분화된 HepaRG 세포에서 베아토시스 유도 및 특성화

Medicine

Your institution must subscribe to JoVE's Medicine section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

본 연구에서는, 지방산 염 나트륨 올레아테를 사용하여 분화된 HepaRG 세포에서 간 용술증을 유도하기 위한 상세한 프로토콜을 설명하고, 일관된 항스톡스를 포함한 지질 축적의 검출 및 정량화를 위한 방법을 채택한다. 라만 산란 (CARS) 현미경 검사법, 세포 형광 분석, 오일 레드 O 염색, 및 qPCR.

Cite this Article

Copy Citation | Download Citations

Di Cocco, S., Belloni, L., Nunn, A. D., Salerno, D., Piconese, S., Levrero, M., Pediconi, N. Inducing and Characterizing Vesicular Steatosis in Differentiated HepaRG Cells. J. Vis. Exp. (149), e59843, doi:10.3791/59843 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

간 지방 세포는 간세포에 트리글리세라이드 함유 지질 방울의 축적에서 발생하는 대사 기능 장애를 나타냅니다. 과도한 지방 축적은 잠재적으로 가역적이고 비 알코올 성 지방 간염 (NASH) 및 결국 간경변 및 간세포 암종 (HCC)으로 진화 할 수있는 비 알코올 성 지방 간 질환 (NAFLD)으로 이어집니다. NASH에 진행과 간세포에서 지질 축적을 연결 하는 분자 메커니즘, 돌이킬 수 없는 간 손상, 섬유 증, 간 경 변, 그리고 심지어 HCC 는 여전히 불분명 남아. 이를 위해, 몇몇 생체외 및 생체내 모형은 NAFLD를 일으키는 원인이 되는 병리학 적인 프로세스를 해명하기 위하여 개발되었습니다. 본 연구에서, 우리는 지방산 염 나트륨 올레아테로 처리된 DMSO 분화 인간 간 HepaRG 세포로 구성된 간 소포증의 유도를 위한 세포 모델을 기술한다. 실제로, 나트륨 올레아테 처리 된 HepaRG 세포는 세포질에 지질 방울을 축적하고 스테토시스의 전형적인 특징을 보여줍니다. 이러한 시험관내 인간 모델은 생체내 마우스 모델뿐만 아니라 1차 인간 간세포에 대한 귀중한 대안을 나타낸다. 우리는 또한 오일 레드 O 염색, 세포 불변 보디피 측정, qPCR에 의한 대사 유전자 발현 분석 및 일관된 항 스토크스를 포함한 HepaRG 세포의 지방 축적의 정량화 및 평가를 위한 여러 가지 방법의 비교를 제시합니다. 라만 산란 (CARS) 현미경 검사법. CARS 이미징은 재료 과학 응용 분야에서 잘 알려진 화학 분석 기술인 라만 분광법의 화학적 특이성과 정밀한 정밀성을 허용하는 고속, 고해상도 비선형 광학 현미경의 이점을 결합합니다. 지질 축적 및 지질 방울 역학의 정량화. 혈관 성 증의 유도를위한 효율적인 시험관 내 모델의 설립, 지질 축적의 정량화 및 특성화에 대한 정확한 방법과 함께, 통해 NAFLD의 조기 진단의 개발로 이어질 수 분자 마커의 식별, 새로운 치료 전략의 생성에.

Introduction

간 지방 증은 간 지방 축적으로 정의 됩니다., 트리 글리세라이드 를 포함 하는 지질 방울 내에서, 적어도의 5% 간 무게의. 장기간 된 간 지질 저장은 잠재적으로 가역적인 과정, 그러나, 그것은 간 대사 기능 장애로 이어질 수 있습니다., 염증 및 비 알코올 지방 간 질환의 고급 형태 (NAFLD), 많은 부분에서 만성 간 질환의 주요 원인 세계1,2. NAFLD는 더 공격적인 비알코올성 지방간염(NASH)으로 진화할 수 있는 다인성 질환으로, 이는 차례로 간경변으로 진행될 수 있고, 환자의 작은 비율로, 간세포암종(HCC)1,3. 아니 승인 된 치료는 NAFLD에 대한 특정 치료로 현재 사용할 수 있으며 식이 요법과 라이프스타일 수정의 조합은 NAFLD 및 NASH 관리의 기둥 남아 4,5,6.

NAFLD의 병인에서 간 지방증의 발달로 이어지는 분자 메커니즘은 여전히 해명 될 남아7. 이러한 맥락에서, 마우스 모델은 인간 steatosis 질병 진행을 연구하기 위해 개발되었다. 다른 모형의 무수한 존재하고, 각각은 다른 접근을 결합하는 유전, 영양 및 화학적으로 유도한 모형을 포함하여 그것의 장단점이 있습니다. 유전자 변형 (형질 전환 또는 녹아웃) 마우스는 자발적으로 간 질환을 개발합니다. 그러나, 이러한 돌연변이는 인간에서 매우 드물며 단일 유전자(예를 들어, ob/ob 마우스)의 삭제 또는 과발현은 분자 수준8,9에서다인성 인간 질환의 병인을 모방하지 않을 수 있다는 점에 유의해야 한다. 마찬가지로, 식이 요법 이나 약리학 조작 후 쥐에 의해 취득 된 질병은 남자 8에서NAFLD의 발달과 관련된 인간의 식단의 효과를 모방하지 않을 수 있습니다. 동물 모형은, 그러나, NAFLD의 이해에 있는 발달을 촉진하고 이 접근은 현재 실험실 연구에서 가장 빈번히 이용되는 전략입니다. 그럼에도 불구하고, 동물 모델에서 얻은 결과의 인간에서의 복제는 반복적으로 실패하여, 클리닉(10)으로의 번역이 불량하게 되었다.

따라서, NAFLD의 시험관내 모델은 NAFLD 진행의 분자 메커니즘을 해명시키는 데 근본적인 역할을 할 수 있으며, 이들은 많은 수의 화합물을 스크리크하는 귀중한 도구를 나타낸다. 1 차적인 세포 배양, 불멸의 세포주 및 간 생검은 연구 목적을 위해 광범위하게 이용되었습니다11. 1 차적인 인간 간세포는 밀접하게 인간 임상 조건과 유사합니다, 그러나 기증자의 한정된 수가 있고, 1 차적인 세포 배양은 세포의 가변성 때문에 나쁜 재현성을 보여줍니다. 이러한 관찰, 윤리적 및 물류 문제와 함께, 인간의 기본 간세포의 사용은 제한되는 결과12. 따라서, 간 세포주들은 간 세포주들이 꾸준히 성장함에 따라 1차 배양에 비해 몇 가지 필수적인 장점을 가지며, 거의 무제한의 수명을 가지며, 안정적인 표현형을 가지는 편리한 대안을 나타낸다. 더욱이, 세포주 쉽게 접근할 수 있고 간 세포주 배양 조건은 1 차적인 간세포의 그것 보다는 더 간단하고 다른 실험실 중 표준화됩니다.

여기서, 우리는 지방산 나트륨 올레아테로 처리된 간 분화 HepaRG 세포로 대표되는 간 베아실 지방증의 체외 세포 기반 모델을 상세히 기술한다. HepaRG 세포주C형 간염 감염및 에드먼드슨 급I의 잘 분화된 간종양(14)에 의해 영향을 받는 여성 환자로부터 확립되었다. HepaRG 세포주 2% 디메틸 설폭사이드 (DMSO)에 노출시 분화 할 수있는 인간 이중 성 전구 세포주 두 개의 상이한 세포 표현형: 담즙 같은 및 간세포 유사 세포. 분화된 HepaRG 세포(dHepaRG)는 성인 간세포와 몇 가지 특징과 특성을 공유하고 알부민, 알돌라세비, 시토크롬 P450 2E1(CYP2E1) 및 시토크롬 P450 3A4(CYP3A4) 13과 같은 간 특이적 유전자를 안정적으로 발현할 수 있는 능력을 가지고 있습니다. (3단계)를 참조하십시오. 지방산 염나트륨 올레아테(250 μM)를 5일간 사용하여 dHepaRG 세포를 치료하면 세포질 지질 방울의 생성으로 이어지며, 지방간14,15,17,18의 효과를 모방한 것이다. 4단계). 지질 방울의 축적은 오일 레드 O 염색에 의해 쉽게 검출 될 수있다 (단계 5), 중성 트리글리세라이드와 지질 적색 오렌지를 얼룩 리소크롬 지방 수용성 염료. 지방 dHepaRG에서 지질을 효율적으로 정량화하기 위해, 여기에서 우리는 4,4-디플루오로-1,3,5,7-tetramethyl-4-보라-3a,4a-디아자-s-indacene (보디피 505/515)(단계 6), 립성 프로브로 염색 한 후 세포 불용형 분석을 보여줍니다. 세포 내 지질 체및 지질 방울 라벨에 사용 되었습니다19. 더욱이, 여기서 우리는 dHepaRG 세포에서 여러 대사 유전자의 정량적 중합효소 연쇄 반응(qPCR) (단계 7) 유전자 발현 완화에 의해 세포증을 평가하는 방법을 보여준다. 올레아테 나트륨 처리 후 지질 방울의 축적을 더욱 특성화하고 정량화하기 위해, 우리는 일관된 안티 스토크스 라만 산란 (CARS) 현미경 검사법 (단계 8)을 수행, 시각화 및 정량화를 가능하게하는 혁신적인 기술 20,21.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. 문화매체 및 시약준비

  1. 증식 배지: 글루타맥스, 10% 태아 소 혈청(FBS), 1% 페니실린/스트렙토마이신, 5 μg/mL 인슐린, 0.5 μM 하이드로코르티손 헤미쿠시네이트를 보충하세요.
  2. 분화 매체: 글루타맥스, 10% FBS, 1% 페니실린/스트렙토미신, 5 μg/mL 인슐린, 50 μM 하이드로코르티손 헤미쿠시네이트 및 2% DMSO를 보충합니다.
  3. 동결 매체: 10% DMSO로 증식 배지를 보충합니다.
  4. 올레아테 나트륨: 100 mM 농도에서 99% 메탄올에 용해하고, O/N을 저어서 -20°C에서 보관하십시오.
  5. 오일 레드 O : 재고 솔루션을 준비합니다. 오일 레드 O 0.35 g의 무게와 이소프로판올 100 mL에 용해. O/N, 필터(0.2 μm)를 저어서 RT에 보관하십시오. 실온(RT)에 20분 동안 앉은 다음 0.2 μm 필터로 걸입니다. 적절한 여과는 배경을 피하기 위해 성공적인 염색을 위해 적극 권장됩니다.
  6. Bodipy (505/515): 100 μM 재고 농도에서 DMSO에 Bodipy (505/515) 염료를 용해하고, 어둠 속에서 -20 °C에 보관하고, 최종 100 nM 농도에서 사용하십시오.
  7. CARS 실험을 위해 투명 유리 바닥 접시를 획득하십시오.

2. 해동, 증폭 및 HepaRG 세포의 동결 보존

  1. 해동질소를 동결보존된 HepaRG 세포를 해동될 때까지 37°C 의 배스에서 배치를 침지하여. 낮은 통로 배치(<20)를 선택합니다. HepaRG 세포는 시판되고 있다.
  2. 세포를 5분 동안 증식 배지 및 원심분리기 10 mL을 함유하는 15 mL 튜브로 빠르게 전달합니다(200 x g, 4°C).
  3. 상급체를 버리고 증식 배지의 5 mL로 세포를 다시 일시 중단하십시오.
  4. 세포를 계산하고 2.5 x 104 세포 /cm2플레이트하기 위해 희석하십시오.
  5. 매 2 또는 3 일마다 매체를 갱신하십시오. 세포는 약 24 시간의 두 배로 증식합니다.
  6. 트립신 용액0.05%로 3-5분 배양에 의한 80% 수렴시 헤파RG 세포를 분리한다. 5 분 (200 x g, 4 °C)에 대한 증식 배지 및 원심 분리기에서 세포를 수집합니다.
  7. 상급체를 버리고 증식 배지의 5 mL로 세포를 다시 일시 중단하십시오.
  8. 세포를 계산하고 2.5 x 104 세포 /cm2플레이트하기 위해 희석하십시오.
  9. 이 단계에서, 2.5-2.8 단계를 반복하여 세포를 증폭시켜 적절한 수의 세포에 도달하여 실험을 시작하거나 2.10단계에서와 같이 냉동 보존한다.
  10. HepaRG 세포를 냉동 보존하기 위해, 트립신 용액 0.05%로 3-5 분 배양하여 도금 한 후 세포를 24 시간 분리하십시오. 5 분 (200 x g, 4 °C)에 대한 증식 배지 및 원심 분리기에서 세포를 수집합니다. 상한을 버리고, 동결 매체의 1 mL / 배치, 1.5 x 106 세포 / 배치로 세포를 다시 중단하고 액체 질소로 배치를 냉동 보존하십시오.

3. 헤파RG 세포의 분화 (일 0-21) (그림1A)

  1. 일 0. 종자 HepaRG 세포를 저밀도(2.5 x 104 세포/cm2)로 배양처리된 접시에 적절한 부피가 있는 증식 배지(도1B). 각 분석(오일 레드 O 염색, FACS 분석, qPCR)에 대해 두 가지 접시를 도금해야 합니다: 대조군 세포와 올레에이트 처리 된 세포에 대해 하나. CARS 측정을 수행하는 경우 (8 단계), 투명 유리 바닥 접시에 병렬로 세포를 씨앗. 대조군으로서, 분화 마커 유전자의 유전자 발현 분석을 수행하기 위해 처리되지 않은 접시 1개(증식 세포 0)를 수확한다(단계 3.6 참조).
  2. 2일차와 4일차. 적절한 부피의 증식 배지로 배지를 변경하고 세포가 합류 할 때까지 성장하게하십시오.
  3. 7일차. 셀은 100% 동조여야 합니다(그림1C). 1x 인산완충식염수린(PBS)으로 세포를 한 번 세척합니다. 1x PBS를 제거하고 적절한 분화 매체 볼륨을 추가합니다.
  4. 8일, 9일, 12일, 15일, 18일.  1x PBS로 세포를 한 번 씻으소서. 1x PBS를 제거하고 적절한 분화 매체 볼륨을 추가합니다.
  5. 21일째. 현미경으로 HepaRG 세포를 관찰하고 세포가 분화 배양체가 결합되어 있는지 확인합니다(그림1D).
  6. 대조군으로서, 1개의 대조군 접시(분화세포일21)를 수확하여 분화 마커 유전자의 유전자 발현 분석(step 7)을 수행한다(도1E).
  7. 21일째에, 분화된 HepaRG 세포는 액체 질소에서 냉동 보존될 수 있습니다.

4. 수혈선증 유도 (21-26일차)

  1. 21일째. 나트륨 올레아테(100 mM)를 250 μM(1:400)의 최종 농도로 완전한 분화 배지의 적절한 부피로 희석한다. 99% 메탄올 1:400(올레아테 나트륨과 동일한 부피)을 분화 배지의 또 다른 aliquot에 첨가하여 차량 제어 처리를 합니다. (예를 들어: 25 μL의 나트륨 올레아테를 배지 의 10 mL에 추가하고 병렬로 99 % 메탄올의 25 μL을 중간 10 mL에 추가하십시오). 세포를 1x PBS로 한 번 씻고 비히클 또는 나트륨 올레에이트 배지를 추가하십시오.
  2. 23일째와 25일째. 4.1단계에서와 같이 갓 준비한 배지의 적절한 부피로 배지를 변경합니다.
  3. 26일째. 광학 현미경으로 관찰하는 지질 방울은 나트륨 올레아테 처리 세포에 축적되고 그림 2A에서와 같이 세포질에서 반투명 방울로 쉽게 볼 수 있습니다.

5. 지질 과부하 및 스테토증 유도평가: 오일 레드 O 스테인링

  1. 1x PBS로 세포를 한 번 씻고 1x PBS를 완전히 제거하십시오.
  2. 4% 파라포름데히드(1x PBS로 희석)를 넣고 RT에서 15분 동안 배양합니다.
    주의 사항: 파라 포름 알데히드는 독성이 있으므로이 단계는 장갑, 실험실 코트 및 마스크를 포함한 보호 장비가있는 연기 후드에서 수행해야합니다.
  3. 파라포름알데히드를 제거하고 1x PBS로 세포를 두 번 씻으하십시오. 세포는 염색하기 전에 며칠 동안 4°C에서 1x PBS로 보관될 수 있다. 파라필름으로 감싸고 알루미늄 호일로 덮어 세포가 건조되는 것을 방지합니다.
  4. PBS를 1x 제거합니다. RT에서 5 분 동안 60 % 이소 프로판올로 세포를 배양하십시오.
  5. 이소프로판올을 제거하고 RT에서 세포를 완전히 건조시키십시오.
  6. 오일 레드 O 작업 용액을 추가하고 RT에서 30 분 동안 배양하십시오. 각 샘플에 필요한 작업 용액의 부피는 셀 배양에 사용되는 미디어의 부피에 해당합니다.
  7. 오일 레드 O 용액을 제거하고 즉시 ddH2O를추가하십시오.
  8. 분석을 위해 현미경으로 이미지를수집합니다(그림 2B).
  9. 오일 레드 O 염료를 용해하려면 : 모든 물을 제거하고 건조 할 수 있도록; 100% 이소프로판올 1mL를 넣고 RT에서 부드럽게 흔들면서 10분 동안 배양합니다.
  10. 용출 오일 레드 O 염료와 이소 프로판올을 여러 번 파이펫, 모든 오일 레드 O가 용액에 있는지 확인. 솔루션을 큐벳으로 옮김으로 옮김을 옮김으로 옮김. 분광광도법에 의해 OD500 nm을 측정하고 100% 이소프로판올을 공백으로 사용합니다(그림2C).

6. 지질 과부하 및 스테토증 유도 평가: 보디피 염색 및 세포불소화분석

  1. 1x PBS로 세포를 한 번 씻으소서. 보디피 100 nM을 배양하여 37°C에서 40분 동안 어둠 속에서 1x PBS로 희석하였다. 유세포분석측정에 스테인드되지 않은 제어가 포함되어야 합니다. 이 시점에서 가능한 한 빛으로부터 샘플을 보호하십시오.
    참고: 각 샘플에 필요한 염색 용액의 부피는 세포 배양에 사용되는 매체의 부피에 해당합니다.
  2. 염색 용액을 제거하고 1x PBS로 세포를 한 번 씻으하십시오. 6.3-6.6 단계로 진행합니다. FACS (형광 활성화 세포 선별) 분석 또는 현미경 이미징을위한 6.7 단계.
  3. 1x PBS로 세포를 부드럽게 긁어 내고 15 mL 튜브로 옮김하십시오. 10 분 동안 원심 분리기 (200 x g, 4 °C).
  4. 펠릿을 방해하지 않고 부드럽게 수퍼나이트를 제거하고 1x PBS 의 3 mL로 씻으십시오. 5 분 동안 원심 분리기 (200 x g, 4 °C).
  5. 상피제를 제거하고 1x PBS의 300 μL에서 다시 중단한 다음 FACS 튜브로 옮김을 옮김을 제거합니다.
  6. 505/515 nm의 여기/방출 파장을 가진 세포 불형 분석으로 보디피 형광 강도를 즉시 측정합니다(그림3A,B).
  7. 1x PBS로 세포를 한 번 씻고 PBS를 완전히 제거하십시오.
  8. 4% 파라포름데히드(1x PBS로 희석)를 넣고 RT에서 15분 동안 배양합니다.
    주의 사항: 파라 포름 알데히드는 독성이 있으므로이 단계는 장갑, 실험실 코트 및 마스크를 포함한 보호 장비가있는 연기 후드에서 수행해야합니다.
  9. 파라포름알데히드를 제거하고 샘플을 PBS에서 5분 동안 3x 세척합니다. 세포는 4°C에서 1x PBS로 유지되거나 즉시 이미지화될 수 있다(도3C). 보관을 위해 파라필름으로 감싸고 알루미늄 호일로 덮어 세포가 건조되는 것을 방지하십시오.

7. 지질 과부하 및 steatosis 유도의 평가: qPCR

  1. 1x PBS로 세포를 한 번 씻으소서. 1 x PBS로 세포를 긁어 내고 200 x g의 원심 분리기를 제거하고 상한체를 버립니다. 이 단계에서, 세포는 -80°C에서 수확되거나 7.2단계에서와 같이 처리될 수 있다.
  2. 제조업체의 지침에 따라 상용 시약을 사용하여 표준 방법으로 총 RNA 격리를 수행합니다.
  3. UV 분광광도 측정을 통해 RNA 농도를 평가하여 A260/A280 판독값을 기준으로 RNA 순도가 2.0에 가깝도록 합니다.
  4. 표준 cDNA 합성 키트로 총 RNA 의 1 μg에서 cDNA를 합성합니다.
  5. CDNA를 H 2O로 최종 50 μL 부피에 희석한다.
  6. qPCR에 의해 삼중으로 각 cDNA 샘플을 분석: 대조군으로 3개의 하우스키핑 유전자에 특정한 프라이머를 포함하여 각 프라이머에 필요한 반응에 충분한 하나의 qPCR 마스터 믹스(표 1)를 준비합니다: gliceraldeide-3-fosfato deidrogenasi (GAPDH), 액틴B 및 리보소말 18S (프라이머 서열에 대한 재료 표 참조):
  7. PCR 멀티월 플레이트에서 잘 당 마스터 믹스 18 μL을 분배합니다.
  8. 각 우물에 2 μL의 cDNA 샘플을 추가합니다. 접시를 밀봉합니다.
  9. 열 주기 명령에 따라 샘플을 실행합니다.

8. 지질 과부하 및 steatosis 유도의 평가: CARS

  1. 5.1-5.3 단계에 설명된 대로 유리 바닥 접시에 이전에 준비된 세포를 수정합니다.
  2. 상용 튜닝 가능한 피코초 펄스 레이저 시스템을 켜서 튜닝하여 서로 다른 파장의 두 출력을 얻습니다. 출력 사이의 주파수 차이는 메틸렌 대칭 스트레칭에 해당하는 강렬한 CARS 광 신호를 생성하기 위해 2,840 cm -1이어야합니다. 1,064 nm ("스토크스"빛)에서 고정 파장 출력의 경우, 다른 파장은 817 nm ("펌프"빛)로 조정되어야한다.
  3. 817 nm 출력이 공간적으로 그리고 시간적으로 1,064 nm 출력과 중첩되도록: 빔을 공간적으로 결합하고 광학 지연 선을 사용하여 레이저의 시간적 중첩을 얻기 위해 적절한 이색 거울 (즉, 817과 1,064 nm 사이의 절단)을 사용합니다. 펄스.
  4. 두 개의 코프로그화 빔이 모두 시준되고 직경이 현미경 내의 광학 시스템에 적합한 유사한 값을 가지고 있는지 확인하십시오. 필요한 경우 빔을 결합하는 이색 거울 앞에 빔을 별도로 충돌시게 합니다.
  5. 적외선 레이저 스캐닝 장치와 듀얼 채널 적색/녹색 에피 검출 유닛을 포함해야 하는 상업용 반전 현미경 시스템을 켜고 코프로그레이저 빔을 스캐닝 유닛에 정렬합니다.
  6. 듀얼 채널 에피 감지 장치를 열고 필터 큐브를 제거하고 적색 파장 감지 필터를 817/1,064 nm 펌프/스토크스 여기의 경우 663nm에 중심이 되는 2,840cm-1 CARS 신호를 선택할 수 있는 밴드패스 필터로 교체합니다. 구성표. 높은 수준의 형광 배경 신호의 수집을 피하기 위해 좁은 대역폭(20nm) 필터가 선호됩니다.
  7. 거꾸로 된 CARS 현미경의 무대에 접시를 놓고, 100x 오일 침지 목표를 사용하여, 세포에 초점을 맞추기 위해 목표의 수직 위치를 이동.
  8. 127 μm x 127 μm에 걸친 시야에 걸쳐 고해상도(1024 x 1024 픽셀) 이미지를 수집하도록 현미경 소프트웨어를 설정합니다.
  9. 현미경 소프트웨어를 설정하여 127 μm x 127 μm 시야의 이미지를 지속적으로 수집하고 표시하고 이미지 수집 매개 변수를 최적화하는 동안 표시된 이미지를 확인합니다. 레이저 파워가 빠른 이미지 수집과 최소한의 손상을 위해 균형을 이루고 필요에 따라 빔 경로에 적절한 중성 밀도 필터를 삽입하고 신호 대 노이즈가 좋은 이미지 수집을 허용하는 픽셀 거주 시간을 선택하십시오. 선택한 레이저 전력 조건하에서 비율을 조절할 수 있습니다.
  10. 최적화된 조건에서 접시 내에서 여러 가지 시야의 이미지를 획득하고 저장합니다. 선택적으로, 녹색 파장 방출에 의해 생성된 다광자 형광 이미지(주로 817 nm에서 2광자 여기로부터), 다른 에피 검출기를 통해 동시에 수집될 수 있다. 각 요리에 대해 8.7-8.10단계를 반복합니다.
  11. CARS 이미지 분석의 경우 ImageJ의 FIJI 구현을 사용하여 이미지를 처리합니다. 추가 분석을 하기 전에 각 이미지에서 Despeckle 기능(또는 이와 유사한 데노이즈 제거 도구)을 작동하여 세부 사항 손실 없이 신호 대 잡음 비율을 개선합니다.
  12. FIJI를 사용하여 수동으로 세포를 선택한 다음 분할된 개별 세포 내에서 지질 방울을 자동으로 계산하여 각 세포와 각 접시에 대한 전체 이미지 데이터 집합에 대한 지질 방울 영역 및 숫자에 대한 통계를 생성합니다.

9. MTT 세포 생존 분석

  1. 플레이트는 분화 배양 배지의 최종 100 μL 부피에서 1 x 105 세포/웰의 밀도를 가진 96웰 플레이트로 HepaRG 세포를 분화하였다.
  2. 24 시간 파종 후, 세포를 99 % 메탄올 (비히클)으로 처리하고 100 μM, 250 μM 및 500 μM 나트륨 올레아테 및 나트륨 팔미테를 100 μL에서 희석하여 분화 배양 배지 / 잘 삼중 으로 희석하였다.
  3. 매 24시간마다 100 μL에서 희석된 99% 메탄올및 100 μM, 250 μM 및 500 μM 나트륨 올레에이트 및 나트륨 팔미테로 배지를 변경합니다.
  4. 96 시간 메탄올/나트륨 올레아테/나트륨 팔미테 처리 후, 100 μL의 분화 배양 배지/잘 에서 희석된 2 μM 독소루비신으로 세포를 대조군으로 치료한다.
  5. 18 시간 독소루부신 처리 후, 분화 배양 배지의 100 μL로 배지를 변경한다.
  6. 파이펫 20 μL 의 3-(4,5-디메틸티아졸-2-yl)-5-(3-카르복시메톡시페닐)-2-2-2H-테트라졸륨 시약 MTT(재료표)의 각각의 웰내로 100μil의 세포를 함유하는 도포시플레이트 . 삼중배분 배양 배지의 100 μL에서 세포없이 시약의 20 μL을 잘 대조군으로 파이펫팅하여 배경 제어를 포함한다.
  7. 가습, 5% CO2 분위기에서 37°C에서 플레이트를 배양한다.
  8. MTT 테트라졸륨 시약으로 30, 60 및 90분 동안 인큐베이션한 후, 96웰 플레이트 리더를 사용하여 490 nm에서 흡광도를 기록하였다. 다른 샘플에 대한 흡광도 값에서 셀 없음 제어 웰의 배경 흡광도를 뺍니다.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

이 프로토콜은 나트륨 올레아테 처리에 의해 DMSO 분화 된 헤파RG 세포에서 소포 골수를 유도하고 특성화하는 효율적인 방법을 설명합니다 (도1A).

HepaRG 세포의 분화.
효율적으로 분화를 유도하기 위해 증식 세포는 증식 배지에서 저밀도(2.5 x 104 세포/cm2)로 시드되어야 합니다. 낮은 밀도에서 시드 할 때, 세포는 적극적으로 분할하고 가늘게 미분화 형태를 취득 (그림1B). 세포는 100% 동급에 도달할 때까지 7일 동안 증식 배지에서 성장하도록 방치되어야 한다(도1C). 2% DMSO에 노출된 후, 세포는 담즙 상피 유사 세포로 둘러싸인 전형적인 간세포 유사 콜로니를 분화하고 형성하기 시작한다(도1D). 분화된 HepaRG 세포는 알부민, Cyp3A4 및 알돌라제 B와 같은 간토 특이적 마커를 발현한다. 적절한 분화를 확인하기 위해, 분화된 세포(21일째)와 증식 세포에서 이들 간 마커 유전자의 발현 수준을 qPCR(도1E)으로 분석하였다. 알부민, Cyp3A4 및 알돌라제 B 유전자는 증식하는 HepaRG 세포에 비해 분화 된 HepaRG 세포에서 업 조절되어야하며, 우리는 이러한 추세를 관찰하여 분화 프로토콜의 효과를 확인합니다.

나트륨 올레아테 처리에 의한 HepaRG 세포에서 의한 혈관 성 증의 유도.
dHepaRG 세포의 나트륨 올레아테 처리는 지방 축적을 유도하고, 세포질에서 지질 방울로서 광학 현미경 하에서 볼 수 있다(도2A). 스테토시스의 효율적인 유도를 확인하기 위해, 올레에이트 처리 및 대조군 HepaRG 세포를 오일 레드 O 염료로 염색하였다. 염색 후, 지질 방울은 적색 방울로 쉽게 볼 수 있으며 (도2B) 이소프로판올로 용출된 오일 레드 O 염료의 분광광도 측정에 의해 정량화될 수 있다(도2C). 세포로부터용유붉은O의 흡광도는 세포질 지질 방울 축적에 정비례한다.

나트륨 올레아테 농도 및 노출 시간은 MTT 배색 세포 생존성 분석법(단계 9)에 의해 결정되었다. 나트륨 올레아테 처리는 나트륨 팔미테 처리및 사멸약물 독소루부신(2 μM)과 비교하여 대조군으로 사용하였다(도2D). 화합물의 세포독성은 MTT 테트라졸륨을 함유하는 상업적 화합물(물자표)을이용하여 MTT에 의해 평가되었다. 수용성 황색 MTT 테트라졸륨 화합물은 대사활성 세포에 의해 보라색 불용성 포르마잔 생성물로 생체저감된다. 포르마잔 생성물은 490 nm에서의 흡광도에 의해 정량화되고 양은 배양내의 살아있는 세포의 수에 정비례한다(도2D).

올레아테 처리 된 HepaRG 세포에서 혈우병 증세의 정량화
올레아테 나트륨 처리 후 세포 지질 함량의 증가를 정량화하기 위해 지질 방울을 표시하는 프로브인 Bodipy dye로 염색을 수행했습니다. 세포불루명 분석을 사용하여, 대조군 세포에 비해 올레산염 처리 된 세포에서 더 높은 Bodipy 평균 형광 강도에 의해 트리글리세라이드 함량을 정량화 할 수있다 (그림3A,B), 효율적인 지방을 나타내는 올레에이트 치료 후 축적. 실제로, Bodipy 염색된 세포의 이미지는 대조군 처리 된 세포에서 밝은 녹색 형광 지질 방울을 나타내며 대조군 세포에서 보이지 않는 것을 보여줍니다 (도3C).

dHepaRG 세포의 나트륨 올레아테 치료는 지질 대사 및 염증성 유전자 발현을 조절한다. 혈관성 골수의 효율적인 유도를 평가하기 위해, 대조군 세포와 비교하여 나트륨 올레아테 처리 된 세포에서 선택된 유전자의발현 수준을 qPCR로 분석하였다(도 4). 아세틸-코아 카르복실라제 베타(ACACB), 글리세롤-3-포스페이트 아실트랜스퍼라제 미토콘드리아(GPAM), 페리핀(PLIN2, PLIN4), 아폴리포프로틴 B(APOB), 피루바테 탈수소효소 이소지메 4(PDK4), 카르니틴 팔미토틸트랜스파스(1) 인터류키친 6(IL6)은 올레아테 처리된 dHepaRG 세포에서 업게이지되었고, 반면 용질 캐리어 패밀리 2 부재 1(SLC2A1), 아포리포프로테인 C-III(APOC3), 스테아로일-코아 데사투라제(SCD)는 하향 조절되었다(도 4). 분화된 HepaRG 세포에 올레아나트륨을 첨가하여 액적의 지질 저장을 특성화하고 정량화하기 위해 혁신적인 현미경 검사법 인 일관된 안티 스토크스 라만 산란 (CARS) 현미경 검사법을 활용했습니다. 라벨없이 지질 방울의 시각화 및 정량화 (그림5A). 지질 방울은 CARS 이미지를 사용하여 단일 세포 수준에서 숫자, 분포 및 형태학의 관점에서 통계적으로 정량화되었다. 나트륨 올레아테 (250 μM)를 가진 처리는 지질 방울의 수에 있는 유의한 증가를 유도했습니다 (그림5B), 이는 세포 당 더 높은 총 액적 지역 (그림5C) 및 세포 당 더 높은 백분율 액적 영역을 주도한 ( ) 도 5D)대조군 세포와 비교하여, dHepaRG 세포가 나트륨 올레아테 처리 후 효율적으로 지방을 축적했음을 나타낸다.

Figure 1
그림 1 : 헤파RG 세포의 분화. (a) 단계 3 및 4에 기재된 바와 같이 HepaRG 세포 분화/치료 프로토콜을 나타내는 대표적인 도면. (B-D) 시드 후 0일째에 헤파RG 세포를 증식시키는 얼룩이없는 것을 보여주는 이미지(B), 합류일 7일째에 시드(C) 및 분화된 헤파RG(dhepaRG)를 시종 후 21일째에 (D)하였다. (e) 총 RNA는 증식 및 dHepaRG 세포로부터 추출하였고, cDNA는 지시된 유전자에 특이적인 프라이머를 사용하여 qPCR에 의해 합성 및 분석하였다(표물질). 샘플을 GAPDH, 액틴B 및 리보소말 18S 하우스키핑 유전자의 평균으로 정규화하였다. 히스토그램은 증식의 배 유도를 보여줍니다 (일 0) 대 분화 세포 (일 21) (막대는 S.D.를 나타냅니다. p-값은 학생의 t-시험에 의해 계산되었다). 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

Figure 2
그림 2 : dHepaRG 세포의 나트륨 올레아테 처리는 지질 방울 축적을 유도합니다. (A) 비염색 된 분화 된 HepaRG (dHepaRG) 세포의 이미지는 차량 (제어) (왼쪽 이미지) 또는 250 μM 나트륨 올레에이트 (오른쪽 이미지)로 5 일 동안 처리되었습니다. (b) 처리 후, 세포를 오일 레드 O 염료로 염색하였다; 지질 방울은 빨간색으로 표시됩니다. (C) 오일 레드 O 염료를 용출하고 OD를 570 nm에서 측정하였다. 결과는 세 가지 독립적 인 실험의 수단으로 표현됩니다 (막대는 학생의 t-시험에 의한 S.D.; p-값을 나타냅니다). (D) dHepaRG 세포 비히클(99% 메탄올)의 세포 생존성 평가(Ctrl) 또는 나트륨 올레아테 및 나트륨 팔미테(100 μM, 250 μM 또는 500 μM)로 5일 동안 처리하거나, 또는 독소루부신(2 μM)으로 18시간 처리하였다.  세포 독성의 평가는 MTT 분석 키트(재료의표)를 사용하여 수행되었다, 490 nm에서 흡수를 기록, 제조 업체의 지시에 따라. 결과는 세 가지 독립적 인 실험의 수단으로 표현된다 (막대는 S.D.를 나타냅니다. p-값은 학생의 t 테스트를 사용하여 결정되었다: *0.01 ≤ p & 0.05; **0.001 ≤ p < 0.01; ***p < 0.001). 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

Figure 3
그림 3 : 보디피 염색에 의한 올레아테 나트륨 처리 후 지방 축적정량화. 분화된 헤파RG(dHepaRG) 세포를 비히클(대조군) 또는 250-μM 나트륨 올레아테로 5일 동안 처리하였다. 처리 후, dHepaRG 세포를 보디피 염료로 염색하고 유세포분석방식으로 분석하였다. (A) 대표 오버레이 프로파일(최대 백분율: 최대 염색 강도백분율). (B) 히스토그램은 세 개의 독립적 인 실험에서 제어를 통해 처리 된 세포의 백분율로 평균 형광 강도 (MFI)를 보여줍니다 (막대는 S.D.를 나타냅니다. p-값은 학생의 t 테스트를 사용하여 결정되었습니다: *0.01 ≤ p & 0.05; **0.001 p & 0.01; ≤p & 0.01; ***p lt. 0.001). (C) 세포를 4% 파라포름알데히드로 고정하였다. 이미지는 보디피 스테인드 지질 방울을 녹색으로 보여줍니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

Figure 4
그림 4 : dHepaRG 세포의 나트륨 올레아테 치료는 지질 대사 및 염증성 유전자 발현의 조절을 유도합니다. 분화된 헤파RG(dHepaRG) 세포를 비히클(대조군) 또는 250-μM 나트륨 올레아테로 5일 동안 처리하였다. cDNAs는 표시된 유전자에 특이적인 프라이머를 사용하여 qPCR에 의해 분석되었고 결과는 GAPDH, 액틴B 및 리보좀 18S 하우스키핑 유전자의 평균으로 정규화되었다; 프라이머는 재료표에 제공됩니다. 히스토그램은 대조군을 통해 처리된 세포의 배 유도로 표시된 유전자의 발현 수준을 보여줍니다 (막대는 S.D.를 표시합니다; p-값은 학생의 t 시험에 의해 계산되었습니다). 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

Figure 5
그림 5 : CARS 현미경으로 나트륨 올레아테 처리 후 지질 방울 축적특성화. 분화된 헤파RG(dHepaRG) 세포를 5일 동안 비히클(대조군) 또는 250 μM 나트륨 올레아테로 처리하고 CARS 현미경으로 분석하였다. (A) 지질 방울 CARS가 빨간색으로 대비를 이루는 대표적인 이미지. (B) 세포 당 지질 방울의 수를 보여주는 히스토그램. (C) 세포당 액적으로 덮인 총 이미지 영역을 보여주는 히스토그램. (D) 히스토그램은 세포당 액적으로 덮인 액적 면적 %를 나타낸다. 모든 결과는 세 가지 독립적 인 실험의 수단으로 표현됩니다 (막대는 S.E.; p-값을 학생의 t 검정에 의해 결정되었습니다 : * 0.01 ≤ p & 0.05; **0.001 ≤ p < 0.01; ***p < 0.001). 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

시약 단일 반응에 대한 부피(μL)
2x SYBR 녹색 형광 염료 10개
PCR 등급 H2O 6개
전달 프라이머(μM) 1개
역프라이머(μM) 1개

표 1: qPCR 마스터 믹스.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

이 프로토콜은 HepaRG 세포를 분화하는 방법과 올레아테나트륨 처리에 의한 포수체 증시를 유도하는 방법을 설명한다(도1A). 실제로, 다른 인간 간세포암(HCC) 세포주와 비교하여, 헤파RG 세포주들은 성인 인간 간세포의 특징을 나타내며, 생체내 배양 된 1차 인간 간세포에 대한 귀중한 대안을 나타내는13,14 ,15. HepaRG 세포주 들은 간 세포 독성 연구, 약물 대사 및 바이러스학 연구15,16,22에널리 사용되어 왔다.

HepaRG 세포와 비교하여, HepG2, HUH7, HUH6 및 Hep3B와 같은 다른 HCC 세포주는 더 낮은 대사 능력을 나타내며, 간 특이적 기능의 실질적인 세트가 결여된23,24,및 더 높은 기저 수준을 나타내고 있다. 지질 방울에 저장된 시토 솔 지방 축적. 따라서, 이러한 HCC 세포주들은 HepaRG 세포주보다 지질 과부하 후 수혈골증의 유도를 위한 모델로서 덜 유용하다.

프로토콜 내의 중요한 단계
저밀도 (2.5 x 104 세포/ cm2)에서 파종 하면, HepaRG 세포는 가늘고 긴 미분화 형태를 획득하여 적극적으로 분할; 100% confluency에 도달한 후에, 그(것)들은 2% DMSO에 노출시 분화할 수 있고 담즙 상피 같이 세포에 의해 포위된 전형적인 간세포 같이 식민지를 형성합니다 (그림1D). 이 혼합 된 담즙 / 간세포 세포 배양은 다른 간 세포 유형 (시노 오이드 또는 Kupffer)이 결여되어 있음에도 불구하고 생리적 상태를 닮은 간 조직의 특징을 재량화합니다.

분화 과정에서 중요한 단계는 세포의 합류입니다. 세포는 저밀도(2.5 x 104 세포/cm2)에서 시드되어야 하며(도1B)적어도 1주일 동안 증식 배지에서 활발히 성장하도록 허용한다(일 0-7). 7일째에, 분화 과정을 시작하기 위해 2% DMSO를 첨가하기 전에, 세포는 100% 합류(도1C)에 있어야 한다. 7일째(2.2단계)에서 완전한 합류에 도달하지 못한 경우, 100% 합류가 달성될 때까지 세포가 증식 배지에서 계속 성장하는 것을 허용하는 것이 좋습니다.

프로토콜의 제한 사항
분화 배지를 첨가한 후, 일부 세포는 고통을 겪고, 전형적으로 세포의 10%가 후속 2-3일 동안 죽는다는 것이 관찰되었다. 이 단계에서, 매일 세척 및 중간 변화 (단계 2.4)는 부동 죽은 세포를 폐기하기 위해 계속해야합니다. 분화 및 증식매체를 모두 보충하기 위해 특정 FBS(재료표)의 사용은, 7-21일 동안 분화 효율및 낮은 세포 사멸을 증가시켜야 한다(단계 2.4). 그것은 매우 통로 까지 세포를 유지 하는 것이 좋습니다 20, 그리고 낮은 통로를 선택 하 (&20) 세포를 분화에 대 한: 적은 세포 죽음 은 막내 HepaRG 세포에 대 한 발생. 또한, HepaRG 분화는 35mm와 60mm 요리에서 더 효과적인 것으로 보이지만 세포는 100mm 및 150mm 접시에 씨를 뿌릴 때 더 많은 고통을 겪는 경향이 있습니다.

수정 및 문제 해결
팔미트및 올레산 지방산의 상이한 비율에 대한 노출은 인트라투플라즈마 지질 방울의 형성을 초래하는 것으로 나타났다25,26. 그러나, 우리는 나트륨 Oleate 처리가 지질 축적 및 세포 생존의 능률적인 유도의 관점에서, palmitic 산 노출 보다는 더 나은 결과를 보였다는 것을 관찰했습니다 (그림2D). 실제로, 팔미트산 치료는 분화된 HepaRG 세포(그림2D)에 대해 독성이 있는 것으로 판명되었으며, 간종 세포주 및 팜미산을 설명하는 인간 및 랫트 간세포 1차 배양에 대한 문헌 데이터와 일치하여 상당히 세포 독성 에이전트25,26,27,28,29. 더욱이, 세포 기지를 둔 세포 기지를 둔 희미성의 낮기 때문에 손바닥의 이용은 도전적입니다. 그럼에도 불구하고, 세포주의 본질적인 가변성으로 인해, 나트륨 올레아테 작업 농도 및 처리 시간 길이를 확인하는 것이 좋습니다, 세포 생존 분석실험으로 시간 과정 실험에서 상이한 농도를 시험.

지질 검출 기술의 중요성과 비교
세포에 있는 지질 양의 정확한 측정은 이 연구 결과에 있는 다른 접근의 수를 통해 설치되었습니다. 정성적 및 또한 오일 레드 O 염색, 보디피 염색 및 CARS 이미징을 통해 얻은 결과 사이에 약 정량적 합의가 관찰되었다. 세포 집단에서 지질 수량의 신속한 추정을 위해, 보디피 유량 세포측정또는 오일 레드 O와 같은 얼룩의 사용은 이상적입니다. 세포의 지질 방울 함량에 대한 보다 상세한 검사를 위해 이미징 양식이 바람직합니다. 더욱이, 오일 레드 O20,30 과 같은 지질 얼룩에 대한 특이성 문제가 보고되었으며, 경우에 따라 보디피 얼룩이 CARS보다 낮은 용량을 가지고 다른 세포 들 사이에서 지질 방울을 독점적으로 라벨로 지정하는 것을 관찰했습니다. 세포기관(데이터가 표시되지 않음). 따라서 CARS와 같은 라벨이 없는 미세 이미징 기술을 사용하면 스테토시스 정량화 및 특성화에 상당한 이점을 제공합니다. 큰 형광 성 표지의 사용의 회피는 일반적인 형광단에 비교된 지질 분자의 작은 크기 때문에 CARS 화상 진찰을 유리하게 만듭니다; 따라서, 지질의 검출을 위해, 라벨없는 방법은 큰 단백질 분자를 관찰하는 것보다 훨씬 더 바람직하다. 지질 CARS 신호는 샘플에서 비선형 상호 작용이 발생할 때만 생성되는 광학 방출이다. 이러한 상호작용은 시료에 초점을 맞춘 두 가지 여기 레이저의 주파수 간의 차이가 매틸렌(CH2)스트레칭 진동 주파수와 일치할 때만 검출될 수 있다. 지질에 있는 메틸렌 단의 풍부는 높은 신호 대 잡음 비율을 가진 아주 강렬한 신호 귀착되고, 광학 상호 작용의 비선형성은 또한 CARS 현미경 검사법에서 높은 공간 분해능이 가능하다는 것을 의미합니다. 일반적으로 CARS 이미지의 우수한 품질은 이 연구에서 입증된 바와 같이 지질 방울의 크기와 수에 대한 통계를 수집할 수 있게 합니다. 또한, 다른 연구는 다른 세포 내 국소화 및 다른 치료와 지질 방울의 크기를 상관 관계하는 CARS 현미경 검사법의 사용을 입증했다 18,다른 파장에서 보충 CARS 측정을 사용 하 여, 또는 광대역 CARS 또는 이와 유사한 자극라만 접근법, 연구자들은 지질 방울31,32내에서 다양한 유형의 지방산을 특성화할 수 있음을 보여주었다. 더욱이, CARS 이미지 수집의 급속성은 살아있는 세포의 인-시투 영상을 가능하게 하여 지질 방울 성장 및응집체(33)의 시간적 진화를 조사하였다.

향후 응용 프로그램
최근 수십 년 동안, 세포 생물학에 있는 지질 작은 물방울의 역할 그리고 기능에 대한 견해는 진화했습니다. 이전에는 기본적으로 불활성 저장 소포로 생각되었으므로, 그들은 이제 매우 역동적인 세포 소기관으로 이해되고,질병에서의 그들의 역할은 점점 34,35,36으로인식되고 있다. 간 질환의 경우, 지질 축적(steatosis)은 오랫동안 중요한 양상으로 알려져 왔지만, 질병 진행에 지질 방울의 정확한 메커니즘이 완전히 명확하지 않다. 따라서 지질 방울의 동적 거동을 특성화할 수 있는 CARS와 같은 방법은 NAFLD를 포함한 질병의 분자 이해의 발달에 매우 중요하다. qPCR에 의한 대사 유전자 발현 분석은 이전 연구17,18에서입증된 바와 같이 CARS를 통한 지질의 분자 이미징에 매우 상보적이며, 질병 메커니즘에 대한 심층적인 통찰력을 제공합니다. 본 연구에서는, 우리는 초기 질병 진단을 위한 바이오 마커의 패널의 건설에 기여할 수 있는 지질 대사 및 선동적인 유전자 발현의 규제 완화와 지방산 축적을 관찰합니다.

나트륨 oleate 처리된 dHepaRG 세포 기지를 둔 모형은 개시에서 뿐 아니라 NAFLD의 진행에 관련시킨 분자 기계장치의 지식을 증가할 수 있습니다, 질병에 더 나은 치료 접근의 발달을 위한 기초를 제공하.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

저자는 그들이 경쟁 적인 재정적 이익이 없다고 선언합니다.

Acknowledgments

우리는 친절하게 HepaRG 세포를 제공 크리스티안 트레포 교수 (INSERM U871, 리옹, 프랑스)에게 감사드립니다. 우리는 행정 도움을 리타 Appodia에 감사드립니다. 이 작품은 MIUR- 장관 델 istruzione, dell'università e 델라 ricerca (FIRB 2011-2016 RBAP10XKNC) 로마의 사피엔자 대학 (prot)에 의해 지원되었다. C26A13T8PS; 제자. C26A142MCH; 제자. C26A15LSXL).

Materials

Name Company Catalog Number Comments
Hyclone HyClone Fetal Clone II  GE Healthcare SH30066
William’s E medium with GlutaMAX  Thermofisher 32551087
Penicillin/streptomycin  SIGMA P4333
Insulin  SIGMA I9278
Hydrocortisone hemisuccinate SIGMA H2270
DMSO, dimethyl sulfoxide SIGMA D2438   
Sodium Oleate SIGMA O7501 
Methanol SIGMA 179337
Isopropanol SIGMA 278475
BODIPY 505/515 Thermofisher D3921
PBS Thermofisher 14190-250
Formaldehyde solution SIGMA 252549
RNAse free DNAseI Promega M198A 
Glass-bottomed dishes Willco Wells GWST-5040
Oil Red solution SIGMA O625
CellTiter 96 AQueous One Solution Promega  G3582
q-PCR oligo name Sequence
ACACB FOR CAAGCCGATCACCAAGAGTAAA
ACACB REV CCCTGAGTTATCAGAGGCTGG
β-actin FOR GCACTCTTCCAGCCTTCCT
β-actin REV AGGTCTTTGCGGATGTCCAC
ALBUMIN FOR TGCTTGAATGTGCTGATGACAGG
ALBUMIN REV AAGGCAAGTCAGCAGGCATCTCATC
ALDOB FOR GCATCTGTCAGCAGAATGGA 
ALDOB REV TAGACAGCAGCCAGGACCTT
APOB FOR CCTCCGTTTTGGTGGTAGAG
APOB REV  CCTAAAAGCTGGGAAGCTGA
APOC3 FOR CTCAGCTTCATGCAGGGTTA
APOC3 REV GGTGCTCCAGTAGTCTTTCAG
CPT1A FOR TCATCAAGAAATGTCGCACG
CPT1A REV GCCTCGTATGTGAGGCAAAA
CYP2E1 FOR TTGAAGCCTCTCGTTGACCC
CYP2E1 REV CGTGGTGGGATACAGCCAA
CYP3A4 FOR CTTCATCCAATGGACTGCATAAAT
CYP3A4 REV TCCCAAGTATAACACTCTACACAGACAA
GAPDH FOR TGACAACTTTGGTATCGTGGAAGG
GAPDH REV AGGGATGATGTTCTGGAGAGCC
GPAM FOR TCTTTGGGTTTGCGGAATGTT
GPAM REV ATGCACATCTCGCTCTTGAATAA
IL6 FOR CCTGAACCTTCCAAAGATGGC
IL6 REV ACCTCAAACTCCAAAAGACCAGTG
PDK4 FOR ACAGACAGGAAACCCAAGCCAC
PDK4 REV TGGAGGTGAGAAGGAACATACACG
PLIN2 FOR TTGCAGTTGCCAATACCTATGC
PLIN2 REV CCAGTCACAGTAGTCGTCACA
PLIN4 FOR AATGAGTTGGAGGGGCTGGGGGACATC
PLIN4 REV GGTCACCTAAACGAACGAAGTAGC
SCD FOR TCTAGCTCCTATACCACCACCA
SCD REV TCGTCTCCAACTTATCTCCTCC
SLC2A1 FOR TGCTCATCAACCGCAACGAG
SLC2A1 REV CCGACTCTCTTCCTTCATCTCCTG
18S FOR CGCCGCTAGAGGTGAAATTC
18S REV TTGGCAAATGCTTTCGCTC

DOWNLOAD MATERIALS LIST

References

  1. Starley, B. Q., Calcagno, C. J., Harrison, S. A. Nonalcoholic fatty liver disease and hepatocellular carcinoma: a weighty connection. Hepatology. 51, (5), 1820-1832 (2010).
  2. Byrne, C. D., Targher, G. NAFLD: a multisystem disease. Journal of Hepatology. 62, (1), Suppl 47-64 (2015).
  3. Marra, F., Gastaldelli, A., Svegliati Baroni, G., Tell, G., Tiribelli, C. Molecular basis and mechanisms of progression of non- alcoholic steatohepatitis. Trends in Molecular Medicine. 14, 72-81 (2008).
  4. Chalasani, N., et al. The diagnosis and management of nonalcoholic fatty liver disease: Practice guidance from the American Association for the Study of Liver Diseases. Hepatology. 67, (1), 328-357 (2018).
  5. Banini, B. A., Sanyal, A. J. Current and future pharmacologic treatment of nonalcoholic steatohepatitis. Current Opinion in Gastroenterology. 33, (3), 134-141 (2017).
  6. Takahashi, Y., Sugimoto, K., Inui, H., Fukusato, T. Current pharmacological therapies for nonalcoholic fatty liver disease/nonalcoholic steatohepatitis. World Journal of Gastroenterology. 21, (13), 3777-3785 (2015).
  7. Younossi, Z., et al. Global burden of NAFLD and NASH: trends, predictions, risk factors and prevention. Nature Reviews Gastroenterology & Hepatology. 15, (1), 11-20 (2018).
  8. Santhekadur, P. K., Kumar, D. P., Sanyal, A. J. Preclinical models of non-alcoholic fatty liver disease. Journal of Hepatology. 68, (2), 230-237 (2018).
  9. Nagarajan, P., Mahesh Kumar, M. J., Venkatesan, R., Majundar, S. S., Juyal, R. C. Genetically modified mouse models for the study of nonalcoholic fatty liver disease. World Journal of. Gastroenterology. 18, (11), 1141-1153 (2012).
  10. Oseini, A. M., Cole, B. K., Issa, D., Feaver, R. E., Sanyal, A. J. Translating scientific discovery: the need for preclinical models of nonalcoholic steatohepatitis. Hepatology International. 12, (1), 6-16 (2018).
  11. Ramboer, E., Vanhaecke, T., Rogiers, V., Vinken, M. Immortalized human hepatic cell lines for in vitro testing and research purposes. Methods in Molecular Biology. 1250, 53-76 (2015).
  12. Gómez-Lechón, M. J., Donato, M. T., Castell, J. V., Jover, R. Human hepatocytes in primary culture: the choice to investigate drug metabolism in man. Current Drug Metabolism. 5, (5), 443-462 (2004).
  13. Marion, M. J., Hantz, O., Durantel, D. The HepaRG cell line: biological properties and relevance as a tool for cell biology, drug metabolism, and virology studies. Methods in Molecular Biology. 640, 261-272 (2010).
  14. Gripon, P., et al. Infection of a human hepatoma cell line by hepatitis B virus. Proceedings of the National Academy of Sciences. 99, (24), 15655-15660 (2002).
  15. Anthérieu, S., Rogue, A., Fromenty, B., Guillouzo, A., Robin, M. A. Induction of vesicular steatosis by amiodarone and tetracycline is associated with up-regulation of lipogenic genes in HepaRG cells. Hepatology. 53, (6), 1895-1905 (2011).
  16. Rouge, A., et al. PPAR agonists reduce steatosis in oleic acid-overloaded HepaRG cells. Toxicology and Applied Pharmacology. 276, (1), 73-81 (2014).
  17. Belloni, L., et al. Targeting a phospho-STAT3-miRNAs pathway improves vesicular hepatic steatosis in an in vitro and in vivo model. Scientific Reports. 8, 13638 (2018).
  18. Nunn, A. D. G., et al. The histone deacetylase inhibiting drug Entinostat induces lipid accumulation in differentiated HepaRG cells. Scientific Reports. 6, 28025 (2016).
  19. Donato, M. T., et al. Cytometric analysis for drug-induced steatosis in HepG2 cells. Chemico-Biological Interactions. 181, (3), 417-423 (2009).
  20. Hellerer, T., Axäng, C., Brackmann, C., Hillertz, P., Pilon, M., Enejder, A. Monitoring of lipid storage in Caenorhabditis elegans using coherent anti-Stokes Raman scattering (CARS) microscopy. Proceedings of the National Academy of Sciences. 104, (37), 14658-14663 (2007).
  21. Le, T. T., Ziemba, A., Urasaki, Y., Brotman, S., Pizzorno, G. Label-free evaluation of hepatic microvesicular steatosis with multimodal coherent anti-Stokes Raman scattering microscopy. PLoS One. 7, (11), 51092 (2012).
  22. Guillouzo, A., Corlu, A., Aninat, C., Glaise, D., Morel, F., Guguen-Guillouzo, C. The human hepatoma HepaRG cells: a highly differentiated model for studies of liver metabolism and toxicity of xenobiotics. Chemico-Biological Interactions. 168, (1), 66-73 (2007).
  23. Nelson, L. J., et al. Human hepatic HepaRG cells maintain an organotypic phenotype with high intrinsic CYP450 Activity/metabolism and significantly outperform standard HepG2/C3A cells for pharmaceutical and therapeutic applications. Basic & Clinical Pharmacology & Toxicology. 120, (1), 30-37 (2017).
  24. Gerets, H. H. J., Tilmant, K., Gerin, B., Chanteux, H., Depelchin, B. O., Dhalluin, S., Atienzar, F. A. Characterization of primary human hepatocytes, HepG2 cells, and HepaRG cells at the mRNA level and CYP activity in response to inducers and their predictivity for the detection of human hepatotoxins. Cell Biology and Toxicology. 28, (2), 69-87 (2012).
  25. Pusl, T., et al. Free fatty acids sensitize hepatocytes to bile acid-induced apoptosis. Biochemical and Biophysical Research Communications. 371, (3), 441-445 (2008).
  26. Gentile, C. L., Pagliassotti, M. J. The role of fatty acids in the development and progression of nonalcoholic fatty liver disease. The Journal of Nutritional Biochemistry. 19, (9), 567-576 (2008).
  27. Mei, S., et al. Differential roles of unsaturated and saturated fatty acids on autophagy and apoptosis in hepatocytes. Journal of Pharmacological Experimental Therapy. 339, 487-498 (2011).
  28. Malhi, H., Bronk, S. F., Werneburg, N. W., Gores, G. J. Free fatty acids induce JNK-dependent hepatocyte lipoapoptosis. Journal of Biological Chemistry. 281, 12093-12101 (2006).
  29. Moravcová, A., Červinková, Z., Kučera, O., Mezera, V., Rychtrmoc, D., Lotková, H. The effect of oleic and palmitic acid on induction of steatosis and cytotoxicity on rat hepatocytes in primary culture. Physiological Research. 64, Suppl 5 627-636 (2015).
  30. Ohsaki, Y., Shinohara, Y., Suzuki, M., Fujimoto, T. A pitfall in using BODIPY dyes to label lipid droplets for fluorescence microscopy. Histochemistry and Cell Biology. 133, (4), 477-480 (2010).
  31. Rinia, H. A., Burger, K. N., Bonn, M., Müller, M. Quantitative label-free imaging of lipid composition and packing of individual cellular lipid droplets using multiplex CARS microscopy. Biophysical Journal. 95, (10), 4908-4914 (2008).
  32. Waschatko, G., Billecke, N., Schwendy, S., Jaurich, H., Bonn, M., Vilgis, T. A., Parekh, S. H. Label-free in situ imaging of oil body dynamics and chemistry in germination. Journal of The Royal Society Interface. 13, (123), (2016).
  33. Jüngst, C., Winterhalder, M. J., Zumbusch, A. Fast and long term lipid droplet tracking with CARS microscopy. Journal of Biophotonics. 4, (6), 435-441 (2011).
  34. Welte, M. A., Gould, A. P. Lipid droplet functions beyond energy storage. Biochimica et Biophysica Acta - Molecular and Cell Biology of Lipids. 1862, (10), Pt B 1260-1272 (2017).
  35. Cohen, S. Lipid droplets as organelles. International Review of Cell and Molecular Biology. 337, 83-110 (2018).
  36. Farese, R. V., Walther, T. C. Lipid droplets finally get a little R-E-S-P-E-C-T. Cell. 139, (5), 855-860 (2009).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics