. Cells proliferate with a doubling time of around 24 h.
  6. Detach HepaRG cells when at 80% confluency by 3-5 min incubation with trypsin solution 0.05%. Collect the cells in proliferating medium and centrifuge for 5 min (200 x g, 4 °C).
  7. Discard the supernatant and resuspend the cells with 5 mL of proliferating medium.
  8. Count the cells and dilute in order to plate 2.5 x 104 cells/cm2.
  9. At this stage, amplify the cells by repeating steps 2.5-2.8 in order to reach an appropriate number of cells to start experiments, or cryopreserve as in step 2.10.
  10. To cryopreserve HepaRG cells, detach the cells 24 h after plating by 3-5 min incubation with trypsin solution 0.05%. Collect the cells in proliferating medium and centrifuge for 5 min (200 x g, 4 °C). Discard the supernatant, resuspend the cells in 1 mL/batch of freezing medium, 1.5 x 106 cells/batch and cryopreserve the batches in liquid nitrogen.

3. Differentiation of HepaRG Cells (Day 0–21) (Figure 1A)

  1. Day 0. Seed HepaRG cells at low density (2.5 x 104 cells/cm2) into culture treated dishes with appropriate volume of proliferation medium (Figure 1B). Two dishes need to be plated for each assay (Oil Red O staining, FACS analysis, qPCR): one for control cells and one for oleate-treated cells. If performing CARS measurements (step 8), seed the cells in parallel into transparent glass-bottomed dishes. As a control, harvest one untreated dish (proliferating cells Day 0) to perform gene expression analysis of differentiation marker genes (see step 3.6).
  2. Day 2 and Day 4. Change the medium with appropriate volume of proliferation medium and let the cells grow until confluence.
  3. Day 7. Cells must be 100% confluent (Figure 1C). Wash the cells once with 1x phosphate-buffered saline (PBS). Remove 1x PBS and add an appropriate volume of differentiation medium.
  4. Day 8, 9, 12, 15, 18.  Wash the cells once with 1x PBS. Remove 1x PBS and add an appropriate volume of differentiation medium.
  5. Day 21. Observe HepaRG cells under a microscope and ensure that the cells are confluent differentiated cultures (Figure 1D).
  6. As a control, harvest one control dish (differentiated cells Day 21) to perform gene expression analysis (step 7) of differentiation marker genes (Figure 1E).
  7. At Day 21, differentiated HepaRG cells can be cryopreserved in liquid-nitrogen.  

4. Induction of Vesicular Steatosis (Day 21–26)

  1. Day 21. Dilute sodium oleate (100 mM) with an appropriate volume of complete differentiation medium to a final concentration of 250 μM (1:400). Add 99% methanol 1:400 (same volume as that of sodium oleate) into another aliquot of differentiation medium to make the vehicle-control treatment. (For instance: add 25 μL of sodium oleate to 10 mL of medium and in parallel add 25 μL of 99% methanol to 10 mL of medium). Wash the cells once with 1x PBS and add vehicle or sodium oleate medium.
  2. Day 23 and Day 25. Change the medium with appropriate volume of freshly prepared medium as in step 4.1.
  3. Day 26. Observe by optical microscope that lipid droplets accumulate in the sodium oleate-treated cells and are easily visible as translucent droplets in the cytoplasm as in Figure 2A.

5. Evaluation ofLipid Overloading and Steatosis Induction: Oil Red O Staining

  1. Wash he cells once with 1x PBS and remove 1x PBS completely.
  2. Add 4% paraformaldehyde (diluted in 1x PBS) and incubate for 15 min at RT.
    CAUTION: Paraformaldehyde is toxic, so this step must be performed in a fume hood, with protective equipment, including gloves, a lab coat, and a mask.
  3. Remove paraformaldehyde and wash the cells twice with 1x PBS. Cells can be kept in 1x PBS at 4 °C for a couple of days before staining. Wrap with parafilm and cover with aluminum foil to prevent the cells from drying.
  4. Remove 1x PBS. Incubate the cells with 60% isopropanol for 5 min at RT.
  5. Remove isopropanol and let the cells dry completely at RT.
  6. Add Oil Red O working solution and incubate at RT for 30 min. The volume of working solution required for each sample corresponds to the volume of media used for culturing the cells.
  7. Remove Oil Red O solution and immediately add ddH2O. Wash the cells 4 times with ddH2O.
  8. Acquire images under the microscope for analysis (Figure 2B).
  9. To elute Oil Red O dye: remove all the water and allow to dry; add 1 mL of 100% isopropanol and incubate for 10 min with gentle shaking at RT.
  10. Pipet the isopropanol with eluted Oil Red O dye up and down several times, ensuring that all the Oil Red O is in the solution. Transfer the solution to a cuvette. Measure OD500 nm by spectrophotometry and use 100% isopropanol as blank (Figure 2C).

6. Evaluation of Lipid Overloading and Steatosis Induction: Bodipy Staining and Cytofluorimetric Analysis  

  1. Wash the cells once with 1x PBS. Incubate with 100 nM of Bodipy diluted in 1x PBS in the dark for 40 min at 37 °C. An unstained control should be included in the flow cytometry measurements. From this point, protect the samples from light as much as possible.
    NOTE: The volume of staining solution required for each sample corresponds to the volume of media used for culturing cells.
  2. Remove staining solution and wash the cells once with 1x PBS. Proceed to steps 6.3-6.6. for FACS (Fluorescence-activated cell sorting) analysis or to step 6.7 for microscope imaging.
  3. Gently scrape the cells with 1x PBS and transfer it into a 15 mL tube. Centrifuge for 10 min (200 x g, 4 °C).
  4. Gently remove the supernatants without disturbing the pellets and wash with 3 mL of 1x PBS. Centrifuge for 5 min (200 x g, 4 °C).
  5. Remove the supernatants and resuspend in 300 μL of 1x PBS, then transfer into a FACS tube.
  6. Immediately measure Bodipy fluorescence intensity by cytofluorimetric analysis with excitation/emission wavelengths of 505/515 nm (Figure 3A,B).
  7. Wash the cells once with 1x PBS and remove PBS completely.
  8. Add 4% paraformaldehyde (diluted in 1x PBS) and incubate for 15 min at RT.
    CAUTION: Paraformaldehyde is toxic, so this step must be performed in a fume hood, with protective equipment, including gloves, a lab coat, and a mask.
  9. Remove paraformaldehyde and wash the samples 3x for 5 min in PBS. Cells can be kept in 1x PBS at 4 °C or imaged immediately (Figure 3C). For storage, wrap with parafilm and cover with aluminum foil to prevent the cells from drying.

7. Evaluation of Lipid Overloading and Steatosis Induction: qPCR

  1. Wash the cells once with 1x PBS. Scrape the cells with 1x PBS, centrifuge at 200 x g, and discard the supernatant. At this step, cells can be harvested at -80 °C or processed as in step 7.2.
  2. Perform total RNA isolation by standard methods using commercial reagents following manufacturer's instructions.
  3. Assess RNA concentration by UV spectrophotometric measurement, ensuring that the RNA purity is high (close to 2.0) based on the A260/A280 reading.
  4. Synthesize cDNA from 1 μg of total RNA with a standard cDNA synthesis kit.
  5. Dilute cDNA to a final 50 μL volume with H2O.
  6. Analyze each cDNA sample in triplicate by qPCR: prepare one qPCR master mix (Table 1) that is sufficient for the needed reactions for each primer, including primers specific for the three housekeeping genes as controls: gliceraldeide-3-fosfato deidrogenasi (GAPDH), actinB and ribosomal 18S (see Table of Materials for primer sequences):
  7. Dispense 18 μL of master mix per well in a PCR multiwall plate.
  8. Add 2 μL of cDNA sample in each well. Seal the plate.
  9. Run the samples according to the Thermal Cycler instruction.

8. Evaluation of Lipid Overloading and Steatosis Induction: CARS

  1. Fix the cells previously prepared on glass-bottomed dishes, as described in steps 5.1-5.3.
  2. Switch on a commercial tunable picosecond pulsed laser system, tuning it to obtain two outputs of different wavelengths. The frequency difference between the outputs must be 2,840 cm-1 to generate the intense CARS light signal corresponding to methylene symmetric stretching; for a fixed-wavelength output at 1,064 nm ("Stokes" light), the other wavelength should be tuned to 817 nm ("pump" light).
  3. Ensure the 817 nm output is spatially and temporally overlapped with the 1,064 nm output: use an appropriate dichroic mirror (i.e., with a cut between 817 and 1,064 nm) to spatially combine the beams and use an optical delay line to obtain temporal overlap of the laser pulses.
  4. Ensure the two copropagating beams are both collimated and that their diameters have similar values that are appropriate for the optical system within the microscope that will focus them onto the sample; if necessary, separately collimate the beams before the dichroic mirror that combines them.
  5. Switch on a commercial inverted microscope system, which should include an infrared laser scanning unit and a dual-channel red/green epi detection unit and align the copropagating laser beams into the scanning unit.
  6. Opening the dual-channel epi detection unit, remove the filter cube and replace its red-wavelength detection filter with a bandpass filter that can select the 2,840 cm-1 CARS signal that is centered at 663 nm for the 817/1,064 nm pump/Stokes excitation scheme. A narrow-bandwidth (20 nm) filter is preferred to avoid the collection of high levels of fluorescent background signals.
  7. Place a dish on the stage of the inverted CARS microscope, and using a 100x oil-immersion objective, shift the vertical position of the objective to focus on the cells.
  8. Set up the microscope software to collect high-resolution (1024 x 1024 pixels) images over a field of view spanning 127 μm x 127 μm.
  9. Set the microscope software to continuously acquire and display images of the 127 μm x 127 μm field of view and check the displayed images whilst optimizing the image collection parameters. Ensure that the laser powers are balanced for rapid image collection and minimal damage, inserting appropriate neutral-density filters in the beam paths as necessary, and select a pixel dwell time that allows the collection of images with a good signal-to-noise ratio under the selected laser power conditions.
  10. Acquire and save images of several different fields of view within the dish under the optimized conditions. Optionally, multiphoton fluorescence images, generated by a green-wavelength emission (mostly from two-photon excitation at 817 nm), may be simultaneously collected via the other epi detector. Repeat steps 8.7-8.10 for each dish.
  11. For the CARS image analysis, process images using the FIJI implementation of ImageJ. Operate the Despeckle function (or a similar denoising tool) on each image before further analysis to improve signal-to-noise ratios without loss of detail.
  12. Use FIJI to select cells manually and then automatically count lipid droplets within segmented individual cells to produce statistics on lipid droplet areas and numbers for each cell and for the entire image dataset for each dish.

9. MTT Cell Viability Assay

  1. Plate differentiated HepaRG cells into a 96-well plate with a density of 1 x 105 cells/well in a final 100 μL volume of differentiation culture medium.
  2. 24 h after seeding, treat the cells with 99% methanol (vehicle) and with 100 μM, 250 μM and 500 μM sodium oleate and sodium palmitate diluted in 100 μL of differentiation culture medium/well in triplicate.
  3. Change the medium with 99% methanol and with 100 μM, 250 μM and 500 μM sodium oleate and sodium palmitate diluted in 100 μL of differentiation culture medium/well every 24 h.
  4. 96 h after methanol/sodium oleate/sodium palmitate treatment, treat the cells with 2 μM doxorubicin diluted in 100 μL of differentiation culture medium/well in triplicate as a control.
  5. 18 h after doxorubucin treatment, change the medium with 100 μL of differentiation culture medium.
  6. Pipet 20 μL of 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium reagent MTT (Table of Materials) into each well of the 96-well assay plate containing the cells in 100 μL of differentiation culture medium. Include a background control by pipetting 20 μL of reagent into a control well without cells in 100 μL of differentiation culture medium in triplicate. 
  7. Incubate the plate at 37 °C in a humidified, 5% CO2 atmosphere.
  8. After incubating for 30, 60, and 90 min with MTT tetrazolium reagent, record the absorbance at 490 nm using a 96-well plate reader. Subtract the background absorbance of the no-cell control wells from the absorbance values for the other samples.

Access restricted. Please log in or start a trial to view this content.

Results

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

This protocol describes an efficient method to induce and characterize vesicular steatosis in DMSO-differentiated HepaRG cells by sodium oleate treatment (Figure 1A).

Differentiation of HepaRG cells.
To efficiently induce differentiation, proliferating cells must be seeded at a low density (2.5 x 104 cells/cm2) in the proliferation medium. When seeded at low density, the cells actively divide and acquire ...

Access restricted. Please log in or start a trial to view this content.

Discussion

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

This protocol describes how to differentiate HepaRG cells and how to induce vesicular steatosis by sodium oleate treatment (Figure 1A). Indeed, compared to other human hepatocellular carcinoma (HCC) cell lines, the HepaRG cell line exhibits features of adult human hepatocytes, representing a valuable alternative to ex vivo cultivated primary human hepatocytes13,14,15. The HepaRG cel...

Access restricted. Please log in or start a trial to view this content.

Disclosures

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

The authors declare that they have no competing financial interests.

Acknowledgements

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

We thank prof. Christian Trepo (INSERM U871, Lyon, France), who kindly provided HepaRG cells. We are grateful to Rita Appodia for administrative help. This work was supported by MIUR- Ministero dell’istruzione, dell'università e della ricerca (FIRB 2011–2016 RBAP10XKNC) and Sapienza University of Rome (prot. C26A13T8PS; prot. C26A142MCH; prot. C26A15LSXL).

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
Hyclone HyClone Fetal Clone II GE HealthcareSH30066
William’s E medium with GlutaMAX Thermofisher32551087
Penicillin/streptomycin SIGMAP4333
Insulin SIGMAI9278
Hydrocortisone hemisuccinateSIGMAH2270
DMSO, dimethyl sulfoxideSIGMAD2438   
Sodium OleateSIGMAO7501 
MethanolSIGMA179337
IsopropanolSIGMA278475
BODIPY 505/515ThermofisherD3921
PBSThermofisher14190-250
Formaldehyde solutionSIGMA252549
RNAse free DNAseIPromegaM198A 
Glass-bottomed dishesWillco WellsGWST-5040
Oil Red solutionSIGMAO625
CellTiter 96 AQueous One SolutionPromega G3582
q-PCR oligo nameSequence
ACACB FORCAAGCCGATCACCAAGAGTAAA
ACACB REVCCCTGAGTTATCAGAGGCTGG
β-actin FORGCACTCTTCCAGCCTTCCT
β-actin REVAGGTCTTTGCGGATGTCCAC
ALBUMIN FORTGCTTGAATGTGCTGATGACAGG
ALBUMIN REVAAGGCAAGTCAGCAGGCATCTCATC
ALDOB FORGCATCTGTCAGCAGAATGGA 
ALDOB REVTAGACAGCAGCCAGGACCTT
APOB FORCCTCCGTTTTGGTGGTAGAG
APOB REV CCTAAAAGCTGGGAAGCTGA
APOC3 FORCTCAGCTTCATGCAGGGTTA
APOC3 REVGGTGCTCCAGTAGTCTTTCAG
CPT1A FORTCATCAAGAAATGTCGCACG
CPT1A REVGCCTCGTATGTGAGGCAAAA
CYP2E1 FORTTGAAGCCTCTCGTTGACCC
CYP2E1 REVCGTGGTGGGATACAGCCAA
CYP3A4 FORCTTCATCCAATGGACTGCATAAAT
CYP3A4 REVTCCCAAGTATAACACTCTACACAGACAA
GAPDH FORTGACAACTTTGGTATCGTGGAAGG
GAPDH REVAGGGATGATGTTCTGGAGAGCC
GPAM FORTCTTTGGGTTTGCGGAATGTT
GPAM REVATGCACATCTCGCTCTTGAATAA
IL6 FORCCTGAACCTTCCAAAGATGGC
IL6 REVACCTCAAACTCCAAAAGACCAGTG
PDK4 FORACAGACAGGAAACCCAAGCCAC
PDK4 REVTGGAGGTGAGAAGGAACATACACG
PLIN2 FORTTGCAGTTGCCAATACCTATGC
PLIN2 REVCCAGTCACAGTAGTCGTCACA
PLIN4 FORAATGAGTTGGAGGGGCTGGGGGACATC
PLIN4 REVGGTCACCTAAACGAACGAAGTAGC
SCD FORTCTAGCTCCTATACCACCACCA
SCD REVTCGTCTCCAACTTATCTCCTCC
SLC2A1 FORTGCTCATCAACCGCAACGAG
SLC2A1 REVCCGACTCTCTTCCTTCATCTCCTG
18S FORCGCCGCTAGAGGTGAAATTC
18S REVTTGGCAAATGCTTTCGCTC

References

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,
  1. Starley, B. Q., Calcagno, C. J., Harrison, S. A. Nonalcoholic fatty liver disease and hepatocellular carcinoma: a weighty connection. Hepatology. 51 (5), 1820-1832 (2010).
  2. Byrne, C. D., Targher, G. NAFLD: a multisystem disease. Journal of Hepatology. 62 (1), Suppl 47-64 (2015).
  3. Marra, F., Gastaldelli, A., Svegliati Baroni, G., Tell, G., Tiribelli, C. Molecular basis and mechanisms of progression of non- alcoholic steatohepatitis. Trends in Molecular Medicine. 14, 72-81 (2008).
  4. Chalasani, N., et al. The diagnosis and management of nonalcoholic fatty liver disease: Practice guidance from the American Association for the Study of Liver Diseases. Hepatology. 67 (1), 328-357 (2018).
  5. Banini, B. A., Sanyal, A. J. Current and future pharmacologic treatment of nonalcoholic steatohepatitis. Current Opinion in Gastroenterology. 33 (3), 134-141 (2017).
  6. Takahashi, Y., Sugimoto, K., Inui, H., Fukusato, T. Current pharmacological therapies for nonalcoholic fatty liver disease/nonalcoholic steatohepatitis. World Journal of Gastroenterology. 21 (13), 3777-3785 (2015).
  7. Younossi, Z., et al. Global burden of NAFLD and NASH: trends, predictions, risk factors and prevention. Nature Reviews Gastroenterology & Hepatology. 15 (1), 11-20 (2018).
  8. Santhekadur, P. K., Kumar, D. P., Sanyal, A. J. Preclinical models of non-alcoholic fatty liver disease. Journal of Hepatology. 68 (2), 230-237 (2018).
  9. Nagarajan, P., Mahesh Kumar, M. J., Venkatesan, R., Majundar, S. S., Juyal, R. C. Genetically modified mouse models for the study of nonalcoholic fatty liver disease. World Journal of. Gastroenterology. 18 (11), 1141-1153 (2012).
  10. Oseini, A. M., Cole, B. K., Issa, D., Feaver, R. E., Sanyal, A. J. Translating scientific discovery: the need for preclinical models of nonalcoholic steatohepatitis. Hepatology International. 12 (1), 6-16 (2018).
  11. Ramboer, E., Vanhaecke, T., Rogiers, V., Vinken, M. Immortalized human hepatic cell lines for in vitro testing and research purposes. Methods in Molecular Biology. 1250, 53-76 (2015).
  12. Gómez-Lechón, M. J., Donato, M. T., Castell, J. V., Jover, R. Human hepatocytes in primary culture: the choice to investigate drug metabolism in man. Current Drug Metabolism. 5 (5), 443-462 (2004).
  13. Marion, M. J., Hantz, O., Durantel, D. The HepaRG cell line: biological properties and relevance as a tool for cell biology, drug metabolism, and virology studies. Methods in Molecular Biology. 640, 261-272 (2010).
  14. Gripon, P., et al. Infection of a human hepatoma cell line by hepatitis B virus. Proceedings of the National Academy of Sciences. 99 (24), 15655-15660 (2002).
  15. Anthérieu, S., Rogue, A., Fromenty, B., Guillouzo, A., Robin, M. A. Induction of vesicular steatosis by amiodarone and tetracycline is associated with up-regulation of lipogenic genes in HepaRG cells. Hepatology. 53 (6), 1895-1905 (2011).
  16. Rouge, A., et al. PPAR agonists reduce steatosis in oleic acid-overloaded HepaRG cells. Toxicology and Applied Pharmacology. 276 (1), 73-81 (2014).
  17. Belloni, L., et al. Targeting a phospho-STAT3-miRNAs pathway improves vesicular hepatic steatosis in an in vitro and in vivo model. Scientific Reports. 8, 13638(2018).
  18. Nunn, A. D. G., et al. The histone deacetylase inhibiting drug Entinostat induces lipid accumulation in differentiated HepaRG cells. Scientific Reports. 6, 28025(2016).
  19. Donato, M. T., et al. Cytometric analysis for drug-induced steatosis in HepG2 cells. Chemico-Biological Interactions. 181 (3), 417-423 (2009).
  20. Hellerer, T., Axäng, C., Brackmann, C., Hillertz, P., Pilon, M., Enejder, A. Monitoring of lipid storage in Caenorhabditis elegans using coherent anti-Stokes Raman scattering (CARS) microscopy. Proceedings of the National Academy of Sciences. 104 (37), 14658-14663 (2007).
  21. Le, T. T., Ziemba, A., Urasaki, Y., Brotman, S., Pizzorno, G. Label-free evaluation of hepatic microvesicular steatosis with multimodal coherent anti-Stokes Raman scattering microscopy. PLoS One. 7 (11), 51092(2012).
  22. Guillouzo, A., Corlu, A., Aninat, C., Glaise, D., Morel, F., Guguen-Guillouzo, C. The human hepatoma HepaRG cells: a highly differentiated model for studies of liver metabolism and toxicity of xenobiotics. Chemico-Biological Interactions. 168 (1), 66-73 (2007).
  23. Nelson, L. J., et al. Human hepatic HepaRG cells maintain an organotypic phenotype with high intrinsic CYP450 Activity/metabolism and significantly outperform standard HepG2/C3A cells for pharmaceutical and therapeutic applications. Basic & Clinical Pharmacology & Toxicology. 120 (1), 30-37 (2017).
  24. Gerets, H. H. J., Tilmant, K., Gerin, B., Chanteux, H., Depelchin, B. O., Dhalluin, S., Atienzar, F. A. Characterization of primary human hepatocytes, HepG2 cells, and HepaRG cells at the mRNA level and CYP activity in response to inducers and their predictivity for the detection of human hepatotoxins. Cell Biology and Toxicology. 28 (2), 69-87 (2012).
  25. Pusl, T., et al. Free fatty acids sensitize hepatocytes to bile acid-induced apoptosis. Biochemical and Biophysical Research Communications. 371 (3), 441-445 (2008).
  26. Gentile, C. L., Pagliassotti, M. J. The role of fatty acids in the development and progression of nonalcoholic fatty liver disease. The Journal of Nutritional Biochemistry. 19 (9), 567-576 (2008).
  27. Mei, S., et al. Differential roles of unsaturated and saturated fatty acids on autophagy and apoptosis in hepatocytes. Journal of Pharmacological Experimental Therapy. 339, 487-498 (2011).
  28. Malhi, H., Bronk, S. F., Werneburg, N. W., Gores, G. J. Free fatty acids induce JNK-dependent hepatocyte lipoapoptosis. Journal of Biological Chemistry. 281, 12093-12101 (2006).
  29. Moravcová, A., Červinková, Z., Kučera, O., Mezera, V., Rychtrmoc, D., Lotková, H. The effect of oleic and palmitic acid on induction of steatosis and cytotoxicity on rat hepatocytes in primary culture. Physiological Research. 64, Suppl 5 627-636 (2015).
  30. Ohsaki, Y., Shinohara, Y., Suzuki, M., Fujimoto, T. A pitfall in using BODIPY dyes to label lipid droplets for fluorescence microscopy. Histochemistry and Cell Biology. 133 (4), 477-480 (2010).
  31. Rinia, H. A., Burger, K. N., Bonn, M., Müller, M. Quantitative label-free imaging of lipid composition and packing of individual cellular lipid droplets using multiplex CARS microscopy. Biophysical Journal. 95 (10), 4908-4914 (2008).
  32. Waschatko, G., Billecke, N., Schwendy, S., Jaurich, H., Bonn, M., Vilgis, T. A., Parekh, S. H. Label-free in situ imaging of oil body dynamics and chemistry in germination. Journal of The Royal Society Interface. 13 (123), (2016).
  33. Jüngst, C., Winterhalder, M. J., Zumbusch, A. Fast and long term lipid droplet tracking with CARS microscopy. Journal of Biophotonics. 4 (6), 435-441 (2011).
  34. Welte, M. A., Gould, A. P. Lipid droplet functions beyond energy storage. Biochimica et Biophysica Acta - Molecular and Cell Biology of Lipids. 1862 (10), Pt B 1260-1272 (2017).
  35. Cohen, S. Lipid droplets as organelles. International Review of Cell and Molecular Biology. 337, 83-110 (2018).
  36. Farese, R. V., Walther, T. C. Lipid droplets finally get a little R-E-S-P-E-C-T. Cell. 139 (5), 855-860 (2009).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Request permission to reuse the text or figures of this JoVE article

Request Permission

Tags

Sodium Oleate TreatmentOil Red O StainingBodipy MeasurementCARS MicroscopyLipid Droplet AccumulationHepatic Steatosis ModelDifferentiated HepatocytesNAFLD In Vitro

Related Articles