גרימת ואפיון שלפוחית הזרע ב הבדיל תאים HepaRG

Medicine

Your institution must subscribe to JoVE's Medicine section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

במחקר זה, אנו מתארים פרוטוקול מפורט לגרימת הכבד שלפוחית השומן בתאי HepaRG עם חומצות שומן מלח נתרן לרדוף ולהעסיק שיטות זיהוי וכימות של הצטברות שומנים בדם, כולל anti-סטוקס קוהרנטי פיזור ראמאן (מכוניות) מיקרוסקופ, ניתוח ציטופלוורימטרי, שמן אדום כתמים ו-qPCR.

Cite this Article

Copy Citation | Download Citations

Di Cocco, S., Belloni, L., Nunn, A. D., Salerno, D., Piconese, S., Levrero, M., Pediconi, N. Inducing and Characterizing Vesicular Steatosis in Differentiated HepaRG Cells. J. Vis. Exp. (149), e59843, doi:10.3791/59843 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

סטרומטוזיס הכבד מייצגת תפקוד מטבולי הנובע מהצטברות של שומנים בטריגליצרידים המכילים טיפות השומנים ב hepatocytes. הצטברות שומן מוגזמת מוביל מחלת כבד שומני לא אלכוהוליים (NAFLD), אשר עשוי הפיך עלול להתפתח שאינם אלכוהוליים steatohepatitis (נאש) ובסופו של דבר שחמת ו hepatocellular קרצינומה (HCC). המנגנון המולקולרי המקשר הצטברות השומנים ב hepatocytes עם ההתקדמות לנאש, נזק כבד בלתי הפיך, פיברוזיס, שחמת, ואפילו HCC עדיין נשאר ברור. לשם כך פותחו מספר מvivo ובדגמים מסוימים כדי להבהיר את התהליכים הפתולוגיים הגורמים לNAFLD. במחקר הנוכחי, אנו מתארים מודל הסלולר עבור אינדוקציה של הכבד שלפוחית השומן המורכבת של DMSO-הבדיל האנושי הכבד HepaRG תאים שטופלו עם חומצת שומן מלח נתרן לאואט. אכן, נתרן oleate התייחס התאים HepaRG לצבור טיפות השומנים בציטופלסמה ולהראות תכונות טיפוסיות של steatosis. זה במודל אנושי מתורבת מייצג חלופה רבת ערך לדגמי עכברים vivo, כמו גם לגוף הפטוציטים האנושי העיקרי. אנו מציגים גם השוואה של מספר שיטות עבור כימות והערכה של הצטברות שומן בתאי HepaRG, כולל שמן אדום כתמים, ציטופלוורימטרית מדידה Bodipy, ביטוי גנים מטבולית ניתוח ידי qPCR, ואנטי-סטוקס קוהרנטי פיזור ראמאן (מכוניות) מיקרוסקופ. הדמיה מכוניות משלבת את הספציפיות הכימי של ספקטרוסקופיית ראמאן, טכניקת ניתוח כימי הידוע היטב ביישומים המדע, עם היתרונות של במהירות גבוהה, ברזולוציה גבוהה לא ליניארי מmicroscopies כדי לאפשר מדויק קוונפיקציה של הצטברות השומנים ו-droplet השומנים. הקמתה של מודל מתורבת יעיל עבור אינדוקציה של שלפוחית העין, לצד שיטה מדויקת עבור כימות ואפיון של הצטברות שומנים בדם, יכול להוביל לפיתוח של אבחנה בשלב מוקדם של nafld דרך ה זיהוי של סמנים מולקולריים, וליצירת אסטרטגיות טיפול חדשות.

Introduction

סטרומטוזיס הכבד מוגדר הצטברות שומן תוך-הכבד, בתוך הטריגליצרידים המכיל טיפות השומנים, של לפחות 5% ממשקל הכבד. אחסון ממושך השומנים הכבד הוא תהליך הפיך פוטנציאלי, אולם, זה יכול להוביל לתפקוד מטבולית בכבד, דלקת וצורות מתקדמות של מחלת כבד שומני לא אלכוהולי (nafld), הגורם השולט של מחלת כבד כרונית בחלקים רבים של העולם1,2. Nafld היא מחלה רב עצרת אשר עשוי להתפתח אגרסיבי יותר שאינם אלכוהוליים steatohepatitis (נאש), אשר בתורו יכול להתקדם שחמת, באחוז קטן של חולים, כדי קרצינומה של hepatocellular (HCC)1,3. טיפול לא מאושר זמין כרגע כטיפול ספציפי עבור nafld ושילוב של דיאטה ושינויים בסגנון חיים נשאר העמוד של הניהול nafld ו נאש4,5,6.

המנגנונים המולקולריים שהובילו להתפתחות הסטירומטוזיס הכבד בפתוגנזה של NAFLD עדיין נשארים להסבר7. בהקשר זה, מודלים העכבר פותחו כדי ללמוד התקדמות המחלה מחלת האדם. מספר רב של דגמים שונים קיימים, ולכל אחד יש יתרונות וחסרונות, כולל מודלים גנטיים, תזונתיים וכימיים שונים המשלבים גישות שונות. עכברים ששונו גנטית (הטרנסגניים או הנוק-אאוט) לפתח באופן ספונטני מחלת כבד. עם זאת, יש לציין כי מוטציות אלה הם נדירים מאוד בבני אדם, מחיקה או ביטוי מעל של גן אחד (g., ob/ob העכבר) לא יכול לחקות את האטיולוגיה של מחלת האדם multifactorial ברמה המולקולרית8,9. כמו כן, המחלה שנרכשה על ידי עכברים לאחר מניפולציה תזונתיים או תרופתי לא יכול לחקות את ההשפעות של דיאטות אדם הקשורים לפיתוח של NAFLD באדם8. עם זאת, מודלים בעלי חיים הקלו התפתחויות בהבנת NAFLD וגישה זו היא כיום האסטרטגיה הנפוצה ביותר במחקר במעבדה. עם זאת, השכפול בבני אדם של תוצאות שהתקבלו במודלים של בעלי חיים נכשל שוב ושוב, דבר שגרם לתרגום עני למרפאה10.

לכן, במודלים של חוץ גופית של NAFLD עשוי לשחק תפקיד בסיסי בהסבר מנגנונים מולקולריים של התקדמות NAFLD, והם מייצגים כלי רב ערך למסך מספר גדול של תרכובות. תרביות תאים ראשוניים, קווי תאים מונצח וביופסיות כבד שימשו בהרחבה למטרות מחקר11. הרופא הראשי האדם הראשוני דומה מאוד לתנאים קליניים אנושיים, אבל יש מספר מוגבל של תורמים, ותרבויות התא הראשי להראות מהווה המסכן העניים בשל השונות של התאים. תצפיות אלה, יחד עם סוגיות אתיות ולוגיסטיות, הביאו לשימוש בתאי ההיפטציטים הראשיים האנושייםבגיל 12. כך, קווי הכבד בתאי מייצגים חלופה נוחה, שיש יתרונות חיוניים מספר על התרבות העיקרית, כמו קווי הכבד בתאי לצמוח בהתמדה, יש תוחלת חיים כמעט בלתי מוגבל, יש פנוטיפים יציבה. יתר על כן, קווי התא נגישים בקלות, תנאי התרבות של קווי תא הכבד הם פשוטים יותר מאשר אלה של hepatocytes הראשי הם סטנדרטיים בין מעבדות שונות.

כאן, אנו מתארים בפירוט מודל מבוסס תא מבחנה של הכבד המבוסס על שלפוחית הצער, מיוצגת על ידי בתאי HepaRG כתית שטופלו עם חומצת שומן נתרן oleate. קו התאים HepaRG הוקם מחולה נקבה מושפע דלקת הפטיטיס C וכיתה אדמונדסון אני מבדיל היטב גידול בכבד14. קו הטלפון HepaRG הוא קו מחולל אנושי בעל עוצמה אנושית המסוגל להבדיל באמצעות חשיפה ל-2% diמתיל סולפוקסיד (DMSO) כלפי שני פנוטיפים סלולריים שונים: כגון המרה ותאים המרופציט. הבדיל התאים HepaRG (dHepaRG) לשתף כמה תכונות ומאפיינים עם heparg מבוגרים ולהחזיק את היכולת לבטא גנים ספציפיים לכבד כגון אלבומין, Aldol, ציטוכרום P450 2E1 (CYP2E1), ו ציטוכרום P450 3A4 (CYP3A4)13 (שלב 3). הטיפול בתאים dHepaRG עם מלח חומצת שומן נתרן אולאט (250 μm) עבור 5 ימים להוביל לדור של טיפות השומנים cytoplasmic, מחקה את ההשפעות של כבד שומני14,15,17,18 ( שלב 4). הצטברות של טיפות שומנים בדם ניתן לזהות בקלות על ידי שמן אדום כתמי O (שלב 5), שומן lysochrome לצבוע מסיסים הכתמים טריגליצרידים נייטרלית ושומנים אדום כתום. כדי לכמת ביעילות שומנים ב dHepaRG שומן, כאן אנו ממחישים ניתוח ציטופלוורימטרית לאחר הצביעת עם 4, 4-difluoro-1, 3, 5, 7-טטרמתיל-4-בורה-3a, 4a-di,-s-indacene (bodipy 505/515) (שלב 6), ליפול ב כדי תאיים גופי השומנים המשמש תווית טיפות השומנים19. יתר על כן, כאן אנו מראים כיצד להעריך הסטרומטוזיס על ידי תגובת שרשרת פולימראז כמותי (שלב 7) הביטוי הגנטי רגולציה של כמה גנים מטבוליים בתאי dHepaRG. כדי לאפיין עוד ולכמת את הצטברות של טיפות שומנים לאחר הטיפול נתרן אולאט, אנו ביצעו בעקביות אנטי סטוקס מיקרוסקופית פיזור (מכוניות) מיקרוסקופ (שלב 8), טכניקה חדשנית המאפשרת הדמיה וכימות של טיפות השומנים ללא תיוג20,21.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. הכנת מדיה תרבותית וריאגנטים

  1. בינוני מתרבים: תוספת בינונית E של ויליאם עם גלוטמקס, 10% סרום של שור עוברי (FBS), 1% פניצילין/סטרפטומיצין, 5 μg/mL אינסולין ו-0.5 μM הידרוקורטיזון המיסופיאט.
  2. לבידול בינוני: תוספת בינונית E של ויליאם עם גלוטמקס, 10% FBS, 1% פניצילין/סטרפטומיצין, 5 μg/mL אינסולין, 50 μM הידרוקורטיזון מיסותמאטה ו 2% DMSO.
  3. הקפאת בינוני: תוספת מתרבים בינונית עם 10% DMSO.
  4. נתרן oleate: לפזר 99% מתנול בריכוז 100 מ"מ, מערבבים O/N, ולאחסן ב-20 ° c.
  5. שמן אדום O: להכין פתרון מלאי. שוקלים 0.35 g של שמן אדום O ומתמוסס ב 100 מ ל של איזופנול. מערבבים O/N, מסנן (0.2 μm), ולאחסן ב-RT. הכינו פתרון עובד: מערבבים 6 מ ל של מניות שמן אדום O פתרון עם 4 מ ל של ddH2O. בואו לשבת בטמפרטורת החדר (RT) עבור 20 דקות, ולאחר מכן לסנן עם מסנן 0.2 יקרומטר. סינון נאות מומלץ מאוד לצביעת מוצלח כדי להימנע מרקע.
  6. Bodipy (505/515): לפזר את Bodipy (505/515) לצבוע ב-DMSO בריכוז 100 מניות μM, החנות ב-20 ° c בחושך, ולהשתמש ב גמר 100 ריכוז nM.
  7. רוכשים מנות עם תחתית זכוכית שקופה לניסויים במכוניות.

2. התאגף, הגברה והקפאה בתאי HepaRG

  1. ההפשרה הקפאת החנקן בתאי HepaRG על ידי הפשרת אצווה באמבט 37 ° c עד מופשר. בחר אצוות מעבר נמוכה (< 20). תאי HepaRG זמינים מסחרית.
  2. במהירות להעביר את התאים לתוך 15 מ ל צינור המכיל 10 מ ל של בינוני מתרבים צנטריפוגה עבור 5 דקות (200 x g, 4 ° c).
  3. להיפטר supernatant ולהשעות מחדש את התאים עם 5 מ ל של בינוני מתרבים.
  4. לספור את התאים ולדלל כדי לוחית 2.5 x 104 תאים/cm2.
  5. לחדש את המדיום כל 2 או 3 ימים. תאים מתרבים עם זמן הכפלה של כ 24 שעות.
  6. ניתוק תאי HepaRG כאשר ב 80% שטף ידי 3-5 דקות דגירה עם טריפסין פתרון 0.05%. לאסוף את התאים בינוני מתרבים צנטריפוגה עבור 5 דקות (200 x g, 4 ° c).
  7. להיפטר supernatant ולהשעות מחדש את התאים עם 5 מ ל של בינוני מתרבים.
  8. לספור את התאים ולדלל כדי לוחית 2.5 x 104 תאים/cm2.
  9. בשלב זה, להגביר את התאים על ידי חוזר שלבים 2.5-2.8 כדי להגיע למספר המתאים של תאים כדי להתחיל ניסויים, או cryopreserve כמו בשלב 2.10.
  10. כדי הקפאת בתאי HepaRG, לנתק את התאים 24 שעות לאחר ציפוי על ידי 3-5 דקות דגירה עם טריפסין פתרון 0.05%. לאסוף את התאים בינוני מתרבים צנטריפוגה עבור 5 דקות (200 x g, 4 ° c). להיפטר supernatant, להשעות מחדש את התאים 1 מ ל/אצווה של הקפאה בינונית, 1.5 x 106 תאים/אצווה ו cryopreserve הקבוצות בחנקן נוזלי.

3. הבידול בתאי HepaRG (יום 0 – 21) (איור 1א)

  1. . היום האפס בתאי HepaRG הזרע בצפיפות נמוכה (2.5 x 104 תאים/ס"מ2) לתוך תרבות מטופלים עם כמות מתאימה של התפשטות בינונית (איור 1B). שתי מנות צריך להיות מצופה עבור כל שיטת (שמן Red O כתמים, ניתוח FACS, qPCR): אחד עבור תאים בקרה אחד עבור תאים oleate שטופלו. אם ביצוע מדידות מכוניות (שלב 8), הזרע את התאים במקביל לתוך מנות התחתית זכוכית שקופה. כפקד, הקציר מאכל אחד מטופל (תאים מתרבים יום 0) כדי לבצע ניתוח ביטוי גנים של גנים בידול סמן (ראה שלב 3.6).
  2. . היום השני והיום הרביעי שנה את המדיום עם עוצמת ההפצה המתאימה והחלק את התאים לצמוח עד למפגש.
  3. . היום השביעי תאים חייבים להיות 100% בעלי שוטפת (איור 1ג). שטוף את התאים פעם אחת עם תמיסת מלח באגירה בעלת 1 x פוספט (PBS). הסר 1x PBS והוסף נפח מתאים של בינוני בידול.
  4. . יום 8, 9, 12, 15, 18  שטוף את התאים פעם אחת עם 1 x PBS. הסר 1x PBS והוסף נפח מתאים של בינוני בידול.
  5. . היום ה -21 להתבונן בתאי HepaRG תחת מיקרוסקופ ולהבטיח כי התאים הם הבדיל תרבויות מובחנת (איור 1ד).
  6. כפקד, הקציר צלחת בקרה אחת (הבדיל תאים יום 21) כדי לבצע ניתוח ביטוי גנים (שלב 7) של גנים סמן בידול (איור 1E).
  7. ביום 21, הבדיל תאים HepaRG ניתן הקפאת השמורים בחנקן נוזלי.

4. אינדוקציה של שלפוחית השמש (יום 21 – 26)

  1. . היום ה -21 לדלל את הנתרן לאואט (100 מ"מ) עם נפח מתאים של בינוני בידול מלא לריכוז הסופי של 250 μM (1:400). הוסף 99% מתנול 1:400 (אותו אמצעי אחסון כמו זה של נתרן oleate) לתוך סדרת מחלקים אחר של בידול בינוני כדי להפוך את הטיפול בקרת רכב. (למשל: הוסף 25 μl של נתרן אולאט ל 10 מ ל של בינוני במקביל להוסיף 25 μl של 99% מתנול ל 10 mL של בינוני). לשטוף את התאים פעם אחת עם 1 x PBS ולהוסיף רכב או נתרן אולאט בינונית.
  2. . יום 23 ויום 25 שנה את המדיום עם הנפח המתאים של בינוני טרי מוכן כמו בשלב 4.1.
  3. . יום 26 להתבונן על ידי מיקרוסקופ אופטי כי טיפות השומנים להצטבר בתאי הרדוף הנתרן התייחס והם בקלות לראות כמו טיפות שקוף בציטופלסמה כמו באיור 2א.

5. הערכה של שומנים יתר והאינדוקציה שדררומטוזיס: שמן אדום כתמים

  1. לשטוף את התאים פעם אחת עם 1 x PBS ולהסיר 1x PBS לחלוטין.
  2. הוסף 4% פאראפורמלדהיד (מדולל ב-1x PBS) ו הדגירה עבור 15 דקות ב RT.
    זהירות: פאראפורמלדהיד הוא רעיל, כך ששלב זה חייב להתבצע בתוך מכסה המנוע, עם ציוד הגנה, כולל כפפות, חלוק מעבדה ומסכה.
  3. להסיר פאראמפורמלדהיד ולשטוף את התאים פעמיים עם 1x PBS. ניתן לשמור את התאים ב-1x PBS ב-4 ° c לכמה ימים לפני הצביעת. לעטוף עם parafilm ולכסות עם רדיד אלומיניום כדי למנוע את התאים מייבוש.
  4. הסר 1x PBS. דגירה את התאים עם 60% איזופנול עבור 5 דקות ב RT.
  5. הסר איזופנול והשאר את התאים יבשים לחלוטין ב-RT.
  6. הוסף שמן אדום O פתרון עבודה דגירה ב RT עבור 30 דקות. הנפח של פתרון העבודה הנדרש עבור כל דוגמה מתאים לנפח המדיה המשמש לעיבוד התאים.
  7. הסרת שמן אדום הפתרון ולהוסיף מיד ddH2o. לשטוף את התאים 4 פעמים עם ddh2o.
  8. השיגו תמונות מתחת למיקרוסקופ לניתוח (איור 2ב').
  9. כדי לצבוע את השמן האדום או דיו: להסיר את כל המים ולאפשר יבש; להוסיף 1 mL של 100% איזופנול ו דגירה עבור 10 דקות עם טלטול עדין ב RT.
  10. ללטף את האיזופנול עם לצבוע שמן אדום או למעלה ולמטה מספר פעמים, להבטיח כי כל שמן אדום O הוא בפתרון. העבר את הפתרון לקובט. למדוד OD500 nm על ידי ספקטרופוטומטר ולהשתמש 100% איזופנול כריק (איור 2ג).

6. הערכה של שומנים יתר והאינדוקציה שדררומטוזיס: בודיפיה כתמים ואנליזה ציטופלוורימטרית

  1. שטוף את התאים פעם אחת עם 1 x PBS. דגירה עם 100 ננומטר של Bodipy מדולל 1x PBS בחושך עבור 40 דקות ב 37 ° c. שליטה בלתי מוכתמת צריכה להיכלל במידות הזרימה של סיילנסה. מנקודה זו, להגן על דגימות מהאור כמה שיותר.
    הערה: הנפח של פתרון הצביעת הנדרש עבור כל דוגמה מתאים לנפח המדיה המשמש לתאי culturing.
  2. הסר פתרון כתמים ושטוף את התאים פעם אחת עם 1x PBS. המשך לצעדים 6.3-6.6. עבור FACS (מיון תאים פלואורסצנטית מופעל) ניתוח או לשלב 6.7 עבור דימות מיקרוסקופ.
  3. מגרדים בעדינות את התאים באמצעות 1x PBS ומעבירים אותו לשפופרת של 15 מ ל. צנטריפוגה עבור 10 דקות (200 x g, 4 ° c).
  4. הסר בעדינות את הסופרנטנים מבלי להפריע את כדורי ולשטוף עם 3 מ ל של 1x PBS. צנטריפוגה עבור 5 דקות (200 x g, 4 ° c).
  5. הסר את הסופרנטנים והשהה מחדש ב-300 μL של 1x PBS, ולאחר מכן העבר לתוך צינור FACS.
  6. מיד למדוד את עוצמת הקרינה של Bodipy על ידי ניתוח ציטופלוורימטרי עם עירור/פליטת אורכי גל של 505/515 ננומטר (איור 3A, B).
  7. שטוף את התאים פעם אחת ב-1x PBS ולהסיר PBS לחלוטין.
  8. הוסף 4% פאראפורמלדהיד (מדולל ב-1x PBS) ו הדגירה עבור 15 דקות ב RT.
    זהירות: פאראפורמלדהיד הוא רעיל, כך ששלב זה חייב להתבצע בתוך מכסה המנוע, עם ציוד הגנה, כולל כפפות, חלוק מעבדה ומסכה.
  9. הסרת פאראפורמלדהיד ולשטוף את הדגימות 3x עבור 5 דקות ב-PBS. ניתן לשמור את התאים ב-1x PBS ב-4 ° צ' או בתמונה מיידית (איור 3ג). לאחסון, לעטוף עם parafilm ולכסות עם רדיד אלומיניום כדי למנוע את התאים מייבוש.

7. הערכת עומס יתר ליפיד והשראה סטרומטוזיס: qPCR

  1. שטוף את התאים פעם אחת עם 1 x PBS. גרד את התאים באמצעות 1x PBS, צנטריפוגה ב 200 x g, ולמחוק את supernatant. בשלב זה, התאים ניתן לקצור ב-80 ° צ' או מעובד כמו בשלב 7.2.
  2. לבצע בידוד RNA הכולל על ידי שיטות סטנדרטיות באמצעות ריאגנטים מסחרי לאחר הוראות היצרן.
  3. להעריך את הריכוז RNA על ידי מדידה spectrophotometric UV, להבטיח כי טוהר RNA הוא גבוה (קרוב ל-2.0) מבוסס על A260/A280 קריאה.
  4. סנתז cDNA מ 1 μg של RNA כולל עם ערכת סינתזה cDNA סטנדרטית.
  5. לדלל cDNA לאחרונה 50 μL הכרך עם H2O.
  6. לנתח כל מדגם cDNA ב טרילקאט על ידי qPCR: להכין מיקס אחד qPCR בסיס (שולחן 1) כי הוא מספיק עבור התגובות הדרושות עבור כל פריימר, כולל מיוחד לשלושה גנים משק הבית כפקדים: גליראלדד-3-פופורה (ראה טבלת חומרים לרצפים פריימר), אקדירוגנאסי (החלק החומרי):
  7. לחלק 18 μL של ערבוב מאסטר בכל טוב בצלחת מרובת הקיר PCR.
  8. הוסף 2 μL של דגימת cDNA בכל באר. . סגור את הלוחית
  9. הפעל את הדגימות בהתאם להוראות הציקלאה התרמית.

8. הערכת עומס יתר של שומנים ושסטרומטוזיס אינדוקציה: מכוניות

  1. תקן את התאים שהוכנו קודם לכן על מנות עם תחתית זכוכית, כמתואר בשלבים 5.1-5.3.
  2. החלף על מערכת לייזר פעמו מסחרית פורק לספק, כוונון זה כדי להשיג שתי תפוקות של אורכי גל שונים. הפרש התדר בין התפוקות חייב להיות 2,840 ס מ-1 כדי ליצור את האות מכוניות אינטנסיבי האור המתאים מתיחה סימטרית מתילן; עבור פלט באורך גל קבוע ב 1,064 nm ("סטוקס" אור), אורך הגל השני צריך להיות מכוון 817 nm ("משאבת" אור).
  3. ודא את 817 ננומטר הפלט הוא מרחב ו באופן זמני עם פלט ננומטר 1,064: השימוש מראה דיקרואיק מתאים (כלומר, עם חתך בין 817 ו 1,064 nm) כדי מרחב לשלב את הקורות ולהשתמש קו השהיה אופטי כדי להשיג חפיפה הזמני של הלייזר פולסים.
  4. ודאו ששתי הקורות הנקוטים הן מקבילות ושהקטרים שלהם כוללים ערכים דומים המתאימים למערכת האופטית בתוך המיקרוסקופ שיתמקדו אותם על המדגם; במידת הצורך, הדבר משלב בנפרד את הקורות לפני המראה הדיקרואיק שמשלב אותם.
  5. הפעל על מערכת מיקרוסקופ הפוכה מסחרי, אשר צריך לכלול יחידת סריקת לייזר אינפרא אדום ויחידה כפולה אדום/ירוק לזיהוי אפינפרין וליישר את קרני לייזר copropagating לתוך יחידת הסריקה.
  6. פתיחת יחידת הזיהוי אפינפרין-channel כפול, להסיר את קוביית הפילטר ולהחליף את מסנן הזיהוי של הגל האדום שלה עם מסנן bandpass שיכול לבחור את האות 2,840 ס"מ-1 מכוניות ממורכז ב 663 nm עבור 817/1064 nm משאבת/סטוקס הריגוש ערכת. מסנן רוחב פס צר (20 ננומטר) מועדף כדי למנוע את האוסף של רמות גבוהות של אותות רקע פלורסנט.
  7. מניחים צלחת על הבמה של מיקרוסקופ מכוניות הפוכה, ובאמצעות 100x המטרה טבילה בשמן, להזיז את המיקום האנכי של המטרה להתמקד על התאים.
  8. להגדיר את תוכנת מיקרוסקופ כדי לאסוף ברזולוציה גבוהה (1024 x 1024 פיקסלים) תמונות מעל שדה של תצוגה הפורש 127 יקרומטר x 127 יקרומטר.
  9. הגדר את תוכנת המיקרוסקופ ברציפות לרכוש ולהציג תמונות של 127 יקרומטר x 127 יקרומטר שדה התצוגה לבדוק את התמונות המוצגות תוך אופטימיזציה של הפרמטרים אוסף התמונה. ודא שכוחות הלייזר מאוזנים לצורך איסוף תמונה מהירה ונזק מינימלי, הוספת מסנני דחיסות נייטרלית מתאימים בנתיבי הקרן בהתאם לצורך, ובחר בפיקסל לשכון זמן המאפשר את אוסף התמונות עם צליל לרעש טוב יחס מתחת לתנאי צריכת החשמל בלייזר שנבחרו.
  10. לרכוש ולשמור תמונות של שדות מספר שונים של תצוגה בתוך המנה תחת התנאים האופטימליים. באופן אופציונלי, תמונות מרובת פוטון הפוטונים, שנוצר על ידי פליטה ירוק-גל (בעיקר משני הפוטון עירור ב 817 ננומטר), ניתן לאסוף בו דרך גלאי האפינפרין אחרים. חזור על שלבים 8.7-8.10 עבור כל מנה.
  11. לניתוח תמונות מכוניות, הדפסת תמונות באמצעות הטמעת היישום של ImageJ. הפעל את הפונקציה הדאכקלה (או כלי מעבר דומה) על כל תמונה לפני ניתוח נוסף כדי לשפר את יחסי האות לרעש ללא אובדן פרטים.
  12. השתמש בפיג כדי לבחור תאים באופן ידני ולאחר מכן באופן אוטומטי לספור טיפות השומנים בתוך תאים בודדים מקוטע כדי לייצר נתונים סטטיסטיים על אזורי droplet ליפיד ומספרים עבור כל תא ועבור כל ערכת הנתונים של התמונה עבור כל מנה.

9. שיטת הכדאיות של תא MTT

  1. הצלחת הבדיל התאים HepaRG לתוך צלחת 96-באר עם צפיפות של 1 x 105 תאים/גם בהיקף הסופי 100 μl של מדיום תרבות בידול.
  2. 24 שעות לאחר זריעה, לטפל בתאים עם 99% מתנול (רכב) עם 100 μm, 250 μm ו500 μm נתרן אולאט ו נתרן palmitate מדולל ב 100 μl של בידול תרבות בינונית/גם ב טרילקאט.
  3. לשנות את המדיום עם 99% מתנול ו עם 100 μm, 250 μm ו500 μm נתרן אולאט נתרן palmitate מדולל ב 100 μl של בידול תרבות בינונית/גם כל 24 h.
  4. 96 h לאחר הטיפול מתנול/נתרן הרדוף/נתרן palmitate, לטפל בתאים עם 2 μM דוקסורוביצין מדולל ב 100 μL של בידול תרבות בינונית/גם בטרילקאט כפקד.
  5. 18 h לאחר הטיפול doxorubucin, לשנות את המדיום עם 100 μL של בידול תרבות בינונית.
  6. Pipet 20 μL של 3-(4, 5-דימתיל thiazol-2-yl)-5-(3-carboxyמתיונין)-2-(4-sulfophenyl)-2H-טטרזולה (שולחן החומרים) לתוך כל באר של 96-היטב הצלחת המכיל את התאים ב 100 μl של תרבות בינונית בינוני . כלול בקרת רקע על ידי ליטוף 20 μL של מגיב לתוך שליטה היטב ללא תאים בשנת 100 μL של בידול התרבות בינונית בטרילקאט.
  7. מודקת את הצלחת ב 37 ° c בתוך מחולל לחות, 5% CO2 האווירה.
  8. לאחר הדגירה של 30, 60, ו 90 דקות עם מגיב MTT הטטריום, להקליט את ספיגת בשנת 490 nm באמצעות קורא הצלחת 96-באר. הפחת את ספיגת הרקע של בארות הבקרה ללא תאים מערכי הספיגה של הדגימות האחרות.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

פרוטוקול זה מתאר שיטה יעילה כדי לגרום ולאפיין את הסטירומטוזיס בתאי ה-dmso-בונות heparg על ידי נתרן אולאט הטיפול (איור 1א).

הבידול בתאי HepaRG.
כדי לגרום ביעילות לבידול, תאים מתרבים חייב להיות נזרע בצפיפות נמוכה (2.5 x 104 תאים/cm2) במדיום התפשטות. כאשר הזרע בצפיפות נמוכה, התאים באופן פעיל להפריד ולרכוש מורפולוגיה מוארך (איור 1B). התאים צריכים להיות שמאל לצמוח בתוך המדיום התפשטות במשך 7 ימים, עד 100% השטף הוא הגיע (איור 1ג). לאחר החשיפה 2% DMSO, התאים מתחילים להבדיל וליצור מושבות hepatocyte אופייני המוקף בתאי אפיתל המרה (איור 1ד). הבדיל תאים HepaRG לבטא סמנים ספציפיים, כגון אלבומין, Cyp3A4 ו Aldolase B. כדי לאמת הבחנה נכונה, את רמות הביטוי של גנים אלה סמן הכבד בתאים הבדיל (יום 21) ובתאים מתרבים (היום 0) נותחו על ידי qPCR (איור 1E). אלבומין, Cyp3A4 ו Aldolase הגנים צריך להיות upregulated בתאי HepaRG הבדיל לעומת תאים HepaRG מתרבים, ואנו הבחנו מגמה זו, המאשרת את האפקטיביות של פרוטוקול הבידול שלנו.

אינדוקציה של שרירי החזה בתאי heparg על ידי נתרן אולאט הטיפול.
נתרן אולאט הטיפול של תאים dHepaRG גורם הצטברות שומן, גלוי תחת מיקרוסקופ אופטי כמו טיפות השומנים ב cytoplasms (איור 2א). כדי לוודא אינדוקציה יעילה של סטירומטוזיס, הרדוף התייחס ושליטה התאים HepaRG היו מוכתמים בצבעי שמן אדום O. לאחר הצביעת, טיפות שומנים בקלות לעין כמו טיפות אדום (איור 2ב) והוא יכול להיות מכמת על ידי מדידה Spectrophotometric של שמן אדום O צבע שחומק עם איזופנול (איור 2ג). ספיגה של שמן אדום המנוע מן התאים הוא פרופורציונלי ישירות כדי cytoplasmic הצטברות השומנים droplet.

הריכוז נתרן הרדוף וזמן חשיפה נקבע על ידי שיטת היכולת של התאים MTT צביעה מטרי (שלב 9). הטיפול נתרן אולאט הושווה נתרן palmitate הטיפול התרופה האפוטוטית doxorubucin (2 μm) שימש כפקד (איור 2ד). רעילות של תרכובות הוערך על ידי MTT, ניצול מתחם מסחרי (טבלת חומרים), אשר מכיל את mtt הטטריום. המתחם הצהוב מסיסים במים, מורכב על ידי תאים metabolically פעילים לתוך מוצר בלתי מסיסים במים סגולים. המוצר הפורמזאן מכמת על-ידי ספיגת ה490 ננומטר והסכום ביחס ישיר למספר תאי המחיה בתרבות (איור 2ד).

קוונפיקציה של שלפוחית החזה בנתרן הרדוף-הטיפול בתאי HepaRG
כדי לכמת את העלייה של תוכן השומנים הסלולר לאחר טיפול נתרן אולאט, אנו ביצעו כתמים עם צבען bodipy, בדיקה כי תוויות טיפות השומנים. באמצעות ניתוח ציטופלוורימטרי, ניתן לכמת את תוכן הטריגליצרידים על ידי משמעות הפלורסנט Bodipy, אשר גבוה יותר בתאי הרדוף התייחס לעומת תאים בקרה (איור 3A, B), המציין שומן יעיל הצטברות לאחר הטיפול האולאט. אכן, תמונות של התאים ויטראז ' בהיר טיפות השומנים ירוק פלורסנט בתאים שטופלו oleate שאינם גלויים בתאי הבקרה (איור 3ג).

נתרן אולאט הטיפול של תאים dHepaRG מראש מטבוליזם השומנים וביטוי גנים דלקתיים. כדי להעריך אינדוקציה יעילה של שרירי החזה, ניתחנו על ידי qPCR את רמות הביטוי של הגנים הנבחרים בתאי הרדוף האואט נתרן לעומת אלה של תאי בקרה (איור 4). אצטריל-CoA קרבוקסיקלז ביתא (ACACB), גליצרול-3-פוספט acyltransferase מיטוכונדריאלי (gpam), פרליפינים (PLIN2, PLIN4), אפוליפופרוטאין B (apob), פירובט דהידרוגנאז קינאז (CPT1A), קרטין פלמיטאיאז 1a ו אינטרלויקין 6 (IL6) היו upregulated בתאי מטופלים dHepaRG, בעוד משפחה הנושאת מסיסות 2 חבר 1 (SLC2A1), אפוליפופרוטאין C-III (APOC3), ו stearoyl-CoA desaturase (scd) היו מוסתות (איור 4). כדי לאפיין עוד ולכמת שומנים באחסון בטיפות על תוספת של נתרן אולאט כדי הבדיל התאים heparg, אנו מנוצל טכניקה מיקרוסקופית חדשני, מיקרוסקופית אנטי סטוקס הקוהרנטי פיזור (מכוניות) מיקרוסקופ, אשר מאפשר ויזואליזציה וכימות של טיפות השומנים ללא תיוג (איור 5א). טיפות השומנים היו מקוונו מבחינה סטטיסטית במונחים של מספרים, הפצה מורפולוגיה ברמת תא בודד באמצעות תמונות מכוניות. הטיפול עם נתרן אולאט (250 μm) המושרה עלייה משמעותית במספר טיפות השומנים (איור 5B), אשר הובילו לאזור ה-droplet הכולל גבוה יותר לכל תא (איור 5ג) ואזור droplet גבוה יותר באחוזים ( איור 5ד), לעומת שליטה בתאים, המציין כי dHepaRG תאים שהצטברו ביעילות שומן לאחר טיפול נתרן אולאט.

Figure 1
איור 1 : בידול של תאים HepaRG. (א) דיאגרמת מייצגים המציגה את פרוטוקול הבידול/הטיפול בתאים כמתואר בשלבים 3 ו-4. (B-D) תמונות המציגות בלתי מוכתם תאים HepaRG ביום 0 לאחר זריעה (ב), במפגש יום 7 לאחר זריעה (C), והבדיל Heparg (dHepaRG) ביום 21 לאחר זריעת (ד). (ה) סה כ RNA הופק מתוך מתרבים ו dHepaRG תאים, cdna היה מסונתז ונותח על ידי qpcr באמצעות מפרט התחל עבור הגנים המצוין (טבלת חומרים). הדגימות היו מנורמלות למשמעות של הגנים האחרים של שירות הניקיון הבין-לבין. היסטגרמות מציגות אינדוקציה מקפלים של מתרבים (היום 0) לעומת תאים הבדיל (יום 21) (בארים מצביעים על ש גויטיין; p-ערכים חושבו על-ידי התלמיד t-בדיקות). אנא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

Figure 2
איור 2 : הטיפול נתרן הרדוף של תאים dHepaRG המושרה הצטברות droplet השומנים. (A) תמונות של בלתי מוכתם הבדיל heparg (dHepaRG) תאים שטופלו 5 ימים עם הרכב (שליטה) (התמונה השמאלית) או עם 250 μm נתרן אולאט (התמונה הימנית). (ב) לאחר הטיפול, התאים היו מוכתמים עם צבע אדום O שמן; טיפות השומנים גלויים באדום. (ג) השמן האדום צבען היה מורד ו OD נמדד ב 570 nm. התוצאות מתבטאות כאמצעי לשלושה ניסויים עצמאיים (ברים מצביעים על ש גויטיין; ערך p לפי מבחן t של סטודנט). (D) הערכת הכדאיות של הרכב dHepaRG תאים (99% מתנול) טיפל (Ctrl) או מטופלים עבור 5 ימים עם נתרן אולאט ו נתרן palmitate (100 μm, 250 μm, או 500 μm), או מטופלים 18 h עם doxorubucin (2 μm).  הערכה של רעילות ציטוזה בוצעה באמצעות ערכת הספק MTT (טבלה של חומרים), ספיגת הקלטה ב 490 nm, על פי הוראות היצרן. תוצאות מבוטא כאמצעי של שלושה ניסויים עצמאיים (בארים מצביעים על ש גויטיין; p-ערכים נקבעו באמצעות t-test של סטודנט: * 0.01 ≤ p < 0.05; * * 0.001 ≤ p < 0.01; * * * p < 0.001). אנא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

Figure 3
איור 3 : קוונפיקציה של הצטברות שומן לאחר הטיפול נתרן אולאט ידי כתמים bodipy. הבדיל heparg (dHepaRG) תאים טופלו עם הרכב (שליטה) או עם 250-μm נתרן אולאט עבור 5 ימים. לאחר הטיפול, תאים dHepaRG היו מוכתמים בצבע Bodipy ונותחו על ידי cy try זרימה. (א) פרופילי שכבת-על מייצגים (% ממקסימום: אחוז מעוצמת הצביעה המירבית). (ב) היסטגרמות מציגות עוצמת קרינה פלואורסצנטית (mfi) כאחוז של תאים מטופלים על שליטה מפני שלושה ניסויים עצמאיים (בארים מצביעים על ש גויטיין; p-ערכים נקבעו באמצעות t-Test של סטודנט: * 0.01 ≤ p < 0.05; * * 0.001 ≤ p < 0.01; * * * p < 0.001). (ג) תאים תוקנו עם 4% פאראפורמלדהיד. תמונות מראה Bodipy-טיפות השומנים ויטראז ' בירוק. אנא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

Figure 4
איור 4 : הטיפול נתרן לאואט של dHepaRG תאים הגורם רגולציה של חילוף החומרים לשומנים וביטוי גנים דלקתיים. הבדיל heparg (dHepaRG) תאים טופלו עם הרכב (שליטה) או עם 250-μm נתרן אולאט עבור 5 ימים. cDNAs נותחו על ידי ה-qPCR בעלי משמעות מדויקת לגבי הגנים המצוינים והתוצאות היו מנורמלות למשמעות של הגנים של שירות הניקיון הבין-מדויק של המאה ה-50, האקב ו-18. התחל ומוענק בלוח החומרים. ההיסטוגרמה מציגה רמות ביטוי של גנים שצוינו כאינדוקציה מקפלים של תאים מטופלים על שליטה (בארים מצביעים על ש גויטיין; ערכי p חושבו על-ידי מבחן t של סטודנט). אנא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

Figure 5
איור 5 : אפיון של הצטברות droplet השומנים לאחר הטיפול נתרן אולאט של מכוניות מיקרוסקופ. הבדיל heparg (dHepaRG) תאים טופלו עם הרכב (שליטה) או עם 250 μm נתרן אולאט עבור 5 ימים נותחו על ידי מיקרוסקופ מכוניות. (א) תמונות מייצגות המציגות השומנים מכוניות droplet ניגודיות באדום. (ב) היסטוגרמה מראה את המספרים של טיפות שומנים בדם לכל תא. (ג) היסטגרמות מציג שטח תמונה מוחלט מכוסה על ידי טיפות לכל תא. (ד) היסטוגרמה המציגה את האזור% droplet המכוסה בטיפות לכל תא. כל התוצאות מבוטא כאמצעי של שלושה ניסויים עצמאיים (בארים מצביעים על S.E.; p-ערכים נקבעו על-ידי מבחן t של הסטודנט: * 0.01 ≤ p < 0.05; * * 0.001 ≤ p < 0.01; * * * p < 0.001). אנא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

ריאגנטים אמצעי אחסון (μL) לתגובה בודדת
2x SYBR ירוק צבע פלורסנט 10
כיתה ה-PCR2O 6
פריימר קדימה (μM) 1
פריימר הפוכה (μM) 1

שולחן 1: מיקס מאסטר qPCR.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

פרוטוקול זה מתאר כיצד להבדיל בין תאי heparg וכיצד לגרום למצב של שלפוחית השתיקה על ידי נתרן אולאט הטיפול (איור 1א). ואכן, לעומת התאים האחרים קרצינומה של hepatocellular (HCC) קווי תא, קו התאים heparg מציג תכונות של האדם בוגרים hepatציטים, המייצג חלופה בעלת ערך ל ex vivo טיפח האדם הראשי hepatציטים13,14 ,15. קו התאים heparg שימש באופן נרחב עבור לימודי הכבד, מטבוליזם התרופות, ומחקרי וירולוגיה15,16,22.

בהשוואה לתאי heparg, קווי תא אחרים של HCC כגון HepG2, HUH7, HUH6 ו Hep3B להציג קיבולות מטבוליות נמוכות יותר, חסר סט משמעותי של פונקציות ספציפיות לכבד23,24, והצגת רמה בסיס גבוהה יותר של cytosolic הצטברות שומן מאוחסן טיפות השומנים. לפיכך, אלה קווי תא HCC הם פחות שימושיים כמודלים עבור אינדוקציה של שלפוחית היתר לאחר העומס יתר של השומנים מאשר קו התאים HepaRG.

צעדים קריטיים בפרוטוקול
כאשר הנזרע בצפיפות נמוכה (2.5 x 104 תאים/ס"מ2), התאים heparg לרכוש מבנה מובחן מוארך, פעיל חלוקה; לאחר שהגיע 100% שליטה, הם מסוגלים להבדיל עם חשיפה 2% DMSO והם יוצרים מושבות hepatocyte טיפוסי מוקף בתאי המרה כמו אפיתל (איור 1ד). התרבות התאית המעורבת בכיס המרה/הפטוציט מהווה תכונות של רקמת הכבד, הדומה למצב פיזיולוגי, למרות המחסור בסוגים אחרים של תאי הכבד (sinusoidal או קופפר).

צעד קריטי בתהליך הבידול הוא השטף של התאים. התאים חייבים להיות שנזרע בצפיפות נמוכה (2.5 x 104 תאים/cm2) (איור 1ב) ומותר לגדול באופן פעיל באמצעי ההפצה לפחות 1 שבוע (יום 0-7). ביום 7, לפני הוספת 2% DMSO כדי להתחיל את תהליך הבידול, התאים חייבים להיות במפגש 100% (איור 1ג). אם ביום 7 (שלב 2.2) לא הגיע שליטה מלאה, מומלץ מאוד כי התאים מורשים להמשיך ולצמוח בתוך המדיום ההפצה לכמה ימים נוספים, עד 100% המפגש מושגת.

מגבלות הפרוטוקול
זה כבר נצפתה כי לאחר הוספת בידול בינוני, כמה תאים סובלים, ובדרך כלל 10% של תאים למות במהלך 2-3 ימים הבאים. בשלב זה, כביסה יומית שינוי בינוני (שלב 2.4) יש להמשיך להשליך תאים מתים צף. השימוש של FBS ספציפי (טבלת חומרים) כדי להשלים הן בידול התקשורת התפשטות, צריך להגביר את יעילות הבידול ואת מוות התאים התחתון במהלך ימים 7-21 (שלב 2.4). מומלץ מאוד לשמור על התאים עד למעבר 20, ולבחור בפסקאות נמוכות יותר (< 20) עבור תאים מבדילים: פחות תאים מוות מתרחש עבור תאי HepaRG הצעיר. יתר על כן, בידול HepaRG נראה יעיל יותר 35 מ"מ ו 60 מ"מ מנות, בעוד תאים נוטים לסבול יותר כאשר הזרע ב 100 mm ו 150 מנות mm.

שינויים ופתרון בעיות
חשיפה ליחס שונה של חומצות שומן פלמיטיק ו אולאית הוכח לגרום להיווצרות טיפות השומנים תאיים שומנים בדם25,26. עם זאת, הבחנו כי הטיפול סודיום לאואט של תאים HepaRG הבדיל הציגו תוצאות טובות יותר מאשר החשיפה חומצה פלמיטית, במונחים של אינדוקציה יעילה של הצטברות השומנים והכדאיות התא (איור 2ד). אכן, הטיפול בחומצה פלמיטית הוכיחה להיות רעיל עבור הבדיל תאים heparg (איור 2ד), בהסכם עם נתוני הספרות על הקווים של תא heparg ועל התרבויות האדם והחולדה הראשונה והעכברוש המתארים חומצה פלמיטית כ , סוכן ציטוטוקסיי באופן משמעותי25,26,27,28,29 יתר על כן, הניצול של palmitate בתא מבוסס בחני הוא מאתגר בשל מסיסות נמוך שלה. אף על פי כן, בשל השונות הפנימית של קווי התאים, מומלץ לאמת את הנתרן לאואט העבודה ריכוז ואורך זמן הטיפול, בדיקת ריכוזים שונים בניסוי זמן-קורס עם שיטת הכדאיות של התא.

משמעות והשוואה של טכניקות זיהוי השומנים
קביעה מדויקת של כמויות השומנים בתאים הוקמה באמצעות מספר גישות שונות במחקר זה. איכותית וגם בקירוב הסכם כמותי נצפתה בין התוצאות שהתקבלו באמצעות כתמים של שמן אדום או, כתמים Bodipy, והדמיה מכוניות. להערכה מהירה של כמויות השומנים באוכלוסיות תאים, השימוש Bodipy-זרימה cy, לנסות או כתם כגון שמן אדום O הוא אידיאלי. לבדיקה מפורטת יותר של התוכן droplet השומנים של תאים, מודאליות הדמיה היא המועדפת. יתר על כן, בעיות ספציפיות דווחו עבור כתמי השומנים כגון שמן אדום O20,30, ואנו יש לנו ציין כי במקרים מסוימים, הכתם bodipy יש קיבולת נמוכה יותר מאשר מכוניות לתווית בלעדית טיפות השומנים בין התא השני אורגלים (נתונים לא מוצגים). לפיכך, השימוש בטכניקת דימות מיקרוסקופי ללא תווית, כגון מכוניות, מספק יתרונות משמעותיים לכימות ואפיון. הימנעות השימוש של תווית פלורסנט גדול עושה מכוניות הדמיה חיובית בשל גודל קטן של מולקולות השומנים לעומת fluorophores אופייני; מכאן, לאיתור שומנים, שיטות ללא תווית רצויות, אפילו יותר מאשר התבוננות במולקולות חלבון גדול. האות מכוניות ליפיד הוא פליטה אופטית שנוצרת רק כאשר אינטראקציה לא לינארית מתרחשת במדגם. אינטראקציה זו ניתן לזהות רק כאשר ההבדל בין התדרים של לייזרים שני עירור התמקדו המדגם מתאים מתילן (CH2) מתיחה תדר תנודה. השפע של קבוצות מתילן בשומנים תוצאות אותות עזים מאוד עם יחסי אות לרעש גבוה, ואת הnonlinearity של האינטראקציה האופטית גם אומר כי הפתרון המרחבי הגבוה אפשרי במיקרוסקופ מכוניות. איכות מעולה של תמונות מכוניות באופן כללי מאפשר את אוסף הסטטיסטיקות על הגדלים והמספרים של טיפות השומנים, כפי שמתואר במחקר זה. בנוסף, מחקרים אחרים הוכיחו את השימוש של מיקרוסקופ מכוניות לתיאום לוקליזציה subcellular שונים וגדלים של טיפות שומנים בדם עם טיפולים שונים18, ועל ידי שימוש מדידות מכוניות משלימות באורכי גל שונים, או מכוניות פס רחב או גישה דומה ראמאן מגורה, החוקרים הראו כי ניתן לאפיין סוגים שונים של חומצות שומן בתוך טיפות השומנים31,32. יתר על כן, מהירות של אוסף תמונות מכוניות אפשרה הדמיה באתרו של תאים חיים כדי לבחון את האבולוציה הטמפורלית של שומנים בצמיחה וצבירת33.

יישומים עתידיים
בעשורים האחרונים, צפיות על תפקידים ופונקציות של טיפות שומנים בדם בביולוגיה התא התפתחו. בעבר חשבו להיות למעשה אחסון ושלפוחיות, הם הבינו כעת להיות מאוד דינמי הסלולר אורגלים, ואת תפקידם במחלות הוא יותר ויותר להיות מזוהה34,35,36. למרות במקרה של מחלת כבד, הצטברות השומנים (steatosis) כבר זמן רב ידוע להיות היבט קריטי, המנגנון המדויק של מעורבות של טיפות שומנים בהתקדמות המחלה אינה ברורה לחלוטין. לכן, שיטות כגון מכוניות שיכולות לאפיין את ההתנהגות הדינמית של טיפות שומנים בדם הם בעלי חשיבות קריטית לפיתוח הבנה מולקולרית של מחלות כולל NAFLD. ביטוי גנים מטבולית ניתוח על ידי qpcr הוא משלים מאוד הדמיה מולקולרית של שומנים באמצעות מכוניות, כפי שמתואר במחקרים קודמים17,18, המאפשר תובנות עמוקות יותר לתוך מנגנוני מחלות. במחקר הנוכחי, אנו צופים הצטברות חומצות שומן עם רגולציה של חילוף החומרים לשומנים וביטוי גנים דלקתיים, אשר עשוי לתרום לבניית פאנל של ביו-סמנים עבור אבחון מחלה מוקדמת.

הנתרן oleate התייחס dHepaRG תא מבוסס מודל עשוי להגביר את הידע של מנגנונים מולקולריים מעורב לא רק בתחילת אלא גם בהתקדמות של NAFLD, מתן בסיס לפיתוח של גישות טיפוליות טוב יותר למחלה.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

המחברים מצהירים כי אין להם אינטרסים פיננסיים מתחרים.

Acknowledgments

אנו מודים לפרופ ' כריסטיאן טרפו (INSERM U871, ליון, צרפת), שסיפק באדיבות תאי HepaRG. אנחנו אסירי תודה לריטה אפודיה. לעזרה ניהולית עבודה זו נתמכת על ידי MIUR-Ministero dell, האוניברסיטה הרומית (FIRB 2011 – 2016 RBAP10XKNC) ו Sapienza אוניברסיטת רומא (פרוט. C26A13T8PS; פרוט. C26A142MCH; פרוט. C26A15LSXL).

Materials

Name Company Catalog Number Comments
Hyclone HyClone Fetal Clone II  GE Healthcare SH30066
William’s E medium with GlutaMAX  Thermofisher 32551087
Penicillin/streptomycin  SIGMA P4333
Insulin  SIGMA I9278
Hydrocortisone hemisuccinate SIGMA H2270
DMSO, dimethyl sulfoxide SIGMA D2438   
Sodium Oleate SIGMA O7501 
Methanol SIGMA 179337
Isopropanol SIGMA 278475
BODIPY 505/515 Thermofisher D3921
PBS Thermofisher 14190-250
Formaldehyde solution SIGMA 252549
RNAse free DNAseI Promega M198A 
Glass-bottomed dishes Willco Wells GWST-5040
Oil Red solution SIGMA O625
CellTiter 96 AQueous One Solution Promega  G3582
q-PCR oligo name Sequence
ACACB FOR CAAGCCGATCACCAAGAGTAAA
ACACB REV CCCTGAGTTATCAGAGGCTGG
β-actin FOR GCACTCTTCCAGCCTTCCT
β-actin REV AGGTCTTTGCGGATGTCCAC
ALBUMIN FOR TGCTTGAATGTGCTGATGACAGG
ALBUMIN REV AAGGCAAGTCAGCAGGCATCTCATC
ALDOB FOR GCATCTGTCAGCAGAATGGA 
ALDOB REV TAGACAGCAGCCAGGACCTT
APOB FOR CCTCCGTTTTGGTGGTAGAG
APOB REV  CCTAAAAGCTGGGAAGCTGA
APOC3 FOR CTCAGCTTCATGCAGGGTTA
APOC3 REV GGTGCTCCAGTAGTCTTTCAG
CPT1A FOR TCATCAAGAAATGTCGCACG
CPT1A REV GCCTCGTATGTGAGGCAAAA
CYP2E1 FOR TTGAAGCCTCTCGTTGACCC
CYP2E1 REV CGTGGTGGGATACAGCCAA
CYP3A4 FOR CTTCATCCAATGGACTGCATAAAT
CYP3A4 REV TCCCAAGTATAACACTCTACACAGACAA
GAPDH FOR TGACAACTTTGGTATCGTGGAAGG
GAPDH REV AGGGATGATGTTCTGGAGAGCC
GPAM FOR TCTTTGGGTTTGCGGAATGTT
GPAM REV ATGCACATCTCGCTCTTGAATAA
IL6 FOR CCTGAACCTTCCAAAGATGGC
IL6 REV ACCTCAAACTCCAAAAGACCAGTG
PDK4 FOR ACAGACAGGAAACCCAAGCCAC
PDK4 REV TGGAGGTGAGAAGGAACATACACG
PLIN2 FOR TTGCAGTTGCCAATACCTATGC
PLIN2 REV CCAGTCACAGTAGTCGTCACA
PLIN4 FOR AATGAGTTGGAGGGGCTGGGGGACATC
PLIN4 REV GGTCACCTAAACGAACGAAGTAGC
SCD FOR TCTAGCTCCTATACCACCACCA
SCD REV TCGTCTCCAACTTATCTCCTCC
SLC2A1 FOR TGCTCATCAACCGCAACGAG
SLC2A1 REV CCGACTCTCTTCCTTCATCTCCTG
18S FOR CGCCGCTAGAGGTGAAATTC
18S REV TTGGCAAATGCTTTCGCTC

DOWNLOAD MATERIALS LIST

References

  1. Starley, B. Q., Calcagno, C. J., Harrison, S. A. Nonalcoholic fatty liver disease and hepatocellular carcinoma: a weighty connection. Hepatology. 51, (5), 1820-1832 (2010).
  2. Byrne, C. D., Targher, G. NAFLD: a multisystem disease. Journal of Hepatology. 62, (1), Suppl 47-64 (2015).
  3. Marra, F., Gastaldelli, A., Svegliati Baroni, G., Tell, G., Tiribelli, C. Molecular basis and mechanisms of progression of non- alcoholic steatohepatitis. Trends in Molecular Medicine. 14, 72-81 (2008).
  4. Chalasani, N., et al. The diagnosis and management of nonalcoholic fatty liver disease: Practice guidance from the American Association for the Study of Liver Diseases. Hepatology. 67, (1), 328-357 (2018).
  5. Banini, B. A., Sanyal, A. J. Current and future pharmacologic treatment of nonalcoholic steatohepatitis. Current Opinion in Gastroenterology. 33, (3), 134-141 (2017).
  6. Takahashi, Y., Sugimoto, K., Inui, H., Fukusato, T. Current pharmacological therapies for nonalcoholic fatty liver disease/nonalcoholic steatohepatitis. World Journal of Gastroenterology. 21, (13), 3777-3785 (2015).
  7. Younossi, Z., et al. Global burden of NAFLD and NASH: trends, predictions, risk factors and prevention. Nature Reviews Gastroenterology & Hepatology. 15, (1), 11-20 (2018).
  8. Santhekadur, P. K., Kumar, D. P., Sanyal, A. J. Preclinical models of non-alcoholic fatty liver disease. Journal of Hepatology. 68, (2), 230-237 (2018).
  9. Nagarajan, P., Mahesh Kumar, M. J., Venkatesan, R., Majundar, S. S., Juyal, R. C. Genetically modified mouse models for the study of nonalcoholic fatty liver disease. World Journal of. Gastroenterology. 18, (11), 1141-1153 (2012).
  10. Oseini, A. M., Cole, B. K., Issa, D., Feaver, R. E., Sanyal, A. J. Translating scientific discovery: the need for preclinical models of nonalcoholic steatohepatitis. Hepatology International. 12, (1), 6-16 (2018).
  11. Ramboer, E., Vanhaecke, T., Rogiers, V., Vinken, M. Immortalized human hepatic cell lines for in vitro testing and research purposes. Methods in Molecular Biology. 1250, 53-76 (2015).
  12. Gómez-Lechón, M. J., Donato, M. T., Castell, J. V., Jover, R. Human hepatocytes in primary culture: the choice to investigate drug metabolism in man. Current Drug Metabolism. 5, (5), 443-462 (2004).
  13. Marion, M. J., Hantz, O., Durantel, D. The HepaRG cell line: biological properties and relevance as a tool for cell biology, drug metabolism, and virology studies. Methods in Molecular Biology. 640, 261-272 (2010).
  14. Gripon, P., et al. Infection of a human hepatoma cell line by hepatitis B virus. Proceedings of the National Academy of Sciences. 99, (24), 15655-15660 (2002).
  15. Anthérieu, S., Rogue, A., Fromenty, B., Guillouzo, A., Robin, M. A. Induction of vesicular steatosis by amiodarone and tetracycline is associated with up-regulation of lipogenic genes in HepaRG cells. Hepatology. 53, (6), 1895-1905 (2011).
  16. Rouge, A., et al. PPAR agonists reduce steatosis in oleic acid-overloaded HepaRG cells. Toxicology and Applied Pharmacology. 276, (1), 73-81 (2014).
  17. Belloni, L., et al. Targeting a phospho-STAT3-miRNAs pathway improves vesicular hepatic steatosis in an in vitro and in vivo model. Scientific Reports. 8, 13638 (2018).
  18. Nunn, A. D. G., et al. The histone deacetylase inhibiting drug Entinostat induces lipid accumulation in differentiated HepaRG cells. Scientific Reports. 6, 28025 (2016).
  19. Donato, M. T., et al. Cytometric analysis for drug-induced steatosis in HepG2 cells. Chemico-Biological Interactions. 181, (3), 417-423 (2009).
  20. Hellerer, T., Axäng, C., Brackmann, C., Hillertz, P., Pilon, M., Enejder, A. Monitoring of lipid storage in Caenorhabditis elegans using coherent anti-Stokes Raman scattering (CARS) microscopy. Proceedings of the National Academy of Sciences. 104, (37), 14658-14663 (2007).
  21. Le, T. T., Ziemba, A., Urasaki, Y., Brotman, S., Pizzorno, G. Label-free evaluation of hepatic microvesicular steatosis with multimodal coherent anti-Stokes Raman scattering microscopy. PLoS One. 7, (11), 51092 (2012).
  22. Guillouzo, A., Corlu, A., Aninat, C., Glaise, D., Morel, F., Guguen-Guillouzo, C. The human hepatoma HepaRG cells: a highly differentiated model for studies of liver metabolism and toxicity of xenobiotics. Chemico-Biological Interactions. 168, (1), 66-73 (2007).
  23. Nelson, L. J., et al. Human hepatic HepaRG cells maintain an organotypic phenotype with high intrinsic CYP450 Activity/metabolism and significantly outperform standard HepG2/C3A cells for pharmaceutical and therapeutic applications. Basic & Clinical Pharmacology & Toxicology. 120, (1), 30-37 (2017).
  24. Gerets, H. H. J., Tilmant, K., Gerin, B., Chanteux, H., Depelchin, B. O., Dhalluin, S., Atienzar, F. A. Characterization of primary human hepatocytes, HepG2 cells, and HepaRG cells at the mRNA level and CYP activity in response to inducers and their predictivity for the detection of human hepatotoxins. Cell Biology and Toxicology. 28, (2), 69-87 (2012).
  25. Pusl, T., et al. Free fatty acids sensitize hepatocytes to bile acid-induced apoptosis. Biochemical and Biophysical Research Communications. 371, (3), 441-445 (2008).
  26. Gentile, C. L., Pagliassotti, M. J. The role of fatty acids in the development and progression of nonalcoholic fatty liver disease. The Journal of Nutritional Biochemistry. 19, (9), 567-576 (2008).
  27. Mei, S., et al. Differential roles of unsaturated and saturated fatty acids on autophagy and apoptosis in hepatocytes. Journal of Pharmacological Experimental Therapy. 339, 487-498 (2011).
  28. Malhi, H., Bronk, S. F., Werneburg, N. W., Gores, G. J. Free fatty acids induce JNK-dependent hepatocyte lipoapoptosis. Journal of Biological Chemistry. 281, 12093-12101 (2006).
  29. Moravcová, A., Červinková, Z., Kučera, O., Mezera, V., Rychtrmoc, D., Lotková, H. The effect of oleic and palmitic acid on induction of steatosis and cytotoxicity on rat hepatocytes in primary culture. Physiological Research. 64, Suppl 5 627-636 (2015).
  30. Ohsaki, Y., Shinohara, Y., Suzuki, M., Fujimoto, T. A pitfall in using BODIPY dyes to label lipid droplets for fluorescence microscopy. Histochemistry and Cell Biology. 133, (4), 477-480 (2010).
  31. Rinia, H. A., Burger, K. N., Bonn, M., Müller, M. Quantitative label-free imaging of lipid composition and packing of individual cellular lipid droplets using multiplex CARS microscopy. Biophysical Journal. 95, (10), 4908-4914 (2008).
  32. Waschatko, G., Billecke, N., Schwendy, S., Jaurich, H., Bonn, M., Vilgis, T. A., Parekh, S. H. Label-free in situ imaging of oil body dynamics and chemistry in germination. Journal of The Royal Society Interface. 13, (123), (2016).
  33. Jüngst, C., Winterhalder, M. J., Zumbusch, A. Fast and long term lipid droplet tracking with CARS microscopy. Journal of Biophotonics. 4, (6), 435-441 (2011).
  34. Welte, M. A., Gould, A. P. Lipid droplet functions beyond energy storage. Biochimica et Biophysica Acta - Molecular and Cell Biology of Lipids. 1862, (10), Pt B 1260-1272 (2017).
  35. Cohen, S. Lipid droplets as organelles. International Review of Cell and Molecular Biology. 337, 83-110 (2018).
  36. Farese, R. V., Walther, T. C. Lipid droplets finally get a little R-E-S-P-E-C-T. Cell. 139, (5), 855-860 (2009).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics