Inducir y caracterizar la esteatosis vesicular en células hepa-repartidas diferenciadas

Medicine

Your institution must subscribe to JoVE's Medicine section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

En este estudio, describimos un protocolo detallado para inducir esteatosis vesicular hepática en células HepaRG diferenciadas con el oleato de sodio de sal de ácido graso y empleamos métodos para la detección y cuantificación de la acumulación de lípidos, incluyendo anti-Stokes coherentes Microscopía de dispersión Raman (CARS), análisis citofluorimétrico, tinción O de color rojo aceite y qPCR.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Di Cocco, S., Belloni, L., Nunn, A. D., Salerno, D., Piconese, S., Levrero, M., Pediconi, N. Inducing and Characterizing Vesicular Steatosis in Differentiated HepaRG Cells. J. Vis. Exp. (149), e59843, doi:10.3791/59843 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

La esteatosis hepática representa una disfunción metabólica que resulta de una acumulación de gotas lipídicas que contienen triglicéridos en hepatocitos. La acumulación excesiva de grasa conduce a una enfermedad del hígado graso no alcohólico (NAFLD), que es potencialmente reversible y puede evolucionar a esteatohepatitis no alcohólica (NASH) y, finalmente, a cirrosis y carcinoma hepatocelular (HCC). Los mecanismos moleculares que vinculan la acumulación de lípidos en hepatocitos con la progresión a NASH, daño hepático irreversible, fibrosis, cirrosis, e incluso HCC todavía no está claro. Para ello, se han desarrollado varios modelos in vitro e in vivo para dilucidar los procesos patológicos que causan la NAFLD. En el presente estudio, describimos un modelo celular para la inducción de esteatosis vesicular hepática que consiste en células HepaRG hepáticas humanas diferenciadas por DMSO tratadas con el oleato de sodio de sal de ácido graso. De hecho, las células HepaRG tratadas con oleato sódico acumulan gotas lipídicas en el citoplasma y muestran características típicas de la esteatosis. Este modelo humano in vitro representa una alternativa valiosa a los modelos de ratones in vivo, así como a los principales hepatocitos humanos. También presentamos una comparación de varios métodos para la cuantificación y evaluación de la acumulación de grasa en células HepaRG, incluyendo la tinción de aceite rojo O, la medición de Bodipy citofluorimétrica, el análisis de la expresión génica metabólica por qPCR y los anti-Stokes coherentes Microscopía de dispersión Raman (CARS). La imagen CARS combina la especificidad química de la espectroscopia Raman, una técnica de análisis químico bien conocida en aplicaciones de ciencia de materiales, con los beneficios de las microscopías ópticas no lineales de alta velocidad y alta resolución para permitir una precisión precisa cuantificación de la acumulación de lípidos y la dinámica de gotas de lípidos. El establecimiento de un modelo in vitro eficiente para la inducción de esteatosis vesicular, junto con un método preciso para la cuantificación y caracterización de la acumulación de lípidos, podría conducir al desarrollo de un diagnóstico en etapa temprana de NAFLD a través de la identificación de marcadores moleculares, y a la generación de nuevas estrategias de tratamiento.

Introduction

La esteatosis hepática se define como acumulación de grasa intrahepática, dentro de las gotas lipídicas que contienen triglicéridos, de al menos el 5% del peso hepático. El almacenamiento prolongado de lípidos hepáticos es un proceso potencialmente reversible, sin embargo, puede conducir a disfunción metabólica hepática, inflamación y formas avanzadas de enfermedad del hígado graso no alcohólico (NAFLD), la causa predominante de la enfermedad hepática crónica en muchas partes de el mundo1,2. La NAFLD es una enfermedad multifactorial que puede evolucionar a la esteatohepatitis no alcohólica (NASH) más agresiva, que a su vez puede progresar a cirrosis y, en un pequeño porcentaje de pacientes, al carcinoma hepatocelular (HCC)1,3. Actualmente no se dispone de terapia aprobada como tratamiento específico para el NAFLD y la combinación de modificaciones de dieta y estilo de vida sigue siendo el pilar de la gestión de NAFLD y NASH4,5,6.

Los mecanismos moleculares que conducen al desarrollo de esteatosis hepática en la patogénesis de la NAFLD todavía están por esclarecer 7 . En este contexto, se han desarrollado modelos de ratón para estudiar la progresión de la enfermedad de la esteatosis humana. Existe una gran variedad de modelos diferentes, y cada uno tiene sus ventajas y desventajas, incluyendo modelos genéticos, nutricionales y químicamente inducidos que combinan diferentes enfoques. Los ratones genéticamente modificados (transgénicos o noqueadores) desarrollan espontáneamente enfermedad hepática. Sin embargo, cabe señalar que estas mutaciones son muy raras en los seres humanos y la deleción o la sobreexpresión de un solo gen (por ejemplo, ratón ob/ob) pueden no imitar la etiología de la enfermedad humana multifactorial a nivel molecular8,9. Del mismo modo, la enfermedad adquirida por los ratones después de la manipulación dietética o farmacológica puede no imitar los efectos de las dietas humanas asociadas con el desarrollo de NAFLD en el hombre8. Sin embargo, los modelos animales han facilitado la evolución de la NAFLD y este enfoque es actualmente la estrategia más utilizada en la investigación de laboratorio. Sin embargo, la replicación en humanos de los resultados obtenidos en modelos animales ha fracasado repetidamente, causando una mala traducción a la clínica10.

Por lo tanto, los modelos in vitro de NAFLD pueden desempeñar un papel fundamental en la esclarecimiento de los mecanismos moleculares de la progresión de la NAFLD, y representan una herramienta valiosa para examinar un gran número de compuestos. Cultivos celulares primarios, líneas celulares inmortalizadas y biopsias hepáticas se han utilizado ampliamente con fines de investigación11. Los hepatocitos humanos primarios se asemejan mucho a las condiciones clínicas humanas, pero hay un número limitado de donantes, y los cultivos celulares primarios muestran una reproducción deficiente debido a la variabilidad de las células. Estas observaciones, junto con cuestiones éticas y logísticas, han dado lugar a que el uso de hepatocitos primarios humanos sea limitado12. Por lo tanto, las líneas de células hepáticas representan una alternativa conveniente, teniendo varias ventajas esenciales sobre el cultivo primario, ya que las líneas celulares hepáticas crecen constantemente, tienen una vida útil casi ilimitada, y tienen un fenotipo estable. Además, las líneas celulares son fácilmente accesibles y las condiciones de cultivo de las líneas celulares hepáticas son más simples que las de los hepatocitos primarios y están estandarizadas entre diferentes laboratorios.

Aquí, describimos en detalle un modelo in vitro basado en células de esteatosis vesicular hepática, representado por células HepaRG diferenciadas hepáticas tratadas con el oleato de sodio de ácido graso. La línea celular hepargal se estableció a partir de una paciente afectada por la infección por hepatitis C y un tumor hepático bien diferenciado de grado I de Edmondson14. La línea celular HepaRG es una línea celular progenitora bipotente humana capaz de diferenciarse al exponerse al 2% de sulfóxido de dimetil (DMSO) hacia dos fenotipos celulares diferentes: células biliares y células similares a hepatocitos. Las células HepaRG diferenciadas (dHepaRG) comparten algunas características y propiedades con hepatocitos adultos y poseen la capacidad de expresar de forma estable genes específicos del hígado como la albúmina, AldolaseB, el citocromo P450 2E1 (CYP2E1) y el citocromo P450 3A4 (CYP3A4)13 (paso 3). El tratamiento de las células dHepaRG con el oleato sódico de sal de ácido graso (250 m) durante 5 días conduce a la generación de gotas lipídicas citoplásmáticas, imitando los efectos del hígado graso14,15,17,18 ( paso 4). La acumulación de gotas lipídicas puede ser fácilmente detectada por la tinción de aceite rojo O (paso 5), un tinte soluble en grasa lisocromo que mancha triglicéridos neutros y lípidos rojo-naranja. Para cuantificar eficientemente los lípidos en dHepaRG graso, aquí ilustramos el análisis citofluorimétrico después de la tinción con 4,4-difluoro-1,3,5,7-tetrametil-4-bora-3a,4a-diaza-s-indacene (Bodipy 505/515) (paso 6), una sonda fluorescente lipofílica que localiza a cuerpos de lípidos intracelulares y se ha utilizado para etiquetar las gotas de lípidos19. Además, aquí mostramos cómo evaluar la esteatosis mediante la reacción cuantitativa en cadena de la polimerasa (qPCR) (paso 7) desregulación de la expresión génica de varios genes metabólicos en células dHepaRG. Para caracterizar y cuantificar aún más la acumulación de gotas de lípidos después del tratamiento con oleato sódico, realizamos una microscopía coherente de dispersión anti-Stokes Raman (CARS) (paso 8), una técnica innovadora que permite la visualización y cuantificación de gotas de lípidos sin etiquetar20,21.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Preparación de medios y reactivos culturales

  1. Medio proliferante: suplemento medio E de William con GlutaMAX, suero bovino 10% fetal (FBS), 1% penicilina/estreptomicina, 5 g/ml y hemisuccinato de hidrocortisona de 0,5 m.
  2. Medio de diferenciación: suplemento medio E de William con GlutaMAX, 10% FBS, 1% penicilina/estreptomicina, insulina de 5 g/ml, hemisuccinato de hidrocortisona de 50 oM y 2% DMSO.
  3. Medio de congelación: suplemento proliferando medio con 10% DMSO.
  4. Oleato de sodio: disolver en metanol al 99% a una concentración de 100 mM, agitar O/N y almacenar a -20 oC.
  5. Oil Red O: preparar una solución de stock. Pesar 0,35 g de aceite rojo O y disolver en 100 ml de isopropanol. Revuelva O/N, filtre (0,2 m) y guárdelo en RT. Prepare una solución de trabajo: mezcle 6 ml de solución Oil Red O Stock con 4 ml de ddH2O. Deje sentarse a temperatura ambiente (RT) durante 20 minutos y, a continuación, filtre con un filtro de 0,2 m. Se recomienda una filtración adecuada para una tinción exitosa para evitar el fondo.
  6. Bodipy (505/515): disolver el tinte Bodipy (505/515) en DMSO a una concentración de stock de 100 oM, almacenar a -20 oC en la oscuridad y utilizar en una concentración final de 100 nM.
  7. Adquiera platos transparentes con fondo de vidrio para los experimentos CARS.

2. Descongelación, amplificación y criopreservación de células HepaRG

  1. Descongelar las células HepaRG de nitrógeno descongelando sumergiendo un lote en un baño de 37 oC hasta que se descongelen. Seleccione un lote de paso bajo (<20). Las células hepaRG están disponibles comercialmente.
  2. Transfiera rápidamente las células a un tubo de 15 ml que contenga 10 ml de medio proliferante y centrífuga durante 5 min (200 x g, 4 oC).
  3. Deseche el sobrenadante y resuspenda las células con 5 ml de medio proliferante.
  4. Cuente las células y diluya para placar 2,5 x 104 celdas/cm2.
  5. Renueve el medio cada 2 o 3 días. Las células proliferan con un tiempo de duplicación de alrededor de 24 h.
  6. Separe las células HepaRG cuando esté al 80% de confluencia por 3-5 min de incubación con solución de trippsina 0.05%. Recoger las células en medio proliferante y centrifugar durante 5 min (200 x g,4 oC).
  7. Deseche el sobrenadante y resuspenda las células con 5 ml de medio proliferante.
  8. Cuente las células y diluya para placar 2,5 x 104 celdas/cm2.
  9. En esta etapa, amplificar las celdas repitiendo los pasos 2.5-2.8 para alcanzar un número adecuado de celdas para iniciar experimentos, o criopreservar como en el paso 2.10.
  10. Para criopreservar las células HepaRG, separe las células 24 h después del enchapado por 3-5 min de incubación con solución de trippsina 0.05%. Recoger las células en medio proliferante y centrifugar durante 5 min (200 x g,4 oC). Deseche el sobrenadante, resuspenda las células en 1 ml/lote de medio de congelación, 1,5 x 106 células/lote y criopreserve los lotes en nitrógeno líquido.

3. Diferenciación de células HepaRG (Día 0–21) (Figura1A)

  1. Día 0. Células hepa-repartidas de semillas a baja densidad (2,5 x 104 células/cm2) en platos tratados con cultivo con un volumen adecuado de medio de proliferación (Figura1B). Se deben chapar dos platos para cada ensayo (tinción de aceite rojo O, análisis FACS, qPCR): uno para células de control y otro para células tratadas con oleato. Si realiza mediciones CARS (paso 8), sembra rinde las células en paralelo en platos transparentes con fondo de vidrio. Como control, cosecha un plato no tratado (células proliferantes Día 0) para realizar análisis de expresión génica de genes marcadores de diferenciación (ver paso 3.6).
  2. Día 2 y Día 4. Cambiar el medio con el volumen adecuado de medio de proliferación y dejar que las células crezcan hasta la confluencia.
  3. Día 7. Las celdas deben ser 100% confluentes (Figura1C). Lave las células una vez con 1 solución salina tamponada con fosfato (PBS). Retire 1x PBS y agregue un volumen adecuado de medio de diferenciación.
  4. Día 8, 9, 12, 15, 18.  Lave las células una vez con 1x PBS. Retire 1x PBS y agregue un volumen adecuado de medio de diferenciación.
  5. Día 21. Observe las células HepaRG bajo un microscopio y asegúrese de que las células sean confluentes cultivos diferenciados (Figura1D).
  6. Como control, cosere una antena de control (células diferenciadas Día 21) para realizar análisis de expresión génica (paso 7) de genes marcadores de diferenciación (Figura1E).
  7. En el día 21, las células HepaRG diferenciadas se pueden crioreservar en nitrógeno líquido.

4. Inducción de esteatosis vesicular (día 21–26)

  1. Día 21. Diluir el oleato sódico (100 mM) con un volumen adecuado de medio de diferenciación completo a una concentración final de 250 m (1:400). Añadir 99% de metanol 1:400 (mismo volumen que el de oleato de sodio) en otra alícuota de diferenciación para realizar el tratamiento de control del vehículo. (Por ejemplo: añadir 25 ml de oleato sódico a 10 ml de medio y en paralelo añadir 25 ml de metanol al 99% a 10 ml de medio). Lave las células una vez con 1pbS y agregue el vehículo o el medio de oleato sódico.
  2. Día 23 y Día 25. Cambie el medio con el volumen adecuado de medio recién preparado como en el paso 4.1.
  3. Día 26. Observe por microscopio óptico que las gotas lipídicas se acumulan en las células tratadas con oleato sódico y son fácilmente visibles como gotas translúcidas en el citoplasma como en la Figura 2A.

5. Evaluación de la sobrecarga de lípidos y la inducción de esteatosis: aceite rojo O tinción

  1. Lávese las células una vez con 1pbS y retire 1x PBS completamente.
  2. Añadir 4% paraformaldehído (diluido en 1x PBS) e incubar durante 15 min a RT.
    PRECAUCION: Paraformaldehyde es tóxico, por lo que este paso debe realizarse en una campana de humo, con equipo de protección, incluyendo guantes, una capa de laboratorio y una máscara.
  3. Retire el paraformaldehído y lave las células dos veces con 1 pbS. Las células se pueden mantener en 1pbS a 4 oC durante un par de días antes de la tinción. Envuelva con parafilm y cubra con papel de aluminio para evitar que las células se sequen.
  4. Retire 1x PBS. Incubar las células con 60% de isopropanol durante 5 min a RT.
  5. Retire el isopropanol y deje que las células se sequen completamente en RT.
  6. Añadir aceite rojo O solución de trabajo e incubar a RT durante 30 min. El volumen de solución de trabajo necesario para cada muestra corresponde al volumen de medios utilizados para el cultivo de las celdas.
  7. Retire la solución de aceite rojo O y agregue inmediatamente ddH2O. Lavar las células 4 veces con ddH2O.
  8. Adquirir imágenes bajo el microscopio para su análisis (Figura 2B).
  9. Para eluir el aceite tinte rojo O: eliminar toda el agua y dejar secar; añadir 1 mL de 100% isopropanol e incubar durante 10 minutos con suave temblor a RT.
  10. Pipet a la isopropanol con aceite eludado tinte rojo o varias veces, asegurando que todo el aceite rojo O está en la solución. Transfiera la solución a una cubeta. Mida OD500 nm por espectrofotometría y utilice 100% isopropanol en blanco (Figura2C).

6. Evaluación de sobrecarga de lípidos e inducción de esteatosis: Tinción de Bodipy y Análisis Citofluorimétrico

  1. Lave las células una vez con 1x PBS. Incubar con 100 nM de Bodipy diluido en 1x PBS en la oscuridad durante 40 min a 37oC. Se debe incluir un control sin mancha en las mediciones de citometría de flujo. A partir de este punto, proteja las muestras de la luz tanto como sea posible.
    NOTA: El volumen de solución de tinción necesaria para cada muestra corresponde al volumen de medios utilizados para el cultivo de celdas.
  2. Retire la solución de tinción y lave las células una vez con 1 pbS. Continúe con los pasos 6.3-6.6. para el análisis facS (clasificación celular activada por fluorescencia) o para el paso 6.7 para la toma de imágenes por microscopio.
  3. Raspar suavemente las células con 1pbS y transferirlas a un tubo de 15 ml. Centrífuga durante 10 min (200 x g,4oC).
  4. Retire suavemente los sobrenadores sin perturbar los pellets y lávelos con 3 ml de 1pbS. Centrífuga durante 5 min (200 x g, 4oC).
  5. Retire los sobrenadores y resuspenda en 300 s de PBS 1x, luego transfiera a un tubo FACS.
  6. Mida inmediatamente la intensidad de la fluorescencia de Bodipy mediante análisis citofluorimétrico con longitudes de onda de excitación/emisión de 505/515 nm (Figura3A,B).
  7. Lave las células una vez con 1pbS y retire PBS por completo.
  8. Añadir 4% paraformaldehído (diluido en 1x PBS) e incubar durante 15 min a RT.
    PRECAUCION: Paraformaldehyde es tóxico, por lo que este paso debe realizarse en una campana de humo, con equipo de protección, incluyendo guantes, una capa de laboratorio y una máscara.
  9. Retire el paraformaldehído y lave las muestras 3 veces durante 5 min en PBS. Las celdas se pueden mantener en 1x PBS a 4 oC o se pueden crear imágenes inmediatamente (Figura3C). Para el almacenamiento, envuelva con parafilm y cubra con papel de aluminio para evitar que las células se sequen.

7. Evaluación de sobrecarga de lípidos e inducción de esteatosis: qPCR

  1. Lave las células una vez con 1x PBS. Raspa las células con 1x PBS, centrífuga a 200 x g,y descarta el sobrenadante. En este paso, las células pueden ser cosechadas a -80 oC o procesadas como en el paso 7.2.
  2. Realice un aislamiento total del ARN mediante métodos estándar utilizando reactivos comerciales siguiendo las instrucciones del fabricante.
  3. Evaluar la concentración de ARN mediante medición espectrofotométrica UV, asegurando que la pureza del ARN sea alta (cerca de 2.0) basada en la lectura A260/A280.
  4. Sintetice el ADNc a partir de 1 g de ARN total con un kit de síntesis de ADNc estándar.
  5. Diluir el ADNC a un volumen final de 50 l con H2O.
  6. Analizar cada muestra de ADNc en triplicado por qPCR: preparar una mezcla maestra qPCR (Tabla 1) que sea suficiente para las reacciones necesarias para cada imprimación, incluyendo imprimaciones específicas para los tres genes de limpieza como controles: gliceraldeide-3-fosfato deidrogenasi (GAPDH), actinB y ribosomal 18S (ver Tabla de Materiales para secuencias de imprimación):
  7. Dispensar 18 l de mezcla maestra por pozo en una placa multipared PCR.
  8. Añadir 2 s de muestra de ADNc en cada poca. Selle el plato.
  9. Ejecute las muestras de acuerdo con la instrucción Thermal Cycler.

8. Evaluación de sobrecarga de lípidos e inducción de esteatosis: CARS

  1. Fije las células previamente preparadas en platos con fondo de vidrio, como se describe en los pasos 5.1-5.3.
  2. Encienda un sistema láser pulsado de picosegundo ajustable comercial, afinándolo para obtener dos salidas de diferentes longitudes de onda. La diferencia de frecuencia entre las salidas debe ser de 2.840 cm-1 para generar la señal de luz CARS intensa correspondiente al estiramiento simétrico de metileno; para una salida de longitud de onda fija a 1.064 nm (luz ("Luz de los estomos"), la otra longitud de onda debe ajustarse a 817 nm ("luz de la bomba").
  3. Asegúrese de que la salida de 817 nm se superponga espacial y temporalmente con la salida de 1.064 nm: utilice un espejo dicroico apropiado (es decir, con un corte entre 817 y 1.064 nm) para combinar espacialmente los haces y utilizar una línea de retardo óptico para obtener la superposición temporal del láser Pulsos.
  4. Asegurar que los dos haces copropagadores estén colimados y que sus diámetros tengan valores similares que sean apropiados para el sistema óptico dentro del microscopio que los enfocará en la muestra; si es necesario, colisione por separado las vigas antes del espejo dicroico que las combina.
  5. Encienda un sistema de microscopio invertido comercial, que debe incluir una unidad de escaneo láser infrarrojo y una unidad de detección de epi rojo/verde de doble canal y alinear los rayos láser copropagadores en la unidad de escaneo.
  6. Abrir la unidad de detección epi de doble canal, quitar el cubo de filtro y reemplazar su filtro de detección de longitud de onda roja por un filtro de paso de banda que puede seleccionar la señal de 2.840 cm-1 CARS que se centra en 663 nm para la excitación de la bomba/Stokes de 817/1.064 nm Esquema. Se prefiere un filtro de ancho de banda estrecho (20 nm) para evitar la recopilación de altos niveles de señales de fondo fluorescentes.
  7. Coloque un plato en el escenario del microscopio CARS invertido, y usando un objetivo de inmersión en aceite de 100x, cambie la posición vertical del objetivo para centrarse en las células.
  8. Configure el software del microscopio para recopilar imágenes de alta resolución (1024 x 1024 píxeles) sobre un campo de visión que abarca 127 mm x 127 m.
  9. Configure el software del microscopio para que adquiera y muestre continuamente imágenes del campo de visión de 127 m x 127 m y compruebe las imágenes mostradas mientras optimiza los parámetros de la colección de imágenes. Asegúrese de que las potencias láser estén equilibradas para una rápida recopilación de imágenes y un daño mínimo, insertando filtros de densidad neutra apropiados en los trazados de haz según sea necesario, y seleccione un tiempo de permanencia de píxeles que permita la recolección de imágenes con una buena señal de ruido en las condiciones de potencia láser seleccionadas.
  10. Adquirir y guardar imágenes de varios campos de visión diferentes dentro del plato bajo las condiciones optimizadas. Opcionalmente, las imágenes de fluorescencia multifotón, generadas por una emisión de longitud de onda verde (principalmente a partir de excitación de dos fotones a 817 nm), pueden recogerse simultáneamente a través del otro detector epi. Repita los pasos 8.7-8.10 para cada plato.
  11. Para el análisis de imágenes CARS, procese imágenes utilizando la implementación FIJI de ImageJ. Utilice la función Despeckle (o una herramienta de denosonación similar) en cada imagen antes de realizar un análisis posterior para mejorar las relaciones señal-ruido sin pérdida de detalle.
  12. Utilice FIJI para seleccionar celdas manualmente y luego contar automáticamente las gotas de lípidos dentro de celdas individuales segmentadas para producir estadísticas sobre las áreas y números de gotas de lípidos para cada celda y para todo el conjunto de datos de imágenes para cada plato.

9. Ensayo de viabilidad celular MTT

  1. Placa diferenciada células HepaRG en una placa de 96 pocillos con una densidad de 1 x 105 células/pozo en un volumen final de 100 oL de medio de cultivo de diferenciación.
  2. 24 h después de la sembrada, tratar las células con 99% de metanol (vehículo) y con 100 m, 250 m y 500 oM de oleato sódico y palmitato sódico diluido en 100 ml de cultivo de diferenciación medio/bien en triplicado.
  3. Cambiar el medio con 99% de metanol y con 100 m, 250 m y 500 m de oleato sódico y palmitato de sodio diluido en 100 oL de cultivo de diferenciación medio/bien cada 24 h.
  4. 96 h después del tratamiento con metanol/oleato de sodio/palmitato de sodio, tratar las células con doxorubicina de 2 M diluidas en 100 ml de cultivo de diferenciación medio/bien en triplicado como control.
  5. 18 h después del tratamiento con doxorubucina, cambie el medio por 100 ml de medio de cultivo de diferenciación.
  6. Pipet20 l de 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium reactivo MTT (Tabla de materiales) en cada pozo de la placa de ensayo de 96 pocillos que contiene las células en 100 ol de medio de cultivo de diferenciación . Incluya un control de fondo pipeteando 20 ml de reactivo en un pozo de control sin células en 100 oL de medio de cultivo de diferenciación en triplicado.
  7. Incubar la placa a 37oC en una atmósfera humidificada y al 5% de CO2.
  8. Después de incubar durante 30, 60 y 90 minutos con el reactivo DE tetrazolium MTT, registre la absorbancia a 490 nm utilizando un lector de placas de 96 pocillos. Restar la absorbancia de fondo de los pozos de control sin celda de los valores de absorbancia para las otras muestras.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Este protocolo describe un método eficaz para inducir y caracterizar la esteatosis vesicular en células HepaRG diferenciadas por DMSO mediante tratamiento con oleato sódico (Figura1A).

Diferenciación de células HepaRG.
Para inducir eficientemente la diferenciación, las células que proliferan deben ser sembradas a baja densidad (2,5 x 104 células/cm2)en el medio de proliferación. Cuando se sembran a baja densidad, las células se dividen activamente y adquieren una morfología alargada indiferenciada (Figura1B). Las células deben dejarse crecer en el medio de proliferación durante 7 días, hasta que se alcance la confluencia del 100% (Figura 1C). Después de la exposición al 2% de DMSO, las células comienzan a diferenciarse y a formar colonias típicas similares a hepatocitos rodeadas de células epiteliales biliares (Figura1D). Las células HepaRG diferenciadas expresan marcadores hepatoespecíficos, como la albúmina, Cyp3A4 y la aldolase B. Para verificar la diferenciación adecuada, los niveles de expresión de estos genes marcadores hepáticos en las células diferenciadas (Día 21) y en las células proliferantes (Día 0) fueron analizados por qPCR (Figura1E). Los genes de albúmina, Cyp3A4 y Aldolase B deben ser regulados en las células HepaRG diferenciadas en comparación con las células hepaRG proliferantes, y observamos esta tendencia, confirmando la eficacia de nuestro protocolo de diferenciación.

Inducción de esteatosis vesicular en células HepaRG mediante tratamiento con oleato sódico.
El tratamiento del oleato sódico de las células dHepaRG induce la acumulación de grasa, visible bajo un microscopio óptico como gotas de lípidos en los citoplasmas (Figura2A). Para verificar la inducción eficiente de esteatosis, las células hepacíticas tratadas con oleato y de control se teñiron con tinte de aceite rojo O. Después de la tinción, las gotas lipídicas son fácilmente visibles como gotas rojas (Figura2B) y se pueden cuantificar mediante la medición espectrofotométrica de color ante ella de aceite rojo o con isopropanol (Figura2C). La absorción del aceite eludado rojo O de las células es directamente proporcional a la acumulación de gotas lipídicas citoplasmáticas.

La concentración de oleato de sodio y el tiempo de exposición se determinaron mediante el ensayo de viabilidad de células colorimétricas MTT (paso 9). El tratamiento con oleato de sodio se comparó con el tratamiento con palmitato de sodio y el fármaco apoptótico doxorubucina (2 m) se utilizó como control (Figura2D). La toxicidad de los compuestos fue evaluada por MTT, aprovechando un compuesto comercial (Tablade Materiales),que contiene el tetrazolio MTT. El compuesto de tetrazolio MTT amarillo soluble en agua es bioreducido por células metabólicamente activas en un producto formazán insoluble en agua púrpura. El producto formazán se cuantifica por su absorbancia en 490 nm y la cantidad es directamente proporcional al número de células vivas en cultivo (Figura2D).

Cuantificación de esteatosis vesicular en células HepaRG tratadas con oleato sódico
Para cuantificar el aumento del contenido de lípidos celulares después del tratamiento con oleato sódico, realizamos la tinción con el tinte Bodipy, una sonda que etiqueta las gotas lipídicas. Utilizando el análisis citofluorimétrico, es posible cuantificar el contenido de triglicéridos por intensidad fluorescente media de Bodipy, que es mayor en las células tratadas con oleato en comparación con las células de control (Figura3A, B), lo que indica grasa eficiente acumulación después del tratamiento con oleato. De hecho, las imágenes de células manchadas de Bodipy muestran gotas de lípidos fluorescentes verdes brillantes en células tratadas con oleato que no son visibles en las células de control (Figura3C).

El tratamiento del oleato de sodio de las células dHepaRG desregula el metabolismo de los lípidos y la expresión génica inflamatoria. Para evaluar la inducción eficiente de la esteatosis vesicular, analizamos por qPCR los niveles de expresión de genes seleccionados en células tratadas con oleato de sodio en comparación con los de las células de control (Figura4). Acetil-CoA carboxilasa beta (ACACB), glicerol-3-fosfato acilaltransferasa mitocondrial (GPAM), perilipinas (PLIN2, PLIN4), apolipoproteína B (APOB), piruvato deshidrogenasa quinasa isozyme 4 (PDK4), carnitina palmitoyltransferase 1A (CPT1A) interleucina 6 (IL6) se reguló en células dHepaRG tratadas con oleato, mientras que la familia portadora de soluto 2 miembro 1 (SLC2A1), laapolipoproteína C-III (APOC3) y la esteatrusilal-CoA desaturasa (SCD) fueron reguladas (Figura 4). Para caracterizar y cuantificar aún más el almacenamiento de lípidos en gotas tras la adición de oleato sódico a células HepaRG diferenciadas, utilizamos una innovadora técnica de microscopía, una microscopía coherente de dispersión de Raman (CARS) anti-Stokes, que permite visualización y cuantificación de gotas lipídicas sin etiquetado (Figura5A). Las gotas de lípidos se cuantificaron estadísticamente en números, distribución y morfología a nivel de una sola célula utilizando imágenes CARS. El tratamiento con oleato sódico (250 oM) indujo un aumento significativo en el número de gotas lipídicas (Figura5B), lo que condujo a un área total de gotas por célula (Figura5C) y un mayor porcentaje de área de gotas por célula ( Figura 5D), en comparación con las células de control, lo que indica que las células dHepaRG acumularon grasa de manera eficiente después del tratamiento con oleato sódico.

Figure 1
Figura 1 : Diferenciación de células HepaRG. (A) Diagrama representativo que muestra el protocolo de diferenciación/tratamiento de células HepaRG, tal como se describe en los pasos 3 y 4. (B-D) Imágenes que muestran células HepaRG proliferantes no manchadas en el día 0 después de la sembración (B), en la confluencia Día 7 después de la sembración (C), y HepaRG diferenciado (dHepaRG) en el día 21 después de la sembración (D). (E) El ARN total se extrajo de las células proliferantes y dHepaRG, el ADNc fue sintetizado y analizado por qPCR utilizando imprimaciones específicas para los genes indicados (Tabla de Materiales). Las muestras se normalizaron a la media de los genes de limpieza GAPDH, actinB y ribosomal 18S. Los histogramas muestran la inducción de pliegues de la proliferación (Día 0) frente a las celdas diferenciadas (Día 21) (las barras indican S.D.; los valores p fueron calculados por las pruebas t del estudiante). Haga clic aquí para ver una versión más grande de esta figura.

Figure 2
Figura 2 : Tratamiento del oleato de sodio de las células dHepaRG inducida acumulación de gotas de lípidos. (A) Imágenes de células HepaRG diferenciadas no manchadas (dHepaRG) tratadas durante 5 días con vehículo (control) (imagen izquierda) o con oleato sódico de 250 m (imagen derecha). (B) Después del tratamiento, las células se teñiron con tinte de aceite rojo O; las gotas de lípidos son visibles en rojo. (C) El tinte rojo o de aceite se eluyó y la DO se midió a 570 nm. Los resultados se expresan como medios de tres experimentos independientes (las barras indican S.D.; valor p por la prueba t del estudiante). (D) Evaluación de la viabilidad celular del vehículo de células dHepaRG (99% metanol) tratado (Ctrl) o tratado durante 5 días con oleato sódico y palmitato de sodio (100 m, 250 m o 500 m), o tratado 18 horas con doxorubucina (2 m).  La evaluación de la citotoxicidad se realizó utilizando un kit de ensayo MTT (Tablade materiales),registrando la absorbancia a 490 nm, según las instrucciones del fabricante. Los resultados se expresan como medio de tres experimentos independientes (las barras indican S.D.; los valores p se determinaron utilizando la prueba t del estudiante: *0,01 a p < 0,05; **0,001 a p < 0,01; ***p < 0,001). Haga clic aquí para ver una versión más grande de esta figura.

Figure 3
Figura 3 : Cuantificación de la acumulación de grasa después del tratamiento con oleato sódico mediante la tinción de Bodipy. Las células hepaRG diferenciadas (dHepaRG) se trataron con vehículo (control) o con oleato sódico de 250-M durante 5 días. Después del tratamiento, las células dHepaRG se teñieron con tinte Bodipy y se analizaron mediante citometría de flujo. (A) Perfiles de superposición representativos (% de máx.: porcentaje de intensidad máxima de tinción). (B) Los histogramas muestran la intensidad media de la fluorescencia (IMF) como un porcentaje de las células tratadas sobre el control de tres experimentos independientes (las barras indican S.D.; los valores p se determinaron utilizando la prueba t del estudiante: *0.01 a p < 0.05; **0.001 á p < 0.01; ***p < 0.001). (C) Las células se fijaron con 4% de paraformaldehyde. Las imágenes muestran gotas de lípidos manchadas de Bodipy en verde. Haga clic aquí para ver una versión más grande de esta figura.

Figure 4
Figura 4 : El tratamiento del oleato de sodio de las células dHepaRG induce la desregulación del metabolismo lipídico y la expresión génica inflamatoria. Las células hepaRG diferenciadas (dHepaRG) se trataron con vehículo (control) o con oleato sódico de 250-M durante 5 días. Los cDNA fueron analizados por qPCR con imprimaciones específicas para los genes indicados y los resultados se normalizaron a la media de los genes de limpieza GAPDH, actinB y ribosomal 18S; las imprimaciones se indican en la Tabla de Materiales. El histograma muestra los niveles de expresión de los genes indicados como inducciones de pliegue de las células tratadas sobre el control (las barras indican S.D.; los valores p fueron calculados por la prueba t del estudiante). Haga clic aquí para ver una versión más grande de esta figura.

Figure 5
Figura 5 : Caracterización de la acumulación de gotas lipídicas después del tratamiento con oleato sódico por microscopía CARS. Las células hepaRG diferenciadas (dHepaRG) fueron tratadas con vehículo (control) o con oleato sódico de 250 m durante 5 días y fueron analizadas por microscopía CARS. (A) Imágenes representativas que muestran gotas de lípidos CARS contraste en rojo. (B) Histograma que muestra el número de gotas de lípidos por celda. (C) Histogramas que muestran el área total de la imagen cubierta por gotas por celda. (D) Histograma que muestra % área de gotas cubierta por gotas por celda. Todos los resultados se expresan como medio de tres experimentos independientes (las barras indican S.E.; los valores p fueron determinados por la prueba t del estudiante: *0.01 a p < 0.05; **0.001 á p < 0.01; ***p < 0.001). Haga clic aquí para ver una versión más grande de esta figura.

Reactivos Volumen (L) para una sola reacción
2x SYBR Tinte fluorescente verde 10
PCR grado H2O 6
Imprimación delantera (M) 1
Imprimación inversa (M) 1

Tabla 1: mezcla maestra qPCR.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Este protocolo describe cómo diferenciar las células HepaRG y cómo inducir esteatosis vesicular mediante el tratamiento con oleato sódico (Figura1A). De hecho, en comparación con otras líneas celulares de carcinoma hepatocelular humano (HCC), la línea celular HepaRG presenta características de hepatocitos humanos adultos, lo que representa una valiosa alternativa a los hepatocitos humanos primarios cultivados ex vivo13,14 ,15. La línea celular HepaRG ha sido ampliamente utilizada para estudios de citotoxicidad hepática, metabolismo de fármacos, y estudios de virología15,16,22.

En comparación con las células HepaRG, otras líneas celulares HCC como HepG2, HUH7, HUH6 y Hep3B muestran capacidades metabólicas más bajas, careciendo de un conjunto sustancial de funciones específicas del hígado23,24, y presentando un nivel basal más alto de acumulación de grasa citosólica almacenada en gotas de lípidos. Por lo tanto, estas líneas celulares HCC son menos útiles como modelos para la inducción de esteatosis vesicular después de la sobrecarga de lípidos que la línea celular HepaRG.

Pasos críticos dentro del protocolo
Cuando se sembran a baja densidad (2,5 x 104 células/cm2),las células HepaRG adquieren una morfología alargada e indiferenciada, dividiendo activamente; después de haber alcanzado una confluencia del 100%, son capaces de diferenciarse al exponerse al 2% de DMSO y forman colonias típicas similares a hepatocitos rodeadas de células epiteliales biliares (Figura1D). Este cultivo mixto de células biliares/hepatocitos recapitula las características del tejido hepático, que se asemeja a una condición fisiológica, a pesar de la falta de otros tipos de células hepáticas (sinusoidales o Kupffer).

Un paso crítico en el proceso de diferenciación es la confluencia de las células. Las células deben ser sembradas a baja densidad (2,5 x 104 células/cm2) (Figura1B)y se les debe permitir crecer activamente en el medio de proliferación durante al menos 1 semana (Día 0-7). En el día 7, antes de agregar 2% DMSO para iniciar el proceso de diferenciación, las celdas deben estar al 100% de confluencia (Figura1C). Si en el Día 7 (paso 2.2) no se ha alcanzado la confluencia completa, se recomienda encarecidamente que las células sigan creciendo en el medio de proliferación durante algunos días adicionales, hasta que se logre una confluencia del 100%.

Limitaciones del protocolo
Se ha observado que después de agregar el medio de diferenciación, algunas células sufren, y típicamente 10% de las células mueren durante los 2-3 días posteriores. En esta etapa, el lavado diario y el cambio medio (paso 2.4) deben continuar descartando las células muertas flotantes. El uso de un FBS específico (Tablade Materiales)para complementar los medios de diferenciación y proliferación, debe aumentar la eficiencia de diferenciación y reducir la muerte celular durante los días 7-21 (paso 2.4). Se recomienda mantener las células hasta el paso 20, y elegir pasajes más bajos (<20) para las células diferenciadoras: se produce menos muerte de células para las células HepaRG más jóvenes. Además, la diferenciación hepargal parece ser más eficaz en platos de 35 mm y 60 mm, mientras que las células tienden a sufrir más cuando se sembran en los platos de 100 mm y 150 mm.

Modificaciones y solución de problemas
Se ha demostrado que la exposición a diferentes proporciones de ácidos grasos palpéticos y oleicos da como resultado la formación de gotas de lípidos intracitoplasmáticas25,26. Sin embargo, observamos que el tratamiento del oleato sódico de células HepaRG diferenciadas presentaba mejores resultados que la exposición al ácido palgáitico, en términos de inducción eficiente de la acumulación de lípidos y la viabilidad celular (Figura2D). De hecho, el tratamiento con ácido palnitico demostró ser tóxico para las células hepésicas diferenciadas (Figura2D),de acuerdo con los datos bibliográficos sobre las líneas celulares de hepatoma y sobre cultivos primarios de hepatocitos humanos y de ratas que describen el ácido palpito como agente citotóxico considerablemente25,26,27,28,29. Además, la utilización del palmitato en ensayos a base de células es difícil debido a su baja solubilidad. Sin embargo, debido a la variabilidad intrínseca de las líneas celulares, se recomienda verificar la concentración de trabajo de oleato de sodio y la duración del tiempo de tratamiento, probando diferentes concentraciones en un experimento de curso de tiempo con un ensayo de viabilidad celular.

Importancia y comparación de las técnicas de detección de lípidos
La determinación precisa de las cantidades de lípidos en las células se estableció a través de una serie de enfoques diferentes en este estudio. Se observó un acuerdo cualitativo y también aproximadamente cuantitativo entre los resultados obtenidos a través de la tinción de aceite rojo O, la tinción de Bodipy y la toma de imágenes CARS. Para una estimación rápida de las cantidades de lípidos en las poblaciones celulares, el uso de citometría de flujo de bodipy o una mancha como el aceite rojo O es ideal. Para un examen más detallado del contenido de gotas lipídicas de las células, se prefiere una modalidad de imagen. Además, se han notificado problemas de especificidad para las manchas lipídicas como el aceite rojo O20,30, y hemos observado que en algunos casos, la mancha Bodipy tiene una capacidad menor que CARS para etiquetar exclusivamente las gotas de lípidos entre otras células orgánulos (datos no mostrados). Por lo tanto, el uso de una técnica de imagen microscópica sin etiquetas como CARS proporciona ventajas significativas para la cuantificación y caracterización de la esteatosis. La evitación del uso de una etiqueta fluorescente grande hace que las imágenes CARS sean favorables debido al pequeño tamaño de las moléculas de lípidos en comparación con los fluoróforos típicos; por lo tanto, para la detección de lípidos, los métodos libres de etiquetas son deseables, incluso más que para la observación de moléculas de proteína sin grandes. La señal CARS de lípidos es una emisión óptica que se genera sólo cuando se produce una interacción no lineal en la muestra. Esta interacción sólo se puede detectar cuando la diferencia entre las frecuencias de los dos láseres de excitación centrados en la muestra coincide con la frecuencia vibratoria de estiramiento de metileno (CH2). La abundancia de grupos de metileno en lípidos da como resultado unas señales muy intensas con altas relaciones señal-ruido, y la no linealidad de la interacción óptica también significa que la alta resolución espacial es posible en la microscopía CARS. La excelente calidad de las imágenes CARS en general permite la recopilación de estadísticas sobre los tamaños y números de gotas lipídicas, como se demuestra en este estudio. Además, otros estudios han demostrado el uso de la microscopía CARS para correlacionar diferentes localizaciones subcelulares y tamaños de gotas de lípidos con diferentes tratamientos18,y mediante el uso de mediciones suplementarias de CARS en diferentes longitudes de onda, o un enfoque Raman de banda ancha o similar estimulado, los investigadores han demostrado que es posible caracterizar diferentes tipos de ácidos grasos dentro de las gotas de lípidos31,32. Además, la rapidez de la colección de imágenes CARS ha permitido que las imágenes in situ de las células vivas examinen la evolución temporal del crecimiento y la agregación de gotas lipídicas33.

Aplicaciones futuras
En las últimas décadas, han evolucionado puntos de vista sobre los roles y funciones de las gotas lipídicas en la biología celular. Anteriormente se pensaba que eran básicamente vesículas de almacenamiento inerte, ahora se entiende que son orgánulos celulares altamente dinámicos, y su papel en la enfermedad está siendo cada vez más reconocido34,35,36. Aunque en el caso de la enfermedad hepática, la acumulación de lípidos (esteatosis) se ha sabido durante mucho tiempo como un aspecto crítico, el mecanismo preciso de la participación de gotas de lípidos en la progresión de la enfermedad no está completamente claro. Por lo tanto, métodos como CARS que pueden caracterizar el comportamiento dinámico de las gotas lipídicas son de importancia crítica para el desarrollo de una comprensión molecular de enfermedades incluyendo NAFLD. El análisis metabólico de la expresión génica por qPCR es altamente complementario a la toma de imágenes moleculares de lípidos a través de CARS, como se demostró en estudios anteriores17,18, permitiendo una visión más profunda de los mecanismos de la enfermedad. En el presente estudio, observamos la acumulación de ácidos grasos con la desregulación del metabolismo lipídico y la expresión génica inflamatoria, que puede contribuir a la construcción de un panel de biomarcadores para el diagnóstico temprano de la enfermedad.

El modelo basado en células dHepaRG tratado con oleato sódico puede aumentar el conocimiento de los mecanismos moleculares implicados no sólo en el inicio, sino también en la progresión de la NAFLD, proporcionando una base para el desarrollo de mejores enfoques terapéuticos para la enfermedad.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Los autores declaran que no tienen intereses financieros en competencia.

Acknowledgments

Agradecemos al profesor Christian Trepo (INSERM U871, Lyon, Francia), quien amablemente proporcionó células HepaRG. Estamos agradecidos a Rita Appodia por su ayuda administrativa. Este trabajo fue apoyado por MIUR- Ministero dell'istruzione, dell'universitá e della ricerca (FIRB 2011-2016 RBAP10XKNC) y la Universidad Sapienza de Roma (prot. C26A13T8PS; Prot. C26A142MCH; Prot. C26A15LSXL).

Materials

Name Company Catalog Number Comments
Hyclone HyClone Fetal Clone II  GE Healthcare SH30066
William’s E medium with GlutaMAX  Thermofisher 32551087
Penicillin/streptomycin  SIGMA P4333
Insulin  SIGMA I9278
Hydrocortisone hemisuccinate SIGMA H2270
DMSO, dimethyl sulfoxide SIGMA D2438   
Sodium Oleate SIGMA O7501 
Methanol SIGMA 179337
Isopropanol SIGMA 278475
BODIPY 505/515 Thermofisher D3921
PBS Thermofisher 14190-250
Formaldehyde solution SIGMA 252549
RNAse free DNAseI Promega M198A 
Glass-bottomed dishes Willco Wells GWST-5040
Oil Red solution SIGMA O625
CellTiter 96 AQueous One Solution Promega  G3582
q-PCR oligo name Sequence
ACACB FOR CAAGCCGATCACCAAGAGTAAA
ACACB REV CCCTGAGTTATCAGAGGCTGG
β-actin FOR GCACTCTTCCAGCCTTCCT
β-actin REV AGGTCTTTGCGGATGTCCAC
ALBUMIN FOR TGCTTGAATGTGCTGATGACAGG
ALBUMIN REV AAGGCAAGTCAGCAGGCATCTCATC
ALDOB FOR GCATCTGTCAGCAGAATGGA 
ALDOB REV TAGACAGCAGCCAGGACCTT
APOB FOR CCTCCGTTTTGGTGGTAGAG
APOB REV  CCTAAAAGCTGGGAAGCTGA
APOC3 FOR CTCAGCTTCATGCAGGGTTA
APOC3 REV GGTGCTCCAGTAGTCTTTCAG
CPT1A FOR TCATCAAGAAATGTCGCACG
CPT1A REV GCCTCGTATGTGAGGCAAAA
CYP2E1 FOR TTGAAGCCTCTCGTTGACCC
CYP2E1 REV CGTGGTGGGATACAGCCAA
CYP3A4 FOR CTTCATCCAATGGACTGCATAAAT
CYP3A4 REV TCCCAAGTATAACACTCTACACAGACAA
GAPDH FOR TGACAACTTTGGTATCGTGGAAGG
GAPDH REV AGGGATGATGTTCTGGAGAGCC
GPAM FOR TCTTTGGGTTTGCGGAATGTT
GPAM REV ATGCACATCTCGCTCTTGAATAA
IL6 FOR CCTGAACCTTCCAAAGATGGC
IL6 REV ACCTCAAACTCCAAAAGACCAGTG
PDK4 FOR ACAGACAGGAAACCCAAGCCAC
PDK4 REV TGGAGGTGAGAAGGAACATACACG
PLIN2 FOR TTGCAGTTGCCAATACCTATGC
PLIN2 REV CCAGTCACAGTAGTCGTCACA
PLIN4 FOR AATGAGTTGGAGGGGCTGGGGGACATC
PLIN4 REV GGTCACCTAAACGAACGAAGTAGC
SCD FOR TCTAGCTCCTATACCACCACCA
SCD REV TCGTCTCCAACTTATCTCCTCC
SLC2A1 FOR TGCTCATCAACCGCAACGAG
SLC2A1 REV CCGACTCTCTTCCTTCATCTCCTG
18S FOR CGCCGCTAGAGGTGAAATTC
18S REV TTGGCAAATGCTTTCGCTC

DOWNLOAD MATERIALS LIST

References

  1. Starley, B. Q., Calcagno, C. J., Harrison, S. A. Nonalcoholic fatty liver disease and hepatocellular carcinoma: a weighty connection. Hepatology. 51, (5), 1820-1832 (2010).
  2. Byrne, C. D., Targher, G. NAFLD: a multisystem disease. Journal of Hepatology. 62, (1), Suppl 47-64 (2015).
  3. Marra, F., Gastaldelli, A., Svegliati Baroni, G., Tell, G., Tiribelli, C. Molecular basis and mechanisms of progression of non- alcoholic steatohepatitis. Trends in Molecular Medicine. 14, 72-81 (2008).
  4. Chalasani, N., et al. The diagnosis and management of nonalcoholic fatty liver disease: Practice guidance from the American Association for the Study of Liver Diseases. Hepatology. 67, (1), 328-357 (2018).
  5. Banini, B. A., Sanyal, A. J. Current and future pharmacologic treatment of nonalcoholic steatohepatitis. Current Opinion in Gastroenterology. 33, (3), 134-141 (2017).
  6. Takahashi, Y., Sugimoto, K., Inui, H., Fukusato, T. Current pharmacological therapies for nonalcoholic fatty liver disease/nonalcoholic steatohepatitis. World Journal of Gastroenterology. 21, (13), 3777-3785 (2015).
  7. Younossi, Z., et al. Global burden of NAFLD and NASH: trends, predictions, risk factors and prevention. Nature Reviews Gastroenterology & Hepatology. 15, (1), 11-20 (2018).
  8. Santhekadur, P. K., Kumar, D. P., Sanyal, A. J. Preclinical models of non-alcoholic fatty liver disease. Journal of Hepatology. 68, (2), 230-237 (2018).
  9. Nagarajan, P., Mahesh Kumar, M. J., Venkatesan, R., Majundar, S. S., Juyal, R. C. Genetically modified mouse models for the study of nonalcoholic fatty liver disease. World Journal of. Gastroenterology. 18, (11), 1141-1153 (2012).
  10. Oseini, A. M., Cole, B. K., Issa, D., Feaver, R. E., Sanyal, A. J. Translating scientific discovery: the need for preclinical models of nonalcoholic steatohepatitis. Hepatology International. 12, (1), 6-16 (2018).
  11. Ramboer, E., Vanhaecke, T., Rogiers, V., Vinken, M. Immortalized human hepatic cell lines for in vitro testing and research purposes. Methods in Molecular Biology. 1250, 53-76 (2015).
  12. Gómez-Lechón, M. J., Donato, M. T., Castell, J. V., Jover, R. Human hepatocytes in primary culture: the choice to investigate drug metabolism in man. Current Drug Metabolism. 5, (5), 443-462 (2004).
  13. Marion, M. J., Hantz, O., Durantel, D. The HepaRG cell line: biological properties and relevance as a tool for cell biology, drug metabolism, and virology studies. Methods in Molecular Biology. 640, 261-272 (2010).
  14. Gripon, P., et al. Infection of a human hepatoma cell line by hepatitis B virus. Proceedings of the National Academy of Sciences. 99, (24), 15655-15660 (2002).
  15. Anthérieu, S., Rogue, A., Fromenty, B., Guillouzo, A., Robin, M. A. Induction of vesicular steatosis by amiodarone and tetracycline is associated with up-regulation of lipogenic genes in HepaRG cells. Hepatology. 53, (6), 1895-1905 (2011).
  16. Rouge, A., et al. PPAR agonists reduce steatosis in oleic acid-overloaded HepaRG cells. Toxicology and Applied Pharmacology. 276, (1), 73-81 (2014).
  17. Belloni, L., et al. Targeting a phospho-STAT3-miRNAs pathway improves vesicular hepatic steatosis in an in vitro and in vivo model. Scientific Reports. 8, 13638 (2018).
  18. Nunn, A. D. G., et al. The histone deacetylase inhibiting drug Entinostat induces lipid accumulation in differentiated HepaRG cells. Scientific Reports. 6, 28025 (2016).
  19. Donato, M. T., et al. Cytometric analysis for drug-induced steatosis in HepG2 cells. Chemico-Biological Interactions. 181, (3), 417-423 (2009).
  20. Hellerer, T., Axäng, C., Brackmann, C., Hillertz, P., Pilon, M., Enejder, A. Monitoring of lipid storage in Caenorhabditis elegans using coherent anti-Stokes Raman scattering (CARS) microscopy. Proceedings of the National Academy of Sciences. 104, (37), 14658-14663 (2007).
  21. Le, T. T., Ziemba, A., Urasaki, Y., Brotman, S., Pizzorno, G. Label-free evaluation of hepatic microvesicular steatosis with multimodal coherent anti-Stokes Raman scattering microscopy. PLoS One. 7, (11), 51092 (2012).
  22. Guillouzo, A., Corlu, A., Aninat, C., Glaise, D., Morel, F., Guguen-Guillouzo, C. The human hepatoma HepaRG cells: a highly differentiated model for studies of liver metabolism and toxicity of xenobiotics. Chemico-Biological Interactions. 168, (1), 66-73 (2007).
  23. Nelson, L. J., et al. Human hepatic HepaRG cells maintain an organotypic phenotype with high intrinsic CYP450 Activity/metabolism and significantly outperform standard HepG2/C3A cells for pharmaceutical and therapeutic applications. Basic & Clinical Pharmacology & Toxicology. 120, (1), 30-37 (2017).
  24. Gerets, H. H. J., Tilmant, K., Gerin, B., Chanteux, H., Depelchin, B. O., Dhalluin, S., Atienzar, F. A. Characterization of primary human hepatocytes, HepG2 cells, and HepaRG cells at the mRNA level and CYP activity in response to inducers and their predictivity for the detection of human hepatotoxins. Cell Biology and Toxicology. 28, (2), 69-87 (2012).
  25. Pusl, T., et al. Free fatty acids sensitize hepatocytes to bile acid-induced apoptosis. Biochemical and Biophysical Research Communications. 371, (3), 441-445 (2008).
  26. Gentile, C. L., Pagliassotti, M. J. The role of fatty acids in the development and progression of nonalcoholic fatty liver disease. The Journal of Nutritional Biochemistry. 19, (9), 567-576 (2008).
  27. Mei, S., et al. Differential roles of unsaturated and saturated fatty acids on autophagy and apoptosis in hepatocytes. Journal of Pharmacological Experimental Therapy. 339, 487-498 (2011).
  28. Malhi, H., Bronk, S. F., Werneburg, N. W., Gores, G. J. Free fatty acids induce JNK-dependent hepatocyte lipoapoptosis. Journal of Biological Chemistry. 281, 12093-12101 (2006).
  29. Moravcová, A., Červinková, Z., Kučera, O., Mezera, V., Rychtrmoc, D., Lotková, H. The effect of oleic and palmitic acid on induction of steatosis and cytotoxicity on rat hepatocytes in primary culture. Physiological Research. 64, Suppl 5 627-636 (2015).
  30. Ohsaki, Y., Shinohara, Y., Suzuki, M., Fujimoto, T. A pitfall in using BODIPY dyes to label lipid droplets for fluorescence microscopy. Histochemistry and Cell Biology. 133, (4), 477-480 (2010).
  31. Rinia, H. A., Burger, K. N., Bonn, M., Müller, M. Quantitative label-free imaging of lipid composition and packing of individual cellular lipid droplets using multiplex CARS microscopy. Biophysical Journal. 95, (10), 4908-4914 (2008).
  32. Waschatko, G., Billecke, N., Schwendy, S., Jaurich, H., Bonn, M., Vilgis, T. A., Parekh, S. H. Label-free in situ imaging of oil body dynamics and chemistry in germination. Journal of The Royal Society Interface. 13, (123), (2016).
  33. Jüngst, C., Winterhalder, M. J., Zumbusch, A. Fast and long term lipid droplet tracking with CARS microscopy. Journal of Biophotonics. 4, (6), 435-441 (2011).
  34. Welte, M. A., Gould, A. P. Lipid droplet functions beyond energy storage. Biochimica et Biophysica Acta - Molecular and Cell Biology of Lipids. 1862, (10), Pt B 1260-1272 (2017).
  35. Cohen, S. Lipid droplets as organelles. International Review of Cell and Molecular Biology. 337, 83-110 (2018).
  36. Farese, R. V., Walther, T. C. Lipid droplets finally get a little R-E-S-P-E-C-T. Cell. 139, (5), 855-860 (2009).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics