Induire et caractériser la stéatose vésiculaire dans des cellules HepaRG différenciées

Medicine

Your institution must subscribe to JoVE's Medicine section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Dans cette étude, nous décrivons un protocole détaillé pour induire la stéatose vésiculaire de foie dans les cellules différenciées d'HépaRG avec l'oleat sodium de sel d'acide gras et employons des méthodes pour la détection et la quantification de l'accumulation de lipide, y compris les anti-Stokes cohérents Microscopie de diffusion raman (CARS), analyse cytofluorimétrique, coloration rouge huile O et qPCR.

Cite this Article

Copy Citation | Download Citations

Di Cocco, S., Belloni, L., Nunn, A. D., Salerno, D., Piconese, S., Levrero, M., Pediconi, N. Inducing and Characterizing Vesicular Steatosis in Differentiated HepaRG Cells. J. Vis. Exp. (149), e59843, doi:10.3791/59843 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

La stéatose hépatique représente un dysfonctionnement métabolique qui résulte d'une accumulation de gouttelettes lipidiques contenant des triglycérides dans les hépatocytes. L'accumulation excessive de graisse mène à la maladie de foie gras non-alcoolique (NAFLD), qui est potentiellement réversible et peut évoluer en stéatohépatite non-alcoolique (NASH) et par la suite cirrhose et carcinome hépatocellulaire (HCC). Les mécanismes moléculaires liant l'accumulation de lipide dans les hépatocytes avec la progression à NASH, les dommages irréversibles de foie, la fibrose, la cirrhose, et même HCC restent toujours peu clairs. À cette fin, plusieurs modèles in vitro et in vivo ont été développés pour élucider les processus pathologiques qui causent nAFLD. Dans la présente étude, nous décrivons un modèle cellulaire pour l'induction de la stéatose vésiculaire du foie qui se compose de cellules hepaRG hepatic humaines différenciées DMSO traitées avec l'oleat de sodium de sel d'acide gras. En effet, les cellules HepaRG traitées à l'oleat de sodium accumulent des gouttelettes lipidiques dans le cytoplasme et présentent des caractéristiques typiques de la stéatose. Ce modèle humain in vitro représente une alternative précieuse aux modèles de souris in vivo ainsi qu'aux hépatocytes humains primaires. Nous présentons également une comparaison de plusieurs méthodes pour la quantification et l'évaluation de l'accumulation de graisse dans les cellules de HepaRG, y compris la coloration rouge d'huile o, la mesure cytofluorimétrique de Bodipy, l'analyse métabolique d'expression de gène par qPCR, et l'anti-Stokes cohérent Microscopie de diffusion raman (CARS). L'imagerie CARS combine la spécificité chimique de la spectroscopie Raman, une technique d'analyse chimique bien connue dans les applications de la science des matériaux, avec les avantages de microscopies optiques non linéaires à haute vitesse et à haute résolution pour permettre quantification de l'accumulation de lipides et de la dynamique des gouttelettes lipidiques. La mise en place d'un modèle in vitro efficace pour l'induction de la stéatose vésiculaire, ainsi qu'une méthode précise pour la quantification et la caractérisation de l'accumulation de lipides, pourrait conduire au développement d'un diagnostic précoce de NAFLD via le l'identification des marqueurs moléculaires et à la génération de nouvelles stratégies de traitement.

Introduction

La stéatose hépatique est définie comme une accumulation de graisse intrahépatique, dans des gouttelettes lipidiques contenant des triglycérides, d'au moins 5 % du poids du foie. Le stockage hépatique prolongé de lipide est un processus potentiellement réversible, cependant, il peut mener au dysfonctionnement métabolique de foie, à l'inflammation et aux formes avancées de la maladie hépatique non alcoolique (NAFLD), la cause prédominante de la maladie chronique de foie dans beaucoup de parties de le monde1,2. NAFLD est une maladie multifactorielle qui peut évoluer vers la stéatohépatite non alcoolique plus agressive (NASH), qui à son tour peut progresser vers la cirrhose et, dans un petit pourcentage de patients, au carcinome hépatocellulaire (HCC)1,3. Aucun traitement approuvé n'est actuellement disponible comme traitement spécifique pour NAFLD et la combinaison des modifications de régime et de mode de vie reste le pilier de la gestion de NAFLD et de NASH4,5,6.

Les mécanismes moléculaires menant au développement de la stéatose hépatique dans la pathogénie de NAFLD restent à élucider7. Dans ce contexte, des modèles murins ont été développés pour étudier la progression de la maladie de stéatose humaine. Une myriade de modèles différents existe, et chacun a ses avantages et ses inconvénients, y compris les modèles génétiques, nutritionnels et induits chimiquement combinant des approches différentes. Les souris génétiquement modifiées (transgéniques ou knock-out) développent spontanément une maladie du foie. Cependant, il convient de noter que ces mutations sont très rares chez l'homme et la suppression ou la surexpression d'un seul gène (par exemple, ob / ob souris) ne peut pas imiter l'étiologie de la maladie humaine multifactorielle au niveau moléculaire8,9. De même, la maladie acquise par les souris après manipulation diététique ou pharmacologique ne peutpas imiter les effets des régimes humains liés au développement de NAFLD dans l'homme 8. Les modèles animaux ont toutefois facilité l'évolution de la compréhension de la NAFLD et cette approche est actuellement la stratégie la plus utilisée dans la recherche en laboratoire. Néanmoins, la réplication chez l'homme des résultats obtenus dans les modèles animaux a échoué à plusieurs reprises, provoquant une mauvaise traduction dans la clinique10.

Par conséquent, les modèles in vitro de NAFLD peuvent jouer un rôle fondamental en élucidant les mécanismes moléculaires de la progression de NAFLD, et ils représentent un outil valable pour examiner un grand nombre de composés. Les cultures cellulaires primaires, les lignées cellulaires immortalisées et les biopsies hépatiques ont été largement utilisées à des fins de recherche11. Les hépatocytes humains primaires ressemblent étroitement aux conditions cliniques humaines, mais il y a un nombre limité de donneurs, et les cultures primaires de cellules montrent la reproductibilité pauvre due à la variabilité des cellules. Ces observations, ainsi que des questions éthiques et logistiques, ont entraîné l'utilisation d'hépatocytes primaires humains étant limité12. Ainsi, les lignées cellulaires hépatiques représentent une alternative pratique, ayant plusieurs avantages essentiels sur la culture primaire, que les lignées cellulaires hépatiques se développent régulièrement, ont une durée de vie presque illimitée, et ont un phénotype stable. En outre, les lignées cellulaires sont facilement accessibles et les conditions de culture des lignées cellulaires hépatiques sont plus simples que celles des hépatocytes primaires et sont normalisées entre les différents laboratoires.

Ici, nous décrivons en détail un modèle cellulaire in vitro de stéatose vésiculaire de foie, représenté par les cellules hepaRG différenciées hépatiques traitées avec l'oleat de sodium d'acide gras. La ligne cellulaire de HepaRG a été établie à partir d'un patient féminin affecté par l'infection d'hépatite C et d'une tumeur bien différenciée de foie de catégorie I d'Edmondson14. La lignée cellulaire HepaRG est une lignée cellulaire bipotente humaine capable de se différencier lors de l'exposition au sulfoxure de diméthyle (DMSO) de 2 % vers deux phénotypes cellulaires différents : les cellules biliaires et hépatocytes. Les cellules HepaRG différenciées (dHepaRG) partagent certaines caractéristiques et propriétés avec les hépatocytes adultes et possèdent la capacité d'exprimer de façon stable des gènes spécifiques au foie tels que l'albumine, l'aldolaseB, le Cytochrome P450 2E1 (CYP2E1) et cytochrome P450 3A4 (CYP3A4)13 (étape 3). Le traitement des cellules dHepaRG avec l'oleat de sodium de sel de sel d'acide gras (250 M) pendant 5 jours mènent à la génération des gouttelettes cytoplasmiques de lipide, imitant les effets du foie gras14,15,17,18 ( étape 4). L'accumulation de gouttelettes lipidiques peut être facilement détectée par la coloration Oil Red O (étape 5), un colorant liposoluble lysochrome qui tache les triglycérides neutres et les lipides rouge-orange. Pour quantifier efficacement les lipides dans le dHepaRG gras, nous illustrons ici l'analyse cytofluorimétrique après coloration avec 4,4-difluoro-1,3,5,5,7-tétramethyl-4-bora-3a,4a-diaza-s-indacene (Bodipy 505/515) (étape 6), une sonde fluorescente lipophile qui localise aux corps lipidiques intracellulaires et a été utilisé pour étiqueter les gouttelettes lipidiques19. En outre, ici nous montrons comment évaluer la stéatose par réaction quantitative en chaîne de polymérase (qPCR) (étape 7) déréglementation d'expression de gène de plusieurs gènes métaboliques dans les cellules dHepaRG. Pour caractériser et quantifier davantage l'accumulation de gouttelettes lipidiques après le traitement à l'avoine de sodium, nous avons effectué une microscopie cohérente de diffusion anti-Stokes Raman (CARS) (étape 8), une technique innovante qui permet la visualisation et la quantification de gouttelettes lipidiques sans étiquetage20,21.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Préparation des médias culturels et des réactifs

  1. Moyen proliférant : supplément du milieu E de William avec glutaMAX, 10% sérum bovin foetal (FBS), 1% pénicilline/streptomycine, insuline de 5 g/mL et 0.5 'M d'hemisuccinate d'hydrocortisone.
  2. Moyen de différenciation : supplément du milieu E de William avec GlutaMAX, 10% FBS, 1% pénicilline/streptomycine, insuline de 5 g/mL, 50 'M d'hémicine hydrocortisone et 2% d'hemisuccinate d'hydrocortisone et 2% de DMSO.
  3. Milieu de congélation : supplément du milieu proliférant avec 10% de DMSO.
  4. Oleate de sodium : dissoudre dans 99 % de méthanol à une concentration de 100 mm, remuer O/N et conserver à -20 oC.
  5. Oil Red O: préparer une solution de stock. Peser 0,35 g d'huile rouge O et dissoudre en 100 ml d'isopropanol. Remuer O/N, filtrer (0,2 m) et stocker chez RT. Préparer une solution de travail : mélanger 6 mL de solution Oil Red O Stock avec 4 ml de ddH2O. Laisser s'asseoir à température ambiante (RT) pendant 20 min, puis filtrer à l''intérieur d'un filtre de 0,2 m. Une filtration appropriée est fortement recommandée pour la coloration réussie pour éviter l'arrière-plan.
  6. Bodipy (505/515) : dissoudre le colorant Bodipy (505/515) dans le DMSO à une concentration de 100 M. de stock, stocker à -20 oC dans l'obscurité et l'utiliser à une concentration finale de 100 nM.
  7. Acquérir des plats transparents à fond de verre pour les expériences CARS.

2. Décongélation, amplification et cryoconservation des cellules HepaRG

  1. Décongeler les cellules HepaRG cryoconservées en immergeant un lot dans un bain de 37 oC jusqu'à ce qu'elles soient décongelées. Sélectionnez un lot de passage faible (lt;20). Les cellules HepaRG sont disponibles dans le commerce.
  2. Transférer rapidement les cellules dans un tube de 15 ml contenant 10 ml de milieu proliférant et de centrifugeuse pendant 5 min (200 x g, 4 oC).
  3. Jeter le supernatant et resuspendre les cellules avec 5 ml de milieu proliférant.
  4. Compter les cellules et diluer afin de plaquer 2,5 x 104 cellules/cm2.
  5. Renouveler le milieu tous les 2 ou 3 jours. Les cellules prolifèrent avec un temps de doublement d'environ 24 h.
  6. Détachez les cellules HepaRG lorsqu'elles sont à 80 % de confluence par incubation de 3 à 5 min avec une solution de trypsine de 0,05 %. Recueillir les cellules dans le milieu proliférant et centrifugeuse pendant 5 min (200 x g, 4 oC).
  7. Jeter le supernatant et resuspendre les cellules avec 5 ml de milieu proliférant.
  8. Compter les cellules et diluer afin de plaquer 2,5 x 104 cellules/cm2.
  9. À ce stade, amplifiez les cellules en répétant les étapes 2.5-2.8 afin d'atteindre un nombre approprié de cellules pour commencer des expériences, ou cryopreserve comme dans l'étape 2.10.
  10. Pour cryoconserver les cellules HepaRG, détacher les cellules 24 h après le placage par 3-5 min d'incubation avec la solution de trypsine 0,05%. Recueillir les cellules dans le milieu proliférant et centrifugeuse pendant 5 min (200 x g, 4 oC). Jeter le supernatant, resuspendre les cellules dans 1 ml/batch de milieu de congélation, 1,5 x 106 cellules/batch et cryoconserver les lots dans de l'azote liquide.

3. Différenciation des cellules HepaRG (Jour 0-21) (Figure 1A)

  1. Jour 0. Cellules d'hépaRG de semences à faible densité (2,5 x 104 cellules/cm2) dans des plats traités par la culture avec un volume approprié de milieu de prolifération (Figure 1B). Deux plats doivent être plats pour chaque analyse (coloration huile rouge O, analyse FACS, qPCR): un pour les cellules témoins et un pour les cellules traitées à l'oléate. Si vous effectuez des mesures CARS (étape 8), ensemencez les cellules en parallèle dans des plats transparents à fond de verre. En tant que contrôle, récoltez un plat non traité (cellules proliférantes Jour 0) pour effectuer l'analyse de l'expression génique des gènes marqueurs de différenciation (voir l'étape 3.6).
  2. Jour 2 et Jour 4. Changer le milieu avec un volume approprié de milieu de prolifération et laisser les cellules se développer jusqu'à la confluence.
  3. Jour 7. Les cellules doivent être 100% confluentes (figure 1C). Laver les cellules une fois avec 1x saline tamponnée par phosphate (PBS). Retirez 1x PBS et ajoutez un volume approprié de milieu de différenciation.
  4. Jour 8, 9, 12, 15, 18.  Laver les cellules une fois avec 1x PBS. Retirez 1x PBS et ajoutez un volume approprié de milieu de différenciation.
  5. Jour 21. Observez les cellules HepaRG au microscope et assurez-vous que les cellules sont des cultures différenciées confluentes (Figure 1D).
  6. En tant que témoin, récoltez un plat témoin (cellules différenciées Jour 21) pour effectuer l'analyse de l'expression génique (étape 7) des gènes marqueurs de différenciation (Figure 1E).
  7. Au jour 21, les cellules HepaRG différenciées peuvent être cryoconservées en azote liquide.

4. Induction de la stéatose vésiculaire (Jour 21-26)

  1. Jour 21. Diluer l'oleat de sodium (100 mM) avec un volume approprié de milieu de différenciation complète à une concentration finale de 250 M (1:400). Ajouter 99 % de méthanol 1:400 (même volume que celui de l'oleat de sodium) dans un autre aliquot de milieu de différenciation pour faire le traitement de contrôle du véhicule. (Par exemple : ajouter 25 l d'oleat de sodium à 10 ml de milieu et ajouter en parallèle 25 l de 99 % de méthanol à 10 ml de milieu). Laver les cellules une fois avec 1x PBS et ajouter le véhicule ou le milieu oleate de sodium.
  2. Jour 23 et Jour 25. Changer le milieu avec un volume approprié de milieu fraîchement préparé comme à l'étape 4.1.
  3. Jour 26. Observez au microscope optique que les gouttelettes lipidiques s'accumulent dans les cellules traitées à l'oleat de sodium et sont facilement visibles sous forme de gouttelettes translucides dans le cytoplasme comme dans la figure 2A.

5. Évaluation de la surcharge de lipide et de l'induction de stéatose : Rouge d'huile O Staining

  1. Laver les cellules une fois avec 1x PBS et enlever 1x PBS complètement.
  2. Ajouter 4 % de paraformaldéhyde (dilué en 1x PBS) et couver pendant 15 min à RT.
    MISE EN GARDE: Le paraformaldéhyde est toxique, de sorte que cette étape doit être effectuée dans une hotte de fumée, avec un équipement de protection, y compris des gants, une blouse de laboratoire, et un masque.
  3. Enlever le paraformaldéhyde et laver les cellules deux fois avec 1x PBS. Les cellules peuvent être conservées en 1x PBS à 4 oC pendant quelques jours avant la coloration. Envelopper de parafilm et recouvrir de papier d'aluminium pour empêcher les cellules de sécher.
  4. Supprimer 1x PBS. Incuber les cellules avec 60% d'isopropanol pendant 5 min à RT.
  5. Enlever l'isopropanol et laisser sécher complètement les cellules à RT.
  6. Ajouter la solution de travail Oil Red O et incuber à RT pendant 30 min. Le volume de la solution de travail requise pour chaque échantillon correspond au volume de supports utilisés pour la culture des cellules.
  7. Retirez la solution Oil Red O et ajoutez immédiatement ddH2O. Lavez les cellules 4 fois avec ddH2O.
  8. Acquérir des images au microscope pour analyse (Figure 2B).
  9. Pour éliter huile Rouge O colorant: enlever toute l'eau et laisser sécher; ajouter 1 mL d'isopropanol à 100% et incuber pendant 10 min avec des secousses douces à RT.
  10. Pipet l'isopropanol avec l'huile élunée Rouge O colorant de haut en bas à plusieurs reprises, en veillant à ce que tout le pétrole rouge O est dans la solution. Transférer la solution dans une cuvette. Mesurer OD500 nm par spectrophotométrie et utiliser 100% isopropanol comme blanc (Figure 2C).

6. Évaluation de la surcharge lipidique et de l'induction de stéatose : teinture de Bodipy et analyse cytofluorimétrique

  1. Laver les cellules une fois avec 1x PBS. Incuber avec 100 nM de Bodipy dilué en 1x PBS dans l'obscurité pendant 40 min à 37 oC. Un contrôle non taché doit être inclus dans les mesures de cytométrie du débit. À partir de ce point, protégez les échantillons de la lumière autant que possible.
    REMARQUE: Le volume de la solution de coloration requise pour chaque échantillon correspond au volume de supports utilisés pour la culture des cellules.
  2. Enlever la solution de coloration et laver les cellules une fois avec 1x PBS. Passez aux étapes 6.3-6.6. pour l'analyse DU CAE (Tri des cellules activée par fluorescence) ou à l'étape 6.7 pour l'imagerie au microscope.
  3. Gratter doucement les cellules avec 1x PBS et les transférer dans un tube de 15 ml. Centrifugeuse pendant 10 min (200 x g, 4 oC).
  4. Retirez délicatement les supernatants sans déranger les granulés et lavez-les avec 3 ml de 1x PBS. Centrifugeuse pendant 5 min (200 x g, 4 oC).
  5. Retirez les supernatants et suspendez-les en 300 OL de 1x PBS, puis transférez-les dans un tube FACS.
  6. Mesurer immédiatement l'intensité de la fluorescence de Bodipy par analyse cytofluorimétrique avec des longueurs d'onde d'excitation/émission de 505/515 nm (Figure 3A,B).
  7. Laver les cellules une fois avec 1x PBS et enlever PBS complètement.
  8. Ajouter 4 % de paraformaldéhyde (dilué en 1x PBS) et couver pendant 15 min à RT.
    MISE EN GARDE: Le paraformaldéhyde est toxique, de sorte que cette étape doit être effectuée dans une hotte de fumée, avec un équipement de protection, y compris des gants, une blouse de laboratoire, et un masque.
  9. Retirer le paraformaldéhyde et laver les échantillons 3x pendant 5 min dans PBS. Les cellules peuvent être conservées en 1x PBS à 4 oC ou images immédiatement (figure3C). Pour le stockage, envelopper de parafilm et couvrir de papier d'aluminium pour empêcher les cellules de sécher.

7. Évaluation de la surcharge lipidique et de l'induction de stéatose : qPCR

  1. Laver les cellules une fois avec 1x PBS. Gratter les cellules avec 1x PBS, centrifugeuse à 200 x g, et jeter le supernatant. À cette étape, les cellules peuvent être récoltées à -80 oC ou traitées comme à l'étape 7.2.
  2. Effectuer l'isolement total de l'ARN par des méthodes standard en utilisant des réactifs commerciaux suivant les instructions du fabricant.
  3. Évaluer la concentration d'ARN par mesure spectrophotométrique UV, en veillant à ce que la pureté de l'ARN soit élevée (près de 2,0) sur la base de la lecture A260/A280.
  4. Synthétiser l'ADNc à partir de 1 g d'ARN total avec un kit de synthèse cDNA standard.
  5. Diluer l'ADNc à un volume final de 50 L avec H2O.
  6. Analyser chaque échantillon d'ADNc en triplicate par qPCR : préparer un mix maître qPCR (tableau 1) qui est suffisant pour les réactions nécessaires pour chaque amorce, y compris les amorces spécifiques pour les trois gènes d'entretien ménager comme témoins : gliceraldeide-3-fosfato deidrogenasi (GAPDH), actinB et ribosomal 18S (voir Tableau des matériaux pour les séquences d'apprêt):
  7. Distribuer 18 l de mélange maître par puits dans une plaque multi-murs PCR.
  8. Ajouter 2 ll d'échantillon d'ADNc dans chaque puits. Scellez l'assiette.
  9. Exécutez les échantillons selon l'instruction thermale Cycler.

8. Évaluation de la surcharge lipidique et de l'induction de stéatose : CARS

  1. Fixez les cellules préalablement préparées sur des plats à fond de verre, comme décrit dans les étapes 5.1-5.3.
  2. Allumez un système laser pulsé picoseconde réglable commerciale, l'accordant pour obtenir deux sorties de longueurs d'onde différentes. La différence de fréquence entre les sorties doit être de 2 840 cm-1 pour générer le signal lumineux intense CARS correspondant à l'étirement symétrique du méthylène; pour une sortie à longueur d'onde fixe à 1 064 nm (lumière « Stokes »), l'autre longueur d'onde doit être réglée à 817 nm (lumière de la pompe).
  3. S'assurer que la sortie de 817 nm est spatialement et temporellement superposée à la sortie de 1 064 nm : utiliser un miroir dichroïque approprié (c.-à-d. avec une coupe entre 817 et 1 064 nm) pour combiner spatialement les faisceaux et utiliser une ligne de retard optique pour obtenir un chevauchement temporel du laser Impulsions.
  4. S'assurer que les deux faisceaux de copropagating sont à la fois collimated et que leurs diamètres ont des valeurs similaires qui sont appropriées pour le système optique dans le microscope qui les concentrera sur l'échantillon; si nécessaire, collimatez séparément les poutres devant le miroir dichroïque qui les combine.
  5. Allumez un système commercial de microscope inversé, qui devrait inclure une unité de balayage laser infrarouge et une unité de détection d'épi rouge/vert à double canal et aligner les faisceaux laser de copropagating dans l'unité de balayage.
  6. Ouvrir l'unité de détection d'épi à double canal, retirer le cube de filtre et remplacer son filtre de détection de longueur d'onde rouge par un filtre de bande qui peut sélectionner le signal 2 840 cm-1 CARS qui est centré à 663 nm pour la pompe 817/1 064 nm/Stokes excitation combine. Un filtre à bande passante étroite (20 nm) est préférable pour éviter la collecte de niveaux élevés de signaux fluorescents.
  7. Placez un plat sur la scène du microscope CARS inversé, et en utilisant un objectif d'immersion d'huile 100x, déplacez la position verticale de l'objectif pour se concentrer sur les cellules.
  8. Configurez le logiciel de microscope pour collecter des images à haute résolution (1024 x 1024 pixels) sur un champ de vision s'étendant sur 127 m x 127 x 127 m.
  9. Définiz le logiciel de microscope pour acquérir et afficher en permanence des images du champ de vision de 127 x 127 m et vérifiez les images affichées tout en optimisant les paramètres de la collection d'images. Assurez-vous que les pouvoirs laser sont équilibrés pour une collecte d'images rapide et des dommages minimes, en insérant des filtres de densité neutre appropriés dans les chemins de faisceau au besoin, et sélectionnez un temps d'habiter pixel qui permet la collecte d'images avec un bon signal au bruit dans les conditions de puissance laser sélectionnées.
  10. Acquérir et enregistrer des images de plusieurs champs de vision différents dans le plat dans les conditions optimisées. En option, les images de fluorescence multiphoton, générées par une émission de longueur d'onde verte (principalement à partir d'excitation à deux photons à 817 nm), peuvent être recueillies simultanément par l'autre détecteur d'épi. Répétez les étapes 8.7-8.10 pour chaque plat.
  11. Pour l'analyse d'images CARS, traiter les images à l'aide de la mise en œuvre DE L'ImageJ par LE FIJI. Exploitez la fonction Despeckle (ou un outil de dénoisation similaire) sur chaque image avant une analyse plus approfondie afin d'améliorer les rapports signal-bruit sans perte de détail.
  12. Utilisez FIJI pour sélectionner manuellement les cellules, puis comptez automatiquement les gouttelettes lipidiques dans les cellules individuelles segmentées pour produire des statistiques sur les zones et les nombres de gouttelettes lipidiques pour chaque cellule et pour l'ensemble des données d'image pour chaque plat.

9. MTT Cell Viability Assay

  1. La plaque a différencié des cellules d'HépaRG dans une plaque de 96 puits avec une densité de 1 x 105 cellules/puits dans un volume final de 100 L de milieu de culture de différenciation.
  2. 24 h après l'ensemencement, traiter les cellules avec 99% de méthanol (véhicule) et avec 100 M, 250 M et 500 M d'oleate de sodium et de palmitate de sodium dilué dans 100 'L de culture de différenciation moyenne /bien en tripler.
  3. Changer le milieu avec 99 % de méthanol et avec 100 M, 250 M et 500 M d'oleat de sodium et de palmitate de sodium dilués dans 100 L de culture de différenciation moyenne/bien toutes les 24 h.
  4. 96 h après le traitement au méthanol/oleatde de sodium/palmitate de sodium, traiter les cellules avec 2 M doxorubicine diluée dans 100 L de culture de différenciation moyenne/bien en triplicate comme un contrôle.
  5. 18 h après traitement à la doxorubucne, changer le milieu avec 100 l de milieu de culture de différenciation.
  6. Pipet 20 l de 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium réagent MTT (Table of Materials) dans chaque puits de la plaque d'analyse 96-bien contenant les cellules en 100 'L de culture moyenne de culture différente . Inclure un contrôle de fond en pipetting 20 'L de réactif dans un puits de contrôle sans cellules dans 100 'L de milieu de culture de différenciation dans le triple.
  7. Incuber la plaque à 37 oC dans une atmosphère humidifiée de 5 % de CO 2.
  8. Après avoir incubé pendant 30, 60 et 90 min avec le réactif Tetrazolium MTT, enregistrez l'absorption à 490 nm à l'aide d'un lecteur de plaque de 96 puits. Soustrayez l'absorption de fond des puits de contrôle sans cellules des valeurs d'absorption pour les autres échantillons.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Ce protocole décrit une méthode efficace pour induire et caractériser la stéatose vésiculaire dans les cellules HepaRG différenciées d'IllSO par le traitement de l'oleatde de sodium (figure 1A).

Différenciation des cellules HepaRG.
Pour induire efficacement la différenciation, les cellules proliférantes doivent être ensemencées à faible densité (2,5 x 104 cellules/cm2) dans le milieu de prolifération. Lorsqu'elles sont ensemiées à faible densité, les cellules se divisent activement et acquièrent une morphologie allongée et indifférenciée (figure 1B). Les cellules doivent être laissées à croître dans le milieu de prolifération pendant 7 jours, jusqu'à ce que 100% de confluence soit atteint (Figure 1C). Après une exposition à 2 % de DMSO, les cellules commencent à se différencier et à former des colonies typiques ressemblant à des hépatocytes entourées de cellules épithéliales biliaires (figure1D). Les cellules HepaRG différenciées expriment des marqueurs spécifiques à l'hépato, tels que l'albumine, le Cyp3A4 et l'Aldolase B. Pour vérifier la différenciation appropriée, les niveaux d'expression de ces gènes marqueurs hépatiques dans les cellules différenciées (Jour 21) et dans les cellules proliférantes (Jour 0) ont été analysés par qPCR (Figure 1E). Les gènes de l'albumine, du Cyp3A4 et de l'Aldolase B devraient être régulés dans les cellules HepaRG différenciées par rapport aux cellules HepaRG proliférantes, et nous avons observé cette tendance, confirmant l'efficacité de notre protocole de différenciation.

Induction de la stéatose vésiculaire dans les cellules D'HepaRG par traitement à l'avoine de sodium.
Le traitement à l'avoine de sodium des cellules dHépaRG induit l'accumulation de graisse, visible sous un microscope optique sous forme de gouttelettes lipidiques dans les cytoplasmes (Figure 2A). Pour vérifier l'induction efficace de la stéatose, les cellules HepaRG traitées à l'oleat et de contrôle ont été tachées de colorant Oil Red O. Après coloration, les gouttelettes lipidiques sont facilement visibles sous forme de gouttelettes rouges (Figure 2B) et peuvent être quantifiées par mesure spectrophotométrique du colorant Oil Red O élifié avec isopropanol (Figure 2C). L'absorption de l'huile rouge O élunée des cellules est directement proportionnelle à l'accumulation cytoplasmique de gouttelettes lipidiques.

La concentration et le temps d'exposition à l'oleat de sodium ont été déterminés par l'étude de viabilité colorimétrique des cellules MTT (étape 9). Le traitement à l'avoine de sodium a été comparé au traitement au palmitate de sodium et la doxorubucne , un médicament apoptotique (2 M) a été utilisée comme contrôle (figure2D). La cytoxicité des composés a été évaluée par MTT, profitant d'un composé commercial (Table of Materials), qui contient le tetrazolium MTT. Le composé jaune soluble dans l'eau MTT tetrazolium est bioréduit par des cellules métaboliquement actives dans un produit formazan pourpre insoluble dans l'eau. Le produit formazan est quantifié par son absorption à 490 nm et la quantité est directement proportionnelle au nombre de cellules vivantes en culture (Figure 2D).

Quantification de la stéatose vésiculaire dans les cellules HepaRG traitées à l'oleat de sodium
Pour quantifier l'augmentation de la teneur en lipides cellulaires après le traitement de l'oleat de sodium, nous avons effectué des taches avec le colorant Bodipy, une sonde qui étiquette les gouttelettes lipidiques. En utilisant l'analyse cytofluorimétrique, il est possible de quantifier la teneur en triglycérides par Bodipy moyenne intensité fluorescente, qui est plus élevé dans les cellules traitées à l'oleatpare par rapport aux cellules témoins (Figure 3A,B), indiquant la graisse efficace accumulation après traitement à l'oleate. En effet, les images de cellules tachées de Bodipy montrent des gouttelettes de lipides fluorescents vert vif dans les cellules traitées à l'oleat qui ne sont pas visibles dans les cellules témoins (Figure 3C).

Le traitement de l'avoine de sodium des cellules dHepaRG dérègle le métabolisme des lipides et l'expression des gènes inflammatoires. Pour évaluer l'induction efficace de la stéatose vésiculaire, nous avons analysé par qPCR les niveaux d'expression des gènes choisis dans les cellules traitées à l'oleat de sodium par rapport à ceux des cellules témoins (Figure 4). Acetyl-CoA carboxylase beta (ACACB), glycerol-3-phosphate acyltransferase mitochondrial (GPAM), perilipins (PLIN2, PLIN4), apolipoprotein B (APOB), pyruvate dehydrogenase kinase isozyme 4 (PDK4), carnitine palmitoyltransferase 1A (CPT1A) et L'interleukine 6 (IL6) était régulée dans les cellules dHépaRG traitées à l'oléate, tandis que la famille de porteurs solute 2 membres 1 (SLC2A1), l'apolipoprotéine C-III (APOC3) et le stearoyl-CoA desaturase (SCD) étaient régulés (figure4). Pour caractériser et quantifier davantage le stockage des lipides dans les gouttelettes lors de l'ajout d'oleate de sodium aux cellules HepaRG différenciées, nous avons utilisé une technique innovante de microscopie, une microscopie anti-Stokes raman cohérente (CARS), qui permet visualisation et quantification des gouttelettes lipidiques sans étiquetage (Figure 5A). Les gouttelettes lipidiques ont été statistiquement quantifiées en termes de nombres, de distribution et de morphologie au niveau d'une seule cellule à l'aide d'images CARS. Le traitement à l'oleat de sodium (250 m) a entraîné une augmentation significative du nombre de gouttelettes lipidiques (figure 5B), ce qui a mené à une plus grande superficie totale de gouttelettes par cellule (figure5C) et à un pourcentage plus élevé de zones de gouttelettes par cellule ( Figure 5D), par rapport aux cellules témoins, ce qui indique que les cellules dHépaRG ont accumulé efficacement la graisse après le traitement à l'avoine de sodium.

Figure 1
Figure 1 : Différenciation des cellules HepaRG. (A) Diagramme représentatif montrant le protocole de différenciation/traitement des cellules HepaRG tel que décrit aux étapes 3 et 4. (B-D) Images montrant des cellules HepaRG proliférantes non tachées au Jour 0 après l'ensemencement (B), au jour de confluence 7 après l'ensemencement (C), et différencié HepaRG (dHepaRG) au Jour 21 après l'ensemencement (D). (E) L'ARN total a été extrait des cellules proliférantes et dHepaRG, l'ADNc a été synthétisé et analysé par qPCR à l'aide d'amorces spécifiques pour les gènes indiqués (Tableau des matériaux). Les échantillons ont été normalisés à la moyenne des gènes d'entretien ménager DE GAPDH, actinB et ribosomal 18S. Les histogrammes montrent l'induction de pli de la prolifération (Jour 0) par rapport aux cellules différenciées (Jour 21) (les barres indiquent S.D.; p-valeurs ont été calculer par les t-tests de l'étudiant). Veuillez cliquer ici pour voir une version plus grande de ce chiffre.

Figure 2
Figure 2 : Traitement de l'oleat de sodium des cellules dHepaRG induit l'accumulation de gouttelettes lipidiques. (A) Images de cellules HepaRG différenciées non tachées (dHepaRG) traitées pendant 5 jours avec véhicule (contrôle) (image de gauche) ou avec 250 'M d'oleate de sodium (image de droite). (B) Après traitement, les cellules ont été tachées avec le colorant d'huile rouge O ; les gouttelettes lipidiques sont visibles en rouge. (C) Oil Red O dye a été élugé et OD a été mesuré à 570 nm. Les résultats sont exprimés comme moyen de trois expériences indépendantes (les barres indiquent S.D.; p-value par le t-test de l'étudiant). (D) Évaluation de la viabilité cellulaire du véhicule de cellules dHépaRG (99 % de méthanol) traité (Ctrl) ou traité pendant 5 jours avec de l'oleate de sodium et du palmitate de sodium (100 M, 250 M, ou 500 M), ou traité 18 h avec de la doxorubucne (2 M).  L'évaluation de la cytotoxicité a été effectuée à l'aide d'un kit d'analyse MTT (Table of Materials), l'absorption d'enregistrement à 490 nm, selon les instructions du fabricant. Les résultats sont exprimés comme des moyens de trois expériences indépendantes (les barres indiquent S.D.; p-values ont été déterminées à l'aide de l'étudiant t-test: 0,01 p 'lt; 0,05; '0,001 'p 'lt; 'p 'lt; 'lt; 'lt; 'lt; 'lt; 'lt' Veuillez cliquer ici pour voir une version plus grande de ce chiffre.

Figure 3
Figure 3 : Quantification de l'accumulation de graisse après traitement à l'oleat de sodium par la coloration Bodipy. Des cellules hepaRG différenciées (dHepaRG) ont été traitées avec le véhicule (contrôle) ou avec l'oleat de sodium de 250 M pendant 5 jours. Après traitement, les cellules de dHepaRG ont été souillées avec le colorant de Bodipy et analysées par cytométrie de flux. (A) Profils de la recouche représentative (% de max : pourcentage d'intensité maximale de coloration). (B) Les histogrammes montrent l'intensité moyenne de fluorescence (Imf) en pourcentage des cellules traitées sur le contrôle de trois expériences indépendantes (les barres indiquent S.D.; p-valeurs ont été déterminées à l'aide de l'étudiant t-test: 0,01 p lt; 0,001 ' p 'lt; 0,01; 'p 0,001). (C) Les cellules ont été fixées avec 4% de paraformaldéhyde. Les images montrent des gouttelettes lipidiques tachées de Bodipy en vert. Veuillez cliquer ici pour voir une version plus grande de ce chiffre.

Figure 4
Figure 4 : Le traitement de l'avoine de sodium des cellules dHepaRG induit la déréglementation du métabolisme lipidique et l'expression des gènes inflammatoires. Des cellules hepaRG différenciées (dHepaRG) ont été traitées avec le véhicule (contrôle) ou avec l'oleat de sodium de 250 M pendant 5 jours. Les cDNA ont été analysés par qPCR avec des amorces spécifiques pour les gènes indiqués et les résultats ont été normalisés à la moyenne des gènes d'entretien ménager DEGAPDH, actinB et ribosomal 18S ; les amorces sont données dans la Table des Matériaux. L'histogramme montre les niveaux d'expression des gènes indiqués comme inductions de pliage des cellules traitées sur le contrôle (les barres indiquent S.D.; p-valeurs ont été calculer par l'étudiant t-test). Veuillez cliquer ici pour voir une version plus grande de ce chiffre.

Figure 5
Figure 5 : Caractérisation de l'accumulation de gouttelettes lipidiques après traitement à l'oleat de sodium par microscopie CARS. Les cellules hepaRG différenciées (dHepaRG) ont été traitées avec le véhicule (contrôle) ou avec l'oleat de sodium de 250 M pendant 5 jours et ont été analysées par microscopie de CARS. (A) Images représentatives montrant le contraste des gouttelettes lipidiques CARS en rouge. (B) Histogramme montrant le nombre de gouttelettes lipidiques par cellule. (C) Histogrammes montrant la surface totale de l'image couverte de gouttelettes par cellule. (D) Histogramme montrant % de zone de gouttelettes couverte de gouttelettes par cellule. Tous les résultats sont exprimés comme des moyens de trois expériences indépendantes (les barres indiquent S.E.; p-values ont été déterminées par l'étudiant t-test: 0,01 p 'lt; 0,05; '0,001 'p 'lt; 'p 'lt; 'lt; 'lt; 'lt; 'lt; 'lt; '. Veuillez cliquer ici pour voir une version plus grande de ce chiffre.

Réactifs Volume (L) pour une seule réaction
2x Teinture fluorescente vert SYBR 10 Ans et plus
PCR grade H2O 6 Annonces
Apprêt vers l'avant (M) 1 Fois
Amorce inversée (M) 1 Fois

Tableau 1 : mix maître qPCR.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Ce protocole décrit comment différencier les cellules HepaRG et comment induire la stéatose vésiculaire par traitement à l'avoine de sodium (Figure 1A). En effet, par rapport à d'autres lignées cellulaires du carcinome hépatocellulaire humain (HCC), la lignée cellulaire HepaRG présente des caractéristiques d'hépatocytes humains adultes, représentant une alternative précieuse aux hépatocytes humains primaires cultivés ex vivo13,14 ,15. La lignée cellulaire HepaRG a été largement utilisée pour les études sur la cytotoxicité hépatique, le métabolisme des médicaments et les études de virologie15,16,22.

En comparaison avec les cellules HepaRG, d'autres lignées cellulaires HCC telles que HepG2, HUH7, HUH6 et Hep3B affichent des capacités métaboliques inférieures, manquant d'un ensemble substantiel de fonctions spécifiques au foie23,24, et présentant un niveau basal plus élevé de accumulation de graisse cytoslique stockée dans les gouttelettes lipidiques. Ainsi, ces lignées cellulaires HCC sont moins utiles comme modèles pour l'induction de la stéatose vésiculaire après la surcharge lipidique que la lignée cellulaire HepaRG.

Étapes critiques du protocole
Lorsqu'elles sont enseisées à faible densité (2,5 x 104 cellules/cm2),les cellules HepaRG acquièrent une morphologie allongée et indifférenciée, se divisant activement; après avoir atteint 100% de confluence, ils sont capables de se différencier lors de l'exposition à 2% de DMSO et ils forment des colonies typiques en forme d'hépatocytes entourés de cellules épithéliales biliaires (figure1D). Cette culture mixte de cellules biliaires/hépatocytes récapitule des dispositifs du tissu de foie, ressemblant à une condition physiologique, en dépit de l'absence d'autres types de cellules de foie (sinusoïdal ou Kupffer).

Une étape critique dans le processus de différenciation est la confluence des cellules. Les cellules doivent être ensemencées à faible densité (2,5 x 104 cellules/cm2) (figure 1B) et être autorisées à se développer activement dans le milieu de prolifération pendant au moins 1 semaine (Jour 0-7). Au jour 7, avant d'ajouter 2% de DMSO pour commencer le processus de différenciation, les cellules doivent être à 100% de confluence (Figure 1C). Si, au jour 7 (étape 2.2), la confluence complète n'a pas été atteinte, il est fortement recommandé que les cellules soient autorisées à continuer à croître dans le milieu de prolifération pendant quelques jours supplémentaires, jusqu'à ce que la confluence à 100 % soit atteinte.

Limitations du protocole
Il a été observé qu'après avoir ajouté le milieu de différenciation, certaines cellules souffrent, et typiquement 10% de cellules meurent pendant les 2-3 jours suivants. À ce stade, le lavage quotidien et le changement moyen (étape 2.4) doivent être continués à jeter les cellules mortes flottantes. L'utilisation d'un FBS spécifique (Tableaudes Matériaux) pour compléter à la fois les médias de différenciation et de prolifération, devrait augmenter l'efficacité de différenciation et la mort cellulaire inférieure pendant les jours 7-21 (étape 2.4). Il est fortement recommandé de maintenir les cellules jusqu'au passage 20, et de choisir des passages inférieurs (lt;20) pour différencier les cellules: moins de décès de cellules se produit pour les plus jeunes cellules HepaRG. De plus, la différenciation de l'HepaRG semble être plus efficace dans les plats de 35 mm et 60 mm, alors que les cellules ont tendance à souffrir davantage lorsqu'elles sont ensemencées dans les plats de 100 mm et 150 mm.

Modifications et dépannage
L'exposition à différents rapports des acides gras palmitiques et oleic a été montrée pour avoir comme conséquence la formation des gouttelettes intracytoplasmatic de lipide25,26. Cependant, nous avons observé que le traitement à l'oleat de sodium des cellules HepaRG différenciées a donné de meilleurs résultats que l'exposition à l'acide palmitique, en termes d'induction efficace de l'accumulation de lipides et de la viabilité cellulaire (Figure 2D). En effet, le traitement de l'acide palmitique s'est avéré toxique pour les cellules HepaRG différenciées (Figure 2D), en accord avec les données de la littérature sur les lignées cellulaires d'hépatome et sur les cultures primaires d'hépatocytes humains et rats qui décrivent l'acide palmitique comme un considérablement agent cytotoxique25,26,27,28,29. En outre, l'utilisation du palmitate dans les essais cellulaires est difficile en raison de sa faible solubilité. Néanmoins, en raison de la variabilité intrinsèque des lignées cellulaires, il est recommandé de vérifier la concentration de travail et la durée du traitement de l'oleat de sodium, en testant différentes concentrations dans le cadre d'une expérience temporelle avec un test de viabilité cellulaire.

Importance et comparaison des techniques de détection des lipides
La détermination précise des quantités de lipides dans les cellules a été établie par un certain nombre d'approches différentes dans cette étude. Un accord qualitatif et aussi quantitatif a été observé entre les résultats obtenus par l'intermédiaire de la coloration Oil Red O, la coloration Bodipy et l'imagerie CARS. Pour une estimation rapide des quantités lipidiques dans les populations cellulaires, l'utilisation de la cytométrie à débit de Bodipy ou d'une tache comme l'huile rouge O est idéale. Pour un examen plus détaillé de la teneur en gouttelettes lipidiques des cellules, une modalité d'imagerie est préférable. En outre, des problèmes de spécificité ont été signalés pour les taches lipidiques telles que l'huile rouge O20,30, et nous avons observé que dans certains cas, la tache Bodipy a une capacité inférieure que CARS à étiqueter exclusivement les gouttelettes lipidiques parmi d'autres cellules organelles (données non montrées). Par conséquent, l'utilisation d'une technique d'imagerie microscopique sans étiquette comme CARS offre des avantages significatifs pour la quantification et la caractérisation de la stéatose. L'évitement de l'utilisation d'une grande étiquette fluorescente rend l'imagerie CARS favorable en raison de la petite taille des molécules lipidiques par rapport aux fluorophores typiques; par conséquent, pour la détection des lipides, des méthodes sans étiquette sont souhaitables, encore plus que pour l'observation de grandes molécules protéiques. Le signal CARS lipidique est une émission optique qui n'est générée que lorsqu'une interaction non linéaire se produit dans l'échantillon. Cette interaction ne peut être détectée que lorsque la différence entre les fréquences des deux lasersd'excitation focalisée sur l'échantillon correspond à la fréquence vibratoire du méthylène (CH 2). L'abondance des groupes de méthylène dans les lipides entraîne un signal très intense avec des rapports signal-bruit élevés, et la non-linéarité de l'interaction optique signifie également que la haute résolution spatiale est possible dans la microscopie CARS. L'excellente qualité des images CARS en général permet la collecte de statistiques sur la taille et le nombre de gouttelettes lipidiques, comme le démontre cette étude. En outre, d'autres études ont démontré l'utilisation de la microscopie CARS pour corréler différentes localisations subcellulaires et tailles de gouttelettes lipidiques avec différents traitements18, et en utilisant des mesures supplémentaires CARS à différentes longueurs d'onde, ou une approche à large bande CARS ou similaire stimulée Raman approche, les chercheurs ont montré qu'il est possible de caractériser différents types d'acides gras dans les gouttelettes lipidiques31,32. En outre, la rapidité de la collecte d'images CARS a permis à l'imagerie in situ des cellules vivantes d'examiner l'évolution temporelle de la croissance des gouttelettes lipidiques et de l'agrégation33.

Applications futures
Au cours des dernières décennies, les points de vue sur les rôles et les fonctions des gouttelettes lipidiques dans la biologie cellulaire ont évolué. Auparavant considérés comme des vésicules de stockage essentiellement inertes, ils sont maintenant considérés comme des organites cellulaires très dynamiques, et leur rôle dans la maladie est de plus en plus reconnu34,35,36. Bien que dans le cas de l'affection hépatique, l'accumulation de lipides (steatosis) a longtemps été connu pour être un aspect critique, le mécanisme précis de la participation des gouttelettes lipidiques dans la progression de la maladie n'est pas complètement clair. Par conséquent, des méthodes telles que CARS qui peuvent caractériser le comportement dynamique des gouttelettes lipidiques sont d'une importance cruciale pour le développement d'une compréhension moléculaire des maladies, y compris NAFLD. L'analyse métabolique d'expression de gène par qPCR est fortement complémentaire à l'imagerie moléculaire des lipides par l'intermédiaire de CARS, comme démontré dans les études précédentes17,18, permettant des aperçus plus profonds dans des mécanismes de la maladie. Dans la présente étude, nous observons l'accumulation d'acides gras avec la déréglementation du métabolisme lipidique et l'expression inflammatoire de gène, qui peut contribuer à la construction d'un panneau de bio-marqueurs pour le diagnostic tôt de la maladie.

Le modèle à base de cellules dHépaRG traités à l'oleate de sodium peut accroître la connaissance des mécanismes moléculaires impliqués non seulement dans le début mais aussi dans la progression de NAFLD, fournissant une base pour le développement de meilleures approches thérapeutiques à la maladie.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Les auteurs déclarent qu'ils n'ont pas d'intérêts financiers concurrents.

Acknowledgments

Nous remercions le prof. Christian Trepo (INSERM U871, Lyon, France), qui a gentiment fourni des cellules HepaRG. Nous sommes reconnaissants à Rita Appodia pour son aide administrative. Ce travail a été soutenu par MIUR-Ministero dell'istruzione, dell'università e della ricerca (FIRB 2011-2016 RBAP10XKNC) et Sapienza University of Rome (prot. C26A13T8PS; Prot. C26A142MCH; Prot. C26A15LSXL).

Materials

Name Company Catalog Number Comments
Hyclone HyClone Fetal Clone II  GE Healthcare SH30066
William’s E medium with GlutaMAX  Thermofisher 32551087
Penicillin/streptomycin  SIGMA P4333
Insulin  SIGMA I9278
Hydrocortisone hemisuccinate SIGMA H2270
DMSO, dimethyl sulfoxide SIGMA D2438   
Sodium Oleate SIGMA O7501 
Methanol SIGMA 179337
Isopropanol SIGMA 278475
BODIPY 505/515 Thermofisher D3921
PBS Thermofisher 14190-250
Formaldehyde solution SIGMA 252549
RNAse free DNAseI Promega M198A 
Glass-bottomed dishes Willco Wells GWST-5040
Oil Red solution SIGMA O625
CellTiter 96 AQueous One Solution Promega  G3582
q-PCR oligo name Sequence
ACACB FOR CAAGCCGATCACCAAGAGTAAA
ACACB REV CCCTGAGTTATCAGAGGCTGG
β-actin FOR GCACTCTTCCAGCCTTCCT
β-actin REV AGGTCTTTGCGGATGTCCAC
ALBUMIN FOR TGCTTGAATGTGCTGATGACAGG
ALBUMIN REV AAGGCAAGTCAGCAGGCATCTCATC
ALDOB FOR GCATCTGTCAGCAGAATGGA 
ALDOB REV TAGACAGCAGCCAGGACCTT
APOB FOR CCTCCGTTTTGGTGGTAGAG
APOB REV  CCTAAAAGCTGGGAAGCTGA
APOC3 FOR CTCAGCTTCATGCAGGGTTA
APOC3 REV GGTGCTCCAGTAGTCTTTCAG
CPT1A FOR TCATCAAGAAATGTCGCACG
CPT1A REV GCCTCGTATGTGAGGCAAAA
CYP2E1 FOR TTGAAGCCTCTCGTTGACCC
CYP2E1 REV CGTGGTGGGATACAGCCAA
CYP3A4 FOR CTTCATCCAATGGACTGCATAAAT
CYP3A4 REV TCCCAAGTATAACACTCTACACAGACAA
GAPDH FOR TGACAACTTTGGTATCGTGGAAGG
GAPDH REV AGGGATGATGTTCTGGAGAGCC
GPAM FOR TCTTTGGGTTTGCGGAATGTT
GPAM REV ATGCACATCTCGCTCTTGAATAA
IL6 FOR CCTGAACCTTCCAAAGATGGC
IL6 REV ACCTCAAACTCCAAAAGACCAGTG
PDK4 FOR ACAGACAGGAAACCCAAGCCAC
PDK4 REV TGGAGGTGAGAAGGAACATACACG
PLIN2 FOR TTGCAGTTGCCAATACCTATGC
PLIN2 REV CCAGTCACAGTAGTCGTCACA
PLIN4 FOR AATGAGTTGGAGGGGCTGGGGGACATC
PLIN4 REV GGTCACCTAAACGAACGAAGTAGC
SCD FOR TCTAGCTCCTATACCACCACCA
SCD REV TCGTCTCCAACTTATCTCCTCC
SLC2A1 FOR TGCTCATCAACCGCAACGAG
SLC2A1 REV CCGACTCTCTTCCTTCATCTCCTG
18S FOR CGCCGCTAGAGGTGAAATTC
18S REV TTGGCAAATGCTTTCGCTC

DOWNLOAD MATERIALS LIST

References

  1. Starley, B. Q., Calcagno, C. J., Harrison, S. A. Nonalcoholic fatty liver disease and hepatocellular carcinoma: a weighty connection. Hepatology. 51, (5), 1820-1832 (2010).
  2. Byrne, C. D., Targher, G. NAFLD: a multisystem disease. Journal of Hepatology. 62, (1), Suppl 47-64 (2015).
  3. Marra, F., Gastaldelli, A., Svegliati Baroni, G., Tell, G., Tiribelli, C. Molecular basis and mechanisms of progression of non- alcoholic steatohepatitis. Trends in Molecular Medicine. 14, 72-81 (2008).
  4. Chalasani, N., et al. The diagnosis and management of nonalcoholic fatty liver disease: Practice guidance from the American Association for the Study of Liver Diseases. Hepatology. 67, (1), 328-357 (2018).
  5. Banini, B. A., Sanyal, A. J. Current and future pharmacologic treatment of nonalcoholic steatohepatitis. Current Opinion in Gastroenterology. 33, (3), 134-141 (2017).
  6. Takahashi, Y., Sugimoto, K., Inui, H., Fukusato, T. Current pharmacological therapies for nonalcoholic fatty liver disease/nonalcoholic steatohepatitis. World Journal of Gastroenterology. 21, (13), 3777-3785 (2015).
  7. Younossi, Z., et al. Global burden of NAFLD and NASH: trends, predictions, risk factors and prevention. Nature Reviews Gastroenterology & Hepatology. 15, (1), 11-20 (2018).
  8. Santhekadur, P. K., Kumar, D. P., Sanyal, A. J. Preclinical models of non-alcoholic fatty liver disease. Journal of Hepatology. 68, (2), 230-237 (2018).
  9. Nagarajan, P., Mahesh Kumar, M. J., Venkatesan, R., Majundar, S. S., Juyal, R. C. Genetically modified mouse models for the study of nonalcoholic fatty liver disease. World Journal of. Gastroenterology. 18, (11), 1141-1153 (2012).
  10. Oseini, A. M., Cole, B. K., Issa, D., Feaver, R. E., Sanyal, A. J. Translating scientific discovery: the need for preclinical models of nonalcoholic steatohepatitis. Hepatology International. 12, (1), 6-16 (2018).
  11. Ramboer, E., Vanhaecke, T., Rogiers, V., Vinken, M. Immortalized human hepatic cell lines for in vitro testing and research purposes. Methods in Molecular Biology. 1250, 53-76 (2015).
  12. Gómez-Lechón, M. J., Donato, M. T., Castell, J. V., Jover, R. Human hepatocytes in primary culture: the choice to investigate drug metabolism in man. Current Drug Metabolism. 5, (5), 443-462 (2004).
  13. Marion, M. J., Hantz, O., Durantel, D. The HepaRG cell line: biological properties and relevance as a tool for cell biology, drug metabolism, and virology studies. Methods in Molecular Biology. 640, 261-272 (2010).
  14. Gripon, P., et al. Infection of a human hepatoma cell line by hepatitis B virus. Proceedings of the National Academy of Sciences. 99, (24), 15655-15660 (2002).
  15. Anthérieu, S., Rogue, A., Fromenty, B., Guillouzo, A., Robin, M. A. Induction of vesicular steatosis by amiodarone and tetracycline is associated with up-regulation of lipogenic genes in HepaRG cells. Hepatology. 53, (6), 1895-1905 (2011).
  16. Rouge, A., et al. PPAR agonists reduce steatosis in oleic acid-overloaded HepaRG cells. Toxicology and Applied Pharmacology. 276, (1), 73-81 (2014).
  17. Belloni, L., et al. Targeting a phospho-STAT3-miRNAs pathway improves vesicular hepatic steatosis in an in vitro and in vivo model. Scientific Reports. 8, 13638 (2018).
  18. Nunn, A. D. G., et al. The histone deacetylase inhibiting drug Entinostat induces lipid accumulation in differentiated HepaRG cells. Scientific Reports. 6, 28025 (2016).
  19. Donato, M. T., et al. Cytometric analysis for drug-induced steatosis in HepG2 cells. Chemico-Biological Interactions. 181, (3), 417-423 (2009).
  20. Hellerer, T., Axäng, C., Brackmann, C., Hillertz, P., Pilon, M., Enejder, A. Monitoring of lipid storage in Caenorhabditis elegans using coherent anti-Stokes Raman scattering (CARS) microscopy. Proceedings of the National Academy of Sciences. 104, (37), 14658-14663 (2007).
  21. Le, T. T., Ziemba, A., Urasaki, Y., Brotman, S., Pizzorno, G. Label-free evaluation of hepatic microvesicular steatosis with multimodal coherent anti-Stokes Raman scattering microscopy. PLoS One. 7, (11), 51092 (2012).
  22. Guillouzo, A., Corlu, A., Aninat, C., Glaise, D., Morel, F., Guguen-Guillouzo, C. The human hepatoma HepaRG cells: a highly differentiated model for studies of liver metabolism and toxicity of xenobiotics. Chemico-Biological Interactions. 168, (1), 66-73 (2007).
  23. Nelson, L. J., et al. Human hepatic HepaRG cells maintain an organotypic phenotype with high intrinsic CYP450 Activity/metabolism and significantly outperform standard HepG2/C3A cells for pharmaceutical and therapeutic applications. Basic & Clinical Pharmacology & Toxicology. 120, (1), 30-37 (2017).
  24. Gerets, H. H. J., Tilmant, K., Gerin, B., Chanteux, H., Depelchin, B. O., Dhalluin, S., Atienzar, F. A. Characterization of primary human hepatocytes, HepG2 cells, and HepaRG cells at the mRNA level and CYP activity in response to inducers and their predictivity for the detection of human hepatotoxins. Cell Biology and Toxicology. 28, (2), 69-87 (2012).
  25. Pusl, T., et al. Free fatty acids sensitize hepatocytes to bile acid-induced apoptosis. Biochemical and Biophysical Research Communications. 371, (3), 441-445 (2008).
  26. Gentile, C. L., Pagliassotti, M. J. The role of fatty acids in the development and progression of nonalcoholic fatty liver disease. The Journal of Nutritional Biochemistry. 19, (9), 567-576 (2008).
  27. Mei, S., et al. Differential roles of unsaturated and saturated fatty acids on autophagy and apoptosis in hepatocytes. Journal of Pharmacological Experimental Therapy. 339, 487-498 (2011).
  28. Malhi, H., Bronk, S. F., Werneburg, N. W., Gores, G. J. Free fatty acids induce JNK-dependent hepatocyte lipoapoptosis. Journal of Biological Chemistry. 281, 12093-12101 (2006).
  29. Moravcová, A., Červinková, Z., Kučera, O., Mezera, V., Rychtrmoc, D., Lotková, H. The effect of oleic and palmitic acid on induction of steatosis and cytotoxicity on rat hepatocytes in primary culture. Physiological Research. 64, Suppl 5 627-636 (2015).
  30. Ohsaki, Y., Shinohara, Y., Suzuki, M., Fujimoto, T. A pitfall in using BODIPY dyes to label lipid droplets for fluorescence microscopy. Histochemistry and Cell Biology. 133, (4), 477-480 (2010).
  31. Rinia, H. A., Burger, K. N., Bonn, M., Müller, M. Quantitative label-free imaging of lipid composition and packing of individual cellular lipid droplets using multiplex CARS microscopy. Biophysical Journal. 95, (10), 4908-4914 (2008).
  32. Waschatko, G., Billecke, N., Schwendy, S., Jaurich, H., Bonn, M., Vilgis, T. A., Parekh, S. H. Label-free in situ imaging of oil body dynamics and chemistry in germination. Journal of The Royal Society Interface. 13, (123), (2016).
  33. Jüngst, C., Winterhalder, M. J., Zumbusch, A. Fast and long term lipid droplet tracking with CARS microscopy. Journal of Biophotonics. 4, (6), 435-441 (2011).
  34. Welte, M. A., Gould, A. P. Lipid droplet functions beyond energy storage. Biochimica et Biophysica Acta - Molecular and Cell Biology of Lipids. 1862, (10), Pt B 1260-1272 (2017).
  35. Cohen, S. Lipid droplets as organelles. International Review of Cell and Molecular Biology. 337, 83-110 (2018).
  36. Farese, R. V., Walther, T. C. Lipid droplets finally get a little R-E-S-P-E-C-T. Cell. 139, (5), 855-860 (2009).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics