Het induceren en karakteriseren van vesiculaire steatose in gedifferentieerde HepaRG cellen

Medicine

Your institution must subscribe to JoVE's Medicine section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

In deze studie beschrijven we een gedetailleerd protocol voor het induceren van lever vesiculaire steatose in gedifferentieerde HepaRG cellen met het vetzuur zout natriumoleaat en gebruiken we methoden voor de detectie en kwantificering van lipide accumulatie, inclusief coherente anti-Stokes Raman verstrooiing (AUTO'S) microscopie, cytofluorimetrische analyse, olie rood O kleuring, en qPCR.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Di Cocco, S., Belloni, L., Nunn, A. D., Salerno, D., Piconese, S., Levrero, M., Pediconi, N. Inducing and Characterizing Vesicular Steatosis in Differentiated HepaRG Cells. J. Vis. Exp. (149), e59843, doi:10.3791/59843 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Hepatische steatose vertegenwoordigt een metabole dysfunctie die voortvloeit uit een accumulatie van triglyceride-bevattende lipide druppeltjes in hepatocyten. Overmatige vetophoping leidt tot niet-alcoholische vette leverziekte (NAFLD), die mogelijk omkeerbaar is en kan evolueren naar niet-alcoholische Steatohepatitis (NASH) en uiteindelijk cirrose en hepatocellulair carcinoom (HCC). De moleculaire mechanismen die de accumulatie van lipiden in hepatocyten koppelen aan de progressie naar NASH, onomkeerbare leverbeschadiging, fibrose, cirrose en zelfs HCC blijven onduidelijk. Hiervoor zijn verschillende in vitro en in vivo modellen ontwikkeld om de pathologische processen te verheldigen die NAFLD veroorzaken. In de huidige studie beschrijven we een cellulair model voor de inductie van vesiculaire steatose van de lever die bestaat uit DMSO-gedifferentieerde humane hepatische HepaRG cellen behandeld met het vetzuur zout natriumoleaat. Inderdaad, natriumoleaat-behandelde HepaRG cellen accumuleren lipide druppeltjes in het cytoplasma en vertonen typische kenmerken van steatose. Dit in vitro menselijk model vertegenwoordigt een waardevol alternatief voor in vivo muizen modellen en de primaire menselijke hepatocyten. We presenteren ook een vergelijking van verschillende methoden voor de kwantificering en evaluatie van vetophoping in HepaRG cellen, waaronder olie rode O-kleuring, cytofluorimetrische Bodipy-meting, metabolische genexpressie analyse door qPCR en coherente anti-Stokes Raman verstrooiing (AUTO'S) microscopie. CARS imaging combineert de chemische specificiteit van Raman-spectroscopie, een chemische analysetechniek die bekend staat in de toepassingen van materiaalwetenschappen, met de voordelen van hoge-snelheid, hoge-resolutie niet-lineaire optische microscopie om nauwkeurige kwantificering van lipide accumulatie en lipide druppel dynamiek. De invoering van een efficiënt in vitro model voor de inductie van vesiculaire steatose, naast een nauwkeurige methode voor de kwantificering en karakterisering van lipide accumulatie, kan leiden tot de ontwikkeling van vroege fase diagnose van NAFLD via de identificatie van moleculaire markers en het genereren van nieuwe behandelstrategieën.

Introduction

Hepatische steatose wordt gedefinieerd als Intrahepatische vet accumulatie, binnen triglyceride-bevattende lipide druppeltjes, van ten minste 5% van de lever gewicht. Langdurige hepatische lipide-opslag is een potentieel omkeerbaar proces, echter, het kan leiden tot lever metabole dysfunctie, ontsteking en geavanceerde vormen van niet-alcoholische vette leverziekte (NAFLD), de overheersende oorzaak van chronische leverziekte in vele delen van de wereld1,2. Nafld is een multifactoriële ziekte die kan evolueren naar de agressievere niet-alcoholische Steatohepatitis (Nash), die op zijn beurt kan vorderen naar cirrose en, bij een klein percentage van de patiënten, tot hepatocellulair carcinoom (HCC)1,3. Er is momenteel geen goedgekeurde therapie beschikbaar als een specifieke behandeling voor nafld en de combinatie van dieet-en leefstijl modificaties blijft de pijler van nafld en Nash Management4,5,6.

De moleculaire mechanismen die leiden tot de ontwikkeling van hepatische steatose in de pathogenese van NAFLD moeten nog steeds worden opgehelderd7. In deze context zijn Muismodellen ontwikkeld om de progressie van de ziekte van de menselijke steatose te bestuderen. Een groot aantal verschillende modellen bestaat, en elk heeft zijn voor-en nadelen, met inbegrip van genetische, nutritionele en chemisch geïnduceerde modellen combineren verschillende benaderingen. Genetisch gemodificeerde (transgene of knock-out) muizen ontwikkelen spontaan leverziekte. Opgemerkt moet echter worden dat deze mutaties zeer zeldzaam zijn bij mensen en dat het verwijderen of overexpressie van een enkel gen (bijv. ob/ob-muis) de etiologie van de multifactoriële menselijke ziekte niet nabootsen op moleculair niveau8,9. Evenzo, de ziekte verworven door muizen na dieet of farmacologische manipulatie kan niet nabootsen van de effecten van menselijke diëten in verband met de ontwikkeling van NAFLD in man8. Diermodellen hebben echter de ontwikkelingen in het begrip van NAFLD vergemakkelijkt en deze aanpak is momenteel de meest gebruikte strategie in laboratoriumonderzoek. Niettemin, de replicatie bij mensen van resultaten verkregen in diermodellen herhaaldelijk is mislukt, waardoor slechte vertaling in de kliniek10.

Daarom kunnen in vitro modellen van NAFLD een fundamentele rol spelen in het verhelderend maken van de moleculaire mechanismen van NAFLD progressie, en ze vertegenwoordigen een waardevol hulpmiddel om een groot aantal verbindingen te schermen. Primaire celculturen, vereeuwigd cellijnen en lever biopsieën zijn uitgebreid gebruikt voor onderzoeksdoeleinden11. Primaire menselijke hepatocyten nauw lijken op menselijke klinische voorwaarden, maar er is een beperkt aantal donoren, en primaire celculturen vertonen slechte reproduceerbaarheid als gevolg van de variabiliteit van de cellen. Deze observaties, samen met ethische en logistieke kwesties, hebben geresulteerd in het gebruik van menselijke primaire hepatocyten wordt beperkt12. Dus, hepatische cellijnen vertegenwoordigen een handig alternatief, met een aantal essentiële voordelen ten opzichte van de primaire cultuur, als hepatische cellijnen groeien gestaag, hebben een bijna onbeperkte levensduur, en hebben een stabiel fenotype. Bovendien, cellijnen zijn gemakkelijk toegankelijk en de cultuur voorwaarden van hepatische cellijnen zijn eenvoudiger dan die van primaire hepatocyten en zijn gestandaardiseerd tussen verschillende laboratoria.

Hier beschrijven we in detail een in vitro cel-gebaseerd model van lever vesiculaire steatose, vertegenwoordigd door hepatische gedifferentieerde HepaRG cellen behandeld met het vetzuur natriumoleaat. De HepaRG cellijn werd opgericht van een vrouwelijke patiënt beïnvloed door hepatitis C infectie en een Edmondson Grade I goed gedifferentieerde lever tumor14. De HepaRG-cellijn is een humane bipotente voorlopercellen die kunnen differentiëren bij blootstelling aan 2% dimethylsulfoxide (DMSO) in de richting van twee verschillende fenotypes van de cel: biliaire-achtige en Hepatocyt-achtige. Gedifferentieerde HepaRG cellen (dHepaRG) delen sommige functies en eigenschappen met volwassen hepatocyten en bezitten de mogelijkheid om stabiel lever-specifieke genen zoals albumine, AldolaseB, cytochroom P450 2E1 (CYP2E1), en cytochroom P450 3A4 (CYP3A4)13 (stap 3). Behandeling van dheparg cellen met het vetzuur zout natriumoleaat (250 μM) voor 5 dagen leiden tot de generatie van cytoplasmatische lipide druppeltjes, nabootsen van de effecten van vette lever14,15,17,18 ( stap 4). Accumulatie van lipide druppeltjes kan gemakkelijk worden gedetecteerd door olie rood O kleuring (stap 5), een lysochroom vetoplosbare kleurstof die neutrale triglyceriden en lipiden rood-oranje vlekken. Om efficiënt kwantificeren lipiden in vette dHepaRG, hier illustreren we cytofluorimetrische analyse na kleuring met 4, 4-difluoro-1, 3, 5, 7-tetramethyl-4-Bora-3a, 4a-diaza-s-indacene (Bodipy 505/515) (stap 6), een lipofiele fluorescerende sonde die lokaliseert aan intracellulaire lipide lichamen en is gebruikt voor het labelen van lipide druppels19. Bovendien laten we hier zien hoe de steatose te evalueren door kwantitatieve polymerase kettingreactie (qPCR) (stap 7) genexpressie deregulering van verschillende metabole genen in dHepaRG cellen. Om de accumulatie van lipide druppeltjes na de behandeling met natriumoleaat verder te karakteriseren en te kwantificeren, voerden we coherente anti-Stokes Raman verstrooiing (AUTO'S) microscopie (stap 8), een innovatieve techniek die de visualisatie en kwantificering van lipide druppeltjes zonder labeling20,21.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. bereiding van de kweek media en reagentia

  1. Prolifererend medium: supplement William's E medium met GlutaMAX, 10% foetaal runderserum (FBS), 1% penicileen/streptomycine, 5 μg/mL insuline en 0,5 μM hydrocortison hemisuccinaat.
  2. Differentiatie medium: supplement William's E medium met GlutaMAX, 10% FBS, 1% penicileen/streptomycine, 5 μg/mL insuline, 50 μM hydrocortison hemisuccinaat en 2% DMSO.
  3. Vries medium: supplement prolifererend medium met 10% DMSO.
  4. Natriumoleaat: oplossen in 99% methanol bij een concentratie van 100 mM, roer O/N en bewaar bij-20 °C.
  5. Oil Red O: bereid een stamoplossing voor. Weeg 0,35 g olie rood O af en los op in 100 mL isopropanol. Roer O/N, filter (0,2 μm), en bewaar bij RT. bereid een werkoplossing voor: Meng 6 mL olie Red O Stock oplossing met 4 mL ddH2o. Laat zitten op kamertemperatuur (RT) voor 20 min, en vervolgens filteren met een 0,2 μm filter. Juiste filtratie wordt sterk aanbevolen voor succesvolle kleuring om achtergrond te vermijden.
  6. Bodipy (505/515): Los Bodipy (505/515) Dye op in DMSO bij een voorraad concentratie van 100 μM, Bewaar bij-20 °C in het donker en gebruik dit bij een uiteindelijke concentratie van 100 nM.
  7. Verkrijg transparante glazen bodem gerechten voor AUTO'S experimenten.

2. ontdooien, amplificatie en Cryopreservering van HepaRG cellen

  1. Ontdooien stikstof cryopreserved HepaRG cellen door het onderdompelen van een partij in een 37 ° c bad tot ontdooid. Selecteer een lage doorgang batch (< 20). HepaRG cellen zijn commercieel beschikbaar.
  2. Breng de cellen snel over in een buis van 15 mL die 10 mL prolifererend medium bevat en Centrifugeer gedurende 5 min (200 x g, 4 °c).
  3. Gooi de supernatant weg en regeer de cellen met 5 mL prolifererend medium.
  4. Tel de cellen en Verdun met het oog op plaat 2,5 x 104 cellen/cm2.
  5. Vernieuw het medium elke 2 of 3 dagen. Cellen vermenigvuldigen met een verdubbelingstijd van ongeveer 24 uur.
  6. Ontkoppel heparine cellen wanneer bij 80% confluentie door 3-5 min incubatie met trypsine oplossing 0,05%. Verzamel de cellen in het prolifererende medium en Centrifugeer gedurende 5 min (200 x g, 4 °c).
  7. Gooi de supernatant weg en regeer de cellen met 5 mL prolifererend medium.
  8. Tel de cellen en Verdun met het oog op plaat 2,5 x 104 cellen/cm2.
  9. In dit stadium versterkt u de cellen door stappen 2.5-2.8 te herhalen om een passend aantal cellen te bereiken om experimenten te starten, of invriezen zoals in stap 2,10.
  10. Om invriezen heparine cellen, loskoppelen van de cellen 24 h na het bekleden met 3-5 min incubatie met trypsine oplossing 0,05%. Verzamel de cellen in het prolifererende medium en Centrifugeer gedurende 5 min (200 x g, 4 °c). Gooi het supernatant weg, regeer de cellen in 1 ml/batch Vries medium, 1,5 x 106 cellen/batch en invriezen de batches in vloeibare stikstof.

3. differentiatie van HepaRG cellen (dag 0 – 21) (Figuur 1A)

  1. Dag 0. Zaad HepaRG cellen bij lage dichtheid (2,5 x 104 cellen/cm2) in cultuur behandelde gerechten met een passende hoeveelheid proliferatie medium (Figuur 1B). Voor elke bepaling moeten twee gerechten worden geplateerd (olie rode O-kleuring, FACS-analyse, qPCR): één voor controle cellen en één voor OLEAAT-behandelde cellen. Als het uitvoeren van AUTO'S metingen (stap 8), zaai de cellen parallel in transparante glazen bodem gerechten. Als een controle, oogst één onbehandeld gerecht (prolifererende cellen dag 0) voor het uitvoeren van genexpressie analyse van differentiatie marker genen (zie stap 3,6).
  2. Dag 2 en dag 4. Verander het medium met de juiste hoeveelheid proliferatie medium en laat de cellen groeien tot samenvloeiing.
  3. Dag 7. Cellen moeten 100% Confluent Health zijn (Figuur 1C). Was de cellen één keer met 1x fosfaat-gebufferde zoutoplossing (PBS). Verwijder 1x PBS en voeg een geschikte hoeveelheid differentiatie medium toe.
  4. Dag 8, 9, 12, 15, 18.  Was de cellen één keer met 1x PBS. Verwijder 1x PBS en voeg een geschikte hoeveelheid differentiatie medium toe.
  5. Dag 21. Observeer HepaRG cellen onder een microscoop en zorg ervoor dat de cellen confluente gedifferentieerde culturen zijn (Figuur 1D).
  6. Als een controle, oogst een controle schotel (gedifferentieerde cellen dag 21) voor het uitvoeren van genexpressie analyse (stap 7) van differentiatie marker genen (Figuur 1E).
  7. Op dag 21, gedifferentieerde HepaRG cellen kunnen worden cryopreserved in vloeibare-stikstof.

4. inductie van vesiculaire steatose (dag 21 – 26)

  1. Dag 21. Verdund natriumoleaat (100 mM) met een geschikt volume volledig differentiatie medium tot een eindconcentratie van 250 μM (1:400). Voeg 99% methanol 1:400 (hetzelfde volume als die van natriumoleaat) toe aan een ander deel van het differentiatie medium om de behandeling van het voertuig te controleren. (Bijvoorbeeld: Voeg 25 μL natriumoleaat toe aan 10 mL medium en voeg parallel 25 μL van 99% methanol toe aan 10 mL medium). Was de cellen één keer met 1x PBS en voeg een voertuig of natriumoleaat medium toe.
  2. Dag 23 en dag 25. Verander het medium met de juiste hoeveelheid vers bereid medium zoals in stap 4,1.
  3. Dag 26. Observeren door optische Microscoop dat lipide druppeltjes accumuleren in de natriumoleaat behandelde cellen en zijn gemakkelijk zichtbaar als doorschijnende druppels in het cytoplasma zoals in Figuur 2A.

5. evaluatie Vanlipide overbelasting en steatose inductie: olie rood O kleuring

  1. Was de cellen één keer met 1x PBS en verwijder 1x PBS volledig.
  2. Voeg 4% Paraformaldehyde (verdund in 1x PBS) toe en inincuberen gedurende 15 minuten bij RT.
    Let op: Paraformaldehyde is giftig, dus deze stap moet worden uitgevoerd in een rook afzuigkap, met beschermende uitrusting, inclusief handschoenen, een Labcoat en een masker.
  3. Verwijder Paraformaldehyde en was de cellen tweemaal met 1x PBS. De cellen kunnen gedurende een paar dagen vóór de kleuring in 1x PBS bij 4 °C worden bewaard. Wikkel met Parafilm en bedek met aluminiumfolie om te voorkomen dat de cellen drogen.
  4. Verwijder 1x PBS. Inincuberen de cellen met 60% isopropanol gedurende 5 min bij RT.
  5. Verwijder isopropanol en laat de cellen volledig drogen bij RT.
  6. Voeg olie rode O-werkoplossing toe en inincuberen bij RT gedurende 30 minuten. Het volume van de werkoplossing die nodig is voor elk monster komt overeen met het volume van de media die worden gebruikt voor het kweken van de cellen.
  7. Verwijder Oil Red O Solution en voeg onmiddellijk ddH2o. was de cellen 4 keer met DDH2o.
  8. Verzamel afbeeldingen onder de Microscoop voor analyse (Figuur 2B).
  9. Om Oil Red O Dye te Elueer: Verwijder al het water en laat het drogen; Voeg 1 mL 100% isopropanol toe en incuberen gedurende 10 minuten met zachtjes schudden bij RT.
  10. Pipet keer het isopropanol met geeleerde olie rode O-kleurstof meerdere malen op en neer, zodat alle olie rode O in de oplossing zit. Breng de oplossing over naar een kuvette. Meet OD500 nm door spectrophotometrie en gebruik 100% isopropanol als blanco (Figuur 2C).

6. evaluatie van lipide-overbelasting en steatose inductie: Bodipy kleuring en Cytofluorimetrische analyse

  1. Was de cellen één keer met 1x PBS. Inbroed met 100 nM Bodipy verdund in 1x PBS in het donker voor 40 min bij 37 °C. Een onbevlekte controle moet worden opgenomen in de flow cytometrie metingen. Vanaf dit punt, Bescherm de monsters van licht zoveel mogelijk.
    Opmerking: Het volume van de kleurings oplossing voor elk monster komt overeen met het volume van de media die worden gebruikt voor het kweken van cellen.
  2. Verwijder de kleurings oplossing en was de cellen één keer met 1x PBS. Ga verder naar stappen 6.3-6.6. voor FACS (fluorescentie-geactiveerde celsortering) of voor stap 6,7 voor Microscoop-beeldvorming.
  3. Schuif de cellen zachtjes met 1x PBS en breng deze over in een buis van 15 mL. Centrifugeer gedurende 10 min (200 x g, 4 °c).
  4. Verwijder voorzichtig de supernatanten zonder de pellets te storen en was met 3 ml 1x PBS. Centrifugeer gedurende 5 min (200 x g, 4 °c).
  5. Verwijder de supernatanten en revoer in 300 μL van 1x PBS en breng vervolgens over naar een FACS Tube.
  6. Meet onmiddellijk de intensiteit van de Bodipy fluorescentie door cytofluorimetrische analyse met excitatie/emissie golflengten van 505/515 nm (Figuur 3A, B).
  7. Was de cellen één keer met 1x PBS en verwijder PBS volledig.
  8. Voeg 4% Paraformaldehyde (verdund in 1x PBS) toe en inincuberen gedurende 15 minuten bij RT.
    Let op: Paraformaldehyde is giftig, dus deze stap moet worden uitgevoerd in een rook afzuigkap, met beschermende uitrusting, inclusief handschoenen, een Labcoat en een masker.
  9. Verwijder Paraformaldehyde en was de monsters 3x gedurende 5 min in PBS. De cellen kunnen in 1x PBS bij 4 °C worden bewaard of onmiddellijk worden afgebeeld (Figuur 3C). Voor opslag, wikkel met Parafilm en afdekking met aluminiumfolie om te voorkomen dat de cellen drogen.

7. evaluatie van lipide-overbelasting en steatose inductie: qPCR

  1. Was de cellen één keer met 1x PBS. Schrael de cellen met 1x PBS, centrifugeer bij 200 x gen gooi het supernatant weg. Bij deze stap kunnen cellen worden geoogst bij-80 °C of worden verwerkt zoals in stap 7,2.
  2. Voer de totale RNA-isolatie volgens standaardmethoden uit met behulp van commerciële reagentia volgens de instructies van de fabrikant.
  3. Evalueer de RNA-concentratie met UV-spectrofotometrische metingen, om ervoor te zorgen dat de RNA-zuiverheid hoog is (dicht bij 2,0) op basis van de A260/A280-meting.
  4. Synthetiseren cDNA van 1 μg totaal RNA met een standaard cDNA synthese Kit.
  5. Verdun cDNA tot een laatste 50 μL volume met H2O.
  6. Analyseer elke cDNA-sample in drievlaat door qPCR: bereid één qPCR-Master mengsel (tabel 1) voor dat voldoende is voor de benodigde reacties voor elke primer, inclusief primers die specifiek zijn voor de drie huishoudelijke genen als besturingselementen: gliceraldeide-3-fosfato deidrogenasi (GAPDH), actinB en ribosomale 18S (Zie tabel van materialen voor primer sequenties):
  7. Verdeel 18 μL Master Mix per put in een PCR-multiwall plaat.
  8. Voeg in elke put 2 μL cDNA-monster toe. De plaat afdichten.
  9. Voer de monsters uit volgens de thermische cycler-instructie.

8. evaluatie van lipide overbelasting en steatose inductie: AUTO'S

  1. Corrigeer de cellen die eerder zijn bereid op gerechten met glazen bodem, zoals beschreven in stappen 5.1-5.3.
  2. Schakel een commercieel instelbaar Pico gepulseerd lasersysteem in en stem het af om twee uitgangen van verschillende golflengten te verkrijgen. Het frequentieverschil tussen de uitgangen moet 2.840 cm-1 voor het genereren van de intense auto's lichtsignaal overeenkomend met methyleen symmetrische stretching; bij een uitgang met een vaste golflengte bij 1.064 nm ("Stokes"-licht) moet de andere golflengte worden afgestemd op 817 nm ("pomp"-licht).
  3. Zorg ervoor dat de 817 nm-uitgang ruimtelijk en tijdelijk overlapt met de 1.064 nm-uitgang: gebruik een geschikte dichroïde spiegel (d.w.z. met een snede tussen 817 en 1.064 nm) om de balken ruimtelijk te combineren en een optische vertragings lijn te gebruiken om temporele overlapping van de laser te verkrijgen Pulsen.
  4. Zorg ervoor dat de twee copropagerende balken beide gecollimatiseerd zijn en dat hun diameters vergelijkbare waarden hebben die geschikt zijn voor het optische systeem binnen de Microscoop die hen op het monster zal concentreren; indien nodig, afzonderlijk collimate de balken voor de dichroïde spiegel die ze combineert.
  5. Schakel een commercieel omgekeerde Microscoop systeem in dat een infrarood laser scanning-eenheid en een tweekanaals rood/groen epi-detectie-eenheid moet bevatten en lijn de copropagerende laserstralen in de Scaneenheid uit.
  6. Het openen van de Dual-Channel epi detectie-eenheid, de filter kubus verwijderen en het detectie filter van de rode golflengte vervangen door een band pass filter dat het 2.840 cm-1 Cars signaal kan selecteren dat gecentreerd is op 663 nm voor de 817/1064 nm pomp/Stokes excitatie Regeling. Een smalle bandbreedte (20 nm) filter heeft de voorkeur om het verzamelen van hoge niveaus van fluorescerende achtergrond signalen te voorkomen.
  7. Plaats een gerecht op het podium van de omgekeerde AUTO'S Microscoop, en met behulp van een 100x olie-onderdompeling doel, verschuiving van de verticale positie van het doel om zich te concentreren op de cellen.
  8. Stel de Microscoop software in voor het verzamelen van afbeeldingen met hoge resolutie (1024 x 1024 pixels) over een gezichtsveld van 127 μm x 127 μm.
  9. Stel de Microscoop software in om continu beelden van het gezichtsveld van 127 μm x 127 μm te verkrijgen en weer te geven en de weergegeven beelden te controleren terwijl de parameters voor de beeld verzameling worden optimaliseert. Zorg ervoor dat de laser krachten in balans zijn voor een snelle beeld verzameling en minimale schade, en voeg zo nodig geschikte filters voor neutrale dichtheid toe aan de straal paden en selecteer een pixel dwelltijd die het mogelijk maakt om beelden met een goed signaal-ruis te verzamelen onder de geselecteerde Laser stroom condities.
  10. Verkrijg en Bewaar afbeeldingen van verschillende weergave gebieden binnen de schaal onder de geoptimaliseerde omstandigheden. Optioneel kunnen multiphoton fluorescentie beelden, gegenereerd door een groen golflengte emissie (meestal uit twee-Fobe excitatie bij 817 nm), gelijktijdig worden verzameld via de andere epi-detector. Herhaal stap 8.7-8.10 voor elk gerecht.
  11. Voor de image-analyse van CARS verwerkt u afbeeldingen met de FIJI-implementatie van ImageJ. Bedien de Despeckle-functie (of een soortgelijk tekengereedschap) voor elke afbeelding vóór verdere analyse om de signaal-ruis verhoudingen te verbeteren zonder verlies van Details.
  12. Gebruik FIJI om cellen handmatig te selecteren en vervolgens automatisch te tellen lipide druppels binnen gesegmenteerde individuele cellen om statistieken te produceren over lipide druppel gebieden en nummers voor elke cel en voor de volledige afbeeldingsgegevensset voor elk gerecht.

9. bepaling van de levensvatbaarheid van de MTT-cel

  1. Plaat gedifferentieerde HepaRG cellen in een 96-put plaat met een dichtheid van 1 x 105 cellen/goed in een finale 100 μL volume van differentiatie kweekmedium.
  2. 24 uur na het zaaien, behandel de cellen met 99% methanol (voertuig) en met 100 μM, 250 μM en 500 μM natriumoleaat en natrium palmitaat verdund in 100 μL differentiatie kweekmedium/goed in drievultaat.
  3. Verander het medium met 99% methanol en met 100 μM, 250 μM en 500 μM natriumoleaat en natrium palmitaat verdund in 100 μL differentiatie kweekmedium/goed elke 24 h.
  4. 96 h na de behandeling met methanol/natriumoleaat/natriumpalmitaat worden de cellen behandeld met 2 μM Doxorubicine, verdund in 100 μL differentiatie kweekmedium/goed in drievultaat als controle.
  5. 18 h na behandeling met doxorubucin, verander het medium met 100 μL differentiatie kweekmedium.
  6. Pipet 20 μL van 3-(4, 5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium reagens MTT (tabel van de materialen) in elke put van de 96-well-test plaat met de cellen in 100 μL cultuurmedium . Neem een achtergrond besturingselement op door Pipetteer 20 μL van het reagens in een goed besturingselement zonder cellen in 100 μL differentiatie kweekmedium in drievultaat.
  7. Inincuberen van de plaat bij 37 °C in een lucht bevoficeerd, 5% CO2 -atmosfeer.
  8. Na incuberen voor 30, 60 en 90 min met MTT tetrazoliumreagens, noteer de extinctie bij 490 nm met behulp van een 96-well plate Reader. Trek de achtergrond absorptie van de No-Cell Control putten uit de extinctiewaarden voor de andere monsters.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Dit protocol beschrijft een efficiënte methode voor het induceren en karakteriseren van vesiculaire steatose in DMSO-gedifferentieerde HepaRG cellen door natriumoleaat behandeling (Figuur 1A).

Differentiatie van HepaRG cellen.
Om differentiatie efficiënt te induceren, moeten prolifererende cellen worden gescheiden bij een lage dichtheid (2,5 x 104 cellen/cm2) in het proliferatie medium. Bij een lage dichtheid verdelen en verwerven de cellen actief een langwerpige, ongedifferentieerde morfologie (Figuur 1B). De cellen moeten worden overgelaten om te groeien in de proliferatie medium voor 7 dagen, tot 100% confluentie is bereikt (Figuur 1C). Na blootstelling aan 2% DMSO beginnen cellen te differentiëren en typische hepatocyte-achtige kolonies te vormen, omringd door biliaire epitheel achtige cellen (Figuur 1D). Gedifferentieerde HepaRG cellen Express hepato-specifieke markers, zoals albumine, Cyp3A4 en aldolase B. Om de juiste differentiatie te controleren, werden de uitdrukkings niveaus van deze hepatische marker genen in de gedifferentieerde cellen (dag 21) en in de prolifererende cellen (dag 0) geanalyseerd door qPCR (Figuur 1E). Albumine, Cyp3A4 en aldolase B genen dienen upregulated te zijn in de gedifferentieerde HepaRG cellen in vergelijking met de prolifererende HepaRG cellen, en we hebben deze trend waargenomen en de effectiviteit van ons differentiatie protocol bevestigd.

Inductie van vesiculaire steatose in HepaRG cellen door natriumoleaat behandeling.
Natriumoleaat behandeling van dHepaRG cellen induceert vetophoping, zichtbaar onder een optische Microscoop als lipide druppeltjes in het cytoplasma (Figuur 2A). Om de efficiënte inductie van steatose te controleren, werden OLEAAT-behandelde en controle HepaRG cellen gekleurd met olie rode O kleurstof. Na kleuring zijn lipide druppeltjes gemakkelijk zichtbaar als rode druppeltjes (Figuur 2B) en kunnen worden gekwantificeerd door spectrofotometrische meting van olie rood O-kleurstof met isopropanol (Figuur 2C). Extinctie van de rode olie-O uit de cellen is direct evenredig met de cytoplasmatische lipide druppel accumulatie.

Natriumoleaat concentratie en blootstellingstijd werden bepaald door de MTT colorimetrische cel levensvatbaarheid test (stap 9). De behandeling met natriumoleaat werd vergeleken met de behandeling met natrium palmitaat en het apoptotische geneesmiddel doxorubucin (2 μM) werd gebruikt als een controle (Figuur 2D). Cytoxiciteit van de verbindingen werd geëvalueerd door MTT, gebruik te maken van een commerciële Compound (tabel van de materialen), die de MTT tetrazolium bevat. De in water oplosbare gele MTT-tetrazoliumverbinding wordt bioreduceerd door metabolische actieve cellen in een paars water-onoplosbaar Formazan-product. Het Formazan-product wordt gekwantificeerd door zijn absorptie bij 490 nm en de hoeveelheid is direct evenredig aan het aantal levende cellen in de cultuur (Figuur 2D).

Kwantificering van vesiculaire steatose bij natriumoleaat-behandelde HepaRG cellen
Om de toename van cellulaire lipide-inhoud te kwantificeren na behandeling met natriumoleaat, hebben we kleuring uitgevoerd met Bodipy Dye, een sonde die lipide druppeltjes etiketten. Met behulp van cytofluorimetrische analyse is het mogelijk om het triglyceriden gehalte te kwantificeren door de gemiddelde fluorescentie intensiteit van Bodipy, die hoger is in OLEAAT behandelde cellen in vergelijking met controle cellen (Figuur 3A, B), wat duidt op efficiënt vet accumulatie na behandeling met OLEAAT. Inderdaad, beelden van Bodipy-gekleurd cellen tonen helder groene fluorescerende lipide druppeltjes in OLEAAT behandelde cellen die niet zichtbaar zijn in de controle cellen (Figuur 3C).

Natriumoleaat behandeling van dHepaRG cellen dereguleert lipide metabolisme en inflammatoire genexpressie. Om de efficiënte inductie van vesiculaire steatose te evalueren, analyseerden we door qPCR de uitdrukkings niveaus van geselecteerde genen in natriumoleaat behandelde cellen in vergelijking met die van controle cellen (Figuur 4). Acetyl-CoA carboxylase Beta (acacb), glycerol-3-fosfaat acyltransferase mitochondriale (gpam), perilipins (PLIN2, PLIN4), apolipoproteïne B (apoB), pyruvaatdehydrogenase kinase isozym 4 (PDK4), carnitine palmitoyltransferase 1a (CPT1A) en Interleukine 6 (IL6) waren upregulated in met OLEAAT behandelde dheparg cellen, terwijl opgeloste stof Carrier familie 2 lid 1 (SLC2A1), apolipoproteïne C-III (APOC3), en stearoyl-COA Desaturase (SCD) werden gedowngereguleerd (Figuur 4). Om de lipideopslag in druppeltjes verder te karakteriseren en te kwantificeren bij toevoeging van natriumoleaat aan gedifferentieerde Heparylcellen, gebruikten we een innovatieve microscopie-techniek, coherente anti-Stokes Raman verstrooiing (AUTO'S) microscopie, die het mogelijk maakt visualisatie en kwantificering van lipide druppeltjes zonder labeling (Figuur 5A). Lipide druppeltjes werden statistisch gekwantificeerd in termen van getallen, distributie en morfologie op het eencellige niveau met behulp van afbeeldingen van AUTO'S. Behandeling met natriumoleaat (250 μM) induceerde een significante toename van het aantal lipide druppeltjes (Figuur 5B), wat leidde tot een hoger totaal druppel gebied per cel (Figuur 5C) en een hoger percentage druppel gebied per cel ( Figuur 5D), in vergelijking met controle cellen, waaruit blijkt dat dheparg cellen efficiënt verzameld vet na natriumoleaat behandeling.

Figure 1
Figuur 1 : Differentiatie van HepaRG cellen. A) representatief diagram dat het protocol voor celdifferentiatie/-behandeling van heparg weergeeft, zoals beschreven in stap 3 en 4. (B-D) Afbeeldingen die ongekleurde prolifererende heparoncellen vertonen op dag 0 na zaaien (B), bij samenvloeiing dag 7 na zaaien (C), en gedifferentieerde Heparg (dheparg) op dag 21 na zaaien (D). (E) totaal RNA werd geëxtraheerd uit prolifererende en dHepaRG cellen, cDNA werd gesynthetiseerd en geanalyseerd door qPCR met behulp van primers specifiek voor de aangegeven genen (tabel van materialen). Monsters werden genormaliseerd naar het gemiddelde van GAPDH, actinB en ribosomale 18S huishoudelijke genen. Histogrammen vertonen vouw inductie van prolifererende (dag 0) versus gedifferentieerde cellen (dag 21) (staven duiden op S.D.; p-waarden werden berekend door de student t-tests). Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 2
Figuur 2 : Natriumoleaat behandeling van dHepaRG cellen geïnduceerde lipide druppel accumulatie. A) afbeeldingen van ongekleurde gedifferentieerde Heparg (dHepaRG) cellen behandeld gedurende 5 dagen met voertuig (controle) (linker afbeelding) of met 250 μM natriumoleaat (rechter afbeelding). B) na de behandeling werden de cellen bevlekt met olie rode O-kleurstof; lipide druppeltjes zijn zichtbaar in rood. C) olie rode O-kleurstof werd afge-en od werd gemeten bij 570 nm. De resultaten worden uitgedrukt als middel van drie onafhankelijke experimenten (staven duiden op S.D.; p-waarde op student t-toets). (D) evaluatie van de levensvatbaarheid van de cellen van het voertuig van dHepaRG cells (99% methanol) behandeld (CTRL) of gedurende 5 dagen behandeld met natriumoleaat en natrium palmitaat (100 μm, 250 μm of 500 μm), of 18 h behandeld met doxorubucin (2 μM).  De beoordeling van de cytotoxiciteit werd uitgevoerd met behulp van een MTT-assay kit (tabel met materialen), opname absorptie bij 490 nm, volgens de instructies van de fabrikant. De resultaten worden uitgedrukt als middel van drie onafhankelijke experimenten (staven duiden op S.D.; p-waarden werden bepaald met behulp van de student t-toets: * 0,01 ≤ p < 0,05; * * 0,001 ≤ p < 0,01; * * * p < 0,001). Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 3
Figuur 3 : Kwantificering van vetophoping na natriumoleaat behandeling door Bodipy kleuring. Gedifferentieerde HepaRG (dHepaRG) cellen werden behandeld met voertuig (controle) of met 250-μM natriumoleaat gedurende 5 dagen. Na de behandeling werden dHepaRG-cellen gekleurd met Bodipy-kleurstof en geanalyseerd door Flowcytometrie. A) representatieve overlayprofielen (% van Max: percentage van de maximale kleurings intensiteit). B) histogrammen tonen de gemiddelde fluorescentie intensiteit (mfi's) als percentage van de behandelde cellen over de controle van drie onafhankelijke experimenten (staven duiden op S.D.; p-waarden werden bepaald met behulp van de t-toets van de student: * 0,01 ≤ p < 0,05; * * 0,001 ≤ p < 0,01; * * * p < 0,001). C) cellen werden vastgesteld met 4% Paraformaldehyde. Afbeeldingen tonen Bodipy-gekleurd lipide druppels in het groen. Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 4
Figuur 4 : Natriumoleaat behandeling van dHepaRG cellen induceert deregulering van lipide metabolisme en inflammatoire genexpressie. Gedifferentieerde HepaRG (dHepaRG) cellen werden behandeld met voertuig (controle) of met 250-μM natriumoleaat gedurende 5 dagen. Cdna's werden geanalyseerd door qPCR met primers specifiek voor de aangegeven genen en de resultaten werden genormaliseerd naar het gemiddelde van GAPDH, actinB en ribosomale 18S huishoudelijke genen; de primers worden in de tafel van de materialengegeven. Het histogram toont de uitdrukkings niveaus van de aangegeven genen als vouw inducties van behandelde cellen over de controle (balken duiden op S.D.; p-waarden werden berekend door de student t-toets). Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 5
Figuur 5 : Karakterisering van lipide druppel accumulatie na natriumoleaat behandeling door auto's microscopie. Gedifferentieerde HepaRG (dHepaRG) cellen werden behandeld met voertuig (controle) of met 250 μM natriumoleaat gedurende 5 dagen en werden geanalyseerd door AUTO'S microscopie. (A) representatieve afbeeldingen met LIPIDE druppel auto's contrast in rood. B) histogram waaruit het aantal lipide druppeltjes per cel blijkt. C) histogrammen met het totale beeldoppervlak dat door druppeltjes per cel wordt bedekt. (D) histogram met% druppel gebied bedekt door druppeltjes per cel. Alle resultaten worden uitgedrukt als middel van drie onafhankelijke experimenten (staven geven aan dat de p-waarden door de student t-toets worden bepaald: * 0,01 ≤ p < 0,05; * * 0,001 ≤ p < 0,01; * * * p < 0,001). Klik hier om een grotere versie van dit cijfer te bekijken.

Reagentia Volume (μL) voor een enkele reactie
2x SYBR groen fluorescerende kleurstof 10
PCR-klasse H2O 6
Voorwaartse primer (μM) 1
Omgekeerde primer (μM) 1

Tabel 1: qPCR Master Mix.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Dit protocol beschrijft hoe u de Heparylcellen onderscheidt en hoe u vesiculaire steatose door natriumoleaat behandeling induceert (Figuur 1A). Sterker nog, in vergelijking met andere humane hepatocellulaire carcinoom (HCC) cellijnen vertoont de heparg cellijn kenmerken van volwassen humane hepatocyten, die een waardevol alternatief vertegenwoordigen voor ex vivo gecultiveerde primaire humane hepatocyten13,14 ,15. De heparg cellijn is op grote schaal gebruikt voor lever cytotoxiciteit studies, drug metabolisme, en virologie studies15,16,22.

In vergelijking met heparg cellen, andere HCC cellijnen zoals HepG2, HUH7, HUH6 en Hep3B weergeven lagere metabole capaciteiten, gebrek aan een aanzienlijke set van lever-specifieke functies23,24, en exposeren een hogere basale niveau van cytosolische vetophoping opgeslagen in lipide druppeltjes. Deze HCC-cellijnen zijn dus minder bruikbaar als modellen voor de inductie van vesiculaire steatose na lipide-overbelasting dan de HepaRG-cellijn.

Kritieke stappen in het Protocol
Bij een lage dichtheid (2,5 x 104 cellen/cm2) krijgen de heparg cellen een langwerpige, ongedifferentieerde morfologie, die actief verdeelt; na het bereiken van 100% confluentie, ze zijn in staat om te differentiëren bij blootstelling aan 2% DMSO en ze vormen typische hepatocyte-achtige kolonies omringd door biliaire epitheliale-achtige cellen (Figuur 1D). Deze gemengde biliaire/hepatocyten celcultuur aan kenmerken van leverweefsel, die lijkt op een fysiologische aandoening, ondanks het ontbreken van andere levercel typen (sinusoïdale of kupffer).

Een cruciale stap in het differentiatieproces is de confluentie van cellen. De cellen moeten worden gesest bij lage dichtheid (2,5 x 104 cellen/cm2) (Figuur 1B) en mogen actief groeien in het proliferatie medium gedurende ten minste 1 week (dag 0-7). Op dag 7, voor het toevoegen van 2% DMSO om het differentiatieproces te starten, de cellen moeten op 100% samenvloeiing (Figuur 1C). Als op dag 7 (stap 2,2) volledige confluentie is niet bereikt, is het sterk aanbevolen dat de cellen mogen blijven groeien in het proliferatie medium voor sommige extra dagen, tot 100% samenvloeiing wordt bereikt.

Beperkingen van het Protocol
Geconstateerd is dat na het toevoegen van differentiatie medium, sommige cellen lijden, en typisch 10% van de cellen sterven tijdens de daaropvolgende 2-3 dagen. In dit stadium moet dagelijks wassen en medium verwisselen (stap 2,4) worden voortgezet om zwevende dode cellen te verwijderen. Het gebruik van een specifieke FBS (tabel van materialen) om zowel de differentiatie en proliferatie media aan te vullen, moet de differentiatie-efficiëntie en de lagere celdood verhogen tijdens dagen 7-21 (stap 2,4). Het wordt sterk aanbevolen om cellen tot passage 20 te behouden en om lagere passages (< 20) te kiezen voor het differentiëren van cellen: minder cellen overlijden voor de jongste HepaRG-cellen. Bovendien lijkt de HepaRG differentiatie effectiever te zijn in gerechten van 35 mm en 60 mm, terwijl de cellen vaak meer lijden wanneer ze worden gesekt in de gerechten van 100 mm en 150 mm.

Wijzigingen en probleemoplossing
Blootstelling aan verschillende verhoudingen van zowel palmitische als oliezuur vetzuren is aangetoond dat het resulteert in de vorming van intracytoplasmatische lipide druppeltjes25,26. We hebben echter vastgesteld dat de behandeling met natriumoleaat van gedifferentieerde Heparinecellen betere resultaten vertoonde dan de blootstelling aan palpozuur, wat betreft een efficiënte inductie van lipide accumulatie en levensvatbaarheid van de cellen (Figuur 2D). De behandeling met palletzuur bleek immers giftig voor gedifferentieerde Heparinecellen (Figuur 2D), in overeenstemming met de literatuurgegevens over hepatoma cellijnen en op humane en rat hepatocyte primaire culturen die palingzuur als een aanzienlijk cytotoxisch middel25,26,27,28,29. Bovendien is het gebruik van palmitaat in cel gebaseerde assays uitdagend vanwege de lage oplosbaarheid. Niettemin wordt, vanwege de intrinsieke variabiliteit van cellijnen, aanbevolen om de werkconcentratie en behandelingsduur van natriumoleaat te controleren, verschillende concentraties te testen in een tijd-cursus experiment met een cel levensvatbaarheid test.

Significantie en vergelijking van lipide detectietechnieken
Nauwkeurige bepaling van lipide bedragen in cellen werd vastgesteld via een aantal verschillende benaderingen in deze studie. Kwalitatieve en ook ongeveer kwantitatieve overeenstemming werd waargenomen tussen de resultaten verkregen via olie rode O-kleuring, Bodipy-kleuring en imaging van AUTO'S. Voor een snelle schatting van lipiden hoeveelheden in celpopulaties is het gebruik van Bodipy-flow cytometrie of een vlek zoals Oil Red O ideaal. Voor een gedetailleerder onderzoek van het lipide druppel gehalte van cellen, is een beeldvormings modaliteit de voorkeur. Bovendien zijn specificiteits problemen gemeld voor lipidenvlekken zoals olie rood O20,30, en we hebben geconstateerd dat in sommige gevallen de bodipy Stain een lagere capaciteit heeft dan auto's om uitsluitend lipide druppeltjes onder andere cellen te labelen organellen (gegevens niet weergegeven). Daarom biedt het gebruik van een label vrije microscopische beeldvormings techniek, zoals AUTO'S, aanzienlijke voordelen voor steatose kwantificering en karakterisering. Het vermijden van het gebruik van een groot fluorescerende etiket maakt de auto Imaging gunstig vanwege de geringe omvang van lipide moleculen in vergelijking met typische fluoroforen; Vandaar, voor de opsporing van lipiden, label-vrije methoden zijn wenselijk, nog meer dan voor het observeren van grote eiwitmoleculen. Het lipide-AUTO'S-signaal is een optische emissie die alleen wordt gegenereerd wanneer een niet-lineaire interactie in het monster optreedt. Deze interactie kan alleen worden gedetecteerd wanneer het verschil tussen de frequenties van de twee excitatie lasers gericht op het monster overeenkomt met de methyleen (2) stretching vibrationele frequentie. De overvloed aan methyleen groepen in lipiden resulteert in een zeer intense signalen met hoge signaal-ruis verhoudingen, en de niet-lineariteit van de optische interactie betekent ook dat hoge ruimtelijke resolutie mogelijk is in AUTO'S microscopie. De uitstekende kwaliteit van de AUTO'S beelden in het algemeen maakt het verzamelen van statistieken over de grootte en het aantal lipide druppeltjes, zoals aangetoond in deze studie. Daarnaast hebben andere studies aangetoond het gebruik van AUTO'S microscopie te correleren verschillende subcellulaire lokalisaties en maten van lipide druppeltjes met verschillende behandelingen18, en door het gebruik van aanvullende auto's metingen bij verschillende golflengten, of een breedband auto of soortgelijke gestimuleerd Raman aanpak, onderzoekers hebben aangetoond dat het mogelijk is om te karakteriseren verschillende soorten vetzuren binnen lipide druppels31,32. Bovendien heeft de snelheid van de beeld verzameling van AUTO'S in-situ beeldvorming van levende cellen mogelijk gemaakt om de temporele evolutie van lipide druppel groei en aggregatie33te onderzoeken.

Toekomstige toepassingen
In de afgelopen decennia, standpunten over de rollen en functies van lipide druppeltjes in celbiologie hebben geëvolueerd. Eerder gedacht te zijn in principe inerte opslag vesicles, ze worden nu beschouwd als zeer dynamische cellulaire organellen, en hun rol in de ziekte wordt steeds meer herkend34,35,36. Hoewel in het geval van leverziekte, lipide accumulatie (steatose) is al lang bekend als een kritisch aspect, het precieze mechanisme van de betrokkenheid van lipide druppeltjes bij ziekteprogressie is niet helemaal duidelijk. Daarom zijn methoden zoals AUTO'S die het dynamische gedrag van lipide druppeltjes kunnen karakteriseren van cruciaal belang voor de ontwikkeling van een moleculair begrip van ziekten, waaronder NAFLD. Metabole genexpressie analyse door qPCR is zeer complementair aan moleculaire beeldvorming van lipiden via auto's, zoals aangetoond in eerdere studies17,18, waardoor dieper inzicht in ziekte mechanismen. In de huidige studie, observeren we vetzuur accumulatie met deregulering van lipide metabolisme en inflammatoire genexpressie, die kunnen bijdragen tot de bouw van een panel van bio-markers voor vroege ziekte diagnose.

Het natriumoleaat-behandelde dHepaRG cel-gebaseerde model kan de kennis van de moleculaire mechanismen die betrokken zijn niet alleen in het begin, maar ook in de progressie van NAFLD verhogen, waardoor een basis voor de ontwikkeling van betere therapeutische benaderingen van de ziekte.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

De auteurs verklaren dat zij geen concurrerende financiële belangen hebben.

Acknowledgments

Wij danken Prof. Christian Trepo (INSERM U871, Lyon, Frankrijk), die vriendelijk de HepaRG cellen geleverd. We zijn Rita Appodia dankbaar voor administratieve hulp. Dit werk werd gesteund door MIUR-Ministero dell'istruzione, dell'università e della Ricerca (FIRB 2011 – 2016 RBAP10XKNC) en Sapienza universiteit van Rome (prot. C26A13T8PS; Prot. C26A142MCH; Prot. C26A15LSXL).

Materials

Name Company Catalog Number Comments
Hyclone HyClone Fetal Clone II  GE Healthcare SH30066
William’s E medium with GlutaMAX  Thermofisher 32551087
Penicillin/streptomycin  SIGMA P4333
Insulin  SIGMA I9278
Hydrocortisone hemisuccinate SIGMA H2270
DMSO, dimethyl sulfoxide SIGMA D2438   
Sodium Oleate SIGMA O7501 
Methanol SIGMA 179337
Isopropanol SIGMA 278475
BODIPY 505/515 Thermofisher D3921
PBS Thermofisher 14190-250
Formaldehyde solution SIGMA 252549
RNAse free DNAseI Promega M198A 
Glass-bottomed dishes Willco Wells GWST-5040
Oil Red solution SIGMA O625
CellTiter 96 AQueous One Solution Promega  G3582
q-PCR oligo name Sequence
ACACB FOR CAAGCCGATCACCAAGAGTAAA
ACACB REV CCCTGAGTTATCAGAGGCTGG
β-actin FOR GCACTCTTCCAGCCTTCCT
β-actin REV AGGTCTTTGCGGATGTCCAC
ALBUMIN FOR TGCTTGAATGTGCTGATGACAGG
ALBUMIN REV AAGGCAAGTCAGCAGGCATCTCATC
ALDOB FOR GCATCTGTCAGCAGAATGGA 
ALDOB REV TAGACAGCAGCCAGGACCTT
APOB FOR CCTCCGTTTTGGTGGTAGAG
APOB REV  CCTAAAAGCTGGGAAGCTGA
APOC3 FOR CTCAGCTTCATGCAGGGTTA
APOC3 REV GGTGCTCCAGTAGTCTTTCAG
CPT1A FOR TCATCAAGAAATGTCGCACG
CPT1A REV GCCTCGTATGTGAGGCAAAA
CYP2E1 FOR TTGAAGCCTCTCGTTGACCC
CYP2E1 REV CGTGGTGGGATACAGCCAA
CYP3A4 FOR CTTCATCCAATGGACTGCATAAAT
CYP3A4 REV TCCCAAGTATAACACTCTACACAGACAA
GAPDH FOR TGACAACTTTGGTATCGTGGAAGG
GAPDH REV AGGGATGATGTTCTGGAGAGCC
GPAM FOR TCTTTGGGTTTGCGGAATGTT
GPAM REV ATGCACATCTCGCTCTTGAATAA
IL6 FOR CCTGAACCTTCCAAAGATGGC
IL6 REV ACCTCAAACTCCAAAAGACCAGTG
PDK4 FOR ACAGACAGGAAACCCAAGCCAC
PDK4 REV TGGAGGTGAGAAGGAACATACACG
PLIN2 FOR TTGCAGTTGCCAATACCTATGC
PLIN2 REV CCAGTCACAGTAGTCGTCACA
PLIN4 FOR AATGAGTTGGAGGGGCTGGGGGACATC
PLIN4 REV GGTCACCTAAACGAACGAAGTAGC
SCD FOR TCTAGCTCCTATACCACCACCA
SCD REV TCGTCTCCAACTTATCTCCTCC
SLC2A1 FOR TGCTCATCAACCGCAACGAG
SLC2A1 REV CCGACTCTCTTCCTTCATCTCCTG
18S FOR CGCCGCTAGAGGTGAAATTC
18S REV TTGGCAAATGCTTTCGCTC

DOWNLOAD MATERIALS LIST

References

  1. Starley, B. Q., Calcagno, C. J., Harrison, S. A. Nonalcoholic fatty liver disease and hepatocellular carcinoma: a weighty connection. Hepatology. 51, (5), 1820-1832 (2010).
  2. Byrne, C. D., Targher, G. NAFLD: a multisystem disease. Journal of Hepatology. 62, (1), Suppl 47-64 (2015).
  3. Marra, F., Gastaldelli, A., Svegliati Baroni, G., Tell, G., Tiribelli, C. Molecular basis and mechanisms of progression of non- alcoholic steatohepatitis. Trends in Molecular Medicine. 14, 72-81 (2008).
  4. Chalasani, N., et al. The diagnosis and management of nonalcoholic fatty liver disease: Practice guidance from the American Association for the Study of Liver Diseases. Hepatology. 67, (1), 328-357 (2018).
  5. Banini, B. A., Sanyal, A. J. Current and future pharmacologic treatment of nonalcoholic steatohepatitis. Current Opinion in Gastroenterology. 33, (3), 134-141 (2017).
  6. Takahashi, Y., Sugimoto, K., Inui, H., Fukusato, T. Current pharmacological therapies for nonalcoholic fatty liver disease/nonalcoholic steatohepatitis. World Journal of Gastroenterology. 21, (13), 3777-3785 (2015).
  7. Younossi, Z., et al. Global burden of NAFLD and NASH: trends, predictions, risk factors and prevention. Nature Reviews Gastroenterology & Hepatology. 15, (1), 11-20 (2018).
  8. Santhekadur, P. K., Kumar, D. P., Sanyal, A. J. Preclinical models of non-alcoholic fatty liver disease. Journal of Hepatology. 68, (2), 230-237 (2018).
  9. Nagarajan, P., Mahesh Kumar, M. J., Venkatesan, R., Majundar, S. S., Juyal, R. C. Genetically modified mouse models for the study of nonalcoholic fatty liver disease. World Journal of. Gastroenterology. 18, (11), 1141-1153 (2012).
  10. Oseini, A. M., Cole, B. K., Issa, D., Feaver, R. E., Sanyal, A. J. Translating scientific discovery: the need for preclinical models of nonalcoholic steatohepatitis. Hepatology International. 12, (1), 6-16 (2018).
  11. Ramboer, E., Vanhaecke, T., Rogiers, V., Vinken, M. Immortalized human hepatic cell lines for in vitro testing and research purposes. Methods in Molecular Biology. 1250, 53-76 (2015).
  12. Gómez-Lechón, M. J., Donato, M. T., Castell, J. V., Jover, R. Human hepatocytes in primary culture: the choice to investigate drug metabolism in man. Current Drug Metabolism. 5, (5), 443-462 (2004).
  13. Marion, M. J., Hantz, O., Durantel, D. The HepaRG cell line: biological properties and relevance as a tool for cell biology, drug metabolism, and virology studies. Methods in Molecular Biology. 640, 261-272 (2010).
  14. Gripon, P., et al. Infection of a human hepatoma cell line by hepatitis B virus. Proceedings of the National Academy of Sciences. 99, (24), 15655-15660 (2002).
  15. Anthérieu, S., Rogue, A., Fromenty, B., Guillouzo, A., Robin, M. A. Induction of vesicular steatosis by amiodarone and tetracycline is associated with up-regulation of lipogenic genes in HepaRG cells. Hepatology. 53, (6), 1895-1905 (2011).
  16. Rouge, A., et al. PPAR agonists reduce steatosis in oleic acid-overloaded HepaRG cells. Toxicology and Applied Pharmacology. 276, (1), 73-81 (2014).
  17. Belloni, L., et al. Targeting a phospho-STAT3-miRNAs pathway improves vesicular hepatic steatosis in an in vitro and in vivo model. Scientific Reports. 8, 13638 (2018).
  18. Nunn, A. D. G., et al. The histone deacetylase inhibiting drug Entinostat induces lipid accumulation in differentiated HepaRG cells. Scientific Reports. 6, 28025 (2016).
  19. Donato, M. T., et al. Cytometric analysis for drug-induced steatosis in HepG2 cells. Chemico-Biological Interactions. 181, (3), 417-423 (2009).
  20. Hellerer, T., Axäng, C., Brackmann, C., Hillertz, P., Pilon, M., Enejder, A. Monitoring of lipid storage in Caenorhabditis elegans using coherent anti-Stokes Raman scattering (CARS) microscopy. Proceedings of the National Academy of Sciences. 104, (37), 14658-14663 (2007).
  21. Le, T. T., Ziemba, A., Urasaki, Y., Brotman, S., Pizzorno, G. Label-free evaluation of hepatic microvesicular steatosis with multimodal coherent anti-Stokes Raman scattering microscopy. PLoS One. 7, (11), 51092 (2012).
  22. Guillouzo, A., Corlu, A., Aninat, C., Glaise, D., Morel, F., Guguen-Guillouzo, C. The human hepatoma HepaRG cells: a highly differentiated model for studies of liver metabolism and toxicity of xenobiotics. Chemico-Biological Interactions. 168, (1), 66-73 (2007).
  23. Nelson, L. J., et al. Human hepatic HepaRG cells maintain an organotypic phenotype with high intrinsic CYP450 Activity/metabolism and significantly outperform standard HepG2/C3A cells for pharmaceutical and therapeutic applications. Basic & Clinical Pharmacology & Toxicology. 120, (1), 30-37 (2017).
  24. Gerets, H. H. J., Tilmant, K., Gerin, B., Chanteux, H., Depelchin, B. O., Dhalluin, S., Atienzar, F. A. Characterization of primary human hepatocytes, HepG2 cells, and HepaRG cells at the mRNA level and CYP activity in response to inducers and their predictivity for the detection of human hepatotoxins. Cell Biology and Toxicology. 28, (2), 69-87 (2012).
  25. Pusl, T., et al. Free fatty acids sensitize hepatocytes to bile acid-induced apoptosis. Biochemical and Biophysical Research Communications. 371, (3), 441-445 (2008).
  26. Gentile, C. L., Pagliassotti, M. J. The role of fatty acids in the development and progression of nonalcoholic fatty liver disease. The Journal of Nutritional Biochemistry. 19, (9), 567-576 (2008).
  27. Mei, S., et al. Differential roles of unsaturated and saturated fatty acids on autophagy and apoptosis in hepatocytes. Journal of Pharmacological Experimental Therapy. 339, 487-498 (2011).
  28. Malhi, H., Bronk, S. F., Werneburg, N. W., Gores, G. J. Free fatty acids induce JNK-dependent hepatocyte lipoapoptosis. Journal of Biological Chemistry. 281, 12093-12101 (2006).
  29. Moravcová, A., Červinková, Z., Kučera, O., Mezera, V., Rychtrmoc, D., Lotková, H. The effect of oleic and palmitic acid on induction of steatosis and cytotoxicity on rat hepatocytes in primary culture. Physiological Research. 64, Suppl 5 627-636 (2015).
  30. Ohsaki, Y., Shinohara, Y., Suzuki, M., Fujimoto, T. A pitfall in using BODIPY dyes to label lipid droplets for fluorescence microscopy. Histochemistry and Cell Biology. 133, (4), 477-480 (2010).
  31. Rinia, H. A., Burger, K. N., Bonn, M., Müller, M. Quantitative label-free imaging of lipid composition and packing of individual cellular lipid droplets using multiplex CARS microscopy. Biophysical Journal. 95, (10), 4908-4914 (2008).
  32. Waschatko, G., Billecke, N., Schwendy, S., Jaurich, H., Bonn, M., Vilgis, T. A., Parekh, S. H. Label-free in situ imaging of oil body dynamics and chemistry in germination. Journal of The Royal Society Interface. 13, (123), (2016).
  33. Jüngst, C., Winterhalder, M. J., Zumbusch, A. Fast and long term lipid droplet tracking with CARS microscopy. Journal of Biophotonics. 4, (6), 435-441 (2011).
  34. Welte, M. A., Gould, A. P. Lipid droplet functions beyond energy storage. Biochimica et Biophysica Acta - Molecular and Cell Biology of Lipids. 1862, (10), Pt B 1260-1272 (2017).
  35. Cohen, S. Lipid droplets as organelles. International Review of Cell and Molecular Biology. 337, 83-110 (2018).
  36. Farese, R. V., Walther, T. C. Lipid droplets finally get a little R-E-S-P-E-C-T. Cell. 139, (5), 855-860 (2009).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics