Indurre e caratterizzare la vesapica steatosi nelle celle HepaRG differenziate

Medicine

Your institution must subscribe to JoVE's Medicine section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

In questo studio, descriviamo un protocollo dettagliato per indurre la steatosi vescicolare del fegato in cellule HepaRG differenziate con l'oleate di sodio acido grasso e impieghiamo metodi per il rilevamento e la quantificazione dell'accumulo di lipidi, compresi gli anti-Stokes coerenti Microscopia a dispersione Raman (CARS), analisi citofluorimetrica, colorazione Oo rosso olio e qPCR.

Cite this Article

Copy Citation | Download Citations

Di Cocco, S., Belloni, L., Nunn, A. D., Salerno, D., Piconese, S., Levrero, M., Pediconi, N. Inducing and Characterizing Vesicular Steatosis in Differentiated HepaRG Cells. J. Vis. Exp. (149), e59843, doi:10.3791/59843 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

La steatosi epatica rappresenta una disfunzione metabolica che deriva da un accumulo di goccioline di lipidi trigliceridi contenenti epatociti. L'eccessivo accumulo di grasso porta alla malattia del fegato grasso non alcolico (NAFLD), che è potenzialmente reversibile e può evolvere in steatoepatite analcolica (NASH) e infine cirrosi e carcinoma epatocellulare (HCC). I meccanismi molecolari che collegano l'accumulo di lipidi negli epatociti con la progressione alla NASH, danni epatici irreversibili, fibrosi, cirrosi, e anche HCC rimane ancora poco chiaro. A tal fine, sono stati sviluppati diversi modelli in vitro e in vivo per chiarire i processi patologici che causano NAFLD. Nel presente studio, descriviamo un modello cellulare per l'induzione della steatosi vescicolare del fegato che consiste di cellule Epatiche Epatiche Epatiche EpaRG epatiche differenziate d'AmSO trattate con l'acido grasso sale oleume di sodio. Infatti, le cellule HepaRG trattate con oleato di sodio accumulano goccioline lipidiche nel citoplasma e mostrano caratteristiche tipiche della steatosi. Questo modello umano in vitro rappresenta una valida alternativa ai modelli di topi in vivo e ai primari epediti umani. Presentiamo anche un confronto di diversi metodi per la quantificazione e la valutazione dell'accumulo di grasso nelle cellule HepaRG, tra cui la colorazione ORossa dell'olio, la misurazione citofluorimetrica del Bodipy, l'analisi metabolica dell'espressione genica da parte di qPCR e anti-Stokes coerenti microscopia a dispersione Raman (CARS). L'imaging CARS combina la specificità chimica della spettroscopia Raman, una tecnica di analisi chimica nota nelle applicazioni scientifiche dei materiali, con i vantaggi delle microscopie ottiche non lineari ad alta velocità e ad alta risoluzione per consentire quantificazione dell'accumulo di lipidi e della dinamica delle goccioline lipidiche. L'istituzione di un efficiente modello in vitro per l'induzione della steatosi vescicolare, insieme a un metodo accurato per la quantificazione e la caratterizzazione dell'accumulo di lipidi, potrebbe portare allo sviluppo di una diagnosi in fase iniziale di NAFLD tramite il l'identificazione dei marcatori molecolari e la generazione di nuove strategie di trattamento.

Introduction

La steatosi epatica è definita come accumulo di grasso intraepatico, all'interno di goccioline di lipidi contenenti trigliceridi, di almeno il 5% del peso del fegato. L'immagazzinamento prolungato di lipidi epatici è un processo potenzialmente reversibile, tuttavia, può portare a disfunzione metabolica del fegato epatico, infiammazione e forme avanzate di malattia epatica grassa non alcolica (NAFLD), la causa predominante della malattia cronica del fegato in molte parti il mondo1,2. NAFLD è una malattia multifattoriale che può evolvere verso la steatoepatite non alcolica più aggressiva (NASH), che a sua volta può progredire in cirrosi e, in una piccola percentuale di pazienti, al carcinoma epatocellulare (HCC)1,3. Nessuna terapia approvata è attualmente disponibile come trattamento specifico per NAFLD e la combinazione di modifiche di dieta e stile di vita rimane il pilastro della gestione NAFLD e NASH4,5,6.

I meccanismi molecolari che portano allo sviluppo della steatosi epatica nella patogenesi del NAFLD rimangono ancora da chiarire7. In questo contesto, sono stati sviluppati modelli murini per studiare la progressione della malattia da steatosi umana. Esiste una miriade di modelli diversi, ognuno dei quali ha i suoi vantaggi e svantaggi, compresi i modelli genetici, nutrizionali e indotti chimicamente che combinano approcci diversi. I topi geneticamente modificati (transgenici o knockout) sviluppano spontaneamente malattie epatiche. Tuttavia, va notato che queste mutazioni sono molto rare nell'uomo e la delezione o sovraespressione di un singolo gene (ad esempio, topo ob/ob) non può imitare l'eziologia della malattia umana multifattoriale al livello molecolare8,9. Allo stesso modo, la malattia acquisita dai topi dopo la manipolazione dietetica o farmacologica non può imitare gli effetti delle diete umane associate allo sviluppo di NAFLD nell'uomo8. I modelli animali, tuttavia, hanno facilitato gli sviluppi nella comprensione del NAFLD e questo approccio è attualmente la strategia attualmente più utilizzata nella ricerca di laboratorio. Tuttavia, la replicazione negli esseri umani dei risultati ottenuti in modelli animali ha ripetutamente fallito, causando una cattiva traduzione nella clinica10.

Pertanto, i modelli in vitro di NAFLD possono svolgere un ruolo fondamentale nel chiarire i meccanismi molecolari della progressione NAFLD e rappresentano uno strumento prezioso per vagliare un gran numero di composti. Colture cellulari primarie, linee cellulari immortalate e biopsie epatiche sono state ampiamente utilizzate per scopi di ricerca11. Gli epatociti umani primari assomigliano molto alle condizioni cliniche umane, ma c'è un numero limitato di donatori, e le colture cellulari primarie mostrano scarsa riproducibilità a causa della variabilità delle cellule. Queste osservazioni, insieme a questioni etiche e logistiche, hanno portato all'uso di equali primari umani limitati12. Così, le linee cellulari epatiche rappresentano una comoda alternativa, avendo diversi vantaggi essenziali rispetto alla cultura primaria, poiché le linee cellulari epatiche crescono costantemente, hanno una durata di vita quasi illimitata e hanno un fenotipo stabile. Inoltre, le linee cellulari sono facilmente accessibili e le condizioni di coltura delle linee cellulari epatiche sono più semplici di quelle degli epediti primari e sono standardizzate tra diversi laboratori.

Qui, descriviamo in dettaglio un modello in vitro basato sulle cellule di steatosi epatica, rappresentato da cellule HepaRG differenziate epatiche trattate con l'oleato di sodio acido grasso. La linea cellulare HepaRG è stata stabilita da una paziente donna affetto da infezione da epatite C e da un tumore al fegato di Edmondson di grado I ben differenziato14. La linea cellulare HepaRG è una linea cellulare del progenitore biformicello umana in grado di differenziare l'esposizione al 2% di solforo dimetilo (DMSO) verso due diversi fenotipi cellulari: cellule biliari ed epatocitiche. Le cellule HepaRG differenziate (dHepaRG) condividono alcune caratteristiche e proprietà con gli epatociti adulti e possiedono la capacità di esprimere stabilmente geni specifici del fegato come Albumin, AldolaseB, Cytochrome P450 2E1 (CYP2E1) e Cytochrome P450 3A4 (CYP3A4)13 (passaggio 3). Il trattamento delle cellule dHepaRG con l'acido grasso sale sodio oleate (250 m) per 5 giorni porta alla generazione di goccioline lipidici citoplasmiche, imitando gli effetti del fegato grasso14,15,17,18 ( al punto 4). L'accumulo di goccioline lipidiche può essere facilmente rilevato dalla colorazione Oil Red O (fase 5), un colorante liposocroso solubile che macchia trigliceridi neutri e lipidi rosso-arancione. Per quantificare in modo efficiente i lipidi nel dHepaRG grasso, qui illustriamo l'analisi citofluorimetrica dopo la colorazione con 4,4-difluoro-1,3,7-tetramethyl-4-bora-3a,4a-diaza-s-indacene (Bodipy 505/515) (passaggio 6), un lipofilificante locale ai corpi lipidici intracellulari ed è stato utilizzato per etichettare le goccioline di lipidi19. Inoltre, qui mostriamo come valutare la steatosi mediante reazione quantitativa della catena di polimerasi (qPCR) (passaggio 7) la deregolazione dell'espressione genica di diversi geni metabolici nelle cellule dHepaRG. Per caratterizzare ulteriormente e quantificare l'accumulo di goccioline di lipidi dopo il trattamento dell'oleate di sodio, abbiamo eseguito una microscopia coerente anti-Stokes Raman scattering (CARS) (fase 8), una tecnica innovativa che consente la visualizzazione e la quantificazione goccioline lipidiche senza etichettare20,21.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Preparazione dei mezzi di coltura e dei reagenti

  1. Mezzo proliferante: supplemento E medio di William con GlutaMAX, 10% siero bovino fetale (FBS), 1% penicillina / streptomicina, 5 g / mL di insulina e 0,5M di idrocortisone emisuccinato.
  2. Mezzi di differenziazione: supplemento E medio di William con GlutaMAX, 10% FBS, 1% penicillina / streptomicina, 5 g / mL di insulina, 50 emisuccinato idrocortisone M e 2% DMSO.
  3. Mezzo di congelamento: integrare il mezzo proliferante con 10% DMSO.
  4. Oleate di sodio: sciogliere nel 99% metanolo a una concentrazione di 100 mM, mescolare O/N, e conservare a -20 gradi centigradi.
  5. Petrolio Red O: preparare una soluzione stock. Pesare 0,35 g di Olio Rosso O e sciogliere in 100 mL di isopropanol. Mescolare O/N, filtrare (0,2 m) e conservare presso RT. Preparare una soluzione funzionante: mescolare 6 mL di soluzione O Stock di olio con 4 mL di ddH2O. Lasciare seduto a temperatura ambiente (RT) per 20 min, quindi filtrare con un filtro di 0,2 m. Una corretta filtrazione è altamente raccomandato per una colorazione di successo per evitare lo sfondo.
  6. Bodipy (505/515): dissolvere bodipy (505/515) colorante in DMSO ad una concentrazione di 100 m di stock, conservare a -20 gradi centigradi al buio, e utilizzare ad una concentrazione finale di 100 nM.
  7. Acquisire piatti trasparenti con fondo in vetro per esperimenti CARS.

2. Scongelamento, amplificazione e crioconservazione delle cellule HepaRG

  1. Scongelare le cellule HepaRG crioconservate di azoto immergendo un lotto in un bagno di 37 gradi centigradi fino a quando non viene scongelato. Selezionare un batch di passaggio basso (<20). Le cellule HepaRG sono disponibili in commercio.
  2. Trasferire rapidamente le cellule in un tubo da 15 mL contenente 10 mL di mezzo proliferante e centrifugare per 5 min (200 xg, 4 gradi centigradi).
  3. Scartare il supernatante e risospendere nuovamente le cellule con 5 mL di mezzo proliferante.
  4. Contare le celle e diluire in modo da piastra 2,5 x 104 cellule / cm2.
  5. Rinnovare il supporto ogni 2 o 3 giorni. Le cellule proliferano con un tempo di raddoppio di circa 24 ore.
  6. Staccare le cellule HepaRG quando a 80% confluenza da 3-5 min incubazione con soluzione trypsin 0.05%. Raccogliere le cellule nel mezzo proliferare e centrifugare per 5 min (200 x g, 4 gradi centigradi).
  7. Scartare il supernatante e risospendere nuovamente le cellule con 5 mL di mezzo proliferante.
  8. Contare le celle e diluire in modo da piastra 2,5 x 104 cellule / cm2.
  9. In questa fase, amplificare le cellule ripetendo i passaggi 2.5-2.8 per raggiungere un numero appropriato di cellule per avviare esperimenti, o crioconservare come nel passaggio 2.10.
  10. Per crioconservare le cellule HepaRG, staccare le cellule 24 h dopo la placcatura di 3-5 min incubazione con soluzione trypsin 0.05%. Raccogliere le cellule nel mezzo proliferare e centrifugare per 5 min (200 x g, 4 gradi centigradi). Scartare il supernatante, riutilizzare le cellule in 1 mL/lotto di mezzo di congelamento, 1,5 x 106 cellule/lotto e crioconservare i lotti in azoto liquido.

3. Differenziazione delle celle HepaRG (giorno 0–21) (Figura1A)

  1. Giorno 0. Seme cellule HepaRG a bassa densità (2,5 x 104 cellule/cm2) in piatti trattati in coltura con volume appropriato di mezzo di proliferazione (Figura 1B). Due piatti devono essere placcati per ogni saggio (colorazione Oil Red O, analisi FACS, qPCR): uno per le cellule di controllo e uno per le cellule trattate con oleati. Se si eseguono misurazioni CARS (passaggio 8), semina le celle in parallelo in piatti trasparenti con fondo in vetro. Come controllo, raccogliere un piatto non trattato (cellule proliferanti Giorno 0) per eseguire l'analisi dell'espressione genica dei geni dei marcatori di differenziazione (vedere il passaggio 3.6).
  2. Giorno 2 e Giorno 4. Cambiare il mezzo con il volume appropriato di mezzo di proliferazione e lasciare che le cellule crescono fino alla confluenza.
  3. Giorno 7. Le celle devono avere un confluente al 100% (Figura 1C). Lavare le cellule una volta con 1x salina tampone fosfato (PBS). Rimuovere 1x PBS e aggiungere un volume appropriato di supporto di differenziazione.
  4. Giorno 8, 9, 12, 15, 18.  Lavare le cellule una volta con 1x PBS. Rimuovere 1x PBS e aggiungere un volume appropriato di supporto di differenziazione.
  5. Giorno 21. Osservare le cellule HepaRG al microscopio e assicurarsi che le cellule siano colture differenziate confluente (Figura 1D).
  6. Come controllo, raccogliere una parabola di controllo (cellule differenziate Giorno 21) per eseguire l'analisi dell'espressione genica (passaggio 7) dei geni dei marcatori di differenziazione (Figura 1E).
  7. Al giorno 21, le cellule HepaRG differenziate possono essere crioconservate in azoto liquido.

4. Induzione della steatosi vescicolare (giorno 21–26)

  1. Giorno 21. Oleate disuso di sodio (100 mM) con un volume appropriato di supporto di differenziazione completo ad una concentrazione finale di 250 m (1:400). Aggiungere il 99% di metanolo 1:400 (stesso volume di quello dell'oleate di sodio) in un'altra aliquota di supporto di differenziazione per effettuare il trattamento di controllo del veicolo. (Ad esempio: aggiungere 25 lofo di oleate di sodio a 10 mL di media e in parallelo aggiungere 25 - L del 99% di metanolo a 10 mL di mezzo). Lavare le cellule una volta con 1x PBS e aggiungere veicolo o mezzo di oleate di sodio.
  2. Giorno 23 e giorno 25. Cambiare il supporto con il volume appropriato di mezzo appena preparato come nel punto 4.1.
  3. Giorno 26. Osservare al microscopio ottico che le goccioline lipidiche si accumulano nelle cellule trattate con oleate di sodio e sono facilmente visibili come goccioline traslucide nel citoplasma come nella Figura 2A.

5. Valutazione del sovraccarico lipidico e dell'induzione della steatosi: colorazione dell'olio Rosso O

  1. Lavare le cellule una volta con 1x PBS e rimuovere completamente 1x PBS.
  2. Aggiungere il 4% di paraformaldeide (diluito in 1x PBS) e incubare per 15 min a RT.
    ATTENZIONE: La paraformaldeide è tossica, quindi questo passaggio deve essere eseguito in un cofano di fumi, con attrezzature protettive, tra cui guanti, un camice da laboratorio e una maschera.
  3. Rimuovere la paraformaldeide e lavare le cellule due volte con 1x PBS. Le cellule possono essere conservate in 1x PBS a 4 gradi centigradi per un paio di giorni prima di colorare. Avvolgere con parafilm e coprire con un foglio di alluminio per evitare che le cellule si asciughino.
  4. Rimuovere 1x PBS. Incubare le cellule con il 60% isopropanolo per 5 min a RT.
  5. Rimuovere l'isopropanolo e lasciare asciugare completamente le cellule a RT.
  6. Aggiungere la soluzione di lavoro Oil Red O e incubare a RT per 30 min. Il volume della soluzione di lavoro richiesta per ogni campione corrisponde al volume dei supporti utilizzati per la coltura delle cellule.
  7. Rimuovere la soluzione Oil Red O e aggiungere immediatamente ddH2O. Lavare le cellule 4 volte con ddH2O.
  8. Acquisire immagini al microscopio per l'analisi (Figura 2B).
  9. Per eluire il tinrio Olio Red O: togliere tutta l'acqua e lasciare asciugare; aggiungere 1 mL di isopropanolo 100% e incubare per 10 min con agitazione delicata a RT.
  10. Pipet l'isopropanol con olio eluito olio red O dye su e giù più volte, assicurando che tutto l'Olio Rosso O è nella soluzione. Trasferire la soluzione in una cuvette. Misurare oD500 nm per spettrofotometria e utilizzare 100% isopropanol come vuoto (Figura 2C).

6. Valutazione del sovraccarico dei lipidi e dell'induzione della steatosi: colorazione bodipy e analisi citofluorimetrica

  1. Lavare le cellule una volta con 1x PBS. Incubare con 100 nM di Bodipy diluito in 1x PBS al buio per 40 min a 37 gradi centigradi. Un controllo non macchiato deve essere incluso nelle misurazioni della citometria di flusso. Da questo punto, proteggere i campioni dalla luce il più possibile.
    NOT: Il volume della soluzione di colorazione necessaria per ogni campione corrisponde al volume dei supporti utilizzati per le cellule di coltura.
  2. Rimuovere la soluzione di colorazione e lavare le cellule una volta con 1x PBS. Procedere ai passaggi 6.3-6.6. per l'analisi FACS (Fluorescence-activated cell sorting) o per il passaggio 6.7 per la imaging al microscopio.
  3. Raschiare delicatamente le cellule con 1x PBS e trasferirle in un tubo da 15 mL. Centrifuga per 10 min (200 x g,4 gradi centigradi).
  4. Rimuovere delicatamente i supernatanti senza disturbare i pellet e lavare con 3 mL di 1x PBS. Centrifuga per 5 min (200 xg, 4 gradi centigradi).
  5. Rimuovere i supernatanti e risospendere in 300 gradi l di 1x PBS, quindi trasferire in un tubo FACS.
  6. Misurare immediatamente l'intensità della fluorescenza bodipy mediante analisi citofluorimetrica con lunghezze d'onda di eccitazione/emissione di 505/515 nm (Figura 3A,B).
  7. Lavare le cellule una volta con 1x PBS e rimuovere completamente PBS.
  8. Aggiungere il 4% di paraformaldeide (diluito in 1x PBS) e incubare per 15 min a RT.
    ATTENZIONE: La paraformaldeide è tossica, quindi questo passaggio deve essere eseguito in un cofano di fumi, con attrezzature protettive, tra cui guanti, un camice da laboratorio e una maschera.
  9. Rimuovere la paraformaldeide e lavare i campioni 3x per 5 min in PBS. Le celle possono essere conservate in 1x PBS a 4 gradi centigradi o immagini immediatamente (Figura 3C). Per lo stoccaggio, avvolgere con parafilm e coprire con un foglio di alluminio per evitare che le cellule si allineino.

7. Valutazione del sovraccarico di lipidi e dell'induzione della steatosi: qPCR

  1. Lavare le cellule una volta con 1x PBS. Raschiare le cellule con 1x PBS, centrifugare a 200 x g, e scartare il supernatante. A questo punto, le cellule possono essere raccolte a -80 gradi centigradi o lavorate come nel passaggio 7.2.
  2. Eseguire l'isolamento totale dell'RNA con metodi standard utilizzando reagenti commerciali seguendo le istruzioni del produttore.
  3. Valutare la concentrazione di RNA mediante misurazione spettrofotometrica UV, assicurando che la purezza dell'RNA sia elevata (vicino a 2,0) in base alla lettura A260/A280.
  4. Sintetizza cDNA da 1 g di RNA totale con un kit di sintesi cDNA standard.
  5. Diluire il cDNA fino a un volume finale di 50 gradi con H2O.
  6. Analizzare ogni campione di cDNA in triplice copia per qPCR: preparare un master mix qPCR (Tabella 1) che è sufficiente per le reazioni necessarie per ogni primer, compresi i primer specifici per i tre geni di pulizia come controlli: gliceraldeide-3-fosfato deidrogenasi (GAPDH), actinB e ribosomal 18S (vedi Tabella dei materiali per sequenze di primer):
  7. Distribuisci 18 l di master mix per pozzo in una piastra multiwall PCR.
  8. Aggiungere 2 l di campione di cDNA in ogni pozzo. Sigillare il piatto.
  9. Eseguire i campioni in base all'istruzione Thermal Cycler.

8. Valutazione del sovraccarico dei lipidi e dell'induzione della steatosi: CARS

  1. Fissare le celle precedentemente preparate su piatti dal fondo di vetro, come descritto nei passaggi 5.1-5.3.
  2. Accendere un sistema laser a impulsi picosecondi regolabile commerciale, sintonizzandolo per ottenere due uscite di diverse lunghezze d'onda. La differenza di frequenza tra le uscite deve essere 2.840 cm-1 per generare il segnale luminoso CARS intenso corrispondente allo stretching simmetrico di metilene; per un'uscita a lunghezza d'onda fissa a 1.064 nm ("luce "Stokes"), l'altra lunghezza d'onda deve essere sintonizzata su 817 nm (luce "pompa").
  3. Assicurarsi che l'output di 817 nm sia spazialmente e temporalmente sovrapposto all'output di 1.064 nm: utilizzare uno specchio dicroico appropriato (ad esempio, con un taglio compreso tra 817 e 1.064 nm) per combinare spazialmente i fasci e utilizzare una linea di ritardo ottica per ottenere la sovrapposizione temporale del laser legumi mpl secchi.
  4. Assicurarsi che i due fasci di copropagazione siano entrambi collimati e che i loro diametri abbiano valori simili appropriati per il sistema ottico all'interno del microscopio che li concentrerà sul campione; se necessario, collitri separatamente le travi prima dello specchio dicroico che li combina.
  5. Accendere un sistema commerciale di microscopio invertito, che dovrebbe includere un'unità di scansione laser a infrarossi e un'unità di rilevamento epi esepistico rosso/verde a doppio canale e allineare i raggi laser copropaganti all'unità di scansione.
  6. Apertura dell'unità di rilevamento epi a doppio canale, rimozione del cubo del filtro e sostituzione del filtro di rilevamento a lunghezza d'onda rossa con un filtro passabanda in grado di selezionare il segnale CARS da 2.840 cm centrato a 663 nm per l'escitazione di pompa/stokes 817/1,064 nm trama. È preferibile un filtro a larghezza ridotta (20 nm) per evitare la raccolta di alti livelli di segnali di sfondo fluorescenti.
  7. Posizionare un piatto sul palco del microscopio CARS invertito, e utilizzando un obiettivo di immersione ad olio 100x, spostare la posizione verticale dell'obiettivo per concentrarsi sulle cellule.
  8. Impostare il software del microscopio per raccogliere immagini ad alta risoluzione (1024 x 1024 pixel) su un campo visivo che si estende su 127 m x 127 m.
  9. Impostare il software del microscopio in modo che acquisisca e visualizzi continuamente le immagini del campo visivo 127 x 127 m e controlla le immagini visualizzate ottimizzando i parametri di raccolta delle immagini. Assicurarsi che le potenze laser siano bilanciate per la raccolta rapida delle immagini e danni minimi, inserendo filtri a densità neutra appropriati nei percorsi del fascio in base alle esigenze, e selezionare un tempo di dimora dei pixel che consenta la raccolta di immagini con un buon segnale-rumore nelle condizioni di alimentazione laser selezionate.
  10. Acquisire e salvare immagini di diversi campi di vista all'interno del piatto nelle condizioni ottimizzate. Facoltativamente, le immagini a fluorescenza multifotone, generate da un'emissione a lunghezza d'onda verde (per lo più da eccitazione di due fotoni a 817 nm), possono essere raccolte simultaneamente tramite l'altro rilevatore di epi. Ripetere i passaggi da 8,7 a 8,10 per ogni piatto.
  11. Per l'analisi delle immagini CARS, elaborare le immagini utilizzando l'implementazione FIJI di ImageJ. Azionare la funzione Despeckle (o uno strumento di denodiamento simile) su ogni immagine prima di un'ulteriore analisi per migliorare i rapporti segnale-rumore senza perdita di dettagli.
  12. Utilizzare FIJI per selezionare le celle manualmente e quindi contare automaticamente le goccioline di lipidi all'interno di singole celle segmentate per produrre statistiche sulle aree e i numeri delle goccioline lipidiche per ogni cella e per l'intero set di dati dell'immagine per ogni parabola.

9. MTT Cell Viability Assay

  1. Piastra differenziata cellule HepaRG in una piastra di 96 pozze con una densità di 1 x 105 celle/bene in un volume finale di 100 l di misura di coltura differenziazione.
  2. 24 h dopo la semina, trattare le cellule con il 99% di metanolo (veicolo) e con 100 M, 250 m e 500 M di oleate di sodio e palmitato di sodio diluite in 100 gradi di coltura differenziazione medio/bene in triplice copia.
  3. Cambiare il mezzo con il 99% di metanolo e con 100 M, 250 M e 500 M di oleate di sodio e palmitato di sodio diluito in 100 , l of differenticoltura media/pozzo ogni 24 ore.
  4. 96 h dopo il trattamento con metanolo/odio di sodio/sodio palmitate, trattare le cellule con 2 doxorubicina diluiti in 100 gradi di coltura di differenziazione medio/bene in triplice come controllo.
  5. 18 h dopo il trattamento doxorubucin, cambiare il mezzo con 100 l di mezzo di coltura differenziazione.
  6. Pipet 20 - L of 3-(4,5-di-dithiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium reagenti MTT (Table of Materials) in ogni bene della piastra di 96-well contenente le cellule in 100 - L di coltura media diversa . Includere un controllo in background con la pipa di 20 - L di reagente in un pozzo di controllo senza cellule in 100 - L di supporto di coltura differenziazione in triplice copia.
  7. Incubare la piastra a 37 gradi centigradi in un'atmosfera umidizzata del 5% di CO 2.
  8. Dopo aver incubato per 30, 60 e 90 min con reagente di tetrazolium MTT, registrare l'assorbimento a 490 nm utilizzando un lettore di lastre di 96 pozzetti. Sottrarre l'assorbimento dello sfondo dei pozze di controllo delle no-cell dai valori di assorbimento per gli altri campioni.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Questo protocollo descrive un metodo efficace per indurre e caratterizzare la steatosi vescicolare nelle cellule HepaRG differenziate DMSO mediante trattamento di oleate di sodio (Figura 1A).

Differenziazione delle cellule HepaRG.
Per indurre in modo efficiente la differenziazione, le cellule proliferanti devono essere semitate ad una bassa densità (2,5 x 104 cellule/cm2) nel mezzo di proliferazione. Quando si esegue la semina a bassa densità, le cellule si dividono e acquisiscono attivamente una morfologia indifferenziata allungata (Figura 1B). Le cellule devono essere lasciate crescere nel mezzo di proliferazione per 7 giorni, fino a raggiungere la confluenza del 100% (Figura 1C). Dopo l'esposizione al 2% di DMSO, le cellule iniziano a differenziarsi e a formare colonie tipiche simili a epatociti circondate da cellule biliari simili a epiteliali (Figura1D). Le cellule EpaRG differenziate esprimono marcatori specifici per l'epato, come Albumin, Cyp3A4 e Aldolase B. Per verificare la corretta differenziazione, i livelli di espressione di questi geni marcatori epatici nelle cellule differenziate (giorno 21) e nelle cellule proliferanti (Giorno 0) sono stati analizzati da qPCR (Figura 1E). I geni Albumin, Cyp3A4 e Aldolase B dovrebbero essere upregulated nelle cellule HepaRG differenziate rispetto alle cellule HepaRG che proliferano, e abbiamo osservato questa tendenza, confermando l'efficacia del nostro protocollo di differenziazione.

Induzione della steatosi vescicolare nelle cellule HepaRG mediante trattamento con oleati di sodio.
Il trattamento dell'oleato di sodio delle cellule dHepaRG induce l'accumulo di grasso, visibile al microscopio ottico come goccioline di lipidi nei citoplasmi (Figura 2A). Per verificare un'induzione efficiente della steatosi, le cellule HepaRG trattate con oleate e di controllo sono state macchiate con coloranti Olio Red O. Dopo la colorazione, le goccioline di lipidi sono facilmente visibili come goccioline rosse (Figura 2B) e possono essere quantificate dalla misurazione spettrofotometrica del colorante Olio Red O eluito con isopropanol (Figura 2C). L'assorbimento dell'Olio Eluito Rosso O dalle cellule è direttamente proporzionale all'accumulo di gocciolina lipidica citoplasmica.

La concentrazione e il tempo di esposizione dell'oleato di sodio sono stati determinati dal saggio di fattibilità delle cellule di colore metrico MTT (passaggio 9). Il trattamento con oleate di sodio è stato confrontato con il trattamento di palmitato di sodio e il farmaco apoptotico doxorubucina (2 M) è stato utilizzato come controllo (Figura 2D). La tossicità dei composti è stata valutata da MTT, sfruttando un composto commerciale (Tabella dei materiali), che contiene il tetrazolio MTT. Il composto tetrazolium giallo solubile in acqua è bioridotto dalle cellule metabolicamente attive in un prodotto formazan viola insolubile in acqua. Il prodotto formazan è quantificato dalla sua assorbimento a 490 nm e l'importo è direttamente proporzionale al numero di cellule viventi in coltura (Figura 2D).

Quantificazione della steatosi vescicolare nelle cellule HepaRG trattate con oleati di sodio
Per quantificare l'aumento del contenuto di lipidi cellulari dopo il trattamento con oleate di sodio, abbiamo eseguito la colorazione con il colorante Bodipy, una sonda che etichetta le goccioline lipidiche. Utilizzando l'analisi citofluorimetrica, è possibile quantificare il contenuto di trigliceridi con l'intensità fluorescente media bodipia, che è più alta nelle cellule trattate con oleati rispetto alle cellule di controllo (Figura 3A,B), indicando un grasso efficiente accumulo dopo il trattamento con oleate. Infatti, le immagini delle cellule color bodipia mostrano goccioline di lipidifluidi fluorescenti verde brillante in cellule trattate con oleati che non sono visibili nelle cellule di controllo (Figura 3C).

Il trattamento dell'oleate di sodio delle cellule dHepaRG deregola il metabolismo dei lipidi e l'espressione genica infiammatoria. Per valutare l'induzione efficiente della steatosi vescicolare, abbiamo analizzato da qPCR i livelli di espressione dei geni selezionati nelle cellule trattate con oleati di sodio rispetto a quelli delle cellule di controllo (Figura 4). Autoboxylase acetil-CoA beta (ACACB), glicerol-3-fosfato acyltransferase mitocondriali (GPAM), perilipine (PLIN2, PLIN4), apolipoproteina B (APOB), piravate dehydrogenase degenasi isozime isozime 4 (PDK4), carnitina palmitoyltransferase 1A (CPT1A) l'interleucina 6 (IL6) sono state regolate in cellule dHepaRG trattate con oleate, mentre la famiglia di vettori solute 2 membri 1 (SLC2A1), l'apolipoproteina C-III (APOC3) e la desaturasi stearoyl-CoA (SCD) sono state regolamentate (Figura 4). Per caratterizzare e quantificare ulteriormente l'immagazzinamento dei lipidi nelle goccioline dopo l'aggiunta di oleate di sodio a cellule HepaRG differenziate, abbiamo utilizzato un'innovativa tecnica di microscopia, una coerente microscopia anti-Stokes Raman scattering (CARS), che visualizzazione e quantificazione delle goccioline di lipidi senza etichettatura (Figura 5A). Le goccioline di lipidi sono state statisticamente quantificate in termini di numeri, distribuzione e morfologia a livello di singola cellula utilizzando immagini CARS. Il trattamento con oleato di sodio (250 m) ha indotto un aumento significativo del numero di goccioline di lipidi (Figura 5B), che ha portato a una maggiore superficie totale di goccioline per cellula (Figura 5C) e a una maggiore percentuale di goccioline per cellula ( Figura 5D), rispetto alle cellule di controllo, indicando che le cellule dHepaRG accumulavano in modo efficiente grasso dopo il trattamento con oleato di sodio.

Figure 1
Figura 1 : differenziazione delle cellule HepaRG. (A) Diagramma rappresentativo che mostra il protocollo di differenziazione/trattamento delle cellule HepaRG, come descritto nei passaggi 3 e 4. (B-D) Immagini che mostrano celle HepaRG non colorate al giorno 0 dopo la semina (B), al giorno 7 della confluenza dopo il semina (C) e AHepaRG differenziate (dHepaRG) al Giorno 21 dopo la semina (D). (E) L'RNA totale è stato estratto dalle cellule proliferanti e dHepaRG, il cDNA è stato sintetizzato e analizzato da qPCR utilizzando primer specifici per i geni indicati (Tabella dei materiali). I campioni sono stati normalizzati secondo i geni gapDH, actinB e ribosomal 18S di pulizia. Gli istogrammi mostrano l'induzione di piegatura della proliferazione (Giorno 0) rispetto alle cellule differenziate (Giorno 21) (le barre indicano S.D.; i valori p sono stati calcolati dai test t di Student). Fare clic qui per visualizzare una versione più grande di questa figura.

Figure 2
Figura 2 : Trattamento dell'oleate di sodio delle cellule dHepaRG indotta dall'accumulo di gocciolinie lipidi. (A) Immagini di cellule HepaRG (dHepaRG) incontaminate trattate per 5 giorni con veicolo (controllo) (immagine a sinistra) o con 250 M di oleato di sodio (immagine a destra). (B) Dopo il trattamento, le cellule sono state macchiate con colorante O Rosso Olio; le goccioline lipidiche sono visibili in rosso. (C) Il tintura a olio Red O è stato eluito e la OD è stata misurata a 570 nm. I risultati sono espressi come mezzi di tre esperimenti indipendenti (le barre indicano S.D.; valore p dal test t di Student). (D) Valutazione della vitalità cellulare del veicolo a cellule dHepaRG (99% metanolo) trattato (Ctrl) o trattato per 5 giorni con oleate di sodio e sodio (100 m, 250M, o 500 M), o trattato per 5or con doxorubucina (2 M).  La valutazione della citotossicità è stata effettuata utilizzando un kit di analisi MTT (Tabella deimateriali), registrando l'assorbimento a 490 nm, secondo le istruzioni del produttore. I risultati sono espressi come mezzi di tre esperimenti indipendenti (le barre indicano che i valori S.D.; p sono stati determinati utilizzando il test t di Student: 0,01 USD - p < 0,05; Fare clic qui per visualizzare una versione più grande di questa figura.

Figure 3
Figura 3 : Quantificazione dell'accumulo di grasso dopo il trattamento dell'oleate di sodio mediante colorazione Bodipy. Le cellule EpaRG (dHepaRG) differenziate sono state trattate con veicolo (controllo) o con oleate di sodio per 5 giorni. Dopo il trattamento, le cellule dHepaRG sono state macchiate con colorante Bodipy e analizzate dalla citometria di flusso. (A) Profili di sovrapposizione rappresentativi (% del massimo: percentuale dell'intensità massima di colorazione). (B) Gli istogrammi mostrano l'intensità media della fluorescenza (MFI) come percentuale di cellule trattate rispetto al controllo di tre esperimenti indipendenti (le barre indicano che i valori di S.D. sono stati determinati utilizzando il test t di Student: 0,01 USD , p < 0,05 USD , < 0.001). (C) Le cellule sono state fissate con il 4% di paraformaldeide. Le immagini mostrano le goccioline di lipidi bodipy in verde. Fare clic qui per visualizzare una versione più grande di questa figura.

Figure 4
Figura 4 : Il trattamento dell'oleate di sodio delle cellule dHepaRG induce la deregolazione del metabolismo dei lipidi e l'espressione genica infiammatoria. Le cellule EpaRG (dHepaRG) differenziate sono state trattate con veicolo (controllo) o con oleate di sodio per 5 giorni. I cDNA sono stati analizzati da qPCR con primer specifici per i geni indicati e i risultati sono stati normalizzati a media dei geni di pulizia GAPDH, actinB e ribosomal 18S; i primer sono indicati nella Tabella dei Materiali. L'istogramma mostra i livelli di espressione dei geni indicati come induzioni di piegatura delle cellule trattate rispetto al controllo (le barre indicano S.D.; i valori p sono stati calcolati dal test t di Student). Fare clic qui per visualizzare una versione più grande di questa figura.

Figure 5
Figura 5 : caratterizzazione dell'accumulo di goccioline lipidi dopo il trattamento dell'oleate di sodio mediante microscopia CARS. Le cellule EpaRG (dHepaRG) sono state trattate con veicolo (controllo) o con 250 oleate di sodio per 5 giorni e sono state analizzate mediante microscopia CARS. (A) Immagini rappresentative che mostrano in rosso gocciolinare di lipidi CARS. (B) Istogramma che mostra il numero di goccioline di lipidi per cellula. (C) Istogrammi che mostrano l'area totale dell'immagine coperta da goccioline per cella. (D) Istogramma che mostra l'area % delle goccioline coperte da goccioline per cella. Tutti i risultati sono espressi come mezzi di tre esperimenti indipendenti (le barre indicano che i valori S.E.; p sono stati determinati dal test t di Student: 0,01 x p < 0,05; Fare clic qui per visualizzare una versione più grande di questa figura.

Reagenti Volume per una singola reazione
2x coloranti fluorescente verde 10 del sistema
PCR grado H2O 6 È possibile:
Primer in avanti (M) 1 : il nome del
Primer inverso (M) 1 : il nome del

Tabella 1: master mix qPCR.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Questo protocollo descrive come differenziare le cellule HepaRG e come indurre la steatosi vescicolare mediante trattamento con oleate di sodio (Figura 1A). Infatti, rispetto ad altre linee cellulari umane del carcinoma epatocellulare (HCC), la linea cellulare HepaRG presenta caratteristiche di epatociti umani adulti, che rappresentano una valida alternativa agli epaticiti umani primari coltivati espansioni13,14 ,15. La linea cellulare HepaRG è stata ampiamente utilizzata per studi di citotossicità epatica, metabolismo dei farmaci, e studi di virologia15,16,22.

Rispetto alle cellule HepaRG, altre linee cellulari HCC come HepG2, HUH7, HUH6 e Hep3B mostrano capacità metaboliche inferiori, prive di una serie sostanziale di funzioni specifiche per il fegato23,24e che presentano un livello basale più elevato di accumulo di grasso citosolico immagazzinato in goccioline di lipidi. Pertanto, queste linee cellulari HCC sono meno utili come modelli per l'induzione della steatosi vescicolare dopo il sovraccarico lipidico rispetto alla linea cellulare HepaRG.

Passaggi critici all'interno del protocollo
Quando si esegue la semina a bassa densità (2,5 x 104 cellule/cm2),le cellule HepaRG acquisiscono una morfologia indifferenziata allungata, si divide attivamente; dopo aver raggiunto il 100% di confluenza, sono in grado di differenziare l'esposizione al 2% di DMSO e formano colonie tipiche simili a epatociti circondate da cellule biliari simili a epiteliali (Figura 1D). Questa coltura mista biliare / epatocite cellule riassume caratteristiche del tessuto epatico, simile a una condizione fisiologica, nonostante la mancanza di altri tipi di cellule epatiche (sinusoidalo o Kupffer).

Un passo critico nel processo di differenziazione è la confluenza delle cellule. Le cellule devono essere semiate a bassa densità (2,5 x 104 celle/cm2) (Figura 1B) e lasciate crescere attivamente nel mezzo di proliferazione per almeno 1 settimana (Giorno 0-7). Al giorno 7, prima di aggiungere 2% DMSO per avviare il processo di differenziazione, le cellule devono essere al 100% confluenza (Figura 1C). Se al giorno 7 (passaggio 2.2) non è stata raggiunta la confluenza completa, si raccomanda vivamente che le cellule possano continuare a crescere nel mezzo di proliferazione per alcuni giorni aggiuntivi, fino a raggiungere il 100% di confluenza.

Limitazioni del protocollo
È stato osservato che dopo l'aggiunta di mezzo di differenziazione, alcune cellule soffrono, e in genere 10% delle cellule muoiono durante i successivi 2-3 giorni. In questa fase, il lavaggio quotidiano e il cambio medio (passaggio 2.4) devono continuare a scartare le cellule morte galleggianti. L'uso di uno specifico FBS (Tabella dei materiali) per integrare sia i mezzi di differenziazione e proliferazione, dovrebbe aumentare l'efficienza di differenziazione e ridurre la morte cellulare durante i giorni 7-21 (passaggio 2.4). Si raccomanda vivamente di mantenere le cellule fino al passaggio 20 e di scegliere passaggi inferiori (<20) per differenziare le cellule: meno morte delle cellule si verifica per le cellule HepaRG più giovani. Inoltre, la differenziazione EpaRG sembra essere più efficace nei piatti da 35 mm e 60 mm, mentre le cellule tendono a soffrire di più quando semino nei piatti da 100 mm e 150 mm.

Modifiche e risoluzione dei problemi
È stato dimostrato che l'esposizione a diversi rapporti di acidi grassi palmitici e oleici si traduca nella formazione di goccioline lipidiche intracitoplasmatiche25,26. Tuttavia, abbiamo osservato che il trattamento dell'oleate di sodio di cellule HepaRG differenziate mostrava risultati migliori rispetto all'esposizione agli acidi palmitici, in termini di induzione efficiente dell'accumulo di lipidi e della vitalità cellulare (Figura 2D). Infatti, il trattamento con acido palmittico si è dimostrato tossico per le cellule HepaRG differenziate (Figura2D),in accordo con i dati della letteratura sulle linee cellulari dell'epatoma e sulle colture primarie umane e ratticheti che descrivono l'acido palmittico come un agente notevolmente citotossico25,26,27,28,29. Inoltre, l'utilizzo di palmitate nei saggi basati sulle cellule è impegnativo a causa della sua bassa solubilità. Tuttavia, a causa della variabilità intrinseca delle linee cellulari, si raccomanda di verificare la concentrazione di lavoro di sodio oleate e la durata del tempo di trattamento, testando diverse concentrazioni in un esperimento di decorso temporale con un saggio di fattibilità cellulare.

Significato e confronto delle tecniche di rilevamento dei lipidi
La determinazione accurata delle quantità di lipidi nelle cellule è stata stabilita attraverso una serie di approcci diversi in questo studio. È stato osservato un accordo qualitativo e anche quantitativo approssimativo tra i risultati ottenuti tramite la colorazione OI Rosso olio, la colorazione Bodipy e l'imaging CARS. Per una rapida stima delle quantità di lipidi nelle popolazioni di cellule, l'uso di citometria del flusso di bodipy o una macchia come OO Rosso Olio è l'ideale. Per un esame più dettagliato del contenuto di gocciolina lipidica delle cellule, è preferibile una modalità di imaging. Inoltre, sono stati segnalati problemi di specificità per le macchie di lipidi come Olsto Rosso20,30, e abbiamo osservato che in alcuni casi, la macchia di Bodipy ha una capacità inferiore rispetto a CARS per etichettare esclusivamente goccioline di lipidi tra le altre cellule organelli (dati non visualizzati). Pertanto, l'uso di una tecnica di imaging microscopico priva di etichette come CARS offre vantaggi significativi per la quantificazione e la caratterizzazione della steatosi. L'evitare l'uso di una grande etichetta fluorescente rende l'imaging CARS favorevole a causa delle piccole dimensioni delle molecole lipidiche rispetto ai fluorofori tipici; quindi, per la rilevazione dei lipidi, sono auspicabili metodi privi di etichette, ancor più che per osservare grandi molecole proteiche. Il segnale CARS lipidico è un'emissione ottica che viene generata solo quando si verifica un'interazione non lineare nel campione. Questa interazione può essere rilevata solo quando la differenza tra le frequenze dei due laser dieccitazione focalizzati sul campione corrisponde al metilene (CH 2) che allunga la frequenza vibrazionale. L'abbondanza di gruppi di metilene nei lipidi si traduce in segnali molto intensi con alti rapporti segnale-rumore, e la non linearità dell'interazione ottica significa anche che un'alta risoluzione spaziale è possibile nella microscopia CARS. L'eccellente qualità delle immagini CARS in generale permette la raccolta di statistiche sulle dimensioni e il numero di goccioline lipidiche, come dimostrato in questo studio. Inoltre, altri studi hanno dimostrato l'uso della microscopia CARS per correlare diverse localizzazioni subcellulari e dimensioni delle goccioline di lipidi con diversi trattamenti18, e utilizzando misurazioni CARS supplementari a diverse lunghezze d'onda, o un approccio RAMan stimolato a banda larga o un simile approccio Raman stimolato, i ricercatori hanno dimostrato che è possibile caratterizzare diversi tipi di acidi grassi all'interno di goccioline lipidiche31,32. Inoltre, la rapidità della raccolta di immagini CARS ha permesso all'imaging in loco delle cellule vive di esaminare l'evoluzione temporale della crescita e dell'aggregazione delle goccioline lipidi che hannopermesso 33.

Applicazioni future
Negli ultimi decenni, le opinioni sui ruoli e le funzioni delle goccioline di lipidi nella biologia cellulare si sono evolute. Precedentemente ritenuti fondamentalmente inerte vesciche di stoccaggio, ora sono intesi come organelli cellulari altamente dinamici, e il loro ruolo nella malattia è sempre più riconosciuto34,35,36. Anche se nel caso della malattia epatica, l'accumulo di lipidi (steatosi) è noto da tempo per essere un aspetto critico, il meccanismo preciso del coinvolgimento delle goccioline lipidiche nella progressione della malattia non è completamente chiaro. Pertanto, metodi come CARS che possono caratterizzare il comportamento dinamico delle goccioline lipidiche sono di fondamentale importanza per lo sviluppo di una comprensione molecolare di malattie tra cui NAFLD. L'analisi metabolica dell'espressione genica da parte di qPCR è altamente complementare all'imaging molecolare dei lipidi tramite CARS, come dimostrato negli studi precedenti17,18, consentendo approfondimenti più approfonditi sui meccanismi della malattia. Nel presente studio, osserviamo l'accumulo di acidi grassi con deregolazione del metabolismo dei lipidi e dell'espressione genica infiammatoria, che può contribuire alla costruzione di un pannello di biomarcatori per la diagnosi precoce della malattia.

Il modello basato sulle cellule dHepaRG trattato con oleato di sodio può aumentare la conoscenza dei meccanismi molecolari coinvolti non solo nell'insorgenza, ma anche nella progressione del NAFLD, fornendo una base per lo sviluppo di migliori approcci terapeutici alla malattia.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Gli autori dichiarano di non avere interessi finanziari concorrenti.

Acknowledgments

Ringraziamo il prof. Siamo grati a Rita Appodia per l'assistenza amministrativa. Questo lavoro è stato sostenuto da MIUR- Profession del' dell'università e della ricerca (FIRB 2011–2016 RBAP10XKNC) e Sapienza University of Rome (prot. C26A13T8PS; Prot. C26A142MCH; Prot. C26A15LSXL).

Materials

Name Company Catalog Number Comments
Hyclone HyClone Fetal Clone II  GE Healthcare SH30066
William’s E medium with GlutaMAX  Thermofisher 32551087
Penicillin/streptomycin  SIGMA P4333
Insulin  SIGMA I9278
Hydrocortisone hemisuccinate SIGMA H2270
DMSO, dimethyl sulfoxide SIGMA D2438   
Sodium Oleate SIGMA O7501 
Methanol SIGMA 179337
Isopropanol SIGMA 278475
BODIPY 505/515 Thermofisher D3921
PBS Thermofisher 14190-250
Formaldehyde solution SIGMA 252549
RNAse free DNAseI Promega M198A 
Glass-bottomed dishes Willco Wells GWST-5040
Oil Red solution SIGMA O625
CellTiter 96 AQueous One Solution Promega  G3582
q-PCR oligo name Sequence
ACACB FOR CAAGCCGATCACCAAGAGTAAA
ACACB REV CCCTGAGTTATCAGAGGCTGG
β-actin FOR GCACTCTTCCAGCCTTCCT
β-actin REV AGGTCTTTGCGGATGTCCAC
ALBUMIN FOR TGCTTGAATGTGCTGATGACAGG
ALBUMIN REV AAGGCAAGTCAGCAGGCATCTCATC
ALDOB FOR GCATCTGTCAGCAGAATGGA 
ALDOB REV TAGACAGCAGCCAGGACCTT
APOB FOR CCTCCGTTTTGGTGGTAGAG
APOB REV  CCTAAAAGCTGGGAAGCTGA
APOC3 FOR CTCAGCTTCATGCAGGGTTA
APOC3 REV GGTGCTCCAGTAGTCTTTCAG
CPT1A FOR TCATCAAGAAATGTCGCACG
CPT1A REV GCCTCGTATGTGAGGCAAAA
CYP2E1 FOR TTGAAGCCTCTCGTTGACCC
CYP2E1 REV CGTGGTGGGATACAGCCAA
CYP3A4 FOR CTTCATCCAATGGACTGCATAAAT
CYP3A4 REV TCCCAAGTATAACACTCTACACAGACAA
GAPDH FOR TGACAACTTTGGTATCGTGGAAGG
GAPDH REV AGGGATGATGTTCTGGAGAGCC
GPAM FOR TCTTTGGGTTTGCGGAATGTT
GPAM REV ATGCACATCTCGCTCTTGAATAA
IL6 FOR CCTGAACCTTCCAAAGATGGC
IL6 REV ACCTCAAACTCCAAAAGACCAGTG
PDK4 FOR ACAGACAGGAAACCCAAGCCAC
PDK4 REV TGGAGGTGAGAAGGAACATACACG
PLIN2 FOR TTGCAGTTGCCAATACCTATGC
PLIN2 REV CCAGTCACAGTAGTCGTCACA
PLIN4 FOR AATGAGTTGGAGGGGCTGGGGGACATC
PLIN4 REV GGTCACCTAAACGAACGAAGTAGC
SCD FOR TCTAGCTCCTATACCACCACCA
SCD REV TCGTCTCCAACTTATCTCCTCC
SLC2A1 FOR TGCTCATCAACCGCAACGAG
SLC2A1 REV CCGACTCTCTTCCTTCATCTCCTG
18S FOR CGCCGCTAGAGGTGAAATTC
18S REV TTGGCAAATGCTTTCGCTC

DOWNLOAD MATERIALS LIST

References

  1. Starley, B. Q., Calcagno, C. J., Harrison, S. A. Nonalcoholic fatty liver disease and hepatocellular carcinoma: a weighty connection. Hepatology. 51, (5), 1820-1832 (2010).
  2. Byrne, C. D., Targher, G. NAFLD: a multisystem disease. Journal of Hepatology. 62, (1), Suppl 47-64 (2015).
  3. Marra, F., Gastaldelli, A., Svegliati Baroni, G., Tell, G., Tiribelli, C. Molecular basis and mechanisms of progression of non- alcoholic steatohepatitis. Trends in Molecular Medicine. 14, 72-81 (2008).
  4. Chalasani, N., et al. The diagnosis and management of nonalcoholic fatty liver disease: Practice guidance from the American Association for the Study of Liver Diseases. Hepatology. 67, (1), 328-357 (2018).
  5. Banini, B. A., Sanyal, A. J. Current and future pharmacologic treatment of nonalcoholic steatohepatitis. Current Opinion in Gastroenterology. 33, (3), 134-141 (2017).
  6. Takahashi, Y., Sugimoto, K., Inui, H., Fukusato, T. Current pharmacological therapies for nonalcoholic fatty liver disease/nonalcoholic steatohepatitis. World Journal of Gastroenterology. 21, (13), 3777-3785 (2015).
  7. Younossi, Z., et al. Global burden of NAFLD and NASH: trends, predictions, risk factors and prevention. Nature Reviews Gastroenterology & Hepatology. 15, (1), 11-20 (2018).
  8. Santhekadur, P. K., Kumar, D. P., Sanyal, A. J. Preclinical models of non-alcoholic fatty liver disease. Journal of Hepatology. 68, (2), 230-237 (2018).
  9. Nagarajan, P., Mahesh Kumar, M. J., Venkatesan, R., Majundar, S. S., Juyal, R. C. Genetically modified mouse models for the study of nonalcoholic fatty liver disease. World Journal of. Gastroenterology. 18, (11), 1141-1153 (2012).
  10. Oseini, A. M., Cole, B. K., Issa, D., Feaver, R. E., Sanyal, A. J. Translating scientific discovery: the need for preclinical models of nonalcoholic steatohepatitis. Hepatology International. 12, (1), 6-16 (2018).
  11. Ramboer, E., Vanhaecke, T., Rogiers, V., Vinken, M. Immortalized human hepatic cell lines for in vitro testing and research purposes. Methods in Molecular Biology. 1250, 53-76 (2015).
  12. Gómez-Lechón, M. J., Donato, M. T., Castell, J. V., Jover, R. Human hepatocytes in primary culture: the choice to investigate drug metabolism in man. Current Drug Metabolism. 5, (5), 443-462 (2004).
  13. Marion, M. J., Hantz, O., Durantel, D. The HepaRG cell line: biological properties and relevance as a tool for cell biology, drug metabolism, and virology studies. Methods in Molecular Biology. 640, 261-272 (2010).
  14. Gripon, P., et al. Infection of a human hepatoma cell line by hepatitis B virus. Proceedings of the National Academy of Sciences. 99, (24), 15655-15660 (2002).
  15. Anthérieu, S., Rogue, A., Fromenty, B., Guillouzo, A., Robin, M. A. Induction of vesicular steatosis by amiodarone and tetracycline is associated with up-regulation of lipogenic genes in HepaRG cells. Hepatology. 53, (6), 1895-1905 (2011).
  16. Rouge, A., et al. PPAR agonists reduce steatosis in oleic acid-overloaded HepaRG cells. Toxicology and Applied Pharmacology. 276, (1), 73-81 (2014).
  17. Belloni, L., et al. Targeting a phospho-STAT3-miRNAs pathway improves vesicular hepatic steatosis in an in vitro and in vivo model. Scientific Reports. 8, 13638 (2018).
  18. Nunn, A. D. G., et al. The histone deacetylase inhibiting drug Entinostat induces lipid accumulation in differentiated HepaRG cells. Scientific Reports. 6, 28025 (2016).
  19. Donato, M. T., et al. Cytometric analysis for drug-induced steatosis in HepG2 cells. Chemico-Biological Interactions. 181, (3), 417-423 (2009).
  20. Hellerer, T., Axäng, C., Brackmann, C., Hillertz, P., Pilon, M., Enejder, A. Monitoring of lipid storage in Caenorhabditis elegans using coherent anti-Stokes Raman scattering (CARS) microscopy. Proceedings of the National Academy of Sciences. 104, (37), 14658-14663 (2007).
  21. Le, T. T., Ziemba, A., Urasaki, Y., Brotman, S., Pizzorno, G. Label-free evaluation of hepatic microvesicular steatosis with multimodal coherent anti-Stokes Raman scattering microscopy. PLoS One. 7, (11), 51092 (2012).
  22. Guillouzo, A., Corlu, A., Aninat, C., Glaise, D., Morel, F., Guguen-Guillouzo, C. The human hepatoma HepaRG cells: a highly differentiated model for studies of liver metabolism and toxicity of xenobiotics. Chemico-Biological Interactions. 168, (1), 66-73 (2007).
  23. Nelson, L. J., et al. Human hepatic HepaRG cells maintain an organotypic phenotype with high intrinsic CYP450 Activity/metabolism and significantly outperform standard HepG2/C3A cells for pharmaceutical and therapeutic applications. Basic & Clinical Pharmacology & Toxicology. 120, (1), 30-37 (2017).
  24. Gerets, H. H. J., Tilmant, K., Gerin, B., Chanteux, H., Depelchin, B. O., Dhalluin, S., Atienzar, F. A. Characterization of primary human hepatocytes, HepG2 cells, and HepaRG cells at the mRNA level and CYP activity in response to inducers and their predictivity for the detection of human hepatotoxins. Cell Biology and Toxicology. 28, (2), 69-87 (2012).
  25. Pusl, T., et al. Free fatty acids sensitize hepatocytes to bile acid-induced apoptosis. Biochemical and Biophysical Research Communications. 371, (3), 441-445 (2008).
  26. Gentile, C. L., Pagliassotti, M. J. The role of fatty acids in the development and progression of nonalcoholic fatty liver disease. The Journal of Nutritional Biochemistry. 19, (9), 567-576 (2008).
  27. Mei, S., et al. Differential roles of unsaturated and saturated fatty acids on autophagy and apoptosis in hepatocytes. Journal of Pharmacological Experimental Therapy. 339, 487-498 (2011).
  28. Malhi, H., Bronk, S. F., Werneburg, N. W., Gores, G. J. Free fatty acids induce JNK-dependent hepatocyte lipoapoptosis. Journal of Biological Chemistry. 281, 12093-12101 (2006).
  29. Moravcová, A., Červinková, Z., Kučera, O., Mezera, V., Rychtrmoc, D., Lotková, H. The effect of oleic and palmitic acid on induction of steatosis and cytotoxicity on rat hepatocytes in primary culture. Physiological Research. 64, Suppl 5 627-636 (2015).
  30. Ohsaki, Y., Shinohara, Y., Suzuki, M., Fujimoto, T. A pitfall in using BODIPY dyes to label lipid droplets for fluorescence microscopy. Histochemistry and Cell Biology. 133, (4), 477-480 (2010).
  31. Rinia, H. A., Burger, K. N., Bonn, M., Müller, M. Quantitative label-free imaging of lipid composition and packing of individual cellular lipid droplets using multiplex CARS microscopy. Biophysical Journal. 95, (10), 4908-4914 (2008).
  32. Waschatko, G., Billecke, N., Schwendy, S., Jaurich, H., Bonn, M., Vilgis, T. A., Parekh, S. H. Label-free in situ imaging of oil body dynamics and chemistry in germination. Journal of The Royal Society Interface. 13, (123), (2016).
  33. Jüngst, C., Winterhalder, M. J., Zumbusch, A. Fast and long term lipid droplet tracking with CARS microscopy. Journal of Biophotonics. 4, (6), 435-441 (2011).
  34. Welte, M. A., Gould, A. P. Lipid droplet functions beyond energy storage. Biochimica et Biophysica Acta - Molecular and Cell Biology of Lipids. 1862, (10), Pt B 1260-1272 (2017).
  35. Cohen, S. Lipid droplets as organelles. International Review of Cell and Molecular Biology. 337, 83-110 (2018).
  36. Farese, R. V., Walther, T. C. Lipid droplets finally get a little R-E-S-P-E-C-T. Cell. 139, (5), 855-860 (2009).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics