Induzieren und Charakterisieren der vesikulären Steatose in differenzierten HepaRG-Zellen

Medicine

Your institution must subscribe to JoVE's Medicine section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

In dieser Studie beschreiben wir ein detailliertes Protokoll zur Induktion von Lebervesikulärsteatose in differenzierten HepaRG-Zellen mit dem Fettsäuresalz Natriumoleat und verwenden Methoden zum Nachweis und zur Quantifizierung der Lipidakkumulation, einschließlich kohärenter Anti-Stokes Raman-Streuung (CARS) Mikroskopie, zytofluorimetrische Analyse, Ölrot O-Färbung und qPCR.

Cite this Article

Copy Citation | Download Citations

Di Cocco, S., Belloni, L., Nunn, A. D., Salerno, D., Piconese, S., Levrero, M., Pediconi, N. Inducing and Characterizing Vesicular Steatosis in Differentiated HepaRG Cells. J. Vis. Exp. (149), e59843, doi:10.3791/59843 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Hepatische Steatose stellt eine metabolische Dysfunktion dar, die aus einer Anhäufung von Triglycerid-haltigen Lipidtröpfchen in Hepatozyten resultiert. Übermäßige Fettansammlung führt zu einer nicht-alkoholischen Fettlebererkrankung (NAFLD), die potenziell reversibel ist und sich zu alkoholfreier Steatohepatitis (NASH) und schließlich zu Zirrhose und hepatozellulärem Karzinom (HCC) entwickeln kann. Die molekularen Mechanismen, die die Fettakkumulation in Hepatozyten mit dem Fortschreiten zu NASH, irreversibleleber Leberschäden, Fibrose, Zirrhose und sogar HCC verbinden, sind noch unklar. Zu diesem Zweck wurden mehrere In-vitro- und In-vivo-Modelle entwickelt, um die pathologischen Prozesse aufzuklären, die NAFLD verursachen. In der vorliegenden Studie beschreiben wir ein zelluläres Modell für die Induktion der vesikulären Steatose der Leber, das aus DMSO-differenzierten menschlichen Hepatic-HepaRG-Zellen besteht, die mit dem Fettsäuresalz Natriumoleat behandelt werden. Tatsächlich akkumulieren Natriumoleat-behandelte HepaRG-Zellen Lipidtröpfchen im Zytoplasma und zeigen typische Merkmale der Steatose. Dieses in vitro humane Modell stellt eine wertvolle Alternative zu in vivo-Mäusemodellen sowie zu den primären menschlichen Hepatozyten dar. Wir präsentieren auch einen Vergleich mehrerer Methoden zur Quantifizierung und Bewertung der Fettansammlung in HepaRG-Zellen, einschließlich Oil Red O Färbung, zytofluorimetrische Rbodipy-Messung, metabolische Genexpressionsanalyse durch qPCR und kohärente Anti-Stokes Raman-Streumikroskopie (CARS). CARS Imaging kombiniert die chemische Spezifität der Raman-Spektroskopie, einer in materialwissenschaftlichen Anwendungen bekannten chemischen Analysetechnik, mit den Vorteilen von hochschnellen, hochauflösenden nichtlinearen optischen Mikrokopien, um präzise Quantifizierung der Lipidakkumulation und Lipidtröpfchendynamik. Die Erstellung eines effizienten In-vitro-Modells für die Induktion der vesikulären Steatose, zusammen mit einer genauen Methode zur Quantifizierung und Charakterisierung der Lipidakkumulation, könnte zur Entwicklung einer Frühstadiumdiagnose von NAFLD über die Identifizierung molekularer Marker und die Generierung neuer Behandlungsstrategien.

Introduction

Lebersteatose ist definiert als intrahepatische Fettansammlung, innerhalb triglyceridhaltiger Lipidtröpfchen, von mindestens 5% des Lebergewichts. Längere Leberlipidspeicherung ist ein potenziell reversibler Prozess, jedoch kann es zu Leberstoffwechselfunktionsstörungen, Entzündungen und fortgeschritteneformen Formen der nichtalkoholischen Fettleber (NAFLD), die vorherrschende Ursache der chronischen Lebererkrankung in vielen Teilen der die Welt1,2. NAFLD ist eine multifaktorielle Erkrankung, die sich zu der aggressiveren alkoholfreien Steatohepatitis (NASH) entwickeln kann, die wiederum zu Zirrhose und in einem kleinen Prozentsatz der Patienten zu einem hepatozellulären Karzinom (HCC)1,3weiterführen kann. Derzeit gibt es keine zugelassene Therapie als spezifische Behandlung für NAFLD und die Kombination von Ernährungs- und Lebensstiländerungen bleibt die Säule des NAFLD- und NASH-Managements4,5,6.

Die molekularen Mechanismen, die zur Entwicklung der Lebersteatose bei der Pathogenese von NAFLD führen, müssen noch aufgeklärt werden7. In diesem Zusammenhang wurden Mausmodelle entwickelt, um das Fortschreiten der humanen Steatose-Krankheit zu untersuchen. Es gibt eine Vielzahl unterschiedlicher Modelle, und jedes hat seine Vor- und Nachteile, einschließlich genetischer, ernährungsphysiologischer und chemisch induzierter Modelle, die verschiedene Ansätze kombinieren. Genetisch veränderte (transgene oder Knockout) Mäuse entwickeln spontan Lebererkrankungen. Es sollte jedoch beachtet werden, dass diese Mutationen beim Menschen sehr selten sind und die Deletion oder Überexpression eines einzelnen Gens (z. B. ob/ob mouse) die Ätiologie der multifaktoriellen menschlichen Krankheit auf molekularer Ebene8,9nicht imitieren darf. Ebenso kann die Krankheit, die von Mäusen nach diätetische oder pharmakologische Manipulation erworben wird, nicht die Auswirkungen der menschlichen Ernährung imitieren, die mit der Entwicklung von NAFLD beim Menschen8verbunden ist. Tiermodelle haben jedoch Entwicklungen im Verständnis von NAFLD erleichtert, und dieser Ansatz ist derzeit die am häufigsten verwendete Strategie in der Laborforschung. Dennoch ist die Replikation der in Tiermodellen erzielten Ergebnisse beim Menschen wiederholt fehlgeschlagen, was zu einer schlechten Übersetzung in die Klinik10geführt hat.

Daher können In-vitro-Modelle von NAFLD eine grundlegende Rolle bei der Aufklärung der molekularen Mechanismen der NAFLD-Progression spielen, und sie stellen ein wertvolles Werkzeug dar, um eine große Anzahl von Verbindungen zu untersuchen. Primäre Zellkulturen, verewigte Zelllinien und Leberbiopsien wurden ausgiebig für Forschungszwecke verwendet11. Primäre menschliche Hepatozyten ähneln den klinischen Erkrankungen des Menschen, aber es gibt eine begrenzte Anzahl von Spendern, und primäre Zellkulturen zeigen aufgrund der Variabilität der Zellen eine schlechte Reproduzierbarkeit. Diese Beobachtungen, zusammen mit ethischen und logistischen Fragen, haben dazu geführt, dass die Verwendung von menschlichen primären Hepatozyten begrenzt wurde12. So stellen Leberzelllinien eine bequeme Alternative dar, die mehrere wesentliche Vorteile gegenüber der Primärkultur hat, da Leberzelllinien stetig wachsen, eine nahezu unbegrenzte Lebensdauer haben und einen stabilen Phänotyp haben. Darüber hinaus sind Zelllinien leicht zugänglich und die Kulturbedingungen von Leberzelllinien sind einfacher als die von primären Hepatozyten und sind zwischen verschiedenen Laboratorien standardisiert.

Hier beschreiben wir detailliert ein in vitro zellbasiertes Modell der vesikulären Lebersteatose, dargestellt durch hepatische differenzierte HepaRG-Zellen, die mit dem Fettsäure-Natriumoleat behandelt werden. Die HepaRG-Zelllinie wurde von einer weiblichen Patientin, die von einer Hepatitis-C-Infektion betroffen ist, und einem Edmondson-Grad-I-Gut differenzierten Lebertumor14festgestellt. Die HepaRG-Zelllinie ist eine menschliche bipotente Vorläuferzelllinie, die in der Lage ist, bei Exposition gegenüber 2% Dimethylsulfoxid (DMSO) zu zwei verschiedenen Zellphänotypen zu differenzieren: Gallen- und Hepatozyten-ähnliche Zellen. Differenzierte HepaRG-Zellen (dHepaRG) teilen einige Merkmale und Eigenschaften mit erwachsenen Hepatozyten und besitzen die Fähigkeit, leberspezifische Gene wie Albumin, AldolaseB, Cytochrom P450 2E1 (CYP2E1) und Cytochrom P450 3A4 (CYP3A4) stabil auszudrücken13 (Schritt 3). Die Behandlung von dHepaRG-Zellen mit dem Fettsäuresalz Natriumoleat (250 M) für 5 Tage führt zur Erzeugung von zytoplasmatischen Lipidtröpfchen, die die Auswirkungen der Fettleber14,15,17,18 ( Schritt 4). Die Anhäufung von Lipidtröpfchen kann leicht durch Oil Red O Färbung (Schritt 5) erkannt werden, einem Lysochrom-Fett-löslichen Farbstoff, der neutrale Triglyceride und Lipide rot-orange färbt. Zur effizienten Quantifizierung von Lipiden in fetthaltigem dHepaRG illustrieren wir hier die zytofluorimetrische Analyse nach der Färbung mit 4,4-Difluor-1,3,5,7-Tetramethyl-4-bora-3a,4a-diaza-s-indacen (Bodipy 505/515) (Schritt 6), einer lipophilen fluoreszierenden Sonde, die intrazellulären Lipidkörpern und wurde zur Kennzeichnung von Lipidtröpfchen19verwendet. Darüber hinaus zeigen wir hier, wie die Steatose durch quantitative Polymerase-Kettenreaktion (qPCR) (Schritt 7) Genexpression Deregulierung mehrerer metabolischer Gene in dHepaRG-Zellen zu bewerten. Um die Ansammlung von Lipidtröpfchen nach der Natriumoleatbehandlung weiter zu charakterisieren und zu quantifizieren, führten wir eine kohärente Anti-Stokes Raman Streumikroskopie (CARS) (Schritt 8) durch, eine innovative Technik, die die Visualisierung und Quantifizierung von Lipidtröpfchen ohne Kennzeichnung20,21.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Herstellung von Kulturmedien und Reagenzien

  1. Vermehrungsmedium: Ergänzen Sie Williams E-Medium mit GlutaMAX, 10% fetalem Rinderserum (FBS), 1% Penicillin/Streptomycin, 5 g/ml Insulin und 0,5 m Hydrocortison-Hemisuccinat.
  2. Differenzierungsmedium: Ergänzung des E-Mediums von William mit GlutaMAX, 10% FBS, 1% Penicillin/Streptomycin, 5 g/ml Insulin, 50 M Hydrocortisonhemisuccinat und 2% DMSO.
  3. Gefriermedium: Ergänzung vermehrendes Medium mit 10% DMSO.
  4. Natriumoleat: in 99% Methanol in einer Konzentration von 100 mM auflösen, O/N umrühren und bei -20 °C lagern.
  5. Oil Red O: Bereiten Sie eine Lagerlösung vor. Wiegen Sie 0,35 g Öl Rot O und lösen Sie es in 100 ml Isopropanol auf. O/N, Filter (0,2 m) umrühren und bei RT lagern. Bereiten Sie eine Arbeitslösung vor: Mischen Sie 6 ml Öl Red O Stock Lösung mit 4 ml ddH2O. Lassen Sie bei Raumtemperatur (RT) für 20 min sitzen, und dann mit einem 0,2 m Filter filtern. Richtige Filtration ist sehr empfehlenswert für eine erfolgreiche Färbung, um Hintergrund zu vermeiden.
  6. Bodipy (505/515): Bodipy (505/515) Farbstoff in DMSO bei einer Lagerkonzentration von 100 m auflösen, bei -20 °C im Dunkeln lagern und bei einer endletzten Konzentration von 100 nM verwenden.
  7. Erwerben Sie transparente Glasböden für CARS-Experimente.

2. Auftauen, Amplifikation und Kryokonservierung von HepaRG-Zellen

  1. Stickstoff kryokonservierte HepaRG-Zellen auftauen, indem Sie eine Charge in ein 37 °C-Bad eintauchen, bis sie aufgetaut ist. Wählen Sie eine Charge mit niedriger Durchgang (<20). HepaRG-Zellen sind im Handel erhältlich.
  2. Übertragen Sie die Zellen schnell in ein 15 ml-Rohr mit 10 ml Prolifer-Medium und Zentrifuge für 5 min (200 x g, 4 °C).
  3. Entsorgen Sie den Überstand und setzen Sie die Zellen mit 5 ml proliferierendem Medium wieder auf.
  4. Zählen Sie die Zellen und verdünnen Sie, um 2,5 x 104 Zellen/cm2zu verplatten.
  5. Erneuern Sie das Medium alle 2 oder 3 Tage. Zellen vermehren sich mit einer Verdoppelungszeit von etwa 24 h.
  6. Trennen Sie HepaRG-Zellen bei 80% Konfluenz durch 3-5 min Inkubation mit Trypsin-Lösung 0,05%. Sammeln Sie die Zellen in proliferierenden Medium und Zentrifuge für 5 min (200 x g, 4 °C).
  7. Entsorgen Sie den Überstand und setzen Sie die Zellen mit 5 ml proliferierendem Medium wieder auf.
  8. Zählen Sie die Zellen und verdünnen Sie, um 2,5 x 104 Zellen/cm2zu verplatten.
  9. In diesem Stadium verstärken Sie die Zellen durch Wiederholung der Schritte 2.5-2.8, um eine angemessene Anzahl von Zellen zu erreichen, um Experimente zu starten, oder Kryokonserven wie in Schritt 2.10.
  10. Um HepaRG-Zellen zu kryoservieren, lösen Sie die Zellen 24 h nach der Beschichtung durch 3-5 min Inkubation mit Trypsin-Lösung 0,05%. Sammeln Sie die Zellen in proliferierenden Medium und Zentrifuge für 5 min (200 x g, 4 °C). Entsorgen Sie den Überstand, setzen Sie die Zellen in 1 ml/Charge Gefriermedium, 1,5 x 106 Zellen/Charge wieder auf und kryoservieren Sie die Chargen in flüssigem Stickstoff.

3. Differenzierung von HepaRG-Zellen (Tag 0–21) (Abbildung 1A)

  1. Tag 0. Samen HepaRG-Zellen mit geringer Dichte (2,5 x 104 Zellen/cm2) in kulturbehandelte Gerichte mit entsprechendem Proliferationsvolumen (Abbildung1B). Für jeden Assay müssen zwei Gerichte plattiert werden (Oil Red O Staining, FACS Analysis, qPCR): eines für Kontrollzellen und eines für oleatbehandelte Zellen. Wenn Sie CARS-Messungen durchführen (Schritt 8), säen Sie die Zellen parallel in transparente Glasbodenschalen. Als Kontrolle, Ernten Sie eine unbehandelte Schale (vermehrende Zellen Tag 0), um Genexpressionsanalyse von Differenzierungmarkergenen durchzuführen (siehe Schritt 3.6).
  2. Tag 2 und Tag 4. Ändern Sie das Medium mit dem entsprechenden Volumen des Proliferationsmediums und lassen Sie die Zellen bis zum Zusammenfluss wachsen.
  3. Tag 7. Die Zellen müssen 100 % konfluent sein (Abbildung 1C). Waschen Sie die Zellen einmal mit 1x Phosphat-gepufferter Saline (PBS). Entfernen Sie 1x PBS und fügen Sie ein entsprechendes Volumen des Differenzierungsmediums hinzu.
  4. Tag 8, 9, 12, 15, 18.  Waschen Sie die Zellen einmal mit 1x PBS. Entfernen Sie 1x PBS und fügen Sie ein entsprechendes Volumen des Differenzierungsmediums hinzu.
  5. Tag 21. Beobachten Sie HepaRG-Zellen unter dem Mikroskop und stellen Sie sicher, dass die Zellen konfluente differenzierte Kulturen sind (Abbildung 1D).
  6. Als Kontrolle, Ernten Sie eine Kontrollschale (differenzierte Zellen Tag 21), um Genexpressionsanalyse (Schritt 7) von Differenzierungmarkergenen durchzuführen (Abbildung 1E).
  7. An Tag 21 können differenzierte HepaRG-Zellen in Flüssigstickstoff kryokonserviert werden.

4. Induktion der Vesicularsteatose (Tag 21–26)

  1. Tag 21. Natriumoleat (100 mM) mit einem entsprechenden Volumen vollständiger Differenzierungsmedium auf eine Endkonzentration von 250 m (1:400) verdünnen. Fügen Sie 99% Methanol 1:400 (gleiches Volumen wie Natriumoleat) in ein anderes Aliquot von Differenzierungsmedium, um die Fahrzeug-Kontroll-Behandlung zu machen. (Zum Beispiel: 25 l Natriumoleat zu 10 ml Medium hinzufügen und parallel dazu 25 l 99% Methanol zu 10 ml Medium hinzufügen). Waschen Sie die Zellen einmal mit 1x PBS und fügen Sie Fahrzeug oder Natriumoleat Medium.
  2. Tag 23 und Tag 25. Ändern Sie das Medium mit dem entsprechenden Volumen des frisch zubereiteten Mediums wie in Schritt 4.1.
  3. Tag 26. Beobachten Sie durch ein optisches Mikroskop, dass sich Lipidtröpfchen in den mit Natriumoleat behandelten Zellen ansammeln und als transluzente Tröpfchen im Zytoplasma leicht sichtbar sind, wie in Abbildung 2A.

5. Bewertung der Lipid-Überlastung und Steatose-Induktion: Öl Rot O Färbung

  1. Waschen Sie die Zellen einmal mit 1x PBS und entfernen Sie 1x PBS vollständig.
  2. 4% Paraformaldehyd hinzufügen (in 1x PBS verdünnt) und 15 min bei RT brüten.
    ACHTUNG: Paraformaldehyd ist giftig, daher muss dieser Schritt in einer Dunstabzugshaube mit Schutzausrüstung, einschließlich Handschuhen, laborierter Kleidung und einer Maske durchgeführt werden.
  3. Entfernen Sie Paraformaldehyd und waschen Sie die Zellen zweimal mit 1x PBS. Die Zellen können in 1x PBS bei 4 °C für ein paar Tage vor der Färbung aufbewahrt werden. Mit Parafilm umwickeln und mit Aluminiumfolie abdecken, um das Trocknen der Zellen zu verhindern.
  4. Entfernen Sie 1x PBS. Inkubieren Sie die Zellen mit 60% Isopropanol für 5 min bei RT.
  5. Entfernen Sie Isopropanol und lassen Sie die Zellen bei RT vollständig trocknen.
  6. Öl rot O Arbeitslösung hinzufügen und bei RT 30 min brüten. Das für jede Probe erforderliche Arbeitsvolumen entspricht dem Medienvolumen, das für die Zellkultivierung verwendet wird.
  7. Entfernen Sie Oil Red O Lösung und fügen Sie sofort ddH2O. Waschen Sie die Zellen 4 mal mit ddH2O.
  8. Bilder unter dem Mikroskop für die Analyse erfassen (Abbildung 2B).
  9. Um Öl Rot O Farbstoff zu elute: entfernen Sie das gesamte Wasser und lassen Sie zu trocknen; 1 ml 100% Isopropanol hinzufügen und 10 min mit sanftem Schütteln bei RT brüten.
  10. Pipet das Isopropanol mit eluiertem Öl Red O Farbstoff auf und ab mehrmals, um sicherzustellen, dass das gesamte Öl Rot O in der Lösung ist. Übertragen Sie die Lösung auf eine Küvette. Messen Sie OD500 nm durch Spektrophotometrie und verwenden Sie 100% Isopropanol als leer (Abbildung 2C).

6. Bewertung der Lipidüberlastung und Steatose-Induktion: Bodipy Staining und Cytofluorimetric Analysis

  1. Waschen Sie die Zellen einmal mit 1x PBS. Inkubieren Sie mit 100 nM Bodipy in 1x PBS im Dunkeln für 40 min bei 37 °C. Eine unbefleckte Steuerung sollte in die Durchflusszytometriemessungen einbezogen werden. Schützen Sie die Proben von diesem Punkt aus so weit wie möglich vor Licht.
    HINWEIS: Das für jede Probe benötigte Volumen der Färbelösung entspricht dem Volumen der Medien, die für die Zellkultivierung verwendet werden.
  2. Entfernen Sie die Färbelösung und waschen Sie die Zellen einmal mit 1x PBS. Fahren Sie mit den Schritten 6.3-6.6 fort. für die FACS-Analyse (Fluoreszenz-aktivierte Zellsortierung) oder für Schritt 6.7 für die Mikroskop-Bildgebung.
  3. Kratzen Sie die Zellen vorsichtig mit 1x PBS und übertragen Sie sie in ein 15 ml Rohr. Zentrifuge für 10 min (200 x g, 4 °C).
  4. Entfernen Sie die Überräube vorsichtig, ohne die Pellets zu stören und waschen Sie sie mit 3 ml 1x PBS. Zentrifuge für 5 min (200 x g, 4 °C).
  5. Entfernen Sie die Überräube und suspendieren Sie in 300 l 1x PBS, und übertragen Sie sie dann in ein FACS-Rohr.
  6. Messen Sie sofort die Bodipy-Fluoreszenzintensität durch zytofluorimetrische Analyse mit Anregungs-/Emissionswellenlängen von 505/515 nm (Abbildung 3A,B).
  7. Waschen Sie die Zellen einmal mit 1x PBS und entfernen Sie PBS vollständig.
  8. 4% Paraformaldehyd hinzufügen (in 1x PBS verdünnt) und 15 min bei RT brüten.
    ACHTUNG: Paraformaldehyd ist giftig, daher muss dieser Schritt in einer Dunstabzugshaube mit Schutzausrüstung, einschließlich Handschuhen, laborierter Kleidung und einer Maske durchgeführt werden.
  9. Entfernen Sie Paraformaldehyd und waschen Sie die Proben 3x für 5 min in PBS. Zellen können in 1x PBS bei 4 °C gehalten oder sofort abgebildet werden (Abbildung 3C). Zur Lagerung mit Parafilm umwickeln und mit Aluminiumfolie abdecken, um das Trocknen der Zellen zu verhindern.

7. Bewertung der Lipidüberlastung und Steatose-Induktion: qPCR

  1. Waschen Sie die Zellen einmal mit 1x PBS. Zerkleinern Sie die Zellen mit 1x PBS, Zentrifuge bei 200 x g, und entsorgen Sie den Überstand. In diesem Schritt können Zellen bei -80 °C geerntet oder wie in Schritt 7.2 verarbeitet werden.
  2. Führen Sie die gesamte RNA-Isolierung mit Standardmethoden mit kommerziellen Reagenzien nach den Anweisungen des Herstellers durch.
  3. Bewerten Sie die RNA-Konzentration durch UV-spektrophotometrische Messung, um sicherzustellen, dass die RNA-Reinheit hoch ist (nahe 2,0) basierend auf dem A260/A280-Wert.
  4. Synthetisieren Sie cDNA aus 1 g Gesamt-RNA mit einem Standard-cDNA-Synthese-Kit.
  5. CDNA mit H2 O auf einendgültiges Volumen von 50 l verdünnen.
  6. Analysieren Sie jede cDNA-Probe in dreifacher Ausfertigung durch qPCR: Bereiten Sie einen qPCR-Master-Mix vor (Tabelle 1), der für die erforderlichen Reaktionen für jeden Primer ausreicht, einschließlich der für die drei Haushaltsgene spezifischen Primer als Steuerung: Gliceraldeid-3-fosfato Deidrogenasi (GAPDH), actinB und ribosomal 18S (siehe Materialtabelle für Primersequenzen):
  7. Geben Sie 18 l Master-Mix pro Bohrung in eine PCR-Multiwall-Platte.
  8. Fügen Sie in jedem Brunnen 2 L cDNA-Proben hinzu. Versiegeln Sie die Platte.
  9. Führen Sie die Proben gemäß der Anweisung Thermal Cycler aus.

8. Bewertung der Lipidüberlastung und Steatose-Induktion: CARS

  1. Fixieren Sie die Zellen, die zuvor auf Glasbodenschalen zubereitet wurden, wie in den Schritten 5.1-5.3 beschrieben.
  2. Schalten Sie ein kommerziell abstimmbares pikodiertes Lasersystem ein und optimieren Sie es, um zwei Ausgänge unterschiedlicher Wellenlängen zu erhalten. Die Frequenzdifferenz zwischen den Ausgängen muss 2.840 cm-1 betragen, um das intensive CARS-Lichtsignal zu erzeugen, das der symmetrischen Methylendehnung entspricht; für einen festen Wellenlängenausgang bei 1.064 nm ("Stokes"-Licht) sollte die andere Wellenlänge auf 817 nm ("Pumpenlicht") eingestellt werden.
  3. Stellen Sie sicher, dass der 817 nm-Ausgang räumlich und zeitlich mit dem 1.064 nm-Ausgang überlappt ist: Verwenden Sie einen geeigneten dichroitischen Spiegel (d.h. mit einem Schnitt zwischen 817 und 1.064 nm), um die Strahlen räumlich zu kombinieren und eine optische Verzögerungslinie zu verwenden, um eine zeitliche Überlappung des Lasers zu erhalten. Impulse.
  4. Stellen Sie sicher, dass die beiden kopropagierenden Strahlen sowohl kollimiert als auch ähnliche Werte aufweisen, die für das optische System innerhalb des Mikroskops geeignet sind, das sie auf die Probe fokussiert; bei Bedarf die Strahlen vor dem dichroitischen Spiegel, der sie kombiniert, separat kollidieren.
  5. Schalten Sie ein kommerzielles invertiertes Mikroskopsystem ein, das eine Infrarot-Laserscaneinheit und eine zweikanalige rot-grüne Epi-Erkennungseinheit umfassen sollte, und richten Sie die kodierenden Laserstrahlen in die Scaneinheit aus.
  6. Öffnen der zweikanaligen Epi-Erkennungseinheit, Entfernen des Filterwürfels und Ersetzen des Rotwellenlängen-Erkennungsfilters durch einen Bandpassfilter, der das 2.840 cm-1 CARS-Signal auswählen kann, das bei 663 nm für die 817/1.064 nm Pumpe/Stokes-Erregung zentriert ist schema. Ein Filter mit schmaler Bandbreite (20 nm) wird bevorzugt, um die Erfassung hoher Fluoreszenz-Hintergrundsignale zu vermeiden.
  7. Legen Sie eine Schale auf die Bühne des invertierten CARS-Mikroskops und verschieben Sie mit einem 100-fachen Öl-Immersion-Objektiv die vertikale Position des Objektivs, um sich auf die Zellen zu konzentrieren.
  8. Richten Sie die Mikroskop-Software ein, um hochauflösende (1024 x 1024 Pixel) Bilder über ein Sichtfeld zu sammeln, das sich über 127 x 127 x 127 cm erstreckt.
  9. Stellen Sie die Mikroskopsoftware so ein, dass sie kontinuierlich Bilder des Sichtfelds von 127 x 127 m erfasst und anzeigen und die angezeigten Bilder überprüfen und gleichzeitig die Bildaufnahmeparameter optimieren. Stellen Sie sicher, dass die Laserleistungen für eine schnelle Bildaufnahme und minimale Beschädigungen ausgeglichen sind, indem Sie bei Bedarf geeignete Neutraldichtefilter in die Strahlpfade einfügen, und wählen Sie eine Pixelverweilzeit aus, die die Sammlung von Bildern mit einem guten Signal-rausch-Signal ermöglicht. Verhältnis unter den gewählten Laserleistungsbedingungen.
  10. Erfassen und speichern Sie Bilder von verschiedenen Sichtfeldern innerhalb der Schale unter den optimierten Bedingungen. Optional können Multiphotonenfluoreszenzbilder, die durch eine grüne Wellenlängenemission (meist aus zwei photonen anregung bei 817 nm) erzeugt werden, gleichzeitig über den anderen Epidetektor gesammelt werden. Wiederholen Sie die Schritte 8.7-8.10 für jedes Gericht.
  11. Für die CARS-Bildanalyse verarbeiten Sie Bilder mit der FIJI-Implementierung von ImageJ. Betreiben Sie die Despeckle-Funktion (oder ein ähnliches Denoising-Tool) auf jedem Bild vor einer weiteren Analyse, um die Signal-Rausch-Verhältnisse ohne Detailverlust zu verbessern.
  12. Verwenden Sie FIJI, um Zellen manuell auszuwählen und dann automatisch Lipidtröpfchen innerhalb segmentierter Einzelzellen zu zählen, um Statistiken über Lipidtröpfchenbereiche und Zahlen für jede Zelle und für das gesamte Bild-Dataset für jede Schale zu erstellen.

9. MTT Cell Viability Assay

  1. Platte differenzierte HepaRG-Zellen zu einer 96-Well-Platte mit einer Dichte von 1 x 105 Zellen/Well in einem abschließenden 100-L-Volumen des Differenzierungskulturmediums.
  2. 24 h nach der Aussaat, behandeln Sie die Zellen mit 99% Methanol (Fahrzeug) und mit 100 'M, 250 'M und 500 'M Natriumoleat und Natriumpalmitat verdünnt in 100 l Differenzierungskultur Medium/gut in Dreifach.
  3. Ändern Sie das Medium mit 99 % Methanol und mit 100 m, 250 m und 500 m Natriumoleat und Natriumpalmitat, das alle 24 h in 100 l Differenzierungskultur medium/well verdünnt wird.
  4. 96 h nach Methanol/Natriumoleat/Natriumpalmitat-Behandlung, behandeln Sie die Zellen mit 2 'M Doxorubicin verdünnt in 100 'L Differenzierungskultur medium/gut in Triplicate als Kontrolle.
  5. 18 h nach Doxorubucin-Behandlung, ändern Sie das Medium mit 100 l Differenzierungskulturmedium.
  6. Pipette 20 l von 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-Tetrazolium-Reagenz MTT (Materialtabelle) in jeden Brunnen der 96-Well-Assay-Platte, die die Zellen in 100 l Differenzierungskulturmedium enthält . Fügen Sie eine Hintergrundsteuerung ein, indem Sie 20 l Reagenz in einen Kontrollbrunnen ohne Zellen in 100 l Differenzierungskulturmedium in Dreifache pipettieren.
  7. Inkubieren Sie die Platte bei 37 °C in einer befeuchteten, 5% CO2-Atmosphäre.
  8. Nach der Inkubation für 30, 60 und 90 min mit MTT TetrazoliumReagenz, notieren Sie die Absorption bei 490 nm mit einem 96-Well-Plattenleser. Subtrahieren Sie die Hintergrundabsorption der zellfreien Kontrollbrunnen von den Absorptionswerten für die anderen Proben.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Dieses Protokoll beschreibt eine effiziente Methode zur Induzieren und Charakterisierung der vesikulären Steatose in DMSO-differenzierten HepaRG-Zellen durch Natriumoleatbehandlung (Abbildung 1A).

Differenzierung von HepaRG-Zellen.
Um eine Differenzierung effizient zu induzieren, müssen vermehrende Zellen mit einer geringen Dichte (2,5 x 104 Zellen/cm2) im Proliferationsmedium ausgesät werden. Bei geringer Dichte teilen sich die Zellen aktiv und erhalten eine langgestreckte undifferenzierte Morphologie (Abbildung 1B). Die Zellen sollten 7 Tage lang im Proliferationsmedium wachsen, bis 100% Konfluenz erreicht ist (Abbildung 1C). Nach der Exposition bei 2% DMSO beginnen sich die Zellen zu differenzieren und zu typischen hepatozytenähnlichen Kolonien zu bilden, die von Gallenepithel-ähnlichen Zellen umgeben sind (Abbildung 1D). Differenzierte HepaRG-Zellen exprimieren hepatospezifische Marker wie Albumin, Cyp3A4 und Aldolase B. Um die richtige Differenzierung zu überprüfen, wurden die Expressionsniveaus dieser lebermarkerischen Gene in den differenzierten Zellen (Tag 21) und in den proliferierenden Zellen (Tag 0) mit qPCR (Abbildung 1E) analysiert. Albumin-, Cyp3A4- und Aldolase-B-Gene sollten in den differenzierten HepaRG-Zellen im Vergleich zu den wuelbeschleunigenden HepaRG-Zellen hochreguliert werden, und wir beobachteten diesen Trend, was die Wirksamkeit unseres Differenzierungsprotokolls bestätigte.

Induktion der vesikulären Steatose in HepaRG-Zellen durch Natriumoleatbehandlung.
Natriumoleatbehandlung von dHepaRG-Zellen induziert Fettansammlung, sichtbar unter einem optischen Mikroskop als Lipidtröpfchen in den Zytoplasmen (Abbildung 2A). Zur Überprüfung der effizienten Induktion von Steatose wurden oleatbehandelte und kontrollierte HepaRG-Zellen mit Ölrot-O-Farbstoff gefärbt. Nach der Färbung sind Lipidtröpfchen leicht als rote Tröpfchen sichtbar (Abbildung 2B) und können durch spektrophotometrische Messung des Ölrot-O-Farbstoffs, der mit Isopropanol eluiert wird , quantifiziert werden (Abbildung 2C). Die Absorption von eluiertem Öl Rot O aus den Zellen ist direkt proportional zur zytoplasmatischen Lipidtröpfchenakkumulation.

Die Natriumoleatkonzentration und die Expositionszeit wurden durch MTT colorimetric cell viability assay (Schritt 9) bestimmt. Die Natriumoleatbehandlung wurde mit der Natriumpalmitatbehandlung verglichen und das apoptotische Medikament Doxorubucin (2 m) wurde als Kontrollmittel verwendet (Abbildung 2D). Die Zytoxizität der Verbindungen wurde von MTT unter Ausnutzung einer kommerziellen Verbindung (Materialtabelle), die das MTT-Tetrazolium enthält, bewertet. Die wasserlösliche gelbe MTT-Tetrazoliumverbindung wird durch metabolisch aktive Zellen zu einem violetten wasserunlöslichen Formazan-Produkt bioreduziert. Das Formazan-Produkt wird durch seine Absorption bei 490 nm quantifiziert und die Menge ist direkt proportional zur Anzahl der lebenden Zellen in der Kultur (Abbildung 2D).

Quantifizierung der vesikulären Steatose in Natriumoleat-behandelten HepaRG-Zellen
Um den Anstieg des zellulären Lipidgehalts nach der Natriumoleatbehandlung zu quantifizieren, führten wir eine Färbung mit Bodipy-Farbstoff durch, einer Sonde, die Lipidtröpfchen kennzeichnet. Mittels zytofluorimetrischer Analyse ist es möglich, den Triglyceridgehalt durch Bodipy-Mean-Fluoreszenzintensität zu quantifizieren, die in oleatbehandelten Zellen höher ist als in Kontrollzellen (Abbildung 3A,B), was auf effizientes Fett hindeutet. Ansammlung nach Oleatbehandlung. Tatsächlich zeigen Bilder von Bodipy-gefärbten Zellen hellgrüne fluoreszierende Lipidtröpfchen in oleatbehandelten Zellen, die in den Kontrollzellen nicht sichtbar sind (Abbildung 3C).

Die Natriumoleatbehandlung von dHepaRG-Zellen dereguliert den Fettstoffwechsel und die entzündliche Genexpression. Um die effiziente Induktion der vesikulären Steatose zu bewerten, analysierten wir mit qPCR die Expressionskonzentrationen ausgewählter Gene in Natriumoleat-behandelten Zellen im Vergleich zu denen von Kontrollzellen (Abbildung 4). Acetyl-CoA Carboxylase beta (ACACB), Glycerin-3-Phosphat acyltransferase mitochondrial (GPAM), Perilipine (PLIN2, PLIN4), Apolipoprotein B (APOB), Pyruvat-Dehydrogenase-Kinase isozym 4 (PDK4), Carnitin palmitoyltransferase 1A (CPT1A) und Interleukin 6 (IL6) wurden in oleatbehandelten dHepaRG-Zellen hochreguliert, während die solute Trägerfamilie 2 Mitglied 1 (SLC2A1), Apolipoprotein C-III (APOC3) und Stearoyl-CoA-Desaturase (SCD) downreguliert wurden (Abbildung 4). Um die Lipidspeicherung in Tröpfchen nach Zugabe von Natriumoleat zu differenzierten HepaRG-Zellen weiter zu charakterisieren und zu quantifizieren, haben wir eine innovative Mikroskopie-Technik, eine kohärente Anti-Stokes-Raman-Streuung (CARS)-Mikroskopie, eingesetzt, die Visualisierung und Quantifizierung von Lipidtröpfchen ohne Beschriftung (Abbildung 5A). Lipidtröpfchen wurden anhand von CARS-Bildern statistisch in Zahlen, Verteilung und Morphologie auf Einzelzellebene quantifiziert. Die Behandlung mit Natriumoleat (250 M) führte zu einer signifikanten Zunahme der Anzahl der Lipidtröpfchen (Abbildung 5B), was zu einer höheren Tröpfchenfläche pro Zelle führte (Abbildung 5C) und einer höheren prozentualen Tröpfchenfläche pro Zelle ( Abbildung 5D), im Vergleich zu Kontrollzellen, was darauf hindeutet, dass dHepaRG-Zellen nach der Natriumoleatbehandlung effizient Fett angesammelt haben.

Figure 1
Abbildung 1 : Differenzierung von HepaRG-Zellen. (A) Repräsentatives Diagramm mit HepaRG-Zelldifferenzierung/-behandlungsprotokoll, wie in den Schritten 3 und 4 beschrieben. (B-D) Bilder, die ungefärbte vermehrende HepaRG-Zellen an Tag 0 nach der Aussaat zeigen (B), am Zusammenfluss Tag 7 nach der Aussaat (C), und differenzierte HepaRG (dHepaRG) an Tag 21 nach der Aussaat (D). (E) Die gesamte RNA wurde aus proliferierenden und dHepaRG-Zellen extrahiert, cDNA wurde synthetisiert und von qPCR mit Primern analysiert, die speziell für die angegebenen Gene bestimmt sind (Materialtabelle). Die Proben wurden auf den Mittelwert von GAPDH-, actinB- und ribosomalen 18S-Haushaltsgenen normalisiert. Histogramme zeigen falteninduktion von vermehrenden (Tag 0) im Vergleich zu differenzierten Zellen (Tag 21) (Balken zeigen S.D.; p-Werte wurden durch Student t-Tests berechnet). Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Figure 2
Abbildung 2 : Natriumoleatbehandlung von dHepaRG-Zellen induzierte Lipidtröpfchenakkumulation. (A) Bilder von ungefärbten differenzierten HepaRG-Zellen (dHepaRG), die 5 Tage lang mit Fahrzeug (Steuerung) (linkes Bild) oder mit 250 M Natriumoleat (rechtes Bild) behandelt wurden. (B) Nach der Behandlung wurden die Zellen mit Öl rot O Farbstoff gefärbt; Lipidtröpfchen sind rot sichtbar. (C) ÖlRoter O-Farbstoff wurde eluiert und OD mit 570 nm gemessen. Die Ergebnisse werden als Mittel für drei unabhängige Experimente ausgedrückt (Bars zeigen S.D.; p-Wert durch Student es t-test). (D) Zelllebensfähigkeitsbewertung des Fahrzeugs der dHepaRG-Zellen (99 % Methanol), das 5 Tage lang mit Natriumoleat und Natriumpalmitat (100 m, 250 m oder 500 m) behandelt oder 18 h mit Doxorubucin (2 m) behandelt wurde.  Die Beurteilung der Zytotoxizität wurde mit einem MTT-Assay-Kit (Tabelle der Materialien )durchgeführt, das die Absorption bei 490 nm nach der Anweisung des Herstellers aufzeichnete. Die Ergebnisse werden als Mittel für drei unabhängige Experimente ausgedrückt (Balken zeigen S.D.; p-Werte wurden mit dem T-Test des Schülers bestimmt: *0,01 x p < 0,05; **0,001 , p < 0,01; ***p < 0,001). Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Figure 3
Abbildung 3 : Quantifizierung der Fettansammlung nach Natriumoleatbehandlung durch Bodipy-Färbung. Differenzierte HepaRG-Zellen (dHepaRG) wurden 5 Tage lang mit Fahrzeug (Steuerung) oder mit 250-M-Natriumoleat behandelt. Nach der Behandlung wurden die dHepaRG-Zellen mit Bodipy-Farbstoff gefärbt und durch Durchflusszytometrie analysiert. (A) Repräsentative Überlagerungsprofile (% von max: Prozentsatz der maximalen Färbeintensität). (B) Histogramme zeigen die mittlere Fluoreszenzintensität (MFI) als Prozentsatz der behandelten Zellen über die Kontrolle aus drei unabhängigen Experimenten (Balken zeigen S.D.; p-Werte wurden mit dem T-Test des Schülers ermittelt: *0,01 s p < 0,05; **0,001 , p < 0,01; ***p < 0,001). (C) Die Zellen wurden mit 4% Paraformaldehyd fixiert. Bilder zeigen Bodipy-gefärbte Lipidtröpfchen in Grün. Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Figure 4
Abbildung 4 : Natriumoleatbehandlung von dHepaRG-Zellen induziert Deregulierung des Fettstoffwechsels und entzündliche Genexpression. Differenzierte HepaRG-Zellen (dHepaRG) wurden 5 Tage lang mit Fahrzeug (Steuerung) oder mit 250-M-Natriumoleat behandelt. cDNAs wurden von qPCR mit Primern analysiert, die speziell für die angegebenen Gene bestimmt sind, und die Ergebnisse wurden auf den Mittelwert von GAPDH,ActinB und ribosomalen 18S Haushaltsgenen normalisiert; die Primer sind in der Tabelle der Materialienangegeben. Das Histogramm zeigt Expressionsniveaus von angegebenen Genen als Falteninduktionen behandelter Zellen über die Kontrolle (Balken zeigen S.D.; p-Werte wurden durch Den t-Test des Schülers berechnet). Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Figure 5
Abbildung 5 : Charakterisierung der Lipidtröpfchenakkumulation nach Natriumoleatbehandlung durch CARS-Mikroskopie. Differenzierte HepaRG-Zellen (dHepaRG) wurden 5 Tage lang mit Fahrzeug (Steuerung) oder mit 250 M Natriumoleat behandelt und mittels CARS-Mikroskopie analysiert. (A) Repräsentative Bilder, die Lipidtröpfchen CARS Kontrast in rot zeigen. (B) Histogramm mit der Anzahl der Lipidtröpfchen pro Zelle. (C) Histogramme mit Gesamtbildfläche, die von Tröpfchen pro Zelle bedeckt ist. (D) Histogramm mit % Tröpfchenfläche, die von Tröpfchen pro Zelle bedeckt ist. Alle Ergebnisse werden als Mittel von drei unabhängigen Experimenten ausgedrückt (Balken zeigen S.E.; p-Werte wurden durch den T-Test des Schülers bestimmt: *0,01 x p < 0,05; **0,001 , p < 0,01; ***p < 0,001). Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Reagenzien Volumen (L) für eine einzelne Reaktion
2x SYBR Grüner Fluoreszenzfarbstoff 10
PCR-Klasse H2O 6
Vorwärtsgrundierung (M) 1
Reverse Primer (M) 1

Tabelle 1: qPCR-Master-Mix.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Dieses Protokoll beschreibt, wie HepaRG-Zellen zu unterscheiden und wie vesikuläre Steatose durch Natriumoleatbehandlung induzieren (Abbildung 1A). Tatsächlich weist die HepaRG-Zelllinie im Vergleich zu anderen menschlichen Hepatozellulären Karzinom-Zelllinien Merkmale von erwachsenen menschlichen Hepatozyten auf, die eine wertvolle Alternative zu ex vivo kultivierten primären menschlichen Hepatozytendarstellen 13,14 ,15. Die HepaRG-Zelllinie wurde weit verbreitet für Leberzytotoxizität Studien, Arzneimittelstoffwechsel, und Virologie Studien15,16,22.

Im Vergleich zu HepaRG-Zellen weisen andere HCC-Zelllinien wie HepG2, HUH7, HUH6 und Hep3B geringere metabolische Kapazitäten auf, ohne einen wesentlichen Satz leberspezifischer Funktionen23,24, und zytosolische Fettansammlung in Lipidtröpfchen gespeichert. Daher sind diese HCC-Zelllinien weniger nützlich als Modelle für die Induktion von vesikulärer Steatose nach Lipidüberlastung als die HepaRG-Zelllinie.

Kritische Schritte innerhalb des Protokolls
Bei geringer Dichte (2,5 x 104 Zellen/cm2)erhalten HepaRG-Zellen eine langgestreckte undifferenzierte Morphologie, die aktiv geteilt wird; nach 100% Konfluenz sind sie in der Lage, sich bei Exposition gegenüber 2% DMSO zu differenzieren und bilden typische hepatozytenähnliche Kolonien, die von Gallenepithel-ähnlichen Zellen umgeben sind (Abbildung 1D). Diese gemischte Gallen-/Hepatozytenzellkultur rekapituliert Merkmale des Lebergewebes, die einem physiologischen Zustand ähneln, trotz fehlender anderer Leberzelltypen (sinusförmig oder Kupffer).

Ein entscheidender Schritt im Differenzierungsprozess ist die Konfluenz von Zellen. Die Zellen müssen mit geringer Dichte (2,5 x 104 Zellen/cm 2) gesät werden (Abbildung 1B) und mindestens 1 Woche lang aktiv im Proliferationsmedium wachsen lassen (Tag 0-7). An Tag 7 müssen die Zellen vor dem Hinzufügen von 2% DMSO, um den Differenzierungsprozess zu starten, bei 100% Zusammenfluss liegen (Abbildung 1C). Wenn an Tag 7 (Schritt 2.2) die vollständige Konfluenz nicht erreicht ist, wird dringend empfohlen, dass die Zellen noch einige Tage im Proliferationsmedium weiter wachsen dürfen, bis ein 100% Zusammenfluss erreicht ist.

Einschränkungen des Protokolls
Es wurde beobachtet, dass nach Zugabe von Differenzierungsmedium, einige Zellen leiden, und in der Regel 10% der Zellen sterben während der folgenden 2-3 Tage. In diesem Stadium müssen das tägliche Waschen und das mittlere Wechseln (Schritt 2.4) fortgesetzt werden, um schwimmende abgestorbene Zellen zu entsorgen. Die Verwendung eines bestimmten FBS (Table of Materials) zur Ergänzung sowohl der Differenzierungs- als auch der Proliferationsmedien sollte die Differenzierungseffizienz erhöhen und den Zelltod während der Tage 7-21 senken (Schritt 2.4). Es wird dringend empfohlen, Zellen bis Zudurchgang 20 zu erhalten und niedrigere Passagen (<20) für die Differenzierung von Zellen zu wählen: weniger Zelltod tritt für die jüngsten HepaRG-Zellen auf. Darüber hinaus scheint die HepaRG-Differenzierung bei 35 mm und 60 mm Schalen wirksamer zu sein, während Zellen tendenziell mehr leiden, wenn sie in den 100 mm und 150 mm Schalen gesät werden.

Änderungen und Fehlerbehebung
Die Exposition gegenüber unterschiedlichen Verhältnissen von palmitischen und ölhaltigen Fettsäuren hat gezeigt, dass sie zur Bildung von intrazytoplasmatischen Lipidtröpfchen25,26führt. Wir beobachteten jedoch, dass die Natriumoleatbehandlung von differenzierten HepaRG-Zellen bessere Ergebnisse zeigte als die Palmitinsäure-Exposition, in Bezug auf eine effiziente Induktion der Lipidakkumulation und Zelllebensfähigkeit (Abbildung 2D). Tatsächlich erwies sich die Behandlung von Palmitinsäure als toxisch für differenzierte HepaRG-Zellen (Abbildung 2D), in Übereinstimmung mit Literaturdaten über Hepatom-Zelllinien und über humane und Rattenhepatozyten-Primärkulturen, die Palmitinsäure als erheblich zytotoxischeMittel25,26,27,28,29. Darüber hinaus ist die Verwendung von Palmitat in zellbasierten Assays aufgrund seiner geringen Löslichkeit eine Herausforderung. Aufgrund der intrinsischen Variabilität der Zelllinien wird jedoch empfohlen, die Natriumoleat-Arbeitskonzentration und Behandlungsdauer zu überprüfen und verschiedene Konzentrationen in einem Zeitverlaufsexperiment mit einem Zelllebensfähigkeitstest zu testen.

Bedeutung und Vergleich von Lipiddetektionstechniken
Die genaue Bestimmung der Lipidmengen in Zellen wurde anhand einer Reihe verschiedener Ansätze in dieser Studie ermittelt. Qualitative und auch annähernd quantitative Übereinstimmung wurde zwischen den Ergebnissen durch Oil Red O Färbung, Bodipy Färbung, und CARS Bildgebung erhalten beobachtet. Für eine schnelle Abschätzung der Lipidmengen in Zellpopulationen ist die Verwendung von Bodipy-Flow-Zytometrie oder einem Fleck wie Oil Red O ideal. Für eine genauere Untersuchung des Lipidtröpfchengehalts von Zellen wird eine bildgebende Modalität bevorzugt. Darüber hinaus wurden Spezifitätsprobleme für Lipidflecken wie Oil Red O20,30berichtet, und wir haben beobachtet, dass in einigen Fällen der Bodipy-Fleck eine geringere Kapazität als CARS hat, lipidtröpfte unter anderen Zelltröpfchen ausschließlich zu kennzeichnen. Organellen (Daten nicht dargestellt). Daher bietet der Einsatz einer etikettenfreien mikroskopischen Bildgebungstechnik wie CARS erhebliche Vorteile für die Steatose-Quantifizierung und Charakterisierung. Die Vermeidung der Verwendung eines großen fluoreszierenden Etiketts macht CARS-Bildgebung aufgrund der geringen Größe von Lipidmolekülen im Vergleich zu typischen Fluorophoren günstig; Daher sind für den Nachweis von Lipiden etikettenfreie Methoden wünschenswert, noch mehr als für die Beobachtung großer Proteinmoleküle. Das Lipid CARS-Signal ist eine optische Emission, die nur erzeugt wird, wenn eine nichtlineare Wechselwirkung in der Probe auftritt. Diese Wechselwirkung kann nur erkannt werden, wenn der Unterschied zwischen den Frequenzen der beiden auf die Probe fokussierten Anregungslaser mit der Methylen (CH2) Dehnschwingungsfrequenz übereinstimmt. Die Häufigkeit von Methylengruppen in Lipiden führt zu sehr intensiven Signalen mit hohen Signal-Rausch-Verhältnissen, und die Nichtlinearität der optischen Wechselwirkung bedeutet auch, dass eine hohe räumliche Auflösung in der CARS-Mikroskopie möglich ist. Die ausgezeichnete Qualität der CARS-Bilder im Allgemeinen ermöglicht die Sammlung von Statistiken über die Größe und Anzahl der Lipidtröpfchen, wie in dieser Studie gezeigt. Darüber hinaus haben andere Studien den Einsatz der CARS-Mikroskopie gezeigt, um verschiedene subzelluläre Lokalisierungen und Größen von Lipidtröpfchen mit verschiedenen Behandlungen zu korrelieren18, und durch die Verwendung zusätzlicher CARS-Messungen bei verschiedenen Wellenlängen, oder ein Breitband CARS oder ähnliche stimuliert Raman Ansatz, Forscher haben gezeigt, dass es möglich ist, verschiedene Arten von Fettsäuren in Lipidtröpfchen charakterisieren31,32. Darüber hinaus hat die Schnelligkeit der CARS-Bildsammlung die In-situ-Bildgebung von lebenden Zellen ermöglicht, die zeitliche Evolution des Lipidtröpfchenwachstums und der Aggregation zu untersuchen33.

Zukünftige Anwendungen
In den letzten Jahrzehnten haben sich die Ansichten über die Rollen und Funktionen von Lipidtröpfchen in der Zellbiologie weiterentwickelt. Früher gedacht, um im Grunde inerte Lagerung Vesikel, sie werden jetzt als hochdynamische Zellorganellen verstanden, und ihre Rolle bei Krankheiten wird zunehmend erkannt34,35,36. Obwohl im Falle von Lebererkrankungen, Lipidakkumulation (Steatose) seit langem bekannt ist, ein kritischer Aspekt zu sein, ist der genaue Mechanismus der Beteiligung von Lipidtröpfchen in der Krankheitsprogression nicht ganz klar. Daher sind Methoden wie CARS, die das dynamische Verhalten von Lipidtröpfchen charakterisieren können, von entscheidender Bedeutung für die Entwicklung eines molekularen Verständnisses von Krankheiten einschließlich NAFLD. Die metabolische Genexpressionsanalyse von qPCR ist eine hochgradig komplementäre molekulare Bildgebung von Lipiden über CARS, wie in früheren Studien17,18gezeigt wurde, was tiefere Einblicke in Krankheitsmechanismen ermöglicht. In der vorliegenden Studie beobachten wir die Fettsäureansammlung mit Deregulierung des Fettstoffwechsels und der entzündlichen Genexpression, die zur Konstruktion eines Panels von Biomarkern für die frühkinestliche Diagnose beitragen kann.

Das mit Natriumoleat behandelte dHepaRG-Zellmodell kann das Wissen über die molekularen Mechanismen erweitern, die nicht nur am Beginn, sondern auch am Fortschreiten der NAFLD beteiligt sind, was eine Grundlage für die Entwicklung besserer therapeutischer Ansätze für die Krankheit bietet.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Die Autoren erklären, dass sie keine konkurrierenden finanziellen Interessen haben.

Acknowledgments

Wir danken Prof. Christian Trepo (INSERM U871, Lyon, Frankreich), der freundlicherweise HepaRG-Zellen zur Verfügung gestellt hat. Wir danken Rita Appodia für die administrative Hilfe. Diese Arbeit wurde von MIUR- Ministero dell'istruzione, dell'université e della ricerca (FIRB 2011–2016 RBAP10XKNC) und der Universität Sapienza in Rom (prot. C26A13T8PS; Prot. C26A142MCH; Prot. C26A15LSXL).

Materials

Name Company Catalog Number Comments
Hyclone HyClone Fetal Clone II  GE Healthcare SH30066
William’s E medium with GlutaMAX  Thermofisher 32551087
Penicillin/streptomycin  SIGMA P4333
Insulin  SIGMA I9278
Hydrocortisone hemisuccinate SIGMA H2270
DMSO, dimethyl sulfoxide SIGMA D2438   
Sodium Oleate SIGMA O7501 
Methanol SIGMA 179337
Isopropanol SIGMA 278475
BODIPY 505/515 Thermofisher D3921
PBS Thermofisher 14190-250
Formaldehyde solution SIGMA 252549
RNAse free DNAseI Promega M198A 
Glass-bottomed dishes Willco Wells GWST-5040
Oil Red solution SIGMA O625
CellTiter 96 AQueous One Solution Promega  G3582
q-PCR oligo name Sequence
ACACB FOR CAAGCCGATCACCAAGAGTAAA
ACACB REV CCCTGAGTTATCAGAGGCTGG
β-actin FOR GCACTCTTCCAGCCTTCCT
β-actin REV AGGTCTTTGCGGATGTCCAC
ALBUMIN FOR TGCTTGAATGTGCTGATGACAGG
ALBUMIN REV AAGGCAAGTCAGCAGGCATCTCATC
ALDOB FOR GCATCTGTCAGCAGAATGGA 
ALDOB REV TAGACAGCAGCCAGGACCTT
APOB FOR CCTCCGTTTTGGTGGTAGAG
APOB REV  CCTAAAAGCTGGGAAGCTGA
APOC3 FOR CTCAGCTTCATGCAGGGTTA
APOC3 REV GGTGCTCCAGTAGTCTTTCAG
CPT1A FOR TCATCAAGAAATGTCGCACG
CPT1A REV GCCTCGTATGTGAGGCAAAA
CYP2E1 FOR TTGAAGCCTCTCGTTGACCC
CYP2E1 REV CGTGGTGGGATACAGCCAA
CYP3A4 FOR CTTCATCCAATGGACTGCATAAAT
CYP3A4 REV TCCCAAGTATAACACTCTACACAGACAA
GAPDH FOR TGACAACTTTGGTATCGTGGAAGG
GAPDH REV AGGGATGATGTTCTGGAGAGCC
GPAM FOR TCTTTGGGTTTGCGGAATGTT
GPAM REV ATGCACATCTCGCTCTTGAATAA
IL6 FOR CCTGAACCTTCCAAAGATGGC
IL6 REV ACCTCAAACTCCAAAAGACCAGTG
PDK4 FOR ACAGACAGGAAACCCAAGCCAC
PDK4 REV TGGAGGTGAGAAGGAACATACACG
PLIN2 FOR TTGCAGTTGCCAATACCTATGC
PLIN2 REV CCAGTCACAGTAGTCGTCACA
PLIN4 FOR AATGAGTTGGAGGGGCTGGGGGACATC
PLIN4 REV GGTCACCTAAACGAACGAAGTAGC
SCD FOR TCTAGCTCCTATACCACCACCA
SCD REV TCGTCTCCAACTTATCTCCTCC
SLC2A1 FOR TGCTCATCAACCGCAACGAG
SLC2A1 REV CCGACTCTCTTCCTTCATCTCCTG
18S FOR CGCCGCTAGAGGTGAAATTC
18S REV TTGGCAAATGCTTTCGCTC

DOWNLOAD MATERIALS LIST

References

  1. Starley, B. Q., Calcagno, C. J., Harrison, S. A. Nonalcoholic fatty liver disease and hepatocellular carcinoma: a weighty connection. Hepatology. 51, (5), 1820-1832 (2010).
  2. Byrne, C. D., Targher, G. NAFLD: a multisystem disease. Journal of Hepatology. 62, (1), Suppl 47-64 (2015).
  3. Marra, F., Gastaldelli, A., Svegliati Baroni, G., Tell, G., Tiribelli, C. Molecular basis and mechanisms of progression of non- alcoholic steatohepatitis. Trends in Molecular Medicine. 14, 72-81 (2008).
  4. Chalasani, N., et al. The diagnosis and management of nonalcoholic fatty liver disease: Practice guidance from the American Association for the Study of Liver Diseases. Hepatology. 67, (1), 328-357 (2018).
  5. Banini, B. A., Sanyal, A. J. Current and future pharmacologic treatment of nonalcoholic steatohepatitis. Current Opinion in Gastroenterology. 33, (3), 134-141 (2017).
  6. Takahashi, Y., Sugimoto, K., Inui, H., Fukusato, T. Current pharmacological therapies for nonalcoholic fatty liver disease/nonalcoholic steatohepatitis. World Journal of Gastroenterology. 21, (13), 3777-3785 (2015).
  7. Younossi, Z., et al. Global burden of NAFLD and NASH: trends, predictions, risk factors and prevention. Nature Reviews Gastroenterology & Hepatology. 15, (1), 11-20 (2018).
  8. Santhekadur, P. K., Kumar, D. P., Sanyal, A. J. Preclinical models of non-alcoholic fatty liver disease. Journal of Hepatology. 68, (2), 230-237 (2018).
  9. Nagarajan, P., Mahesh Kumar, M. J., Venkatesan, R., Majundar, S. S., Juyal, R. C. Genetically modified mouse models for the study of nonalcoholic fatty liver disease. World Journal of. Gastroenterology. 18, (11), 1141-1153 (2012).
  10. Oseini, A. M., Cole, B. K., Issa, D., Feaver, R. E., Sanyal, A. J. Translating scientific discovery: the need for preclinical models of nonalcoholic steatohepatitis. Hepatology International. 12, (1), 6-16 (2018).
  11. Ramboer, E., Vanhaecke, T., Rogiers, V., Vinken, M. Immortalized human hepatic cell lines for in vitro testing and research purposes. Methods in Molecular Biology. 1250, 53-76 (2015).
  12. Gómez-Lechón, M. J., Donato, M. T., Castell, J. V., Jover, R. Human hepatocytes in primary culture: the choice to investigate drug metabolism in man. Current Drug Metabolism. 5, (5), 443-462 (2004).
  13. Marion, M. J., Hantz, O., Durantel, D. The HepaRG cell line: biological properties and relevance as a tool for cell biology, drug metabolism, and virology studies. Methods in Molecular Biology. 640, 261-272 (2010).
  14. Gripon, P., et al. Infection of a human hepatoma cell line by hepatitis B virus. Proceedings of the National Academy of Sciences. 99, (24), 15655-15660 (2002).
  15. Anthérieu, S., Rogue, A., Fromenty, B., Guillouzo, A., Robin, M. A. Induction of vesicular steatosis by amiodarone and tetracycline is associated with up-regulation of lipogenic genes in HepaRG cells. Hepatology. 53, (6), 1895-1905 (2011).
  16. Rouge, A., et al. PPAR agonists reduce steatosis in oleic acid-overloaded HepaRG cells. Toxicology and Applied Pharmacology. 276, (1), 73-81 (2014).
  17. Belloni, L., et al. Targeting a phospho-STAT3-miRNAs pathway improves vesicular hepatic steatosis in an in vitro and in vivo model. Scientific Reports. 8, 13638 (2018).
  18. Nunn, A. D. G., et al. The histone deacetylase inhibiting drug Entinostat induces lipid accumulation in differentiated HepaRG cells. Scientific Reports. 6, 28025 (2016).
  19. Donato, M. T., et al. Cytometric analysis for drug-induced steatosis in HepG2 cells. Chemico-Biological Interactions. 181, (3), 417-423 (2009).
  20. Hellerer, T., Axäng, C., Brackmann, C., Hillertz, P., Pilon, M., Enejder, A. Monitoring of lipid storage in Caenorhabditis elegans using coherent anti-Stokes Raman scattering (CARS) microscopy. Proceedings of the National Academy of Sciences. 104, (37), 14658-14663 (2007).
  21. Le, T. T., Ziemba, A., Urasaki, Y., Brotman, S., Pizzorno, G. Label-free evaluation of hepatic microvesicular steatosis with multimodal coherent anti-Stokes Raman scattering microscopy. PLoS One. 7, (11), 51092 (2012).
  22. Guillouzo, A., Corlu, A., Aninat, C., Glaise, D., Morel, F., Guguen-Guillouzo, C. The human hepatoma HepaRG cells: a highly differentiated model for studies of liver metabolism and toxicity of xenobiotics. Chemico-Biological Interactions. 168, (1), 66-73 (2007).
  23. Nelson, L. J., et al. Human hepatic HepaRG cells maintain an organotypic phenotype with high intrinsic CYP450 Activity/metabolism and significantly outperform standard HepG2/C3A cells for pharmaceutical and therapeutic applications. Basic & Clinical Pharmacology & Toxicology. 120, (1), 30-37 (2017).
  24. Gerets, H. H. J., Tilmant, K., Gerin, B., Chanteux, H., Depelchin, B. O., Dhalluin, S., Atienzar, F. A. Characterization of primary human hepatocytes, HepG2 cells, and HepaRG cells at the mRNA level and CYP activity in response to inducers and their predictivity for the detection of human hepatotoxins. Cell Biology and Toxicology. 28, (2), 69-87 (2012).
  25. Pusl, T., et al. Free fatty acids sensitize hepatocytes to bile acid-induced apoptosis. Biochemical and Biophysical Research Communications. 371, (3), 441-445 (2008).
  26. Gentile, C. L., Pagliassotti, M. J. The role of fatty acids in the development and progression of nonalcoholic fatty liver disease. The Journal of Nutritional Biochemistry. 19, (9), 567-576 (2008).
  27. Mei, S., et al. Differential roles of unsaturated and saturated fatty acids on autophagy and apoptosis in hepatocytes. Journal of Pharmacological Experimental Therapy. 339, 487-498 (2011).
  28. Malhi, H., Bronk, S. F., Werneburg, N. W., Gores, G. J. Free fatty acids induce JNK-dependent hepatocyte lipoapoptosis. Journal of Biological Chemistry. 281, 12093-12101 (2006).
  29. Moravcová, A., Červinková, Z., Kučera, O., Mezera, V., Rychtrmoc, D., Lotková, H. The effect of oleic and palmitic acid on induction of steatosis and cytotoxicity on rat hepatocytes in primary culture. Physiological Research. 64, Suppl 5 627-636 (2015).
  30. Ohsaki, Y., Shinohara, Y., Suzuki, M., Fujimoto, T. A pitfall in using BODIPY dyes to label lipid droplets for fluorescence microscopy. Histochemistry and Cell Biology. 133, (4), 477-480 (2010).
  31. Rinia, H. A., Burger, K. N., Bonn, M., Müller, M. Quantitative label-free imaging of lipid composition and packing of individual cellular lipid droplets using multiplex CARS microscopy. Biophysical Journal. 95, (10), 4908-4914 (2008).
  32. Waschatko, G., Billecke, N., Schwendy, S., Jaurich, H., Bonn, M., Vilgis, T. A., Parekh, S. H. Label-free in situ imaging of oil body dynamics and chemistry in germination. Journal of The Royal Society Interface. 13, (123), (2016).
  33. Jüngst, C., Winterhalder, M. J., Zumbusch, A. Fast and long term lipid droplet tracking with CARS microscopy. Journal of Biophotonics. 4, (6), 435-441 (2011).
  34. Welte, M. A., Gould, A. P. Lipid droplet functions beyond energy storage. Biochimica et Biophysica Acta - Molecular and Cell Biology of Lipids. 1862, (10), Pt B 1260-1272 (2017).
  35. Cohen, S. Lipid droplets as organelles. International Review of Cell and Molecular Biology. 337, 83-110 (2018).
  36. Farese, R. V., Walther, T. C. Lipid droplets finally get a little R-E-S-P-E-C-T. Cell. 139, (5), 855-860 (2009).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics