Inducerande och karaktäriserande vesikulär steatos i differentierade HepaRG-celler

Medicine

Your institution must subscribe to JoVE's Medicine section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

I denna studie, vi beskriver ett detaljerat protokoll för att inducera lever vesikulär steatos i differentierade HepaRG celler med fettsyra salt natriumoleat och använda metoder för detektion och kvantifiering av lipidackumulering, inklusive sammanhängande anti-Stokes Raman spridning (bilar) mikroskopi, cytofluorimetrisk analys, olja röd O färgning, och qPCR.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Di Cocco, S., Belloni, L., Nunn, A. D., Salerno, D., Piconese, S., Levrero, M., Pediconi, N. Inducing and Characterizing Vesicular Steatosis in Differentiated HepaRG Cells. J. Vis. Exp. (149), e59843, doi:10.3791/59843 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Leversteatos representerar en metabolisk dysfunktion som resulterar från en ansamling av triglycerid innehållande lipiddroppar i hepatocyter. Överdriven fettansamling leder till alkoholfria fettlever (NAFLD), som är potentiellt reversibel och kan utvecklas till alkoholfri steatohepatit (NASH) och så småningom cirros och Hepatocellulär cancer (HCC). De molekylära mekanismerna som förbinder lipidackumulering i hepatocyter med progressionen till NASH, irreversibel leverskada, fibros, cirros, och även HCC är fortfarande oklart. För detta ändamål har flera in vitro-och in vivo-modeller utvecklats för att belysa de patologiska processer som orsakar NAFLD. I den nuvarande studien, beskriver vi en cellulär modell för induktion av lever vesikulär steatos som består av DMSO-differentierade mänskliga levern HepaRG celler behandlade med fettsyra salt natriumoleat. Faktum natrium Oleate-behandlade HepaRG celler ackumuleras lipiddroppar i cytoplasman och visar typiska egenskaper hos steatos. Denna in vitro human modell utgör ett värdefullt alternativ till in vivo möss modeller samt till de primära humana hepatocyter. Vi presenterar också en jämförelse av flera metoder för kvantifiering och utvärdering av ansamling av fett i HepaRG celler, inklusive olja röd O färgning, cytofluorimetrisk Bodipy mätning, metabolisk gen uttrycks analys av qPCR, och sammanhängande anti-Stokes Raman spridning (bilar) mikroskopi. BILAR Imaging kombinerar Raman spektroskopi kemiska specificitet, en kemisk analysteknik välkänd i materialvetenskap tillämpningar, med fördelarna med hög hastighet, högupplösta icke-linjära optiska microscopies att möjliggöra exakt kvantifiering av lipidackumulering och lipiddynamik. Inrättandet av en effektiv in vitro-modell för induktion av vesikulär steatos, tillsammans med en noggrann metod för kvantifiering och karakterisering av lipidackumulering, kan leda till utveckling av tidig diagnostisering av NAFLD via identifiering av molekyl markörer och generering av nya behandlingsstrategier.

Introduction

Leversteatos definieras som intrahepatisk fettansamling, inom triglyceridinnehållande lipiddroppar, med minst 5% av lever vikten. Långvarig nedsatt lipidlagring är en potentiellt reversibel process, emellertid, det kan leda till lever metabolisk dysfunktion, inflammation och avancerade former av alkoholfria fettlever (NAFLD), den dominerande orsaken till kronisk leversjukdom i många delar av världen1,2. NAFLD är en multifaktoriell sjukdom som kan utvecklas till den mer aggressiva alkoholhaltig steatohepatit (NASH), som i sin tur kan utvecklas till cirros och, i en liten andel av patienterna, till Hepatocellulär cancer (HCC)1,3. Ingen godkänd behandling finns för närvarande som en särskild behandling för NAFLD och kombinationen av kost och livsstilsförändringar förblir pelaren i NAFLD och NASH Management4,5,6.

De molekylära mekanismerna som leder till utvecklingen av leversteatos i patogenesen av NAFLD återstår fortfarande att belysa7. I detta sammanhang har musmodeller utvecklats för att studera progression av Human leversteatos. En myriad av olika modeller existerar, och var och en har sina fördelar och nackdelar, inklusive genetiska, näringsmässiga och kemiskt inducerade modeller som kombinerar olika metoder. Genetiskt modifierade (transgena eller knockout) möss utvecklar spontant leversjukdom. Emellertid, det bör noteras att dessa mutationer är mycket sällsynta hos människor och radering eller överuttryck av en enda gen (t. ex., OB/ob mus) kan inte efterlikna etiologin för den multifaktoriella mänskliga sjukdomen på molekylär nivå8,9. Likaså kan den sjukdom som förvärvas av möss efter diet eller farmakologisk manipulation inte efterlikna effekterna av mänsklig kost i samband med utvecklingen av NAFLD i man8. Djurmodeller har dock underlättat utvecklingen i förståelsen av NAFLD och detta tillvägagångssätt är för närvarande den mest använda strategin i laboratorieforskning. Ändå har replikation hos människor av resultat som erhållits i djurmodeller upprepade gånger misslyckats, vilket orsakar dålig översättning till kliniken10.

Därför, in vitro-modeller av NAFLD kan spela en grundläggande roll i att belysa de molekylära mekanismerna i NAFLD progression, och de utgör ett värdefullt verktyg för att avskärma ett stort antal föreningar. Primära cellkulturer, förevigade cellinjer och leverbiopsier har i stor utsträckning använts för forskningsändamål11. Primära humana hepatocyter liknar mycket humana kliniska tillstånd, men det finns ett begränsat antal givare, och primära cellkulturer uppvisar dålig reproducerbarhet på grund av cellernas variation. Dessa observationer, tillsammans med etiska och logistiska frågor, har resulterat i användning av humana primära hepatocyter är begränsad12. Sålunda, lever cellinjer utgör ett bekvämt alternativ, med flera viktiga fördelar jämfört med primärkulturen, som lever cellinjer växa stadigt, har en nästan obegränsad livslängd, och har en stabil fenotyp. Dessutom är cellinjer lättillgängliga och kultur förhållandena för levercellinjer är enklare än för primära hepatocyter och är standardiserade mellan olika laboratorier.

Här beskriver vi i detalj en in vitro-cellbaserad modell av levervesikulär steatos, representerad av leverdifferentierade HepaRG-celler behandlade med fettsyran natriumoleat. Den HepaRG cellinjer etablerades från en kvinnlig patient som drabbats av hepatit C-infektion och en Edmondson grad jag väl differentierade lever tumör14. Den HepaRG cellinjer är en mänsklig bipotent progenitorcellinjer som kan differentiera vid exponering för 2% dimetylsulfoxid (DMSO) mot två olika cell fenotyper: biliär-liknande och hepatocyte-liknande celler. Differentierade HepaRG celler (dHepaRG) dela vissa funktioner och egenskaper med vuxna hepatocyter och besitter förmågan att stabilt uttrycka leverspecifika gener såsom albumin, AldolaseB, cytokrom P450 2E1 (CYP2E1), och cytokrom P450 3A4 (CYP3A4)13 (steg 3). Behandling av dheparg celler med fettsyran salt natriumoleat (250 μm) för 5 dagar leda till generering av cytoplasmiska lipiddroppar, imitera effekterna av fettlever14,15,17,18 ( steg 4). Ansamling av lipiddroppar kan lätt upptäckas av olja röd O färgning (steg 5), en lysokrom fettlösliga färgämnen som fläckar neutrala triglycerider och lipider röd-orange. För att effektivt kvantifiera lipider i Fatty dHepaRG, här illustrerar vi cytofluorimetrisk analys efter färgning med 4, 4-difluoro-1, 3, 5, 7-tetrametyl-4-Bora-3a, 4a-diaza-s-indacene (Bodipy 505/515) (steg 6), en lipofila fluorescerande sond som lokaliserar till intracellulära lipidkroppar och har använts för att märka lipiddroppar19. Dessutom, här visar vi hur man utvärderar steatos genom kvantitativ polymeras kedjereaktion (qPCR) (steg 7) genuttryck avreglering av flera metaboliska gener i dheparg celler. För att ytterligare karakterisera och kvantifiera ackumuleringen av lipiddroppar efter behandling med natriumoleat utförde vi sammanhängande anti-Stokes Raman spridning (Cars) mikroskopi (steg 8), en innovativ teknik som möjliggör visualisering och kvantifiering av lipiddroppar utan märkning20,21.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. beredning av odlingsmedier och reagenser

  1. Prolifererande medium: komplettera Williams E medium med GlutaMAX, 10% foster bovint serum (FBS), 1% penicillin/streptomycin, 5 μg/mL insulin och 0,5 μM hydrokortison hemisuccinat.
  2. Differentiering medium: supplement Williams E medium med GlutaMAX, 10% FBS, 1% penicillin/streptomycin, 5 μg/mL insulin, 50 μM hydrokortison hemisuccinat och 2% DMSO.
  3. Frysning medium: komplettera prolifererande medium med 10% DMSO.
  4. Natriumoleat: lös i 99% metanol vid en koncentration av 100 mM, rör om O/N och förvara vid-20 ° c.
  5. Olja röd O: Förbered en stamlösning. Väg upp 0,35 g Oljeröd O och lös upp i 100 mL isopropanol. Rör O/N, filter (0,2 μm) och förvara på RT. Förbered en fungerande lösning: blanda 6 mL olja röd O stamlösning med 4 mL ddH2o. Låt sitta i rumstemperatur (RT) i 20 min, och sedan filtrera med ett 0,2 μm filter. Korrekt filtrering rekommenderas starkt för lyckad färgning för att undvika bakgrund.
  6. Bodipy (505/515): lös Bodipy (505/515) Dye i DMSO vid en lager koncentration på 100 μM, lagra vid-20 ° c i mörker, och använd vid en slutlig 100 nM koncentration.
  7. Förvärva transparenta glas bottnat rätter för bilar experiment.

2. upptining, amplifiering och Kryopreservering av HepaRG-celler

  1. Tina upp kväve som kryopreserverade HepaRG-celler genom att doppa ett parti i ett bad 37 ° c tills det avfrostade. Välj en låg passage-sats (< 20). HepaRG-celler är kommersiellt tillgängliga.
  2. Överför snabbt cellerna till ett 15 mL-rör som innehåller 10 mL prolifererande medium och Centrifugera i 5 min (200 x g, 4 ° c).
  3. Kassera supernatanten och Omsuspendera cellerna med 5 mL prolifererande medium.
  4. Räkna cellerna och späd för att plattan 2,5 x 104 celler/cm2.
  5. Förnya mediet varje 2 eller 3 dagar. Celler sprider sig med en fördubblings tid på cirka 24 h.
  6. Lossa HepaRG celler när vid 80% confluency av 3-5 min inkubation med trypsin lösning 0,05%. Samla in cellerna i prolifererande medium och Centrifugera i 5 min (200 x g, 4 ° c).
  7. Kassera supernatanten och Omsuspendera cellerna med 5 mL prolifererande medium.
  8. Räkna cellerna och späd för att plattan 2,5 x 104 celler/cm2.
  9. I detta skede, förstärka cellerna genom att upprepa steg 2.5-2.8 för att nå ett lämpligt antal celler för att starta experiment, eller frysa som i steg 2,10.
  10. För att kryopreserve HepaRG celler, lossa cellerna 24 h efter plätering av 3-5 min inkubation med trypsin lösning 0,05%. Samla in cellerna i prolifererande medium och Centrifugera i 5 min (200 x g, 4 ° c). Kassera supernatanten, Omsuspendera cellerna i 1 mL/sats frys medium, 1,5 x 106 celler/sats och frys reserv partierna i flytande kväve.

3. differentiering av HepaRG-celler (dag 0 – 21) (figur 1A)

  1. Dag 0. Utsäde av HepaRG-celler med låg densitet (2,5 x 104 celler/cm2) till kulturbehandlade rätter med lämplig mängd spridnings medium (figur 1B). Två rätter måste pläteras för varje analys (olja röd O färgning, FACS analys, qPCR): en för kontrollceller och en för Oleate-behandlade celler. Om utför bilar mätningar (steg 8), utsäde cellerna parallellt i transparenta glasbotten rätter. Som en kontroll, skörda en obehandlad maträtt (proliferating cells dag 0) för att utföra genuttryck analys av differentiering markör gener (se steg 3,6).
  2. Dag 2 och dag 4. Ändra mediet med lämplig volym av proliferation medium och låt cellerna växa tills Confluence.
  3. Dag 7. Cellerna måste vara 100% konfluenta (figur 1C). Tvätta cellerna en gång med 1x fosfatbuffrad saltlösning (PBS). Ta bort 1x PBS och tillsätt en lämplig volym differentierings medium.
  4. Dag 8, 9, 12, 15, 18.  Tvätta cellerna en gång med 1x PBS. Ta bort 1x PBS och tillsätt en lämplig volym differentierings medium.
  5. Dag 21. Observera HepaRG celler i Mikroskop och se till att cellerna är konfluenta differentierade kulturer (figur 1D).
  6. Som en kontroll, skörda en kontroll skålen (differentierade celler dag 21) för att utföra gen uttrycks analys (steg 7) av differentiering markörgener (figur 1E).
  7. Vid dag 21, differentierade HepaRG celler kan vara kryopreserved i flytande kväve.

4. induktion av vesikulär steatos (dag 21 – 26)

  1. Dag 21. Späd natriumoleat (100 mM) med en lämplig volym av fullständigt differentierings medium till en slutlig koncentration av 250 μM (1:400). Tillsätt 99% metanol 1:400 (samma volym som den för natriumoleat) i en annan alikvot av differentierings mediet för att göra fordonets kontroll behandling. (Till exempel: Tillsätt 25 μL natriumoleat till 10 mL medium och parallellt tillsätt 25 μL 99% metanol till 10 mL medium). Tvätta cellerna en gång med 1x PBS och tillsätt vehikel eller natriumoleat medium.
  2. Dag 23 och dag 25. Ändra mediet med lämplig volym av nyberedd medium som i steg 4,1.
  3. Dag 26. Observera med optiska mikroskop att lipiddroppar ackumuleras i natrium Oleate-behandlade celler och är lätt synlig som genomskinliga droppar i cytoplasman som i figur 2A.

5. utvärdering av Lipidöverlastning och steatos induktion: olja röd O färgning

  1. Tvätta celler en gång med 1x PBS och ta bort 1x PBS helt.
  2. Tillsätt 4% PARAFORMALDEHYD (utspädd i 1x PBS) och inkubera i 15 minuter vid RT.
    Försiktighet: PARAFORMALDEHYD är giftig, så detta steg måste utföras i en draghuv, med skyddsutrustning, inklusive handskar, en labbrock, och en mask.
  3. Ta bort PARAFORMALDEHYD och tvätta cellerna två gånger med 1x PBS. Celler kan förvaras i 1x PBS vid 4 ° c i ett par dagar före färgning. Wrap med parafilm och täck med aluminiumfolie för att förhindra att cellerna torkar.
  4. Ta bort 1x PBS. Inkubera cellerna med 60% isopropanol i 5 minuter vid RT.
  5. Ta bort isopropanol och låt cellerna torka helt vid RT.
  6. Tillsätt olja röd O arbetslösning och inkubera vid RT i 30 min. Den mängd arbetslösning som krävs för varje prov motsvarar volymen av de medier som används för odling av cellerna.
  7. Ta bort olja röd O lösning och omedelbart lägga till ddH2o. Tvätta cellerna 4 gånger med DDH2o.
  8. Hämta bilder under mikroskop för analys (figur 2B).
  9. Till eluera olja röd O färg: ta bort allt vatten och låt torka; Tillsätt 1 mL 100% isopropanol och inkubera i 10 minuter med skonsam skakning vid RT.
  10. Pipet isopropanol med eluerad olja röd O färg upp och ner flera gånger, se till att all olja röd O är i lösningen. Överför lösningen till en kuvette. Mät OD500 nm med spektrofotometri och Använd 100% isopropanol som blind (figur 2C).

6. utvärdering av Lipidöverbelastning och steatos induktion: Bodipy färgning och Cytofluorimetrisk analys

  1. Tvätta cellerna en gång med 1x PBS. Inkubera med 100 nM av Bodipy utspädd i 1x PBS i mörker för 40 min vid 37 ° c. En obefläckade kontroll bör inkluderas i flödescytometrimätningarna. Från denna punkt, skydda proverna från ljus så mycket som möjligt.
    Anmärkning: Volymen av den infärgnings lösning som krävs för varje prov motsvarar volymen av de medier som används för odling av celler.
  2. Ta bort infärgnings lösningen och tvätta cellerna en gång med 1x PBS. Fortsätt till steg 6.3-6.6. för FACS-analys (Fluorescence-activated cell sortering) eller steg 6,7 för Mikroskop avbildning.
  3. Skrapa försiktigt cellerna med 1x PBS och överför det till en 15 mL tub. Centrifugera i 10 min (200 x g, 4 ° c).
  4. Ta försiktigt bort supernatanterna utan att störa pellets och tvätta med 3 mL 1x PBS. Centrifugera i 5 min (200 x g, 4 ° c).
  5. Ta bort samman supernatanterna och Omsuspendera i 300 μl 1x PBS, sedan överföra till ett FACS-rör.
  6. Mät omedelbart bodipy fluorescens intensitet genom cytofluorimetrisk analys med excitation/emission våglängder av 505/515 nm (figur 3A, B).
  7. Tvätta cellerna en gång med 1x PBS och ta bort PBS helt.
  8. Tillsätt 4% PARAFORMALDEHYD (utspädd i 1x PBS) och inkubera i 15 minuter vid RT.
    Försiktighet: PARAFORMALDEHYD är giftig, så detta steg måste utföras i en draghuv, med skyddsutrustning, inklusive handskar, en labbrock, och en mask.
  9. Ta bort PARAFORMALDEHYD och tvätta proverna 3x i 5 min i PBS. Cellerna kan förvaras i 1x PBS vid 4 ° c eller avbildas omedelbart (figur 3C). För förvaring, wrap med parafilm och täck med aluminiumfolie för att förhindra att cellerna torkar.

7. utvärdering av Lipidöverbelastning och steatos induktion: qPCR

  1. Tvätta cellerna en gång med 1x PBS. Skrapa cellerna med 1x PBS, Centrifugera vid 200 x goch Kassera supernatanten. I detta steg kan celler skördas vid-80 ° c eller bearbetas som i steg 7,2.
  2. Utför total RNA-isolering med standardmetoder med hjälp av kommersiella reagenser enligt tillverkarens anvisningar.
  3. Bedöm RNA-koncentrationen med UV-spektrofotometriska mätningar, vilket säkerställer att RNA-renheten är hög (nära 2,0) baserat på A260/A280-läsningen.
  4. Syntetisera cDNA från 1 μg totalt RNA med en standard cDNA syntes kit.
  5. Späd cDNA till en slutlig 50 μL volym med H2O.
  6. Analysera varje cDNA-prov i tre exemplar med qPCR: Förbered en qPCR Master Mix (tabell 1) som är tillräcklig för de reaktioner som behövs för varje primer, inklusive primers som är specifika för de tre Housekeeping-generna som kontroller: gliceraldeide-3-Fosfato deidrogenasi (GAPDH), actinB och ribosomal 18S (se bordlägga av material för primer ordnar):
  7. Fördela 18 μL Mastermix per brunn i en PCR-multiväggplatta.
  8. Tillsätt 2 μL cDNA-prov i varje brunn. Försegla plattan.
  9. Kör proverna enligt Termocyklerinstruktionen.

8. utvärdering av Lipidöverbelastning och steatosis induktion: bilar

  1. Fix de celler som tidigare utarbetats på glasbotten rätter, som beskrivs i steg 5.1-5.3.
  2. Slå på en kommersiell avstämbar pikosekund pulsad lasersystem, trimma den för att få två utgångar av olika våglängder. Frekvens skillnaden mellan utgångarna måste vara 2 840 cm-1 för att generera den intensiva bilar ljussignal som motsvarar metylensymmetriska stretching; för en fast våglängd utgång vid 1 064 nm ("Stokes" ljus), bör den andra våglängd vara inställd på 817 nm ("pump" ljus).
  3. Se till att 817 nm-utgången är rumsligt och temporalt överlappad med 1 064 nm-utgång: Använd en lämplig Dichroic spegel (dvs, med ett snitt mellan 817 och 1 064 nm) att rumsligt kombinera balkar och använda en optisk fördröjning linje för att få temporala överlappning av lasern Pulser.
  4. Se till att de två föröknings balkar är båda kollimerade och att deras diametrar har liknande värden som är lämpliga för det optiska systemet i mikroskopet som kommer att fokusera dem på provet; om det behövs, separat kollimate balkar före Dichroic spegeln som kombinerar dem.
  5. Slå på en kommersiell inverterad Mikroskop system, som bör innehålla en infraröd laserskanning enhet och en Dual-Channel röd/grön EPI detekterings enhet och anpassa copropagerande laserstrålar i skannings enheten.
  6. Öppna Dual-Channel EPI detekterings enhet, ta bort filterkuben och ersätt dess röda våglängd detektions filter med ett bandpass filter som kan välja 2 840 cm-1 bilar signal som är centrerad vid 663 Nm för 817/1064 nm pump/Stokes excitation System. Ett smalbandsfilter (20 nm) är att föredra för att undvika insamling av höga nivåer av fluorescerande bakgrunds signaler.
  7. Placera en maträtt på scenen av den inverterade bilar Mikroskop, och med hjälp av en 100x oljeimmersion mål, flytta den vertikala positionen av målet att fokusera på cellerna.
  8. Ställ in Mikroskop programvaran för att samla högupplösta (1024 x 1024 pixlar) bilder över ett synfält som spänner över 127 μm x 127 μm.
  9. Ställ in Mikroskop programvaran att kontinuerligt förvärva och Visa bilder av 127 μm x 127 μm synfält och kontrollera de visade bilderna samtidigt optimera parametrarna Bildinsamling. Se till att laser krafterna är balanserade för snabb Bildinsamling och minimal skada, infoga lämpliga filter för neutral densitet i strål banorna efter behov, och välj en pixel dröj tid som gör det möjligt att samla bilder med en bra signal-till-brus under de valda lasereffekt förhållandena.
  10. Förvärva och spara bilder av flera olika syn områden inom skålen under optimerade förhållanden. Alternativt kan multiphoton fluorescens bilder, som genereras av en grön våglängd utsläpp (främst från två-Photon excitation vid 817 nm), samtidigt samlas in via den andra EPI detektor. Upprepa steg 8.7-8.10 för varje maträtt.
  11. För bilarna bildanalys, bearbeta bilder med FIJI genomförandet av ImageJ. Använd Despeckle-funktionen (eller ett liknande denoising-verktyg) på varje bild innan ytterligare analys för att förbättra signal-till-brus-förhållanden utan detaljförlust.
  12. Använd FIJI för att markera celler manuellt och sedan automatiskt räkna lipiddroppar i segmenterade enskilda celler för att producera statistik om lipid dropp områden och siffror för varje cell och för hela bild datauppsättningen för varje maträtt.

9. livskraft analys för MTT-celler

  1. Plattan differentierade HepaRG celler i en 96-brunn tallrik med en densitet av 1 x 105 celler/brunn i en slutlig 100 μl volym differentiering odlingssubstrat.
  2. 24 h efter sådd, behandla cellerna med 99% metanol (fordon) och med 100 μM, 250 μM och 500 μM natriumoleat och natriumpalmitat utspädd i 100 μL av differentiering kultur medium/brunn i tre exemplar.
  3. Ändra mediet med 99% metanol och med 100 μM, 250 μM och 500 μM natriumoleat och natriumpalmitat utspädd i 100 μL av differentiering kultur medium/brunn varje 24 h.
  4. 96 h efter behandling med metanol/natriumoleat/natriumpalmitat, behandla cellerna med 2 μM doxorubicin utspädd i 100 μL differentierings kultur medium/brunn i tre exemplar som kontroll.
  5. 18 h efter behandling med doxorubucin, ändra mediet med 100 μL av differentiering odlingssubstrat.
  6. Pipet 20 μL 3-(4, 5-dimetyltiazol-2-yl)-5-(3-karboxymetoxifenyl)-2-(4-sulfofenyl)-2H-tetrazolium reagens MTT (tabell över material) i varje brunn av 96-brunn assay plattan som innehåller cellerna i 100 μl differentiering odlingssubstrat . Inkludera en bakgrundskontroll genom att Pipettera 20 μL reagens i en kontroll brunn utan celler i 100 μL av differentierings odlingsmediet i tre exemplar.
  7. Inkubera plattan vid 37 ° c i en Befuktad 5% CO2 -atmosfär.
  8. Efter inkuberingen för 30, 60 och 90 min med MTT tetrazolium reagens, registrera absorbansen vid 490 nm med hjälp av en 96-väl tallrik läsare. Subtrahera bakgrunds absorbansen för No-cell Control Wells från absorbansvärdena för de andra proverna.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Detta protokoll beskriver en effektiv metod för att inducera och karakterisera vesikulär steatos i DMSO-differentierade HepaRG-celler genom behandling med natriumoleat (figur 1A).

Differentiering av HepaRG-celler.
För att effektivt framkalla differentiering måste prolifererande celler seedas med låg densitet (2,5 x 104 celler/cm2) i spridnings mediet. När cellerna seedas vid låg densitet delar de aktivt upp och förvärvar en långsträckt odifferentierad morfologi (figur 1B). Cellerna bör lämnas att växa i spridningen mediet för 7 dagar, tills 100% confluency uppnås (figur 1C). Efter exponering för 2% DMSO, celler börjar differentiera och att bilda typiska hepatocyte-liknande kolonier omgivna av biliär epitelial-liknande celler (figur 1D). Differentierade HepaRG-celler uttrycker hepato-specifika markörer, såsom albumin, Cyp3A4 och Aldolase B. För att kontrollera korrekt differentiering analyserades uttrycksnivåerna av dessa levermarkörgener i de differentierade cellerna (dag 21) och i de prolifererande cellerna (dag 0) av qPCR (figur 1E). Albumin, Cyp3A4 och Aldolase B-gener bör uppreglerad i de differentierade heparg-cellerna jämfört med de prolifererande heparg-cellerna, och vi observerade denna trend, vilket bekräftar effektiviteten i vårt differentierings protokoll.

Induktion av vesikulär steatos i HepaRG celler genom natriumoleat behandling.
Natriumoleat behandling av dHepaRG celler inducerar ansamling av fett, synlig under ett optiskt mikroskop som lipid droppar i cytoplasman (figur 2A). För att kontrollera effektiv induktion av steatos, oleat-behandlade och kontroll HepaRG celler färgas med olja röd O färgämne. Efter färgning är lipiddroppar lätt synliga som röda droppar (figur 2B) och kan kvantifieras med spektrofotometriska mätningar av olja röd O färgämne som eluerats med isopropanol (figur 2C). Absorbans av eluerad olja röd O från cellerna är direkt proportionell mot cytoplasmatiska lipid dropp ansamling.

Koncentrationen av natriumoleat och exponeringstiden fastställdes med hjälp av en MTT-kolorimetrisk cell lönsamhetsanalys (steg 9). Behandling med natriumoleat jämfördes med behandling med natriumpalmitat och den apoptotiska drogen doxorubucin (2 μM) användes som kontroll (figur 2D). Cytoxicitet av föreningarna utvärderades med MTT, dra nytta av en kommersiell förening (tabell över material), som innehåller MTT tetrazolium. Den vattenlösliga gula MTT tetrazolium föreningen är bioreducerad av metaboliskt aktiva celler till en lila vattenolöslig formazan produkt. Den formazan produkten kvantifieras genom sin absorbans vid 490 nm och beloppet är direkt proportionell mot antalet levande celler i kulturen (figur 2D).

Kvantifiering av vesikulär steatos i natriumoleatbehandlade HepaRG-celler
För att kvantifiera ökningen av cellulära lipidhalten efter natriumoleat behandling, vi utförde färgning med Bodipy Dye, en sond som etiketter lipiddroppar. Med hjälp av cytofluorimetrisk analys är det möjligt att kvantifiera triglyceridhalten med Bodipy genomsnittlig fluorescerande intensitet, som är högre i oleatbehandlade celler jämfört med kontrollceller (figur 3A, B), vilket indikerar effektivt fett ackumulering efter behandling med oleat. I själva verket, bilder av Bodipy-färgade celler visar ljust grön fluorescerande lipiddroppar i Oleate-behandlade celler som inte syns i kontroll cellerna (figur 3C).

Natriumoleat behandling av dHepaRG celler avreglerar lipidmetabolismen och inflammatoriska genuttryck. För att utvärdera en effektiv induktion av vesikulär steatos analyserade vi genom qPCR uttrycksnivåerna för utvalda gener i natriumoleatbehandlade celler jämfört med kontroll cellernas (figur 4). Acetyl-COA ribulosbisfosfatkarboxylas beta (acacb), glycerol-3-fosfat acyltransferas mitokondrie (gpam), perilipins (PLIN2, PLIN4), apolipoprotein B (ApoB), pyruvatdehydrogenas Kinas isozymet 4 (PDK4), karnitin palmitoyltransferas 1a (CPT1A) och interleukin 6 (IL6) var uppreglerad i oleatbehandlade dheparg-celler, medan familjen solute Carrier 2 medlem 1 (SLC2A1), apolipoprotein C-III (APOC3) och Stearoyl-COA-desaturas (SCD) var nedreglerade (figur 4). För att ytterligare karakterisera och kvantifiera lipid lagring i droppar vid tillsats av natriumoleat till differentierade heparg celler, utnyttjade vi en innovativ mikroskopi teknik, sammanhängande anti-Stokes Raman spridning (bilar) mikroskopi, vilket gör att visualisering och kvantifiering av lipiddroppar utan märkning (figur 5a). Lipiddroppar var statistiskt kvantifierade i termer av antal, distribution och morfologi på encellig nivå med hjälp av bilar bilder. Behandling med natriumoleat (250 μm) inducerade en signifikant ökning av antalet lipiddroppar (figur 5B), vilket ledde till ett högre totalt dropp område per cell (figur 5C) och ett högre procentuellt dropp område per cell ( Figur 5D) jämfört med kontrollceller, vilket indikerar att dheparg-celler effektivt ackumulerat fett efter behandling med natriumoleat.

Figure 1
Figur 1 : Differentiering av HepaRG-celler. A) ettrepresentativt diagram över det differentierings-/behandlingsprotokoll för HepaRG-celler som beskrivs i steg 3 och 4. (B-D) Bilder som visar ofärgade prolifererande heparg-celler dag 0 efter sådd (B), vid sammanflödet dag 7 efter sådd (C), och differentierade heparg (dheparg) vid dag 21 efter sådd (D). (E) totalt RNA extraherades från prolifererande och dHepaRG-celler, cDNA syntetiserades och analyserades av qPCR med primers som var specifika för de angivna generna (tabell över material). Proverna normaliserades till medelvärdet av de egna generna GAPDH, actinB och ribosomal 18S. Histograms Visa Fold induktion av prolifererande (dag 0) kontra differentierade celler (dag 21) (staplar indikerar SD; p-värden beräknades genom Students t-test). Vänligen klicka här för att se en större version av denna siffra.

Figure 2
Figur 2 : Natriumoleat behandling av dheparg celler inducerad lipid dropp ackumulering. A) bilder av ofärgade differentierade heparg-celler (dheparg) behandlade i 5 dagar med vehikel (kontroll) (vänster bild) eller med 250 μm natriumoleat (höger bild). (B) efter behandling, cellerna färgas med olja röd O färgämne; lipiddroppar är synliga i rött. C) olja röd O färg var eluerad och OD mättes vid 570 nm. Resultaten uttrycks som medel för tre oberoende experiment (staplar indikerar SD, p-värde efter Students t-test). D) utvärdering av cellernas genomförbarhet av dHepaRG-celler (99% metanol) behandlade (Ctrl) eller behandlade i 5 dagar med natriumoleat och natriumpalmitat (100 μm, 250 μm eller 500 μm), eller behandlade 18 h med doxorubucin (2 μm).  Bedömning av cytotoxicitet utfördes med hjälp av en MTT-analyssats (tabell över material), inspelnings absorbans vid 490 nm, enligt tillverkarens anvisningar. Resultaten uttrycks som medel för tre oberoende experiment (staplar indikerar SD; p-värden fastställdes med hjälp av Students t-test: * 0,01 ≤ p < 0,05; * * 0,001 ≤ p < 0,01; * * * p < 0,001). Vänligen klicka här för att se en större version av denna siffra.

Figure 3
Figur 3 : Kvantifiering av ansamling av fett efter natriumoleat behandling med Bodipy färgning. Differentierade HepaRG-celler (dHepaRG) behandlades med vehikel (kontroll) eller med 250-μM natriumoleat i 5 dagar. Efter behandling, var dHepaRG celler färgas med Bodipy färgämne och analyseras av flödescytometri. A) representativa överläggnings profiler (% av Max: procent av maximal färgintensitet). (B) histogram visar medelfluorescensintensitet (MFI) som en procentandel av behandlade celler över kontroll från tre oberoende experiment (staplar indikerar SD; p-värden fastställdes med hjälp av Students t-test: * 0,01 ≤ p < 0,05; * * 0,001 ≤ p < 0,01; * * * p < 0,001). C) cellerna fastställdes med 4% PARAFORMALDEHYD. Bilder visar Bodipy-färgade lipiddroppar i grönt. Vänligen klicka här för att se en större version av denna siffra.

Figure 4
Figur 4 : Natriumoleat behandling av dHepaRG celler inducerar avreglering av lipidmetabolismen och inflammatoriska genuttryck. Differentierade HepaRG-celler (dHepaRG) behandlades med vehikel (kontroll) eller med 250-μM natriumoleat i 5 dagar. cDNAs analyserades av qPCR med primers som var specifika för de angivna generna och resultaten normaliserades till medelvärdet av de egna generna GAPDH, actinB och ribosomal 18S. primers ges i tabellen av material. Histogrammet visar uttrycks nivåer av indikerade gener som viknings induktioner av behandlade celler över kontroll (staplar indikerar SD; p-värden beräknades genom Students t-test). Vänligen klicka här för att se en större version av denna siffra.

Figure 5
Figur 5 : Karakterisering av lipiddroplet ackumulering efter natriumoleat behandling av bilar Microscopy. Differentierade HepaRG (dHepaRG) celler behandlades med fordon (kontroll) eller med 250 μM natriumoleat för 5 dagar och analyserades av bilar Microscopy. (A) representativa bilder som visar lipid dropp-bilar kontrasterar i rött. (B) histogram som visar antalet lipiddroppar per cell. (C) histogram som visar totalbild yta täckt av droppar per cell. (D) histogram som visar% dropp-området täckt av droppar per cell. Alla resultat uttrycks som medel av tre oberoende experiment (bommar för indikerar e-, p-värderar bestämdes av deltagarens t-test: * 0,01 ≤ p < 0,05; * * 0,001 ≤ p < 0,01; * * * p < 0,001). Vänligen klicka här för att se en större version av denna siffra.

Reagenser Volym (μL) för en enda reaktion
2x SYBR grön fluorescerande färgämne 10
PCR-klass H2O 6
Framåt primer (μM) 1
Omvänd primer (μM) 1

Tabell 1: huvud mix av qPCR.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Detta protokoll beskriver hur man differentierar HepaRG-celler och hur man inducerar vesikulär steatos genom natriumoleatbehandling (figur 1A). I själva verket, jämfört med andra humana hepatocellulära carcinom (HCC) cellinjer, heparg cell linjen uppvisar egenskaper hos vuxna humana hepatocyter, som representerar ett värdefullt alternativ till ex vivo odlade primära humana hepatocyter13,14 ,15. Den heparg cell linjen har använts i stor utsträckning för levercytotoxicitetsstudier, läkemedelsmetabolism, och virologi studier15,16,22.

I jämförelse med heparg celler, andra HCC cellinjer såsom HepG2, HUH7, HUH6 och Hep3B Visa lägre metabolisk kapacitet, saknar en betydande uppsättning av leverspecifika funktioner23,24, och uppvisar en högre basal nivå av cytosolisk fettansamling lagrad i lipiddroppar. Sålunda, dessa HCC cellinjer är mindre användbara som modeller för induktion av vesikulär steatos efter lipid överbelastning än HepaRG cellinjer.

Kritiska steg inom protokollet
När seedade vid låg densitet (2,5 x 104 celler/cm2), heparg celler förvärva en långsträckt odifferentierad morfologi, aktivt dividera; efter att ha uppnått 100% confluency, de kan differentiera vid exponering för 2% DMSO och de bildar typiska hepatocyte-liknande kolonier omgivna av biliär epitelial-liknande celler (figur 1D). Denna blandade biliär/hepatocyte cellkultur recapitulates funktioner i levern vävnad, som liknar en fysiologisk tillstånd, trots saknar andra lever cells typer (Sinusoidal eller Kupffer).

Ett kritiskt steg i differentierings processen är cellernas sammanlänkning. Cellerna måste vara seedade vid låg densitet (2,5 x 104 celler/cm2) (figur 1B) och tillåtas att aktivt växa i spridnings mediet under minst 1 vecka (dag 0-7). På dag 7, innan du lägger till 2% DMSO att starta differentierings processen, cellerna måste vara på 100% sammanflödet (figur 1C). Om vid dag 7 (steg 2,2) fullständig sammanflödet inte har uppnåtts, det rekommenderas starkt att cellerna tillåts fortsätta växa i spridningen mediet för några ytterligare dagar, tills 100% sammanflödet uppnås.

Protokollets begränsningar
Det har observerats att efter att ha lagt differentiering medium, vissa celler lider, och typiskt 10% av cellerna dör under de efterföljande 2-3 dagar. I detta skede måste daglig tvättning och medelstora förändringar (steg 2,4) fortsätta att kassera flytande döda celler. Användningen av en specifik FBS (tabell över material) för att komplettera både differentiering och spridning media, bör öka differentiering effektivitet och lägre celldöd under dagar 7-21 (steg 2,4). Det rekommenderas starkt att bibehålla cellerna upp till passage 20, och att välja nedre passager (< 20) för att differentiera celler: mindre celler döden inträffar för de yngsta HepaRG cellerna. Dessutom verkar HepaRG differentiering vara mer effektiv i 35 mm och 60 mm rätter, medan cellerna tenderar att lida mer när seedade i 100 mm och 150 mm rätter.

Ändringar och felsökning
Exponering för olika förhållanden av både palmitinsyra och oljesyra fettsyror har visat sig resultera i bildandet av intracytoplasmatiska lipiddroppar25,26. Emellertid, vi observerade att natriumoleat behandling av differentierade heparg celler uppvisade bättre resultat än palmitinsyra Acid exponering, i termer av effektiv induktion av lipidackumulering och cellviabilitet (figur 2D). I själva verket, palmitinsyra Acid behandling visade sig vara giftigt för differentierade heparg celler (figur 2D), i samförstånd med litteraturdata om hepatom cellinjer och på människa och råtta hepatocyte primära kulturer som beskriver palmitinsyra Acid som en avsevärt cytotoxiskt medel25,26,27,28,29. Dessutom är utnyttjandet av palmitat i cellbaserade analyser utmanande på grund av dess låga löslighet. På grund av de inneboende variabiliteten i cellinjer, rekommenderas att kontrollera natrium oleat arbets koncentration och behandlingstid längd, testa olika koncentrationer i en tid-kurs experiment med en cell genomförbarhet analys.

Betydelse och jämförelse av lipiddetekterings tekniker
Noggrann bestämning av lipidmängder i celler fastställdes via ett antal olika metoder i denna studie. Kvalitativ och även ungefär kvantitativ överenskommelse observerades mellan de resultat som erhållits via olja röd O färgning, Bodipy färgning, och bilar Imaging. För en snabb uppskattning av lipidkvantiteter i cellpopulationer, användning av Bodipy-flödescytometri eller en fläck som olja röd O är idealisk. För en mer detaljerad undersökning av lipidhalten i celler, en avbildning modalitet är att föredra. Dessutom har specificitet problemrapporter ATS för lipidfläckar såsom olja röd O20,30, och vi har konstaterat att i vissa fall, den bodipy fläcken har en lägre kapacitet än bilar att uteslutande etiketten lipiddroppar bland andra cell organeller (data visas inte). Därför ger användning av en etikettfri mikroskopisk avbildningsteknik som bilar betydande fördelar för steatos kvantifiering och karakterisering. Undvikande av användning av en stor fluorescerande etikett gör bilar Imaging gynnsamma på grund av den lilla storleken av lipidmolekyler jämfört med typiska fluoroforer; Därför, för detektion av lipider, etikett-fria metoder är önskvärda, ännu mer så än för att observera stora proteinmolekyler. Lipidbilarna signalen är en optisk emission som genereras endast när en ickelinjär interaktion sker i provet. Denna interaktion kan bara upptäckas när skillnaden mellan frekvenserna av de två excitation lasrar fokuserat på provet matchar metylenblått (CH2) stretching vibrationsfrekvens. Överflödet av metylenblått grupper i lipider resulterar i en mycket intensiva signaler med hög signal-brus-förhållanden, och olinjäritet av den optiska interaktionen innebär också att hög rumslig upplösning är möjligt i bilar mikroskopi. Den utmärkta kvaliteten på bilar bilder i allmänhet tillåter insamling av statistik om storlekar och antal lipiddroppar, vilket framgår av denna studie. Dessutom har andra studier visat användning av bilar mikroskopi att korrelera olika subcellulära lokaliseringar och storlekar av lipiddroppar med olika behandlingar18, och genom att använda kompletterande bilar mätningar vid olika våglängder, eller en bredbands bil eller liknande stimulerad Raman-strategi har forskarna visat att det är möjligt att karakterisera olika typer av fettsyror inom lipiddroppar31,32. Dessutom har snabbhet i bilar Bildinsamling aktiverat in situ-avbildning av levande celler för att undersöka den temporala utvecklingen av lipid dropp tillväxt och aggregation33.

Framtida tillämpningar
Under de senaste decennierna har synen på rollerna och funktionerna hos lipiddroppar i cellbiologi utvecklats. Tidigare tros vara i princip inert lagring blåsor, de är nu förstås att vara mycket dynamiska cellulära organeller, och deras roll i sjukdomen är alltmer erkänns34,35,36. Även i fallet med leversjukdom, lipidackumulering (steatos) har länge varit känt för att vara en kritisk aspekt, den exakta mekanismen för inblandning av lipiddroppar i sjukdomsprogression är inte helt klart. Därför, metoder såsom bilar som kan karakterisera det dynamiska beteendet hos lipiddroppar är av avgörande betydelse för utvecklingen av en molekylär förståelse av sjukdomar inklusive NAFLD. Metabolisk gen uttrycks analys av qPCR är ett mycket komplement till molekylär avbildning av lipider via bilar, vilket visats i tidigare studier17,18, vilket ger djupare insikter i sjukdomsmekanismer. I den nuvarande studien iakttar vi ansamling av fettsyror med avreglering av lipidmetabolismen och inflammatoriska genuttryck, vilket kan bidra till byggandet av en panel av biomarkörer för tidig sjukdomsdiagnos.

Den natriumoleat-behandlade dHepaRG cell-baserade modellen kan öka kunskapen om de molekylära mekanismer som berörs inte bara i början utan också i utvecklingen av NAFLD, vilket ger en grund för utvecklingen av bättre terapeutiska metoder för sjukdomen.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Författarna förklarar att de inte har några konkurrerande ekonomiska intressen.

Acknowledgments

Vi tackar prof. Christian Trepo (INSERM U871, Lyon, Frankrike), som vänligt gav HepaRG celler. Vi är tacksamma mot Rita Appodia för administrativ hjälp. Detta arbete stöddes av MIUR-Ministero dell' istruzione, dell' Università e della ricerca (FIRB 2011 – 2016 RBAP10XKNC) och Sapienza-universitetet i Rom (prot. C26A13T8PS; Prot. C26A142MCH; Prot. C26A15LSXL).

Materials

Name Company Catalog Number Comments
Hyclone HyClone Fetal Clone II  GE Healthcare SH30066
William’s E medium with GlutaMAX  Thermofisher 32551087
Penicillin/streptomycin  SIGMA P4333
Insulin  SIGMA I9278
Hydrocortisone hemisuccinate SIGMA H2270
DMSO, dimethyl sulfoxide SIGMA D2438   
Sodium Oleate SIGMA O7501 
Methanol SIGMA 179337
Isopropanol SIGMA 278475
BODIPY 505/515 Thermofisher D3921
PBS Thermofisher 14190-250
Formaldehyde solution SIGMA 252549
RNAse free DNAseI Promega M198A 
Glass-bottomed dishes Willco Wells GWST-5040
Oil Red solution SIGMA O625
CellTiter 96 AQueous One Solution Promega  G3582
q-PCR oligo name Sequence
ACACB FOR CAAGCCGATCACCAAGAGTAAA
ACACB REV CCCTGAGTTATCAGAGGCTGG
β-actin FOR GCACTCTTCCAGCCTTCCT
β-actin REV AGGTCTTTGCGGATGTCCAC
ALBUMIN FOR TGCTTGAATGTGCTGATGACAGG
ALBUMIN REV AAGGCAAGTCAGCAGGCATCTCATC
ALDOB FOR GCATCTGTCAGCAGAATGGA 
ALDOB REV TAGACAGCAGCCAGGACCTT
APOB FOR CCTCCGTTTTGGTGGTAGAG
APOB REV  CCTAAAAGCTGGGAAGCTGA
APOC3 FOR CTCAGCTTCATGCAGGGTTA
APOC3 REV GGTGCTCCAGTAGTCTTTCAG
CPT1A FOR TCATCAAGAAATGTCGCACG
CPT1A REV GCCTCGTATGTGAGGCAAAA
CYP2E1 FOR TTGAAGCCTCTCGTTGACCC
CYP2E1 REV CGTGGTGGGATACAGCCAA
CYP3A4 FOR CTTCATCCAATGGACTGCATAAAT
CYP3A4 REV TCCCAAGTATAACACTCTACACAGACAA
GAPDH FOR TGACAACTTTGGTATCGTGGAAGG
GAPDH REV AGGGATGATGTTCTGGAGAGCC
GPAM FOR TCTTTGGGTTTGCGGAATGTT
GPAM REV ATGCACATCTCGCTCTTGAATAA
IL6 FOR CCTGAACCTTCCAAAGATGGC
IL6 REV ACCTCAAACTCCAAAAGACCAGTG
PDK4 FOR ACAGACAGGAAACCCAAGCCAC
PDK4 REV TGGAGGTGAGAAGGAACATACACG
PLIN2 FOR TTGCAGTTGCCAATACCTATGC
PLIN2 REV CCAGTCACAGTAGTCGTCACA
PLIN4 FOR AATGAGTTGGAGGGGCTGGGGGACATC
PLIN4 REV GGTCACCTAAACGAACGAAGTAGC
SCD FOR TCTAGCTCCTATACCACCACCA
SCD REV TCGTCTCCAACTTATCTCCTCC
SLC2A1 FOR TGCTCATCAACCGCAACGAG
SLC2A1 REV CCGACTCTCTTCCTTCATCTCCTG
18S FOR CGCCGCTAGAGGTGAAATTC
18S REV TTGGCAAATGCTTTCGCTC

DOWNLOAD MATERIALS LIST

References

  1. Starley, B. Q., Calcagno, C. J., Harrison, S. A. Nonalcoholic fatty liver disease and hepatocellular carcinoma: a weighty connection. Hepatology. 51, (5), 1820-1832 (2010).
  2. Byrne, C. D., Targher, G. NAFLD: a multisystem disease. Journal of Hepatology. 62, (1), Suppl 47-64 (2015).
  3. Marra, F., Gastaldelli, A., Svegliati Baroni, G., Tell, G., Tiribelli, C. Molecular basis and mechanisms of progression of non- alcoholic steatohepatitis. Trends in Molecular Medicine. 14, 72-81 (2008).
  4. Chalasani, N., et al. The diagnosis and management of nonalcoholic fatty liver disease: Practice guidance from the American Association for the Study of Liver Diseases. Hepatology. 67, (1), 328-357 (2018).
  5. Banini, B. A., Sanyal, A. J. Current and future pharmacologic treatment of nonalcoholic steatohepatitis. Current Opinion in Gastroenterology. 33, (3), 134-141 (2017).
  6. Takahashi, Y., Sugimoto, K., Inui, H., Fukusato, T. Current pharmacological therapies for nonalcoholic fatty liver disease/nonalcoholic steatohepatitis. World Journal of Gastroenterology. 21, (13), 3777-3785 (2015).
  7. Younossi, Z., et al. Global burden of NAFLD and NASH: trends, predictions, risk factors and prevention. Nature Reviews Gastroenterology & Hepatology. 15, (1), 11-20 (2018).
  8. Santhekadur, P. K., Kumar, D. P., Sanyal, A. J. Preclinical models of non-alcoholic fatty liver disease. Journal of Hepatology. 68, (2), 230-237 (2018).
  9. Nagarajan, P., Mahesh Kumar, M. J., Venkatesan, R., Majundar, S. S., Juyal, R. C. Genetically modified mouse models for the study of nonalcoholic fatty liver disease. World Journal of. Gastroenterology. 18, (11), 1141-1153 (2012).
  10. Oseini, A. M., Cole, B. K., Issa, D., Feaver, R. E., Sanyal, A. J. Translating scientific discovery: the need for preclinical models of nonalcoholic steatohepatitis. Hepatology International. 12, (1), 6-16 (2018).
  11. Ramboer, E., Vanhaecke, T., Rogiers, V., Vinken, M. Immortalized human hepatic cell lines for in vitro testing and research purposes. Methods in Molecular Biology. 1250, 53-76 (2015).
  12. Gómez-Lechón, M. J., Donato, M. T., Castell, J. V., Jover, R. Human hepatocytes in primary culture: the choice to investigate drug metabolism in man. Current Drug Metabolism. 5, (5), 443-462 (2004).
  13. Marion, M. J., Hantz, O., Durantel, D. The HepaRG cell line: biological properties and relevance as a tool for cell biology, drug metabolism, and virology studies. Methods in Molecular Biology. 640, 261-272 (2010).
  14. Gripon, P., et al. Infection of a human hepatoma cell line by hepatitis B virus. Proceedings of the National Academy of Sciences. 99, (24), 15655-15660 (2002).
  15. Anthérieu, S., Rogue, A., Fromenty, B., Guillouzo, A., Robin, M. A. Induction of vesicular steatosis by amiodarone and tetracycline is associated with up-regulation of lipogenic genes in HepaRG cells. Hepatology. 53, (6), 1895-1905 (2011).
  16. Rouge, A., et al. PPAR agonists reduce steatosis in oleic acid-overloaded HepaRG cells. Toxicology and Applied Pharmacology. 276, (1), 73-81 (2014).
  17. Belloni, L., et al. Targeting a phospho-STAT3-miRNAs pathway improves vesicular hepatic steatosis in an in vitro and in vivo model. Scientific Reports. 8, 13638 (2018).
  18. Nunn, A. D. G., et al. The histone deacetylase inhibiting drug Entinostat induces lipid accumulation in differentiated HepaRG cells. Scientific Reports. 6, 28025 (2016).
  19. Donato, M. T., et al. Cytometric analysis for drug-induced steatosis in HepG2 cells. Chemico-Biological Interactions. 181, (3), 417-423 (2009).
  20. Hellerer, T., Axäng, C., Brackmann, C., Hillertz, P., Pilon, M., Enejder, A. Monitoring of lipid storage in Caenorhabditis elegans using coherent anti-Stokes Raman scattering (CARS) microscopy. Proceedings of the National Academy of Sciences. 104, (37), 14658-14663 (2007).
  21. Le, T. T., Ziemba, A., Urasaki, Y., Brotman, S., Pizzorno, G. Label-free evaluation of hepatic microvesicular steatosis with multimodal coherent anti-Stokes Raman scattering microscopy. PLoS One. 7, (11), 51092 (2012).
  22. Guillouzo, A., Corlu, A., Aninat, C., Glaise, D., Morel, F., Guguen-Guillouzo, C. The human hepatoma HepaRG cells: a highly differentiated model for studies of liver metabolism and toxicity of xenobiotics. Chemico-Biological Interactions. 168, (1), 66-73 (2007).
  23. Nelson, L. J., et al. Human hepatic HepaRG cells maintain an organotypic phenotype with high intrinsic CYP450 Activity/metabolism and significantly outperform standard HepG2/C3A cells for pharmaceutical and therapeutic applications. Basic & Clinical Pharmacology & Toxicology. 120, (1), 30-37 (2017).
  24. Gerets, H. H. J., Tilmant, K., Gerin, B., Chanteux, H., Depelchin, B. O., Dhalluin, S., Atienzar, F. A. Characterization of primary human hepatocytes, HepG2 cells, and HepaRG cells at the mRNA level and CYP activity in response to inducers and their predictivity for the detection of human hepatotoxins. Cell Biology and Toxicology. 28, (2), 69-87 (2012).
  25. Pusl, T., et al. Free fatty acids sensitize hepatocytes to bile acid-induced apoptosis. Biochemical and Biophysical Research Communications. 371, (3), 441-445 (2008).
  26. Gentile, C. L., Pagliassotti, M. J. The role of fatty acids in the development and progression of nonalcoholic fatty liver disease. The Journal of Nutritional Biochemistry. 19, (9), 567-576 (2008).
  27. Mei, S., et al. Differential roles of unsaturated and saturated fatty acids on autophagy and apoptosis in hepatocytes. Journal of Pharmacological Experimental Therapy. 339, 487-498 (2011).
  28. Malhi, H., Bronk, S. F., Werneburg, N. W., Gores, G. J. Free fatty acids induce JNK-dependent hepatocyte lipoapoptosis. Journal of Biological Chemistry. 281, 12093-12101 (2006).
  29. Moravcová, A., Červinková, Z., Kučera, O., Mezera, V., Rychtrmoc, D., Lotková, H. The effect of oleic and palmitic acid on induction of steatosis and cytotoxicity on rat hepatocytes in primary culture. Physiological Research. 64, Suppl 5 627-636 (2015).
  30. Ohsaki, Y., Shinohara, Y., Suzuki, M., Fujimoto, T. A pitfall in using BODIPY dyes to label lipid droplets for fluorescence microscopy. Histochemistry and Cell Biology. 133, (4), 477-480 (2010).
  31. Rinia, H. A., Burger, K. N., Bonn, M., Müller, M. Quantitative label-free imaging of lipid composition and packing of individual cellular lipid droplets using multiplex CARS microscopy. Biophysical Journal. 95, (10), 4908-4914 (2008).
  32. Waschatko, G., Billecke, N., Schwendy, S., Jaurich, H., Bonn, M., Vilgis, T. A., Parekh, S. H. Label-free in situ imaging of oil body dynamics and chemistry in germination. Journal of The Royal Society Interface. 13, (123), (2016).
  33. Jüngst, C., Winterhalder, M. J., Zumbusch, A. Fast and long term lipid droplet tracking with CARS microscopy. Journal of Biophotonics. 4, (6), 435-441 (2011).
  34. Welte, M. A., Gould, A. P. Lipid droplet functions beyond energy storage. Biochimica et Biophysica Acta - Molecular and Cell Biology of Lipids. 1862, (10), Pt B 1260-1272 (2017).
  35. Cohen, S. Lipid droplets as organelles. International Review of Cell and Molecular Biology. 337, 83-110 (2018).
  36. Farese, R. V., Walther, T. C. Lipid droplets finally get a little R-E-S-P-E-C-T. Cell. 139, (5), 855-860 (2009).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics