Индуцирование и характеристика везикулярного стеатоза в дифференцированных клетках гепаррг

Medicine

Your institution must subscribe to JoVE's Medicine section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

В этом исследовании мы описываем подробный протокол для индуцирования печени везикулярный стеатоз в дифференцированных клетках HepaRG с жирным кислотным олеатом соли натрия и используем методы обнаружения и количественной оценки накопления липидов, включая когерентный анти-Стокс Рамана рассеяния (CARS) микроскопии, цитофторетриметрический анализ, Масло красный O окрашивания, и qPCR.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Di Cocco, S., Belloni, L., Nunn, A. D., Salerno, D., Piconese, S., Levrero, M., Pediconi, N. Inducing and Characterizing Vesicular Steatosis in Differentiated HepaRG Cells. J. Vis. Exp. (149), e59843, doi:10.3791/59843 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Печеночный стеатоз представляет собой метаболическую дисфункцию, которая является результатом накопления триггеросодержащих липидных капель в гепатоцитах. Чрезмерное накопление жира приводит к безалкогольной жировой болезни печени (NAFLD), которая потенциально обратима и может перерасти в безалкогольный стеатогепатит (NASH) и в конечном итоге цирроз и гепатоцеллюля). Молекулярные механизмы, связывающие накопление липидов в гепатоцитах с прогрессированием в NASH, необратимые повреждения печени, фиброз, цирроз печени и даже HCC до сих пор остается неясным. С этой целью, несколько in vitro и in vivo модели были разработаны, чтобы выяснить патологические процессы, которые вызывают NAFLD. В настоящем исследовании, мы описываем клеточной модели для индукции печени везикулярный стеатоз, который состоит из DMSO-дифференцированных человеческих печеночных клеток HepaRG, обработанных жирными кислотами соли олеата. Действительно, олейт натрия обработанных клеток HepaRG накапливают липидные капли в цитоплазме и показывают типичные особенности стеатоза. Эта человеческая модель in vitro представляет собой ценную альтернативу моделям in vivo мышей, а также первичным человеческим гепатоцитам. Мы также представляем сравнение нескольких методов количественной оценки и оценки накопления жира в клетках HepaRG, включая окодело oil Red O, цитофторметрическое измерение Бодипи, метаболический анализ экспрессии генов qPCR и когерентный анти-Стокс Рамана рассеяния (CARS) микроскопии. Изображение CARS сочетает в себе химическую специфичность Раманской спектроскопии, метода химического анализа, хорошо известного в материалах, с преимуществами высокоскоростных нелинейных оптических микроскопов с высоким разрешением количественное увеличение накопления липидов и динамики липидных капель. Создание эффективной модели in vitro для индукции везикулярного стеатоза, наряду с точным методом количественной оценки и характеристики накопления липидов, может привести к развитию ранней стадии диагностики НАФЛД с помощью идентификации молекулярных маркеров и создания новых стратегий лечения.

Introduction

Печеночный стеатоз определяется как внутрипеченое накопление жира, в триглицеридов, содержащих липидные капли, по крайней мере 5% от веса печени. Длительное хранение печеночных липидов является потенциально обратимым процессом, однако, это может привести к дисфункции обмена веществ печени, воспаление и передовые формы безалкогольных жировых заболеваний печени (NAFLD), преобладающей причиной хронических заболеваний печени во многих частях мир1,2. НАФЛД является многофакторным заболеванием, которое может эволюционировать до более агрессивного безалкогольного стеатогепатита (NASH), который, в свою очередь, может прогрессировать до цирроза печени и, в небольшом проценте пациентов, гепатоцеллюлярной карциномы (HCC)1,3. Нет утвержденной терапии в настоящее время доступна в качестве конкретного лечения для NAFLD и сочетание диеты и изменения образа жизни остается столп НАФЛД и NASH управления4,5,6.

Молекулярные механизмы, ведущие к развитию печеночного стеатоза в патогенезаНАФЛД, еще предстоит выяснить 7. В этом контексте были разработаны модели мышей для изучения прогрессирования болезни стеатоза человека. Существует множество различных моделей, и каждая из них имеет свои преимущества и недостатки, включая генетические, питательные и химически индуцированные модели, сочетающие различные подходы. Генетически модифицированные (трансгенные или нокаутирующие) мыши спонтанно развивают заболевания печени. Однако следует отметить, что эти мутации очень редки у людей и удаление или чрезмерное выражение одного гена (например, об/об мышь) не могут имитировать этиологию многофакторного заболевания человека на молекулярном уровне8,9. Аналогичным образом, болезнь, приобретенная мышами после диетических или фармакологических манипуляций, не можетимитировать эффекты рациона человека, связанные с развитием НАФЛД у человека 8. Модели животных, однако, способствовали развитию понимания НАФЛД, и этот подход в настоящее время является наиболее часто используемой стратегией в лабораторных исследованиях. Тем не менее, репликация в организме человека результатов, полученных в животных моделях неоднократно не удалось, в результате чего плохой перевод в клинику10.

Таким образом, модели in vitro NAFLD могут играть основополагающую роль в выяснении молекулярных механизмов прогрессии NAFLD, и они представляют собой ценный инструмент для проверки большого количества соединений. Первичные клеточные культуры, увековеченные клеточные линии и биопсия печени широко используются в исследовательских целях11. Первичные гепатоциты человека очень похожи на клинические условия человека, но существует ограниченное число доноров, а первичные клеточные культуры показывают плохую воспроизводимость из-за изменчивости клеток. Эти наблюдения, наряду с этическими и материально-техническими вопросами, привели к тому, что использование первичных гепатоцитов человека было ограничено12. Таким образом, печеночные клеточные линии представляют собой удобную альтернативу, имеющая ряд существенных преимуществ перед первичной культурой, так как линии печеночных клеток постоянно растут, имеют почти неограниченный срок службы и имеют стабильный фенотип. Кроме того, клеточные линии легко доступны, а культурные условия линий печеночной клетки проще, чем у первичных гепатоцитов, и стандартизируются между различными лабораториями.

Здесь мы подробно описываем модель клеточного цитирования печени, представленную печеночными дифференцированными клетками HepaRG, обработанными олеатом натрия. Линия клеток HepaRG была создана из женщины,пациентки, пораженной инфекцией гепатита С, и Эдмондсона класса I хорошо дифференцированной опухоли печени14. Линия клеток HepaRG является человеческой бипотентной линии клеток-прародителей, способной дифференцироваться при воздействии 2% диметилсульфида (DMSO) на два различных клеточных фенотипа: желтоподобные и гепатоцитные клетки. Дифференцированные клетки HepaRG (dHepaRG) имеют некоторые особенности и свойства со взрослыми гепатоцитами и обладают способностью четко выражать гены, характерные для печени, такие как Альбумин, АлдолазеБ, Цитохром P450 2E1 (CYP2E1) и Cytochrome P450 3A4 (CYP3A4)13 (шаг 3). Лечение клеток dHepaRG жирным кислотным олеатом натрия (250 мкм) в течение 5 дней приводит к выработке цитоплазмических липидных капель, имитирующих эффекты жировой печени14,15,17,18 ( шаг 4). Накопление липидных капель может быть легко обнаружено маслом Red O окрашивания (шаг 5), лизохром жирорастворимый краситель, который окрашивает нейтральные триглицериды и липиды красно-оранжевый. Для эффективной количественной оценки липидов в жирной dHepaRG, здесь мы иллюстрируем цитофторетриметрический анализ после окрашивания с 4,4-дифторо-1,3,5,7-тетраметил-4-бора-3a,4a-диаза-с-индицен (Bodipy 505/515) (шаг 6), липофилии флоцентистые внутриклеточных липидных органов и был использован для обозначения липидных капель19. Кроме того, здесь мы показываем, как оценить стеатоз по количественной полимеразной цепной реакции (qPCR) (шаг 7) генной экспрессии дерегуляции нескольких метаболических генов в клетках dHepaRG. Для дальнейшей характеристики и количественной оценки накопления липидных капель после лечения олеатом натрия, мы выполнили когерентную анти-Стокс Раман рассеяния (CARS) микроскопии (шаг 8), инновационный метод, который позволяет визуализации и количественной оценки липидные капли без маркировки20,21.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Подготовка культурных СМИ и реагентов

  1. Пролиферирующая среда: дополнить среду Уильяма E с GlutaMAX, 10% сыворотки крупного рогатого скота плода (FBS), 1% пенициллина / стрептомицина, 5 мкг/мл инсулина и 0,5 мкмизона здоров.
  2. Дифференциация среды: дополнить Уильяма E среды с GlutaMAX, 10% FBS, 1% пенициллин / стрептомицин, 5 мкг /мл инсулина, 50 мкмизонов емисуччинаии 50 мкмизонов и 2% DMSO.
  3. Замораживание среды: дополнение размножающейся среды с 10% DMSO.
  4. Олеят натрия: растворить в 99% метанола при концентрации 100 мМ, перемешать O/N и хранить при -20 градусов по Цельсию.
  5. Нефть Красный O: подготовить фондовый раствор. Взвесить 0,35 г масла Red O и растворить в 100 мл изопропанола. Перемешать O/N, фильтр (0,2 мкм) и хранить на RT. Подготовьте рабочее решение: смешайте 6 мл раствора Oil Red O Stock с 4 мл ddH2O. Пусть сидеть при комнатной температуре (RT) в течение 20 минут, а затем фильтр с 0,2 мкм фильтра. Правильная фильтрация настоятельно рекомендуется для успешного окрашивания, чтобы избежать фона.
  6. Бодипи (505/515): растворяют краситель Bodipy (505/515) в DMSO при концентрации запасов 100 мкм, хранят при -20 градусов по Цельсию в темноте и используют при окончательной концентрации 100 нм.
  7. Приобретайте прозрачные стеклянные блюда для экспериментов CARS.

2. Таяние, усиление и криоконсервация клеток HepaRG

  1. Оттепель азота криоконсервированных клеток HepaRG путем погружения партии в ванну 37 градусов по Цельсию до размораживания. Выберите пакет с низким проходом (Злт;20). Клетки HepaRG доступны на коммерческой уровне.
  2. Быстро переносите клетки в трубку 15 мл, содержащую 10 мл размножающейся среды и центрифуги в течение 5 мин (200 х г, 4 кв. C).
  3. Откажитесь от супернатанта и отрепримите клетки с помощью 5 мл размножающейся среды.
  4. Подсчитайте клетки и разбавьте, чтобы пластина 2,5 х 104 клетки /см2.
  5. Обновлять среду каждые 2 или 3 дня. Клетки размножаться с удвоением времени около 24 ч.
  6. Отсоединить клетки HepaRG при 80% стоечности на 3-5 мин инкубации с раствором трипсина 0,05%. Соберите клетки в пролиферирующей среде и центрифуге в течение 5 мин (200 х г,4 кв. C).
  7. Откажитесь от супернатанта и отрепримите клетки с помощью 5 мл размножающейся среды.
  8. Подсчитайте клетки и разбавьте, чтобы пластина 2,5 х 104 клетки /см2.
  9. На этом этапе, усиливать клетки, повторяя шаги 2.5-2.8 для того, чтобы достичь соответствующего количества клеток, чтобы начать эксперименты, или криоконсервации, как в шаге 2.10.
  10. Чтобы криоконсервировать клетки HepaRG, отсоедините клетки 24 ч после покрытия на 3-5 мин инкубации с раствором трипсина 0,05%. Соберите клетки в пролиферирующей среде и центрифуге в течение 5 мин (200 х г,4 кв. C). Откажитесь от супернатанта, отрепримите клетки в 1 мл/пакет замораживающей среды, 1,5 х 106 ячеек/пакет и криоконсервируют партии в жидком азоте.

3. Дифференциация клеток HepaRG (День 0-21)(Рисунок 1A)

  1. День 0. Семена HepaRG клетки с низкой плотностью (2,5 х 10 104 клетки/см2) в культуре обработанные блюда с соответствующим объемом пролиферации среды(рисунок 1B). Два блюда должны быть покрыты для каждого анализа (Масло Красный O окрашивание, анализ FACS, qPCR): один для контрольных клеток и один для олеат-обработанных клеток. При выполнении измерений CARS (шаг 8), семена клеток параллельно в прозрачные стеклянные bottomed блюда. В качестве контроля, урожай одного необработанного блюда (пролиферации клеток День 0) для выполнения анализа экспрессии генов дифференциации маркер генов (см. шаг 3.6).
  2. День 2 и День 4. Измените среду с соответствующим объемом пролиферации среды и пусть клетки растут до слияния.
  3. День 7. Клетки должны быть 100% конфлюентными(рисунок 1C). Вымойте клетки один раз с 1x фосфат-буферный солен (PBS). Удалить 1x PBS и добавить соответствующий объем дифференциации среды.
  4. День 8, 9, 12, 15, 18.  Вымойте клетки один раз с 1x PBS. Удалить 1x PBS и добавить соответствующий объем дифференциации среды.
  5. День 21. Наблюдайте клетки HepaRG под микроскопом и убедитесь, что клетки совмещены дифференцированными культурами(рисунок 1D).
  6. В качестве контроля, урожай один контроль блюдо (дифференцированные клетки День 21) для выполнения анализа экспрессии генов (шаг 7) дифференциации маркер генов(Рисунок 1E).
  7. На 21-й день дифференцированные клетки HepaRG могут быть криоконсервированы в жидком азоте.

4. Индукция везикулярного стеатоза (День 21-26)

  1. День 21. Разбавить олеатом натрия (100 мМ) с соответствующим объемом полной дифференциации среды до конечной концентрации 250 мкм (1:400). Добавьте 99% метанола 1:400 (такой же объем, как у олеата натрия) в другой аликот дифференциации среды, чтобы сделать лечение управления транспортным средством. (Например: добавьте 25 л олеата натрия к 10 мл среднего и параллельно добавляем 25 л 99% метанола к 10 мл среднего). Вымойте клетки один раз с 1x PBS и добавить транспортного средства или олеата натрия среды.
  2. День 23 и День 25. Измените среду с соответствующим объемом свежеприготовленной среды как в шаге 4.1.
  3. День 26. Обратите внимание с помощью оптического микроскопа, что липидные капли накапливаются в клетках, обработанных олеатом натрия, и легко видны как полупрозрачные капли в цитоплазме, как на рисунке 2А.

5. ОценкаЛипидперевая перегрузка и индукция стеатоза: Нефть Красная O окрашивание

  1. Вымойте он клетки один раз с 1x PBS и удалить 1x PBS полностью.
  2. Добавьте 4% параформальдегида (разбавленного в 1x PBS) и инкубировать в течение 15 мин на RT.
    ПРЕДЕКТО: Параформальдегид является токсичным, поэтому этот шаг должен быть выполнен в дымовой капот, с защитным оборудованием, включая перчатки, лабораторное пальто и маску.
  3. Удалить параформальдегид и мыть клетки дважды с 1x PBS. Клетки могут храниться в 1x PBS при 4 градусах По Цельсию в течение нескольких дней до окрашивания. Оберните парафильмом и накройте алюминиевой фольгой, чтобы предотвратить высыхание клеток.
  4. Удалите 1x PBS. Инкубировать клетки с 60% изопропанола в течение 5 мин на RT.
  5. Удалить изопропанол и дайте клеткам высохнуть полностью на RT.
  6. Добавьте рабочее решение Oil Red O и инкубинуте на RT в течение 30 мин. Объем рабочего решения, необходимого для каждого образца, соответствует объему носителей, используемых для культивирования клеток.
  7. Удалить масло Красный O раствор и сразу же добавить ddH2O. Вымойте клетки 4 раза с ddH2O.
  8. Приобретение изображений под микроскопом для анализа(рисунок 2B).
  9. Чтобы выпустить масло Красный O краситель: удалить всю воду и дайте высохнуть; добавить 1 мл 100% изопропанола и инкубировать в течение 10 минут с нежной тряской на RT.
  10. Pipet изопропанол с eluted Масло Красный O краситель вверх и вниз несколько раз, гарантируя, что все масло Красный O находится в растворе. Перенесите раствор в кювет. Измерьте OD500 nm спектрофотометрией и используйте 100% изопропанол как пустой(рисунок 2C).

6. Оценка липидной перегрузки и индукции стеатоза: Бодипи окрашивание и цитофторетриметрический анализ

  1. Вымойте клетки один раз с 1x PBS. Инкубировать с 100 нм Bodipy разбавленной в 1x PBS в темноте в течение 40 мин при 37 градусов по Цельсию. Неокрашенный контроль должен быть включен в измерения цитометрии потока. С этого момента, защитить образцы от света как можно больше.
    ПРИМЕЧАНИЕ: Объем раствора окрашивания, необходимого для каждого образца, соответствует объему носителей, используемых для культивирования клеток.
  2. Удалить окрашивающий раствор и мыть клетки один раз с 1x PBS. Переходки к шагам 6.3-6.6. для анализа FACS (fluorescence-activated cell s) или для шага 6.7 для визуализации микроскопа.
  3. Аккуратно соскребите клетки с 1x PBS и передать его в трубку 15 мл. Центрифуга в течение 10 мин (200 х г, 4 кв. C).
  4. Аккуратно удалите супернационты, не нарушая гранулы и мыть с 3 мл 1x PBS. Центрифуга в течение 5 мин (200 х г, 4 кв. C).
  5. Удалить супернационты и повторно в 300 Зл 1x PBS, а затем передать в трубку FACS.
  6. Немедленно измеряйте интенсивность флуоресценции Bodipy цитофториметрическим анализом с возбуждением/длиной волн выбросов 505/515 нм(рисунок 3A,B).
  7. Вымойте клетки один раз с 1x PBS и удалить PBS полностью.
  8. Добавьте 4% параформальдегида (разбавленного в 1x PBS) и инкубировать в течение 15 мин на RT.
    ПРЕДЕКТО: Параформальдегид является токсичным, поэтому этот шаг должен быть выполнен в дымовой капот, с защитным оборудованием, включая перчатки, лабораторное пальто и маску.
  9. Удалить параформальдегид и мыть образцы 3x в течение 5 мин в PBS. Клетки могут храниться в 1x PBS при 4 градусах Цельсия или изображены сразу(рисунок 3C). Для хранения, оберните парафильмом и накройте алюминиевой фольгой, чтобы предотвратить высыхание клеток.

7. Оценка перегрузки липидных и стеатозной индукции: qPCR

  1. Вымойте клетки один раз с 1x PBS. Очистите клетки с 1x PBS, центрифуга на 200 х г, и отбросить супернатант. На этом этапе, клетки могут быть собраны при -80 градусов по Цельсию или обработаны как в шаге 7.2.
  2. Выполняйте полную изоляцию РНК стандартными методами с использованием коммерческих реагентов в соответствии с инструкциями производителя.
  3. Оцените концентрацию РНК с помощью УФ-спектрофотометрических измерений, гарантируя высокую чистоту РНК (близко к 2,0) на основе чтения A260/A280.
  4. Синтезировать кДНК из 1 мкг общей РНК со стандартным набором синтеза кДНК.
  5. Разбавить кДНК до окончательного объема 50 Л л с H2O.
  6. Проанализируйте каждый образец cDNA в тройном qPCR: подготовьте одну мастерскую смесь qPCR(Таблица1), которая достаточна для необходимых реакций для каждого грунтовки, включая праймеры, специфичные для трех генов домашнего хозяйства в качестве элементов управления: глицеральдеид-3-фосфато deidrogenasi (GAPDH), актинB и ribosomal 18S (см. Таблица материалов для грунтовых последовательностей):
  7. Распределить 18 зл мастер смеси на хорошо в ПЦР многостенной пластины.
  8. Добавьте 2 злицита образца кДНК в каждом колодце. Запечатать тарелку.
  9. Запустите образцы в соответствии с инструкцией Thermal Cycler.

8. Оценка липидной перегрузки и индукции стеатоза: CARS

  1. Исправьте клетки, предварительно приготовленные на стеклянных посудах, как описано в шагах 5.1-5.3.
  2. Включите коммерческую настраиваемую picosecond импульсную лазерную систему, настраивая ее на получение двух выходов разной длины волн. Разница в частоте между выходами должна быть 2840 см-1 для генерации интенсивного светового сигнала CARS, соответствующего метиленовой симметричной растяжке; для выходной на фиксированной длине 1064 нм ("Стокс" свет), другая длина волны должна быть настроена до 817 нм ("насос" свет).
  3. Убедитесь, что выход 817 нм пространственно и временно перекрывается с выходом 1064 нм: используйте соответствующее дихроическое зеркало (т.е. с разрезом между 817 и 1064 нм), чтобы пространственно комбинировать лучи и использовать оптическую линию задержки для получения временного перекрытия лазера Импульсов.
  4. Убедитесь, что два копропагата т.д. являются коллимимированными и что их диаметры имеют одинаковые значения, соответствующие оптической системе в микроскопе, которая сфокусирует их на образце; при необходимости, отдельно сосоединить балки перед дихроческим зеркалом, которое их объединяет.
  5. Включите коммерческую перевернутую систему микроскопа, которая должна включать инфракрасный лазерный сканирующий блок и двухканальный красный/зеленый блок обнаружения эпи и выровнять копропагатные лазерные лучи в сканирующее устройство.
  6. Открывая двухканальный блок обнаружения эпи, удалите куб и замените его фильтр обнаружения красной волны фильтром, который может выбрать сигнал 2840 см-1 CARS, который сосредоточен на 663 нм для насоса 817/1,064 нм/Стокса Схема. Фильтр с узкой полосой (20 нм) предпочтительнее, чтобы избежать сбора высоких уровней флуоресцентных фоновых сигналов.
  7. Поместите блюдо на сцене перевернутого микроскопа CARS, и, используя 100x цель погружения масла, сдвиг вертикальное положение цели сосредоточиться на клетках.
  8. Настройка микроскопа программного обеспечения для сбора высокого разрешения (1024 х 1024 пикселей) изображения на поле зрения, охватывающих 127 мкм х 127 мкм.
  9. Установите программное обеспечение микроскопа для непрерывного приобретения и отображения изображений поля обзора 127 мкм x 127 мкм и проверки отображаемых изображений при оптимизации параметров сбора изображений. Убедитесь, что лазерные силы сбалансированы для быстрого сбора изображений и минимального повреждения, вставляя соответствующие фильтры нейтральной плотности в пути луча по мере необходимости, и выберите время обитания пикселя, что позволяет сбор изображений с хорошим сигналом к шуму соотношение в выбранных условиях лазерной мощности.
  10. Приобрести и сохранить изображения нескольких различных полей зрения в блюдо в оптимизированных условиях. Дополнительно, мультифотон флуоресценции изображения, созданные зелено-волновой эмиссии (в основном из двух-фотонных возбуждения на 817 нм), могут быть одновременно собраны через другой детектор эпи. Повторите шаги 8.7-8.10 для каждого блюда.
  11. Для анализа изображений CARS обрабатывает изображения с помощью реализации ImageJ FIJI. Управляйте функцией Despeckle (или аналогичным инструментом денозирования) на каждом изображении перед дальнейшим анализом для улучшения соотношения сигнала к шуму без потери детализации.
  12. Используйте FIJI, чтобы выбрать клетки вручную, а затем автоматически подсчитать липидные капли в сегментированных отдельных клетках для получения статистики по липидным капле и числам для каждой клетки и для всего набора данных изображений для каждого блюда.

9. MtT Cell Viability

  1. Плита дифференцировала клетки HepaRG в 96-колодецную пластину с плотностью 1 х 105 клеток/колодца в окончательном 100 л объема среды культуры дифференциации.
  2. 24 ч после посева, лечить клетки с 99% метанола (транспортное средство) и с 100 МКм, 250 ММ и 500 ММ олеат натрия и пальмитат натрия разбавленной в 100 л дифференциации культуры среднего / хорошо в тройной.
  3. Измените среду с 99% метанола и с 100 мкм, 250 мкм и 500 ММ олеатом натрия и пальмитатом натрия, разбавленными в 100 л культуры дифференциации среднего/хорошо каждые 24 ч.
  4. 96 ч после метанола/ натрия олеат / натрия пальмитат лечения, лечить клетки с 2 ММ доксорубицин разбавленной в 100 л дифференциации культуры среднего / хорошо в тройной в качестве контроля.
  5. 18 ч после лечения доксорубуцином, изменить среду с 100 Зл культуры среды.
  6. Пипет 20 ЗЛ 3-(4,5-диметилтиазол-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-сульфофенил)-2H-тетразолий реагент MTT (Таблица Материалов) в каждую скважину 96-хорошо, асай пластины, содержащие клетки в 100 средних . Включите фоновый контроль путем пайпетации 20 зл реагента в контрольный колодец без ячеек в 100 Л культуры дифференциации среды в тройном.
  7. Инкубировать пластину при 37 градусах Цельсия в увлажненной, 5% CO2 атмосфере.
  8. После инкубации в течение 30, 60 и 90 минут с реагентом MTT tetrazolium, запишите абсорбцию на 490 нм с помощью 96-хорошо плиты читателя. Вычесть фоновое поглощение неклеточных управляющих скважин из значений абсорбции для других образцов.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Этот протокол описывает эффективный метод, чтобы вызвать и охарактеризовать везикулярный стеатоз в DMSO дифференцированных клеток HepaRG натрия олеат лечения(рисунок 1A).

Дифференциация клеток HepaRG.
Чтобы эффективно вызвать дифференциацию, пролиферирующие клетки должны быть посеяны при низкой плотности (2,5 х 10 104 клетки/см2) в среде распространения. При посеве при низкой плотности клетки активно делятся и приобретают удлиненную недифференцированную морфологию(рисунок 1В). Клетки должны быть оставлены расти в среде распространения в течение 7 дней, пока 100% confluency достигается(рисунок 1C). После воздействия 2% ДМСО, клетки начинают дифференцироваться и формировать типичные гепатоцитов, как колонии, окруженные желчных эпителиальных клеток (Рисунок 1D). Дифференцированные клетки HepaRG выражают гепато-специфические маркеры, такие как Альбумин, Cyp3A4 и Aldolase B. Для проверки правильной дифференциации уровни экспрессии этих генов печеночного маркера в дифференцированных клетках (День 21) и в размножающихся клетках (День 0) были проанализированы qPCR(Рисунок 1E). Альбумин, Cyp3A4 и Aldolase B гены должны быть upregulated в дифференцированных клетках HepaRG по сравнению с размножающимися клетками HepaRG, и мы наблюдали эту тенденцию, подтверждая эффективность нашего протокола дифференциации.

Индукция везикулярного стеатоза в клетках HepaRG путем лечения олеатом натрия.
Олеат натрия лечение клеток dHepaRG индуцирует накопление жира, видимый под оптическим микроскопом в виде липидных капель цитоплазм(рисунок 2А). Для проверки эффективной индукции стеатоза, олеат-обработанных и контроля HepaRG клетки были окрашены с маслом Красный O краситель. После окрашивания липидные капли легко видны как красные капли(рисунок 2B) и могут быть количественно с помощью спектрофотометрического измерения красителя Oil Red O, иллюстрированного изопропанолом (рисунок2C). Абсорбция элетированного масла Red O из клеток прямо пропорциональна цитоплазматическим накоплениям липидных капель.

Концентрация олеата натрия и время экспозиции были определены MTT анализом жизнеспособности колориметрических клеток (шаг 9). Лечение олеатом натрия было сравнено к обработке ладонита натрия и apoptotic снадобье doxorubucin (2 мкм) было использовано как контроль(рисунок 2D). Цитоксичность соединений была оценена MTT, воспользовавшись коммерческим соединением(Таблица материалов), который содержит TEtrazolium MTT. Водорастворимый желтый мтт тетразолий соединение биоуменьшается метаболически активными клетками в фиолетовый водорастворимый формазан. Формазан продукт количественно его поглощения на 490 нм и количество прямо пропорционально количеству живых клеток в культуре(Рисунок 2D).

Количественная оценка везикулярного стеатоза в клетках HepaRG, обработанных олеатом натрия
Для количественной оценки увеличения содержания липидов в клетке после лечения олеатом натрия, мы выполнили окрашивание с Bodipy красителя, зонд, который этикетки липидных капель. Используя цитофториметрический анализ, можно количественно содержание триглицеридов бодипи средняя интенсивность флуоресцентных, которая выше в олеат-обработанных клеток по сравнению с контрольными клетками (Рисунок 3A,B), с указанием эффективного жира накопление после лечения олеатом. Действительно, изображения окрашенных бодипи клеток показывают ярко-зеленые флуоресцентные липидные капли в обработанных олеатом клетках, которые не видны в контрольных клетках(Рисунок 3C).

Олеат натрия лечения клеток dHepaRG дерегулирует метаболизм липидов и воспалительных экспрессии генов. Для оценки эффективной индукции везикулярного стеатоза, мы проанализировали qPCR уровни экспрессии выбранных генов в клетках, обработанных олеатом натрия по сравнению с клетками, созидающими(Рисунок 4). Ацетил-КоА carboxylase бета (ACACB), глицерол-3-фосфат ацилтрансферазы митохондриальной (GPAM), перилипинов (PLIN2, PLIN4), аполипопротеин B (APOB), пируват дегидрогеназы киназы isozyme 4 (PDK4), карнитина пальмитоция интерлейкин 6 (IL6) были upregulated в олеат-обработанных dHepaRG клеток, в то время как солотные семьи перевозчика 2 член 1 (SLC2A1), аполипопротеин C-III (APOC3), и stearoyl-CoA desaturase (SCD) были downregulated(рисунок 4). Для дальнейшей характеристики и количественной оценки хранения липидов в каплях при добавлении олеата натрия в дифференцированные клетки HepaRG, мы использовали инновационную технику микроскопии, когерентную анти-Стокс Раман рассеяния (CARS) микроскопии, которая позволяет визуализация и количественная оценка липидных капель без маркировки(рисунок 5А). Липидные капли были статистически количественно с точки зрения чисел, распределения и морфологии на одноклеточном уровне с использованием изображений CARS. Лечение олеатом натрия (250 мкм) привело к значительному увеличению количества липидных капель(рисунок 5В), что привело к более высокой общей площади капель на одну клетку (рисунок5С) и более высокой процентной площади капли на одну клетку ( Рисунок 5D), по сравнению с контрольными клетками, что указывает на то, что клетки dHepaRG эффективно накапливают жир после лечения олеатом натрия.

Figure 1
Рисунок 1 : Дифференциация клеток HepaRG. (A) Представитель диаграммы, показывающие HepaRG клеточной дифференциации / протокол лечения, как описано в шагах 3 и 4. (B-D) Изображения, показывающие неокрашенные размножающиеся клетки HepaRG в день 0 после посева (B), в день слияния 7 после посева (C), и дифференцированные HepaRG (dHepaRG) в день 21 после посева (D). (E) Всего РНК была извлечена из размножающихся и dHepaRG клеток, кДНК была синтезирована и проанализирована qPCR с помощью грунтовки, специфичными для указанных генов (Таблица материалов). Образцы были нормализованы в среднем GAPDH, актинB и рибосомные 18S домеведения генов. Гистограммы показывают раз индукцию размножающихся (День 0) по сравнению с дифференцированными клетками (День 21) (бары указывают на S.D.; p-значения были вычислены по Т-тестам студента). Пожалуйста, нажмите здесь, чтобы просмотреть большую версию этой цифры.

Figure 2
Рисунок 2 : Олеат натрия лечение dHepaRG клеток индуцированного накопления липидных капель. (A) Изображения неокрашенных дифференцированных клеток HepaRG (dHepaRG) обработанных на 5 дней с кораблем (управление) (левое изображение) или с oleate натрия 250 мкм (правое изображение). (B) После обработки, клетки были запятнаны с красителем красного масла O; липидные капли видны красным цветом. (C) Масло Красный O краситель был eluted и OD был измерен на 570 нм. Результаты выражаются как средства трех независимых экспериментов (бары, указывающие S.D.; p-value t-test Студента). (D) Оценка жизнеспособности клеток dHepaRG транспортных средств (99% метанола) лечение (Ctrl) или лечение в течение 5 дней с олеатом натрия и натрия palmitate (100 МКм, 250 мкм, или 500 мкм), или лечение 18 ч с доксорубцином (2 мкм).  Оценка цитотоксичности была проведена с использованием комплекта MTT assay(Таблицаматериалов), записи поглощения на 490 нм, в соответствии с инструкцией производителя. Результаты выражаются в качестве средств трех независимых экспериментов (бары указывают на S.D.; p-значения были определены с помощью Т-теста студента: 0,01. р. ; 0,05; 0,001 евро p l; 0.01; Пожалуйста, нажмите здесь, чтобы просмотреть большую версию этой цифры.

Figure 3
Рисунок 3 : Количественная оценка накопления жира после лечения олеатом натрия бодипийским окрашиванием. Дифференцированные клетки HepaRG (dHepaRG) лечились транспортнымсредством (управлением) или 250-мм олеатом натрия в течение 5 дней. После лечения, dHepaRG клетки были окрашены бодипи красителя и проанализированы поток цитометрии. (A) Представитель наложения профилей (% от макс: процент максимальной интенсивности окрашивания). (B) Гистограммы показывают, средняя интенсивность флуоресценции (МФИ) в процентах от обработанных клеток над контролем от трех независимых экспериментов (бары указывают S.D.; p-значения были определены с помощью T-тест студента: 0,01 p злт; 0,001). (C) Клетки были зафиксированы с 4% параформальдегида. Изображения показывают Bodipy окрашенных липидных капель в зеленом цвете. Пожалуйста, нажмите здесь, чтобы просмотреть большую версию этой цифры.

Figure 4
Рисунок 4 : Олеат натрия лечение клеток dHepaRG индуцирует дерегегулирование липидного метаболизма и воспалительное выражение генов. Дифференцированные клетки HepaRG (dHepaRG) лечились транспортнымсредством (управлением) или 250-мм олеатом натрия в течение 5 дней. cDNAs были проанализированы qPCR с праймерами, специфичными для указанных генов, и результаты были нормализованы в среднем GAPDH, actinB и ribosomal 18S домехальных генов; праймеры приведены в таблице материалов. Гистограмма показывает уровни экспрессии указанных генов, как раз индукции обработанных клеток над контролем (бары указывают S.D.; p-значения были вычислены T-тест студента). Пожалуйста, нажмите здесь, чтобы просмотреть большую версию этой цифры.

Figure 5
Рисунок 5 : Характеристика накопления липидных капель после лечения олеатом натрия микроскопией CARS. Дифференцированные клетки HepaRG (dHepaRG) лечились транспортнымсредством (управлением) или 250 умна натрия в течение 5 дней и анализировались микроскопией CARS. (A) Представитель изображения, показывающие липидные капли CARS контраст в красном цвете. (B) Гистограмма, показывающая количество липидных капель на клетку. (C) Гистограммы, показывающие общую площадь изображения, покрытую каплями на клетку. (D) Гистограмма, показывающая% области капель, покрытых каплями на клетку. Все результаты выражаются в качестве средств трех независимых экспериментов (бары указывают на S.E.; p-значения были определены T-тестом студента: 0,01 п.л.; 0,05; 0,001 евро p l; 0.01; Пожалуйста, нажмите здесь, чтобы просмотреть большую версию этой цифры.

Реагентов Объем (КЛ) для одной реакции
2x SYBR Зеленый флуоресцентный краситель 10 Лет
PcR класс H2O 6
Передняя грунтовка (мМ) 1
Обратная грунтовка (мМ) 1

Таблица 1: мастер-микс qPCR.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Этот протокол описывает, как дифференцировать клетки HepaRG и как вызвать везикулярный стеатоз лечения олеатом натрия(рисунок 1A). Действительно, по сравнению с другими человеческими линиями клеток гепатоцеллюлярной карциномы (HCC), клеточная линия HepaRG демонстрирует особенности взрослых гепатоцитов человека, что представляет собой ценную альтернативу бывшим виво культивируемым первичным гепатоцитам человека13,14 ,15. Линия клеток HepaRG широко используется для исследований цитотоксичности печени, метаболизма наркотиков и вирусологических исследований15,16,22.

По сравнению с клетками HepaRG, другие клеточные линии HCC, такие как HepG2, HUH7, HUH6 и Hep3B отображают более низкие метаболические возможности, не имея существенного набора функций, связанных с печенью23,24,и демонстрируют более высокий базальный уровень цитозоликовое накопление жира хранится в липидных каплях. Таким образом, эти линии клеток HCC менее полезны в качестве моделей для индукции везикулярного стеатоза после перегрузки липидов, чем линия клеток HepaRG.

Критические шаги в протоколе
При посеве при низкой плотности (2,5 х 10 104 клетки/см2),клетки HepaRG приобретают удлиненную недифференцированную морфологию, активно разделяющую; после достижения 100% вспыхивания, они способны дифференциирования при воздействии 2% DMSO, и они образуют типичные гепатоцитов, как колонии, окруженные желчных эпителиальных клеток (Рисунок 1D). Эта смешанная желчных / гепатоцитов клеточной культуры резюмирует особенности ткани печени, напоминающие физиологическое состояние, несмотря на отсутствие других типов клеток печени (синусоидальной или Купффер).

Важным шагом в процессе дифференциации является слияние клеток. Клетки должны быть посеяны при низкой плотности (2,5 х 10 104 клетки/см2) (рисунок1В)и позволяют активно расти в среде распространения, по крайней мере 1 неделю (день 0-7). На 7-й день, прежде чем добавить 2% DMSO, чтобы начать процесс дифференциации, клетки должны быть на 100% слияние(Рисунок 1C). Если на 7-м дне (шаг 2.2) полная стычка не достигнута, настоятельно рекомендуется, чтобы клетки продолжали расти в среде распространения в течение еще нескольких дней, пока не будет достигнуто 100% слияние.

Ограничения протокола
Было отмечено, что после добавления среды дифференциации, некоторые клетки страдают, и, как правило, 10% клеток умирают в течение последующих 2-3 дней. На этом этапе ежедневная стирка и среда изменения (шаг 2.4) должны быть продолжены, чтобы отказаться от плавающих мертвых клеток. Использование конкретного FBS(Таблица материалов) в дополнение как дифференциации и распространения средств массовой информации, должно увеличить эффективность дифференциации и снижение смертности клеток в течение дней 7-21 (шаг 2.4). Настоятельно рекомендуется поддерживать клетки до 20 прохода, а также выбирать более низкие проходы (Злт;20) для дифференциациирующих клеток: меньше клеток смерти происходит для самых маленьких клеток HepaRG. Кроме того, дифференциация HepaRG, кажется, более эффективна в 35 мм и 60 мм посуды, в то время как клетки, как правило, страдают больше, когда семенами в 100 мм и 150 мм блюд.

Модификации и устранение неполадок
Воздействие различных соотношений как пальмитических, так и олеинных жирных кислот приводит к образованию интрацитоплазматических липидных капель25,26. Тем не менее, мы заметили, что олеат натрия лечения дифференцированных клеток HepaRG выставлены лучшие результаты, чем воздействие пальмитиновой кислоты, с точки зрения эффективной индукции накопления липидов и жизнеспособности клеток (Рисунок 2D). Действительно, пальмитовая кислота лечение оказалось токсичным для дифференцированных клеток HepaRG (Рисунок 2D), в согласии с литературными данными о линиях клеток гепатомы и на человека и крысы гепатоцитов первичных культур, которые описывают пальмитиновой кислоты, как значительно цитотоксический агент25,26,27,28,29. Кроме того, использование пальмитата в клеточных анализов является сложной задачей из-за его низкой растворимости. Тем не менее, из-за внутренней изменчивости клеточных линий, рекомендуется проверить концентрацию натрия олеатом рабочей концентрации и продолжительности лечения, проверяя различные концентрации в эксперименте с временной пробы с анализом жизнеспособности клеток.

Значение и сравнение методов обнаружения липидов
Точное определение липидных количеств в клетках было установлено с помощью ряда различных подходов в этом исследовании. Квалификационное, а также примерно количественное соглашение наблюдалось между результатами, полученными с помощью oil Red O окрашивания, Bodipy окрашивания, и CARS изображений. Для быстрой оценки количества липидов в популяциях клеток, использование цитометрии Бодипи-потока или пятно, такое как Oil Red O, является идеальным. Для более детального изучения содержания липидных капель в клетках предпочтительнее способ визуализации. Кроме того, специфические проблемы были зарегистрированы для липидных пятен, таких как Oil Red O20,30,и мы заметили, что в некоторых случаях, bodipy пятно имеет меньшую емкость, чем CARS исключительно этикетки липидных капель среди других клеток органеллы (данные не показаны). Таким образом, использование без этикетки микроскопических методов визуализации, таких как CARS обеспечивает значительные преимущества для стеатоза количественной и характеристики. Избегание использования большой флуоресцентной этикетки делает визуализацию CARS благоприятной из-за небольшого размера липидных молекул по сравнению с типичными флюорофорами; следовательно, для обнаружения липидов, без этикетки методы желательны, даже больше, чем для наблюдения больших молекул белка. Сигнал липидов CARS представляет собой оптическое излучение, которое генерируется только при нелинейном взаимодействии в образце. Это взаимодействие может быть обнаружено только тогда, когда разница между частотами двух возбуждающих лазеров, ориентированных наобразец, соответствует метилену (CH 2) растяжения частоты вибрационных. Обилие метиленовых групп в липидах приводит к очень интенсивным сигналам с высоким и шумовым соотношением сигнала к шуму, а нелинейность оптического взаимодействия также означает, что высокое пространственное разрешение возможно в микроскопии CARS. Отличное качество изображений CARS в целом позволяет сбор статистических данных о размерах и количестве липидных капель, как показано в данном исследовании. Кроме того, другие исследования показали использование микроскопии CARS для корреляции различных субклеточных локализаций и размеров липидных капель с различными методами лечения18, а также с помощью дополнительных измерений CARS на разных длинах волн, или широкополосный CARS или аналогичный стимулировал Роман подход, исследователи показали, что можно охарактеризовать различные типы жирных кислот в липидных капель31,32. Кроме того, быстрота сбора изображений CARS позволила на месте изображения живых клеток для изучения временной эволюции роста липидных капель и агрегации33.

Будущие приложения
В последние десятилетия, взгляды на роли и функции липидных капель в клеточной биологии развивались. Ранее считалось, в основном инертных пузырьков хранения, они в настоящее время понимается как высоко динамические клеточные органеллы, и их роль в болезни все чаще признается34,35,36. Хотя в случае заболевания печени, накопление липидов (стеатоз) уже давно известно, что критический аспект, точный механизм вовлечения липидных капель в прогрессирование заболевания не совсем ясно. Таким образом, такие методы, как CARS, которые могут охарактеризовать динамическое поведение липидных капель имеют решающее значение для развития молекулярного понимания заболеваний, включая НАФЛД. Метаболический анализ экспрессии генов qPCR в значительной степени дополняет молекулярную визуализацию липидов через CARS, как показано в предыдущих исследованиях17,18, что позволяет глубже понять механизмы болезни. В настоящем исследовании мы наблюдаем накопление жирных кислот с дерегуляцией метаболизма липидов и воспалительной экспрессией генов, что может способствовать построению панели биомаркеров для ранней диагностики заболеваний.

Олеат натрия лечение dHepaRG клеточной модели может расширить знания о молекулярных механизмов, участвующих не только в начале, но и в прогрессии NAFLD, обеспечивая основу для разработки лучших терапевтических подходов к болезни.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Авторы заявляют, что у них нет конкурирующих финансовых интересов.

Acknowledgments

Мы благодарим профессора Кристиана Трепо (INSERM U871, Лион, Франция), который любезно предоставил клетки HepaRG. Мы благодарны Рите Апподиа за административную помощь. Эта работа была поддержана MIUR-Ministero dell'istruzione, dell'universite e della ricerca (FIRB 2011-2016 RBAP10XKNC) и Римским университетом Сапиенца (протеже. C26A13T8PS; Прот. C26A142MCH; Прот. C26A15LSXL).

Materials

Name Company Catalog Number Comments
Hyclone HyClone Fetal Clone II  GE Healthcare SH30066
William’s E medium with GlutaMAX  Thermofisher 32551087
Penicillin/streptomycin  SIGMA P4333
Insulin  SIGMA I9278
Hydrocortisone hemisuccinate SIGMA H2270
DMSO, dimethyl sulfoxide SIGMA D2438   
Sodium Oleate SIGMA O7501 
Methanol SIGMA 179337
Isopropanol SIGMA 278475
BODIPY 505/515 Thermofisher D3921
PBS Thermofisher 14190-250
Formaldehyde solution SIGMA 252549
RNAse free DNAseI Promega M198A 
Glass-bottomed dishes Willco Wells GWST-5040
Oil Red solution SIGMA O625
CellTiter 96 AQueous One Solution Promega  G3582
q-PCR oligo name Sequence
ACACB FOR CAAGCCGATCACCAAGAGTAAA
ACACB REV CCCTGAGTTATCAGAGGCTGG
β-actin FOR GCACTCTTCCAGCCTTCCT
β-actin REV AGGTCTTTGCGGATGTCCAC
ALBUMIN FOR TGCTTGAATGTGCTGATGACAGG
ALBUMIN REV AAGGCAAGTCAGCAGGCATCTCATC
ALDOB FOR GCATCTGTCAGCAGAATGGA 
ALDOB REV TAGACAGCAGCCAGGACCTT
APOB FOR CCTCCGTTTTGGTGGTAGAG
APOB REV  CCTAAAAGCTGGGAAGCTGA
APOC3 FOR CTCAGCTTCATGCAGGGTTA
APOC3 REV GGTGCTCCAGTAGTCTTTCAG
CPT1A FOR TCATCAAGAAATGTCGCACG
CPT1A REV GCCTCGTATGTGAGGCAAAA
CYP2E1 FOR TTGAAGCCTCTCGTTGACCC
CYP2E1 REV CGTGGTGGGATACAGCCAA
CYP3A4 FOR CTTCATCCAATGGACTGCATAAAT
CYP3A4 REV TCCCAAGTATAACACTCTACACAGACAA
GAPDH FOR TGACAACTTTGGTATCGTGGAAGG
GAPDH REV AGGGATGATGTTCTGGAGAGCC
GPAM FOR TCTTTGGGTTTGCGGAATGTT
GPAM REV ATGCACATCTCGCTCTTGAATAA
IL6 FOR CCTGAACCTTCCAAAGATGGC
IL6 REV ACCTCAAACTCCAAAAGACCAGTG
PDK4 FOR ACAGACAGGAAACCCAAGCCAC
PDK4 REV TGGAGGTGAGAAGGAACATACACG
PLIN2 FOR TTGCAGTTGCCAATACCTATGC
PLIN2 REV CCAGTCACAGTAGTCGTCACA
PLIN4 FOR AATGAGTTGGAGGGGCTGGGGGACATC
PLIN4 REV GGTCACCTAAACGAACGAAGTAGC
SCD FOR TCTAGCTCCTATACCACCACCA
SCD REV TCGTCTCCAACTTATCTCCTCC
SLC2A1 FOR TGCTCATCAACCGCAACGAG
SLC2A1 REV CCGACTCTCTTCCTTCATCTCCTG
18S FOR CGCCGCTAGAGGTGAAATTC
18S REV TTGGCAAATGCTTTCGCTC

DOWNLOAD MATERIALS LIST

References

  1. Starley, B. Q., Calcagno, C. J., Harrison, S. A. Nonalcoholic fatty liver disease and hepatocellular carcinoma: a weighty connection. Hepatology. 51, (5), 1820-1832 (2010).
  2. Byrne, C. D., Targher, G. NAFLD: a multisystem disease. Journal of Hepatology. 62, (1), Suppl 47-64 (2015).
  3. Marra, F., Gastaldelli, A., Svegliati Baroni, G., Tell, G., Tiribelli, C. Molecular basis and mechanisms of progression of non- alcoholic steatohepatitis. Trends in Molecular Medicine. 14, 72-81 (2008).
  4. Chalasani, N., et al. The diagnosis and management of nonalcoholic fatty liver disease: Practice guidance from the American Association for the Study of Liver Diseases. Hepatology. 67, (1), 328-357 (2018).
  5. Banini, B. A., Sanyal, A. J. Current and future pharmacologic treatment of nonalcoholic steatohepatitis. Current Opinion in Gastroenterology. 33, (3), 134-141 (2017).
  6. Takahashi, Y., Sugimoto, K., Inui, H., Fukusato, T. Current pharmacological therapies for nonalcoholic fatty liver disease/nonalcoholic steatohepatitis. World Journal of Gastroenterology. 21, (13), 3777-3785 (2015).
  7. Younossi, Z., et al. Global burden of NAFLD and NASH: trends, predictions, risk factors and prevention. Nature Reviews Gastroenterology & Hepatology. 15, (1), 11-20 (2018).
  8. Santhekadur, P. K., Kumar, D. P., Sanyal, A. J. Preclinical models of non-alcoholic fatty liver disease. Journal of Hepatology. 68, (2), 230-237 (2018).
  9. Nagarajan, P., Mahesh Kumar, M. J., Venkatesan, R., Majundar, S. S., Juyal, R. C. Genetically modified mouse models for the study of nonalcoholic fatty liver disease. World Journal of. Gastroenterology. 18, (11), 1141-1153 (2012).
  10. Oseini, A. M., Cole, B. K., Issa, D., Feaver, R. E., Sanyal, A. J. Translating scientific discovery: the need for preclinical models of nonalcoholic steatohepatitis. Hepatology International. 12, (1), 6-16 (2018).
  11. Ramboer, E., Vanhaecke, T., Rogiers, V., Vinken, M. Immortalized human hepatic cell lines for in vitro testing and research purposes. Methods in Molecular Biology. 1250, 53-76 (2015).
  12. Gómez-Lechón, M. J., Donato, M. T., Castell, J. V., Jover, R. Human hepatocytes in primary culture: the choice to investigate drug metabolism in man. Current Drug Metabolism. 5, (5), 443-462 (2004).
  13. Marion, M. J., Hantz, O., Durantel, D. The HepaRG cell line: biological properties and relevance as a tool for cell biology, drug metabolism, and virology studies. Methods in Molecular Biology. 640, 261-272 (2010).
  14. Gripon, P., et al. Infection of a human hepatoma cell line by hepatitis B virus. Proceedings of the National Academy of Sciences. 99, (24), 15655-15660 (2002).
  15. Anthérieu, S., Rogue, A., Fromenty, B., Guillouzo, A., Robin, M. A. Induction of vesicular steatosis by amiodarone and tetracycline is associated with up-regulation of lipogenic genes in HepaRG cells. Hepatology. 53, (6), 1895-1905 (2011).
  16. Rouge, A., et al. PPAR agonists reduce steatosis in oleic acid-overloaded HepaRG cells. Toxicology and Applied Pharmacology. 276, (1), 73-81 (2014).
  17. Belloni, L., et al. Targeting a phospho-STAT3-miRNAs pathway improves vesicular hepatic steatosis in an in vitro and in vivo model. Scientific Reports. 8, 13638 (2018).
  18. Nunn, A. D. G., et al. The histone deacetylase inhibiting drug Entinostat induces lipid accumulation in differentiated HepaRG cells. Scientific Reports. 6, 28025 (2016).
  19. Donato, M. T., et al. Cytometric analysis for drug-induced steatosis in HepG2 cells. Chemico-Biological Interactions. 181, (3), 417-423 (2009).
  20. Hellerer, T., Axäng, C., Brackmann, C., Hillertz, P., Pilon, M., Enejder, A. Monitoring of lipid storage in Caenorhabditis elegans using coherent anti-Stokes Raman scattering (CARS) microscopy. Proceedings of the National Academy of Sciences. 104, (37), 14658-14663 (2007).
  21. Le, T. T., Ziemba, A., Urasaki, Y., Brotman, S., Pizzorno, G. Label-free evaluation of hepatic microvesicular steatosis with multimodal coherent anti-Stokes Raman scattering microscopy. PLoS One. 7, (11), 51092 (2012).
  22. Guillouzo, A., Corlu, A., Aninat, C., Glaise, D., Morel, F., Guguen-Guillouzo, C. The human hepatoma HepaRG cells: a highly differentiated model for studies of liver metabolism and toxicity of xenobiotics. Chemico-Biological Interactions. 168, (1), 66-73 (2007).
  23. Nelson, L. J., et al. Human hepatic HepaRG cells maintain an organotypic phenotype with high intrinsic CYP450 Activity/metabolism and significantly outperform standard HepG2/C3A cells for pharmaceutical and therapeutic applications. Basic & Clinical Pharmacology & Toxicology. 120, (1), 30-37 (2017).
  24. Gerets, H. H. J., Tilmant, K., Gerin, B., Chanteux, H., Depelchin, B. O., Dhalluin, S., Atienzar, F. A. Characterization of primary human hepatocytes, HepG2 cells, and HepaRG cells at the mRNA level and CYP activity in response to inducers and their predictivity for the detection of human hepatotoxins. Cell Biology and Toxicology. 28, (2), 69-87 (2012).
  25. Pusl, T., et al. Free fatty acids sensitize hepatocytes to bile acid-induced apoptosis. Biochemical and Biophysical Research Communications. 371, (3), 441-445 (2008).
  26. Gentile, C. L., Pagliassotti, M. J. The role of fatty acids in the development and progression of nonalcoholic fatty liver disease. The Journal of Nutritional Biochemistry. 19, (9), 567-576 (2008).
  27. Mei, S., et al. Differential roles of unsaturated and saturated fatty acids on autophagy and apoptosis in hepatocytes. Journal of Pharmacological Experimental Therapy. 339, 487-498 (2011).
  28. Malhi, H., Bronk, S. F., Werneburg, N. W., Gores, G. J. Free fatty acids induce JNK-dependent hepatocyte lipoapoptosis. Journal of Biological Chemistry. 281, 12093-12101 (2006).
  29. Moravcová, A., Červinková, Z., Kučera, O., Mezera, V., Rychtrmoc, D., Lotková, H. The effect of oleic and palmitic acid on induction of steatosis and cytotoxicity on rat hepatocytes in primary culture. Physiological Research. 64, Suppl 5 627-636 (2015).
  30. Ohsaki, Y., Shinohara, Y., Suzuki, M., Fujimoto, T. A pitfall in using BODIPY dyes to label lipid droplets for fluorescence microscopy. Histochemistry and Cell Biology. 133, (4), 477-480 (2010).
  31. Rinia, H. A., Burger, K. N., Bonn, M., Müller, M. Quantitative label-free imaging of lipid composition and packing of individual cellular lipid droplets using multiplex CARS microscopy. Biophysical Journal. 95, (10), 4908-4914 (2008).
  32. Waschatko, G., Billecke, N., Schwendy, S., Jaurich, H., Bonn, M., Vilgis, T. A., Parekh, S. H. Label-free in situ imaging of oil body dynamics and chemistry in germination. Journal of The Royal Society Interface. 13, (123), (2016).
  33. Jüngst, C., Winterhalder, M. J., Zumbusch, A. Fast and long term lipid droplet tracking with CARS microscopy. Journal of Biophotonics. 4, (6), 435-441 (2011).
  34. Welte, M. A., Gould, A. P. Lipid droplet functions beyond energy storage. Biochimica et Biophysica Acta - Molecular and Cell Biology of Lipids. 1862, (10), Pt B 1260-1272 (2017).
  35. Cohen, S. Lipid droplets as organelles. International Review of Cell and Molecular Biology. 337, 83-110 (2018).
  36. Farese, R. V., Walther, T. C. Lipid droplets finally get a little R-E-S-P-E-C-T. Cell. 139, (5), 855-860 (2009).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics