Induzir e caracterizar a esteatose vesicular em células HepaRG diferenciadas

Medicine

Your institution must subscribe to JoVE's Medicine section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Neste estudo, nós descrevemos um protocolo detalhado para induzir o esteatose vesicular do fígado em pilhas diferenciadas de HepaRG com o oleato do sódio do sal do ácido gordo e empregamos métodos para a deteção e a quantificação da acumulação do lipido, incluindo anti-Stokes coerente Microscopia do espalhamento de Raman (carros), análise cytofluorimetric, mancha vermelha O do óleo, e qPCR.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Di Cocco, S., Belloni, L., Nunn, A. D., Salerno, D., Piconese, S., Levrero, M., Pediconi, N. Inducing and Characterizing Vesicular Steatosis in Differentiated HepaRG Cells. J. Vis. Exp. (149), e59843, doi:10.3791/59843 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

A esteatose hepática representa uma disfunção metabólica que resulta de um acúmulo de gotas lipídicas contendo triglicerídeos em hepatócitos. O acúmulo excessivo de gordura leva à doença hepática gordurosa não alcoólica (DHGNA), que é potencialmente reversível e pode evoluir para esteatohepatite não alcoólica (NASH) e, eventualmente, cirrose e carcinoma hepatocelular (HCC). Os mecanismos moleculares que ligam a acumulação lipídica em hepatócitos com a progressão para NASH, dano hepático irreversível, fibrose, cirrose e até mesmo HCC ainda permanecem obscuros. Para isso, vários modelos in vitro e in vivo foram desenvolvidos para elucidar os processos patológicos que causam a DHGNA. No presente estudo, descrevemos um modelo celular para a indução de esteatose vesicular hepática que consiste em células de HepaRG hepáticas humanas diferenciadas por DMSO tratadas com o oleato de sódio de sal de ácidos graxos. De fato, as células HepaRG tratadas com oleato de sódio acumulam gotas lipídicas no citoplasma e apresentam características típicas de esteatose. Este modelo in vitro humano representa uma alternativa valiosa aos modelos in vivo dos ratos assim como aos hepatocytes humanos preliminares. Também apresentamos uma comparação de vários métodos para a quantificação e avaliação do acúmulo de gordura em células de HepaRG, incluindo coloração de óleo vermelho O, medida de Bodipy citofluimétrica, análise metabólica da expressão gênica por qPCR e anti-Stokes coerente Microscopia de espalhamento Raman (CARS). A imagem latente dos carros combina a especificidade química da espectroscopia de Raman, uma técnica da análise química conhecida em aplicações da ciência dos materiais, com os benefícios das microscopias óticas de alta velocidade, de alta resolução não-lineares para permitir a precisão quantificação da acumulação lipídica e da dinâmica das gotas lipídicas. O estabelecimento de um modelo in vitro eficiente para a indução da esteatose vesicular, ao lado de um método exato para a quantificação e caracterização do acúmulo lipídico, poderia levar ao desenvolvimento do diagnóstico de fase precoce da DHGNA através da identificação de marcadores moleculares, e à geração de novas estratégias de tratamento.

Introduction

A esteatose hepática é definida como acúmulo de gordura intrahepática, dentro de gotas lipídicas contendo triglicerídeos, de pelo menos 5% do peso do fígado. O armazenamento hepático prolongado de lipídios é um processo potencialmente reversível, no entanto, pode levar a disfunção metabólica hepática, inflamação e formas avançadas de doença hepática gordurosa não alcoólica (DHGNA), a causa predominante de doença hepática crônica em muitas partes do o mundo1,2. A NAFLD é uma doença multifatorial que pode evoluir para a esteatohepatite não alcoólica mais agressiva (Nash), que por sua vez pode progredir para cirrose e, em pequena porcentagem de pacientes, para carcinoma hepatocelular (HCC)1,3. Nenhuma terapia aprovada está atualmente disponível como um tratamento específico para a NAFLD e a combinação de modificações de dieta e estilo de vida continua sendo o pilar da NAFLD e da gerência de Nash4,5,6.

Os mecanismos moleculars que conduzem ao desenvolvimento da esteatose hepatic na patogénese de NAFLD permanecem ainda para ser elucidados7. Neste contexto, modelos de camundongo foram desenvolvidos para estudar a progressão da doença da esteatose humana. Existe uma infinidade de modelos diferentes, e cada um tem suas vantagens e desvantagens, incluindo modelos genéticos, nutricionais e quimicamente induzidos combinando diferentes abordagens. Os ratos geneticamente modificados (transgênicos ou Knockout) desenvolvem espontaneamente a doença hepática. Entretanto, deve-se notar que estas mutações são muito raras nos seres humanos e o apagamento ou a excesso-expressão de um único gene (por exemplo, rato de OB/OB) não podem imitar a etiologia da doença humana multifatorial a nível molecular8,9. Da mesma forma, a doença adquirida por camundongos após manipulação dietética ou farmacológica pode não imitar os efeitos das dietas humanas associadas ao desenvolvimento da DHGNA no homem8. Os modelos animais têm, no entanto, facilitado a evolução na compreensão da DHGNA e essa abordagem é atualmente a estratégia mais freqüentemente utilizada na pesquisa laboratorial. No entanto, a replicação em humanos dos resultados obtidos em modelos animais tem falhado repetidamente, causando má tradução para a clínica10.

Portanto, os modelos in vitro da DHGNA podem desempenhar um papel fundamental na elucidação dos mecanismos moleculares da progressão da NAFLD, e representam uma ferramenta valiosa para a tela de um grande número de compostos. Culturas de células primárias, linhas celulares imortalizadas e biópsias hepáticas têm sido amplamente utilizadas para fins de pesquisa11. Os hepatócitos humanos preliminares assemelham-se pròxima às circunstâncias clínicas humanas, mas há um número limitado de doadores, e as culturas de pilha preliminares mostram a reprodutibilidade pobre devido à variabilidade das pilhas. Essas observações, juntamente com questões éticas e logísticas, resultaram no uso de hepatócitos primários humanos sendo limitados12. Assim, as linhas de célula hepatic representam uma alternativa conveniente, tendo diversas vantagens essenciais sobre a cultura preliminar, porque as linhas de pilha hepatic crescem firmemente, têm uma vida-extensão quase ilimitada, e têm um phenotype estável. Além disso, as linhas celulares são facilmente acessíveis e as condições de cultura das linhagens celulares hepáticas são mais simples do que as dos hepatócitos primários e são padronizadas entre os diferentes laboratórios.

Aqui, nós descrevemos em detalhe um modelo Cell-Based in vitro da esteatose vesicular do fígado, representada por pilhas diferenciadas hepatic do HepaRG tratadas com o oleate do sódio do ácido gordo. A linha celular de HepaRG foi estabelecida de um paciente fêmea afetado pela infecção da hepatite C e por um tumor bem diferenciado do fígado da classe de Edmondson mim14. A linha celular HepaRG é uma linhagem de células progenitoras bipotentes humanas capaz de diferenciar a exposição a 2% de sulfóxido de dimetil (DMSO) em direção a dois fenótipos de células diferentes: células semelhantes às das vias biliares e hepatócitos. As células de HepaRG diferenciadas (dHepaRG) compartilham algumas características e propriedades com hepatócitos adultos e possuem a capacidade de expressar de forma estável genes específicos do fígado, como albumina, AldolaseB, citocromo P450 2E1 (CYP2E1) e citocromo P450 3A4 (CYP3A4)13 (passo 3). O tratamento de células de dheparg com o oleato de sódio de sal de ácidos graxos (250 μm) por 5 dias levam à geração de gotas lipídicas citoplasmáticas, imitando os efeitos do fígado gordo14,15,17,18 ( Passo 4). A acumulação de gotas lipídicas pode ser facilmente detectada pela coloração de óleo vermelho O (passo 5), um corante lisocromo solúvel em gordura que mancha triglicérides neutros e lipídios vermelho-laranja. Para quantificar eficientemente os lipídios no dheparg gordo, aqui nós ilustramos a análise cytofluorimetric após a mancha com 4, 4-difluoro-1, 3, 5, 7-tetramethyl-4-Bora-3A, 4a-diaza-s-indacene (bodipy 505/515) (etapa 6), uma sonda fluorescente lipofílico a corpos lipídicos intracelulares e tem sido usado para rotular gotas lipídicas19. Além disso, aqui nós mostramos como avaliar a esteatose pela reacção em cadeia quantitativa do polymerase (qPCR) (etapa 7) desregulação da expressão de gene de diversos genes metabólicos em pilhas de dHepaRG. Para caracterizar e quantificar ainda mais o acúmulo de gotas lipídicas após o tratamento com oleato de sódio, realizou-se a microscopia de espalhamento Raman (CARS) coerente de anti-Stokes (etapa 8), uma técnica inovadora que possibilita a visualização e quantificação de gotas lipídicas sem rotulagem20,21.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. preparação de meios de cultura e reagentes

  1. Meio proliferating: suplemento de William E médio com GlutaMAX, 10% soro fetal bovino (FBS), 1% penicilina/estreptomicina, 5 μg/mL de insulina e 0,5 μM hidrocortisona hemisuccinato.
  2. Meio de diferenciação: suplemento de William E meio com GlutaMAX, 10% FBS, 1% penicilina/estreptomicina, 5 μg/mL de insulina, 50 μM de hidrocortisona hemisuccinato e 2% DMSO.
  3. Meio de congelação: suplemento proliferating médio com 10% DMSO.
  4. Oleato de sódio: dissolver em 99% metanol em uma concentração de 100 mM, agitar O/N, e armazenar a-20 ° c.
  5. Óleo vermelho O: Prepare uma solução de ações. Pesar 0,35 g de óleo vermelho O e dissolver em 100 mL de isopropanol. Mexa O/N, filtre (0,2 μm) e armazene em RT. Prepare uma solução de trabalho: misture 6 mL de solução Oil Red O stock com 4 mL de ddH2o. Deixe descansar à temperatura ambiente (RT) durante 20 min e, em seguida, filtre com um filtro de 0,2 μm. A filtração apropriada é altamente-recomendado para a mancha bem sucedida para evitar o fundo.
  6. Bodipy (505/515): dissolva a tintura de Bodipy (505/515) no DMSO em uma concentração de estoque de 100 μM, armazene a-20 ° c na obscuridade, e use-a em uma concentração final de 100 nanômetro.
  7. Adquira pratos transparentes de fundo de vidro para experimentos de carros.

2. descongelamento, amplificação e criopreservação de células HepaRG

  1. Células de HepaRG criopreservadas do nitrogênio do descongelamento imersando um grupo em um banho de 37 ° c até descongelado. Selecione um lote de passagem baixa (< 20). As células HepaRG estão disponíveis comercialmente.
  2. Transfira ràpida as pilhas em um tubo de 15 mL que contem 10 mL do meio proliferating e centrifugue por 5 minutos (200 x g, 4 ° c).
  3. Descarte o sobrenadante e resuma as células com 5 mL de meio proliferante.
  4. Contar as células e diluir a fim de chapa 2,5 x 104 células/cm2.
  5. Renovar o meio a cada 2 ou 3 dias. As células proliferam com um tempo de duplicação de cerca de 24 h.
  6. Desanexar células HepaRG quando em 80% confluência por 3-5 min incubação com solução de tripsina 0, 5%. Recolher as células em meio proliferating e centrifugar por 5 min (200 x g, 4 ° c).
  7. Descarte o sobrenadante e resuma as células com 5 mL de meio proliferante.
  8. Contar as células e diluir a fim de chapa 2,5 x 104 células/cm2.
  9. Nesta fase, amplificar as células, repetindo as etapas 2.5-2.8, a fim de alcançar um número adequado de células para iniciar experimentos, ou criopreservar como na etapa 2,10.
  10. Para criopreservar células HepaRG, separe as células 24 h após a plaqueamento por 3-5 min de incubação com solução de tripsina 0, 5%. Recolher as células em meio proliferating e centrifugar por 5 min (200 x g, 4 ° c). Descarte o sobrenadante, Ressuspender as células em 1 mL/lote de meio de congelação, 1,5 x 106 células/lote e crirepreservar os lotes em nitrogênio líquido.

3. diferenciação das células HepaRG (dia 0 – 21) (Figura 1A)

  1. Dia 0. Células HepaRG de sementes em baixa densidade (2,5 x 104 células/cm2) em pratos tratados com cultura com volume adequado de meio de proliferação (Figura 1B). Dois pratos precisam de ser chapeados para cada ensaio (mancha do óleo vermelho O, análise de FACS, qPCR): um para pilhas do controle e um para pilhas oleate-tratadas. Se a realização de medições CARS (passo 8), sementes as células em paralelo em transparente de fundo de vidro pratos. Como um controle, colher um prato não tratado (proliferating células dia 0) para realizar a análise da expressão gênica de genes marcador de diferenciação (ver passo 3,6).
  2. Dia 2 e dia 4. Mude o meio com o volume apropriado de meio de proliferação e deixe as células crescerem até a confluência.
  3. Dia 7. As células devem ser 100% confluentes (Figura 1C). Lave as células uma vez com 1x fosfato-tampão salino (PBS). Remover 1X PBS e adicionar um volume adequado de meio de diferenciação.
  4. Dia 8, 9, 12, 15, 18.  Lave as células uma vez com 1X PBS. Remover 1X PBS e adicionar um volume adequado de meio de diferenciação.
  5. Dia 21. Observar as células HepaRG um microscópio e garantir que as células sejam culturas diferenciadas confluentes (Figura 1D).
  6. Como controle, colher um prato de controle (células diferenciadas dia 21) para realizar a análise da expressão gênica (etapa 7) dos genes do marcador de diferenciação (Figura 1E).
  7. No dia 21, as células HepaRG diferenciadas podem ser criopreservadas em nitrogênio líquido.

4. indução da esteatose vesicular (dia 21 – 26)

  1. Dia 21. Diluir o oleato sódico (100 mM) com um volume adequado de meio de diferenciação completo a uma concentração final de 250 μM (1:400). Adicionar 99% metanol 1:400 (mesmo volume que o de oleato de sódio) em outra alíquota de meio de diferenciação para fazer o tratamento do veículo-controle. (Por exemplo: Adicionar 25 μL de oleato de sódio a 10 mL de meio e, em paralelo, adicionar 25 μL de 99% de metanol a 10 mL de meio). Lave as células uma vez com 1X PBS e adicione o meio de oleato de sódio ou veículo.
  2. Dia 23 e dia 25. Mude o meio com o volume apropriado de meio preparado na hora como na etapa 4,1.
  3. Dia 26. Observar pelo microscópio óptico que as gotas lipídicas se acumulam nas células tratadas com oleato de sódio e são facilmente visíveis como gotas translúcidas no citoplasma como na Figura 2A.

5. avaliação Desobrecarregamento de lipídios e indução de esteatose: óleo vermelho O coloração

  1. Lave-as pilhas uma vez com 1X PBS e remova 1X PBS completamente.
  2. Adicionar 4% paraformaldeído (diluído em 1X PBS) e incubar por 15 min em RT.
    Atenção: Paraformaldeído é tóxico, por isso esta etapa deve ser realizada em uma capa de fumaça, com equipamentos de proteção, incluindo luvas, um jaleco e uma máscara.
  3. Retire o paraformaldeído e lave as células duas vezes com 1X PBS. As células podem ser mantidas em 1X PBS a 4 ° c por um par de dias antes da coloração. Enrole com parafilm e cubra com folha de alumínio para impedir que as células de secagem.
  4. Remover 1X PBS. Incubar as células com isopropanol a 60% durante 5 min em RT.
  5. Remova o isopropanol e deixe as células secar completamente na RT.
  6. Adicionar óleo vermelho O solução de trabalho e incubar em RT por 30 min. O volume de solução de trabalho necessário para cada amostra corresponde ao volume de mídia utilizado para a cultura das células.
  7. Remova a solução Oil Red O e adicione imediatamente ddH2o. Lave as células 4 vezes com DDH2o.
  8. Adquira imagens o microscópio para análise (Figura 2B).
  9. Para eluir óleo vermelho O corante: Retire toda a água e deixe secar; Adicionar 1 mL de isopropanol a 100% e incubar durante 10 min com agitação suave na RT.
  10. Pipet o isopropanol com óleo eluída vermelho o tintura para cima e para baixo várias vezes, garantindo que todo o óleo vermelho o está na solução. Transfira a solução para uma cubeta. Medir OD500 nm por espectrofotometria e utilizar 100% de isopropanol em branco (Figura 2C).

6. avaliação da sobrecarga lipídica e indução de esteatose: coloração Bodipy e análise Citofluimétrica

  1. Lave as células uma vez com 1X PBS. Incubar com 100 nM de Bodipy diluído em 1X PBS no escuro por 40 min a 37 ° c. Um controle não manchado deve ser incluído nas medições de citometria de fluxo. A partir deste ponto, proteja as amostras da luz, tanto quanto possível.
    Nota: O volume de solução de coloração necessário para cada amostra corresponde ao volume de mídia utilizado para a cultura de células.
  2. Remova a solução de coloração e lave as células uma vez com 1X PBS. Prossiga para os passos 6.3-6.6. para a análise de FACS (classificação de célula ativada por fluorescência) ou para a etapa 6,7 para a imagem latente do microscópio.
  3. Raspe delicadamente as pilhas com 1X PBS e transfira-a em um tubo de 15 mL. Centrifugador por 10 min (200 x g, 4 ° c).
  4. Retire suavemente os sobrenadantes sem perturbar os pellets e lave com 3 mL de 1X PBS. Centrifugador por 5 min (200 x g, 4 ° c).
  5. Retire os sobrenadantes e ressuscitem em 300 μL de 1X PBS, em seguida, transfira para um tubo FACS.
  6. Meça imediatamente a intensidade da fluorescência de Bodipy pela análise cytofluorimetric com comprimentos de onda da excitação/emissão de 505/515 nanômetro (Figura 3A, B).
  7. Lave as células uma vez com 1X PBS e remover PBS completamente.
  8. Adicionar 4% paraformaldeído (diluído em 1X PBS) e incubar por 15 min em RT.
    Atenção: Paraformaldeído é tóxico, por isso esta etapa deve ser realizada em uma capa de fumaça, com equipamentos de proteção, incluindo luvas, um jaleco e uma máscara.
  9. Retire o paraformaldeído e lave as amostras 3x durante 5 min em PBS. As células podem ser mantidas em 1X PBS a 4 ° c ou fotografadas imediatamente (Figura 3c). Para armazenamento, enrole com parafilm e cubra com folha de alumínio para evitar que as células de secagem.

7. avaliação da sobrecarga lipídica e indução de esteatose: qPCR

  1. Lave as células uma vez com 1X PBS. Raspar as células com 1X PBS, centrifugar a 200 x g, e descartar o sobrenadante. Nesta etapa, as células podem ser colhidas em-80 ° c ou processadas como na etapa 7,2.
  2. Realize o isolamento total de RNA por métodos padrão usando reagentes comerciais seguindo as instruções do fabricante.
  3. Avalie a concentração do RNA pela medida espectrofotométrica UV, assegurando-se de que a pureza do RNA seja elevada (perto de 2,0) baseada na leitura A260/A280.
  4. Sintetizar cDNA a partir de 1 μg de RNA total com um kit de síntese de cDNA padrão.
  5. Diluir o cDNA para um volume final de 50 μL com H2O.
  6. Analisar cada amostra de cDNA em triplicado por qPCR: Prepare uma mistura Master qPCR (tabela 1) que é suficiente para as reações necessárias para cada primer, incluindo primers específicos para os três genes de limpeza como controles: gliceraldeide-3-fosfato deidrogenasi (GAPDH), actinB e ribossomal 18S (ver tabela de materiais para sequências de primer):
  7. Dispense 18 μL de mistura mestra por poço em uma placa multiparede de PCR.
  8. Adicione 2 μL de amostra de cDNA em cada poço. Sele a placa.
  9. Execute as amostras de acordo com a instrução Thermal cycler.

8. avaliação da sobrecarga lipídica e indução de esteatose: CARS

  1. Fixar as células previamente preparadas em pratos de fundo de vidro, conforme descrito nas etapas 5.1-5.3.
  2. Ligue um sistema de laser pulsado de picosegundo comercial sintonizável, ajustando-o para obter duas saídas de comprimentos de onda diferentes. A diferença de frequência entre as saídas deve ser de 2.840 cm-1 para gerar o sinal luminoso de carros intenso correspondente ao alongamento simétrico de metileno; para uma saída de comprimento de onda fixo a 1.064 nm (luz "Stokes"), o outro comprimento de onda deve ser ajustado para 817 nm ("Pump" Light).
  3. Assegure-se de que a saída de 817 nm seja espacialmente e temporalmente sobreposta com a saída de 1.064 nm: Use um espelho dicróico apropriado (ou seja, com um corte entre 817 e 1.064 nm) para combinar espacialmente as vigas e usar uma linha de retardo óptico para obter sobreposição temporal do laser Pulsos.
  4. Assegure-se de que os dois feixes copropagadores sejam collimados e que seus diâmetros tenham valores semelhantes que sejam apropriados para o sistema óptico dentro do microscópio que os focalizará na amostra; se necessário, Colime separadamente os feixes antes do espelho dichroic que os combina.
  5. Ligue um sistema comercial de microscópio invertido, que deve incluir uma unidade de digitalização a laser infravermelho e uma unidade de detecção de EPI de canal duplo vermelho/verde e alinhar os feixes de laser de copropagação na unidade de digitalização.
  6. Abrindo a unidade da deteção do EPI do duplo-canal, remova o cubo do filtro e substitua seu filtro da deteção do vermelho-comprimento de onda com um filtro do bandpass que possa selecionar o sinal de 2.840 cm-1 carros que é centrado em 663 nanômetro para a excitação da bomba/Stokes de 817/1064 nanômetro Esquema. Um filtro de largura de banda estreita (20 nm) é preferível para evitar a coleta de altos níveis de sinais de fundo fluorescentes.
  7. Coloc um prato no estágio do microscópio invertido dos carros, e usando um objetivo do óleo-imersão 100x, desloc a posição vertical do objetivo para centrar-se sobre as pilhas.
  8. Configure o software do microscópio para coletar imagens de alta resolução (1024 x 1024 pixels) em um campo de visão que abrange 127 μm x 127 μm.
  9. Defina o software do microscópio para adquirir e exibir continuamente imagens do campo de visão de 127 μm x 127 μm e verificar as imagens exibidas enquanto otimiza os parâmetros de coleta de imagem. Assegure-se de que os poderes do laser estejam equilibrados para a coleção rápida da imagem e o dano mínimo, introduzindo filtros apropriados da neutro-densidade nos trajetos do feixe como necessário, e selecione um tempo de permanência do pixel que permita a coleção das imagens com um bom sinal-à-ruído as condições de energia laser selecionadas.
  10. Adquirir e salvar imagens de vários campos de visão diferentes dentro do prato as condições otimizadas. Opcionalmente, as imagens da fluorescência do multifotônica, geradas por uma emissão do verde-comprimento de onda (na maior parte da excitação do dois-fotão em 817 nanômetro), podem simultaneamente ser coletadas através do outro detector do EPI. Repita os passos 8.7-8.10 para cada prato.
  11. Para a análise de imagem CARS, processe imagens usando a implementação de FIJI do ImageJ. Opere a função de despeckle (ou uma ferramenta de denoising similar) em cada imagem antes da análise mais adicional para melhorar relações sinal-à-ruído sem perda de detalhe.
  12. Use FIJI para selecionar células manualmente e, em seguida, contar automaticamente as gotas lipídicas dentro de células individuais segmentadas para produzir estatísticas sobre as áreas de gotas lipídicas e números para cada célula e para todo o conjunto de dados de imagem para cada prato.

9. ensaio de viabilidade celular MTT

  1. Placas diferenciadas de células HepaRG em uma placa 96-well com uma densidade de 1 x 105 células/bem em um volume final de 100 μl de meio de cultura de diferenciação.
  2. 24 h após a semeadura, tratar as células com 99% de metanol (veículo) e com 100 μM, 250 μM e 500 μM de oleato de sódio e palmitato de sódio diluído em 100 μL de meio de cultura de diferenciação/bem em triplicado.
  3. Alterar o meio com 99% de metanol e com 100 μM, 250 μM e 500 μM de oleato de sódio e palmitato de sódio diluído em 100 μL de meio de cultura de diferenciação/bem a cada 24 h.
  4. 96 h após o tratamento com metanol/oleato de sódio/palmitato de sódio, tratar as células com doxorrubicina 2 μM diluída em 100 μL de meio de cultura de diferenciação/bem em triplicado como controle.
  5. 18 h após o tratamento com doxorubucina, mude o meio com 100 μL de meio de cultura de diferenciação.
  6. Pipet 20 μL de 3-(4, 5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-reagente MTT do Tetrazolium (tabela dos materiais) em cada poço da placa do ensaio 96-well que contem as pilhas em 100 μl do meio de cultura da diferenciação . Inclua um controle do fundo introduzindo com pipting 20 μL do reagente em um poço de controle sem pilhas em 100 μL do meio de cultura da diferenciação no Triplicate.
  7. Incubar a placa em 37 ° c em uma atmosfera humidificada, de 5% CO2 .
  8. Após incubação de 30, 60 e 90 min com reagente de MTT tetrazólio, registre a absorvência em 490 nm usando um leitor de placas de 96 poços. Subtrair a absorvência de fundo dos poços de controle sem célula dos valores de absorvância para as outras amostras.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Este protocolo descreve um método eficiente para induzir e caracterizar o esteatose vesicular em pilhas DMSO-diferenciadas de heparg pelo tratamento do oleato do sódio (Figura 1a).

Diferenciação de células HepaRG.
Para induzir de forma eficiente a diferenciação, as células proliferantes devem ser semeadas em baixa densidade (2,5 x 104 células/cm2) no meio de proliferação. Quando semeadas em baixa densidade, as células dividem-se ativamente e adquirem uma morfologia alongada indiferenciada (Figura 1B). As células devem ser deixadas para crescer no meio de proliferação por 7 dias, até que se alcançam 100% de confluência (Figura 1C). Após a exposição a 2% DMSO, as células começam a se diferenciar e a formar colônias típicas de hepatócitos, rodeadas por células epiteliais biliares-semelhantes (Figura 1D). Células HepaRG diferenciadas expressam marcadores hepato-específicos, como albumina, Cyp3A4 e aldolase B. Para verificar a diferenciação adequada, os níveis de expressão desses genes de marcadores hepáticos nas células diferenciadas (dia 21) e nas células proliferantes (dia 0) foram analisados por qPCR (Figura 1e). Os genes albumina, Cyp3A4 e aldolase B devem ser upregulados nas células HepaRG diferenciadas em comparação com as células HepaRG proliferantes, e observamos essa tendência, confirmando a efetividade do nosso protocolo de diferenciação.

Indução da esteatose vesicular em células HepaRG por tratamento com oleato de sódio.
O tratamento oleato de sódio de células de dHepaRG induz acúmulo de gordura, visível um microscópio óptico como gotas lipídicas nos citoplasmas (Figura 2a). Para verificar a indução eficiente da esteatose, as células de HepaRG tratadas com oleato e controle foram coradas com corante óleo vermelho O. Após a coloração, as gotas lipídicas são facilmente visíveis como gotas vermelhas (Figura 2B) e podem ser quantificadas por medida espectrofotométrica de óleo vermelho O corante eluída com isopropanol (Figura 2C). A absorvência do óleo eluída vermelho o das pilhas é diretamente proporcional à acumulação cytoplasmic do gota do lipido.

A concentração de oleato de sódio e o tempo de exposição foram determinados pelo ensaio de viabilidade da célula colorimétrica MTT (etapa 9). O tratamento com oleato de sódio foi comparado ao tratamento com palmitato de sódio e o fármaco apoptótico doxorubucin (2 μM) foi utilizado como controle (Figura 2D). A citoxidade dos compostos foi avaliada pelo MTT, aproveitando-se de um composto comercial (tabela de materiais), que contém o MTT tetrazólio. O composto amarelo solúvel em água do tetrazólio de MTT é bioreduced por pilhas metabolicamente ativas em um produto de formazan água-insolúvel roxo. O produto formazan é quantificado pela sua absorbância a 490 nm e a quantidade é diretamente proporcional ao número de células vivas na cultura (Figura 2D).

Quantificação da esteatose vesicular em células HepaRG tratadas com oleato de sódio
Para quantificar o aumento do conteúdo lipídico celular após o tratamento com oleato de sódio, realizamos coloração com corante Bodipy, uma sonda que rotula gotas lipídicas. Utilizando-se a análise citofluométrica, é possível quantificar o teor de triglicerídeos pela intensidade fluorescente média de Bodipy, que é maior em células tratadas com oleato em comparação às células de controle (Figura 3A, B), indicando gordura eficiente acumulação após o tratamento com oleato. De fato, imagens de células manchadas de Bodipy mostram gotas lipídicas fluorescentes verdes brilhantes em células tratadas com oleato que não são visíveis nas células de controle (Figura 3C).

O tratamento oleato de sódio de células dHepaRG desegulates metabolismo lipídico e expressão gênica inflamatória. Para avaliar a indução eficiente da esteatose vesicular, analisamos por qPCR os níveis de expressão de genes selecionados em células tratadas com oleato de sódio em comparação com as células de controle (Figura 4). Acetil-CoA carboxilase beta (ACACB), glicerol-3-fosfato aciltransferase mitocondrial (gpam), perilipins (PLIN2, PLIN4), apolipoproteína B (apob), piruvato desidrogenase quinase isozyme 4 (PDK4), carnitina palmitoyltransferase 1a (CPT1A) e o interleucina 6 (IL6) foi upregulated em pilhas oleate-tratadas de dheparg, visto que o membro 1 da família 2 do portador do soluto (SLC2A1), o apolipoproteína C-III (APOC3), e o desaturase de stearoyl-COA (SCD) foram downregulamentada (Figura 4). Para caracterizar e quantificar ainda mais o armazenamento lipídico em gotas após adição de oleato de sódio a células HepaRG diferenciadas, utilizamos uma técnica de microscopia inovadora, microscopia coerente de dispersão Raman anti-Stokes (CARS), que possibilita visualização e quantificação de gotículas lipídicas sem rotulagem (Figura 5A). As gotas lipídicas foram quantificadas estatisticamente em termos de números, distribuição e morfologia no nível de célula única usando imagens CARS. O tratamento com oleato de sódio (250 μm) induziu um aumento significativo no número de gotas lipídicas (Figura 5B), o que levou a uma maior área de gotículas totais por célula (Figura 5C) e uma área de gota percentual maior por célula ( Figura 5D), em comparação com as células de controle, indicando que as células dheparg acumularam eficientemente a gordura após o tratamento com oleato de sódio.

Figure 1
Figura 1 : Diferenciação de células HepaRG. A) diagrama representativo que mostra o protocolo de diferenciação/tratamento de células heparg, conforme descrito nas etapas 3 e 4. (B-D) Imagens que mostram células de HepaRG proliferating não manchadas no dia 0 após a semeadura (B), no dia 7 da confluência após a semeadura (C), e Heparg diferenciado (dheparg) no dia 21 após a semeadura (D). (E) o RNA total foi extraído das pilhas proliferating e de dHepaRG, o cDNA foi sintetizado e analisado por qPCR usando os primers específicos para os genes indicados (tabela dos materiais). As amostras foram normalizadas para a média de genes de limpeza de GAPDH, actinB e ribossomal 18S. Os histogramas mostram a indução da dobra de proliferating (dia 0) contra pilhas diferenciadas (dia 21) (as barras indicam o S.D.; os valores de p foram computados por t-testes de Student). Por favor clique aqui para ver uma versão maior desta figura.

Figure 2
Figura 2 : O tratamento do oleato do sódio de pilhas de dHepaRG induziu a acumulação da gota do lipido. (A) imagens de células heparg diferenciadas não manchadas (dheparg) tratadas por 5 dias com veículo (controle) (imagem à esquerda) ou com oleato de sódio a 250 μm (imagem à direita). (B) após o tratamento, as células foram coradas com óleo vermelho o corante; gotículas lipídicas são visíveis em vermelho. (C) óleo vermelho O corante foi eluída e OD foi medido em 570 nm. Os resultados são expressos como meio de três experimentos independentes (barras indicam S.D.; valor de p pelo teste t de Student). (D) avaliação da viabilidade celular do veículo das células dHepaRG (99% metanol) Tratado (Ctrl) ou tratado por 5 dias com oleato de sódio e palmitato de sódio (100 μm, 250 μm ou 500 μm), ou Tratado 18 h com doxorubucina (2 μm).  A avaliação da citotoxicidade foi realizada por meio de um kit de ensaio MTT (tabela de materiais), registrando a absorvência a 490 nm, de acordo com a instrução do fabricante. Os resultados são expressos como meio de três experimentos independentes (barras indicam S.D.; os valores de p foram determinados por meio do teste t de Student: * 0, 1 ≤ p < 0, 5; * * 0, 1 ≤ p < 0, 1; * * * p < 0, 1). Por favor clique aqui para ver uma versão maior desta figura.

Figure 3
Figura 3 : Quantificação da acumulação gorda após o tratamento oleato do sódio pela mancha de bodipy. As pilhas diferenciadas de HepaRG (dHepaRG) foram tratadas com o veículo (controle) ou com o oleato do sódio do 250-μM por 5 dias. Após o tratamento, as células de dHepaRG foram coradas com corante Bodipy e analisadas por citometria de fluxo. (A) perfis de sobreposição representativos (% do máximo: percentagem da intensidade máxima de coloração). (B) histogramas mostram a intensidade média de fluorescência (MFI) como percentual de células tratadas sobre o controle de três experimentos independentes (barras indicam S.D.; os valores de p foram determinados usando o teste t de Student: * 0, 1 ≤ p < 0, 5; * * 0, 1 ≤ p < 0, 1; * * * p < 0, 1). (C) as células foram fixadas com paraformaldeído a 4%. Imagens mostram gotículas lipídicas manchadas de Bodipy em verde. Por favor clique aqui para ver uma versão maior desta figura.

Figure 4
Figura 4 : O tratamento de oleato de sódio de células de dHepaRG induz a desregulação do metabolismo lipídico e da expressão gênica inflamatória. As pilhas diferenciadas de HepaRG (dHepaRG) foram tratadas com o veículo (controle) ou com o oleato do sódio do 250-μM por 5 dias. os cDNAs foram analisados por qPCR com primers específicos para os genes indicados e os resultados foram normalizados para a média dos genes de limpeza de GAPDH, actinB e ribossomal 18S; os primers são fornecidos na tabela de materiais. O histograma mostra os níveis de expressão dos genes indicados como induções de dobra das células tratadas sobre o controle (as barras indicam S.D.; os valores de p foram calculados pelo teste t de Student). Por favor clique aqui para ver uma versão maior desta figura.

Figure 5
Figura 5 : Caracterização da acumulação de gotas lipídicas após o tratamento com oleato de sódio pela microscopia Cars. As células de HepaRG diferenciadas (dHepaRG) foram tratadas com veículo (controle) ou com oleato de sódio a 250 μM por 5 dias e analisadas por microscopia de carros. (A) imagens representativas que mostram o contraste dos carros com gotas lipídicas em vermelho. (B) histograma mostrando o número de gotículas lipídicas por célula. (C) histogramas mostrando a área total da imagem coberta por gotas por célula. (D) histograma mostrando% de área de gotículas cobertas por gotas por célula. Todos os resultados são expressos como meio de três experimentos independentes (barras indicam S.E.; os valores de p foram determinados pelo teste t de Student: * 0, 1 ≤ p < 0, 5; * * 0, 1 ≤ p < 0, 1; * * * p < 0, 1). Por favor clique aqui para ver uma versão maior desta figura.

Reagentes Volume (μL) para uma única reacção
2x SYBR verde fluorescente corante 10
PCR grau H2O 6
Primer dianteiro (μM) 1
Primer reverso (μM) 1

Tabela 1: Mix mestre qPCR.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Este protocolo descreve como diferenciar as células HepaRG e como induzir a esteatose vesicular pelo tratamento oleato de sódio (Figura 1A). Com efeito, em comparação com outras linhagens celulares de carcinoma hepatocelular humano (HCC), a linha celular heparg apresenta características de hepatócitos humanos adultos, representando uma valiosa alternativa aos hepatócitos humanos primários cultivados ex vivo13,14 ,15. A linha celular heparg tem sido amplamente utilizada para estudos de citotoxicidade hepática, metabolismo de fármacos e estudos de virologia15,16,22.

Em comparação com as células heparg, outras linhagens celulares de HCC, como HepG2, HUH7, HUH6 e Hep3B, apresentam menor capacidade metabólica, faltando um conjunto substancial de funções específicas do fígado23,24e exibindo um nível basal mais alto de acúmulo de gordura citosólica armazenada em gotas lipídicas. Assim, estas linhagens celulares de HCC são menos úteis como modelos para indução de esteatose vesicular após sobrecarga lipídica do que a linha celular HepaRG.

Etapas críticas dentro do protocolo
Quando semeadas em baixa densidade (2,5 x 104 células/cm2), as células heparg adquirem uma morfologia não diferenciada alongada, dividindo-se ativamente; Depois de atingir 100% de confluência, eles são capazes de diferenciar a exposição a 2% DMSO e formam colônias típicas de hepatócitos, rodeadas por células epiteliais semelhantes às biliares (Figura 1D). Esta cultura misturada da pilha biliar/Hepatocyte recapitula características do tecido do fígado, assemelhando-se a uma condição physiological, apesar de faltar outros tipos da pilha de fígado (sinusoidal ou Kupffer).

Um passo crítico no processo de diferenciação é a confluência das células. As células devem ser semeadas em baixa densidade (2,5 x 104 células/cm2) (Figura 1B) e autorizadas a crescer ativamente no meio de proliferação por pelo menos 1 semana (dia 0-7). No dia 7, antes de adicionar 2% de DMSO para iniciar o processo de diferenciação, as células devem estar em 100% de confluência (Figura 1C). Se no dia 7 (passo 2,2) confluência completa não foi atingido, é altamente recomendável que as células são autorizados a continuar a crescer no meio de proliferação para alguns dias adicionais, até 100% confluência é alcançada.

Limitações do protocolo
Observou-se que, após a adição de meio de diferenciação, algumas células sofrem, e tipicamente 10% das células morrem durante os subseqüentes 2-3 dias. Nesta fase, a lavagem diária e a mudança média (etapa 2,4) devem ser continuadas a rejeitar pilhas inoperantes de flutuação. O uso de um FBS específico (tabela de materiais) para complementar a mídia de diferenciação e proliferação, deve aumentar a eficiência de diferenciação e menor morte celular durante os dias 7-21 (etapa 2,4). É altamente recomendável manter as células até a passagem 20, e escolher passagens inferiores (< 20) para diferenciar as células: menos células de morte ocorre para as células mais jovens HepaRG. Além disso, a diferenciação de HepaRG parece ser mais eficaz em pratos de 35 mm e 60 mm, enquanto as células tendem a sofrer mais quando semeadas nos pratos de 100 mm e 150 mm.

Modificações e solução de problemas
A exposição a diferentes proporções de ácidos graxos palpático e oleico demonstrou resultar na formação de gotas lipídicas intracitoplasmáticas25,26. No entanto, observou-se que o tratamento oleato de sódio de células HepaRG diferenciadas apresentou melhores resultados do que a exposição ao ácido palpático, em termos de indução eficiente do acúmulo lipídico e da viabilidade celular (Figura 2D). De fato, o tratamento com ácido palpático mostrou-se tóxico para as células HepaRG diferenciadas (Figura 2D), de acordo com dados da literatura sobre linhagens celulares de hepatoma e sobre as culturas primárias de hepatócitos humanos e de ratos que descrevem o ácido palpático como um Agente consideravelmente citotóxico25,26, 27,28,29. Além disso, a utilização de palmitato em ensaios baseados em células é desafiadora devido à sua baixa solubilidade. No entanto, devido à variabilidade intrínseca das linhagens celulares, recomenda-se verificar a concentração de trabalho de oleato de sódio e o comprimento do tempo de tratamento, testando diferentes concentrações em um experimento de tempo-curso com um ensaio de viabilidade celular.

Significância e comparação de técnicas de detecção de lipídios
A determinação exata de quantidades do lipido nas pilhas foi estabelecida através de um número de aproximações diferentes neste estudo. Observou-se concordância qualitativa e também aproximadamente quantitativa entre os resultados obtidos por meio da coloração Oil Red O, coloração de Bodipy e imagem de CARS. Para uma estimativa rápida de quantidades lipídicas em populações de células, o uso de citometria de fluxo de Bodipy ou uma mancha como óleo vermelho O é ideal. Para uma examinação mais detalhada do índice do gota do lipido das pilhas, uma modalidade da imagem latente é preferida. Além disso, foram relatados problemas de especificidade para manchas lipídicas, como Oil Red o20,30, e observamos que, em alguns casos, a mancha bodipy tem uma menor capacidade do que os carros para rotular exclusivamente gotículas lipídicas entre outras células organelas (dados não mostrados). Portanto, o uso de uma técnica de imagem microscópica sem rótulo, como o CARS, oferece vantagens significativas para a quantificação e caracterização da esteatose. A evitação do uso de uma grande etiqueta fluorescente faz a imagem latente dos carros favorável devido ao tamanho pequeno de moléculas do lipido comparada aos Fluorophores típicos; Portanto, para a detecção de lipídios, métodos sem rótulo são desejáveis, ainda mais do que para observar grandes moléculas proteicas. O sinal de lipídios CARS é uma emissão óptica que é gerada somente quando ocorre uma interação não linear na amostra. Essa interação só pode ser detectada quando a diferença entre as frequências dos dois lasers de excitação focados na amostra coincide com a frequência vibracional de alongamento de metileno (CH2). A abundância de grupos de metileno em lipídios resulta em sinais muito intensos com altas proporções de sinal-ruído, e a não linearidade da interação óptica também significa que a alta resolução espacial é possível na microscopia de carros. A excelente qualidade das imagens do CARS em geral permite a coleta de estatísticas sobre os tamanhos e números de gotas lipídicas, como demonstrado neste estudo. Além disso, outros estudos demonstraram o uso da microscopia CARS para correlacionar diferentes localizações subcelulares e tamanhos de gotículas lipídicas com diferentes tratamentos18, e usando medições suplementares de Cars em diferentes comprimentos de onda, ou um carro de banda larga ou similar estimulado Raman abordagem, os pesquisadores mostraram que é possível caracterizar diferentes tipos de ácidos graxos dentro de gotas lipídicas31,32. Além disso, a rapidez da coleta de imagens do CARS permitiu a imagem in situ de células ao vivo para examinar a evolução temporal do crescimento da gota lipídica e da agregação33.

Aplicações futuras
Nas últimas décadas, os pontos de vista sobre os papéis e funções das gotas lipídicas na biologia celular evoluíram. Previamente pensado para ser basicamente vesículas de armazenamento inerte, eles agora são entendidos como organelles celulares altamente dinâmicos, e seu papel na doença é cada vez mais reconhecido34,35,36. Embora no caso da doença hepática, a acumulação lipídica (esteatose) tem sido conhecida por ser um aspecto crítico, o mecanismo preciso do envolvimento de gotas lipídicas na progressão da doença não é completamente claro. Portanto, métodos como o CARS que podem caracterizar o comportamento dinâmico das gotas lipídicas são de importância crucial para o desenvolvimento de uma compreensão molecular de doenças, incluindo a DHGNA. A análise metabólica da expressão gênica por qPCR é altamente complementar à imagem molecular de lipídios via Cars, como demonstrado em estudos anteriores17,18, permitindo insights mais profundos sobre os mecanismos da doença. No presente estudo, observamos acúmulo de ácidos graxos com desregulação do metabolismo lipídico e expressão gênica inflamatória, o que pode contribuir para a construção de um painel de biomarcadores para o diagnóstico precoce da doença.

O modelo baseado em células de dHepaRG tratado com oleato de sódio pode aumentar o conhecimento dos mecanismos moleculares envolvidos não apenas no início, mas também na progressão da DHGNA, proporcionando uma base para o desenvolvimento de melhores abordagens terapêuticas para a doença.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Os autores declaram que não têm interesses financeiros concorrentes.

Acknowledgments

Agradecemos ao Prof. Christian trepo (INSERM U871, Lyon, França), que gentilmente forneceu células HepaRG. Agradecemos a Rita Appodia pela ajuda administrativa. Este trabalho foi apoiado por MIUR-Ministero dell' istruzione, dell' Università e della ricerca (FIRB 2011 – 2016 RBAP10XKNC) e Universidade Sapienza de Roma (Prot. C26A13T8PS; Prot. C26A142MCH; Prot. C26A15LSXL).

Materials

Name Company Catalog Number Comments
Hyclone HyClone Fetal Clone II  GE Healthcare SH30066
William’s E medium with GlutaMAX  Thermofisher 32551087
Penicillin/streptomycin  SIGMA P4333
Insulin  SIGMA I9278
Hydrocortisone hemisuccinate SIGMA H2270
DMSO, dimethyl sulfoxide SIGMA D2438   
Sodium Oleate SIGMA O7501 
Methanol SIGMA 179337
Isopropanol SIGMA 278475
BODIPY 505/515 Thermofisher D3921
PBS Thermofisher 14190-250
Formaldehyde solution SIGMA 252549
RNAse free DNAseI Promega M198A 
Glass-bottomed dishes Willco Wells GWST-5040
Oil Red solution SIGMA O625
CellTiter 96 AQueous One Solution Promega  G3582
q-PCR oligo name Sequence
ACACB FOR CAAGCCGATCACCAAGAGTAAA
ACACB REV CCCTGAGTTATCAGAGGCTGG
β-actin FOR GCACTCTTCCAGCCTTCCT
β-actin REV AGGTCTTTGCGGATGTCCAC
ALBUMIN FOR TGCTTGAATGTGCTGATGACAGG
ALBUMIN REV AAGGCAAGTCAGCAGGCATCTCATC
ALDOB FOR GCATCTGTCAGCAGAATGGA 
ALDOB REV TAGACAGCAGCCAGGACCTT
APOB FOR CCTCCGTTTTGGTGGTAGAG
APOB REV  CCTAAAAGCTGGGAAGCTGA
APOC3 FOR CTCAGCTTCATGCAGGGTTA
APOC3 REV GGTGCTCCAGTAGTCTTTCAG
CPT1A FOR TCATCAAGAAATGTCGCACG
CPT1A REV GCCTCGTATGTGAGGCAAAA
CYP2E1 FOR TTGAAGCCTCTCGTTGACCC
CYP2E1 REV CGTGGTGGGATACAGCCAA
CYP3A4 FOR CTTCATCCAATGGACTGCATAAAT
CYP3A4 REV TCCCAAGTATAACACTCTACACAGACAA
GAPDH FOR TGACAACTTTGGTATCGTGGAAGG
GAPDH REV AGGGATGATGTTCTGGAGAGCC
GPAM FOR TCTTTGGGTTTGCGGAATGTT
GPAM REV ATGCACATCTCGCTCTTGAATAA
IL6 FOR CCTGAACCTTCCAAAGATGGC
IL6 REV ACCTCAAACTCCAAAAGACCAGTG
PDK4 FOR ACAGACAGGAAACCCAAGCCAC
PDK4 REV TGGAGGTGAGAAGGAACATACACG
PLIN2 FOR TTGCAGTTGCCAATACCTATGC
PLIN2 REV CCAGTCACAGTAGTCGTCACA
PLIN4 FOR AATGAGTTGGAGGGGCTGGGGGACATC
PLIN4 REV GGTCACCTAAACGAACGAAGTAGC
SCD FOR TCTAGCTCCTATACCACCACCA
SCD REV TCGTCTCCAACTTATCTCCTCC
SLC2A1 FOR TGCTCATCAACCGCAACGAG
SLC2A1 REV CCGACTCTCTTCCTTCATCTCCTG
18S FOR CGCCGCTAGAGGTGAAATTC
18S REV TTGGCAAATGCTTTCGCTC

DOWNLOAD MATERIALS LIST

References

  1. Starley, B. Q., Calcagno, C. J., Harrison, S. A. Nonalcoholic fatty liver disease and hepatocellular carcinoma: a weighty connection. Hepatology. 51, (5), 1820-1832 (2010).
  2. Byrne, C. D., Targher, G. NAFLD: a multisystem disease. Journal of Hepatology. 62, (1), Suppl 47-64 (2015).
  3. Marra, F., Gastaldelli, A., Svegliati Baroni, G., Tell, G., Tiribelli, C. Molecular basis and mechanisms of progression of non- alcoholic steatohepatitis. Trends in Molecular Medicine. 14, 72-81 (2008).
  4. Chalasani, N., et al. The diagnosis and management of nonalcoholic fatty liver disease: Practice guidance from the American Association for the Study of Liver Diseases. Hepatology. 67, (1), 328-357 (2018).
  5. Banini, B. A., Sanyal, A. J. Current and future pharmacologic treatment of nonalcoholic steatohepatitis. Current Opinion in Gastroenterology. 33, (3), 134-141 (2017).
  6. Takahashi, Y., Sugimoto, K., Inui, H., Fukusato, T. Current pharmacological therapies for nonalcoholic fatty liver disease/nonalcoholic steatohepatitis. World Journal of Gastroenterology. 21, (13), 3777-3785 (2015).
  7. Younossi, Z., et al. Global burden of NAFLD and NASH: trends, predictions, risk factors and prevention. Nature Reviews Gastroenterology & Hepatology. 15, (1), 11-20 (2018).
  8. Santhekadur, P. K., Kumar, D. P., Sanyal, A. J. Preclinical models of non-alcoholic fatty liver disease. Journal of Hepatology. 68, (2), 230-237 (2018).
  9. Nagarajan, P., Mahesh Kumar, M. J., Venkatesan, R., Majundar, S. S., Juyal, R. C. Genetically modified mouse models for the study of nonalcoholic fatty liver disease. World Journal of. Gastroenterology. 18, (11), 1141-1153 (2012).
  10. Oseini, A. M., Cole, B. K., Issa, D., Feaver, R. E., Sanyal, A. J. Translating scientific discovery: the need for preclinical models of nonalcoholic steatohepatitis. Hepatology International. 12, (1), 6-16 (2018).
  11. Ramboer, E., Vanhaecke, T., Rogiers, V., Vinken, M. Immortalized human hepatic cell lines for in vitro testing and research purposes. Methods in Molecular Biology. 1250, 53-76 (2015).
  12. Gómez-Lechón, M. J., Donato, M. T., Castell, J. V., Jover, R. Human hepatocytes in primary culture: the choice to investigate drug metabolism in man. Current Drug Metabolism. 5, (5), 443-462 (2004).
  13. Marion, M. J., Hantz, O., Durantel, D. The HepaRG cell line: biological properties and relevance as a tool for cell biology, drug metabolism, and virology studies. Methods in Molecular Biology. 640, 261-272 (2010).
  14. Gripon, P., et al. Infection of a human hepatoma cell line by hepatitis B virus. Proceedings of the National Academy of Sciences. 99, (24), 15655-15660 (2002).
  15. Anthérieu, S., Rogue, A., Fromenty, B., Guillouzo, A., Robin, M. A. Induction of vesicular steatosis by amiodarone and tetracycline is associated with up-regulation of lipogenic genes in HepaRG cells. Hepatology. 53, (6), 1895-1905 (2011).
  16. Rouge, A., et al. PPAR agonists reduce steatosis in oleic acid-overloaded HepaRG cells. Toxicology and Applied Pharmacology. 276, (1), 73-81 (2014).
  17. Belloni, L., et al. Targeting a phospho-STAT3-miRNAs pathway improves vesicular hepatic steatosis in an in vitro and in vivo model. Scientific Reports. 8, 13638 (2018).
  18. Nunn, A. D. G., et al. The histone deacetylase inhibiting drug Entinostat induces lipid accumulation in differentiated HepaRG cells. Scientific Reports. 6, 28025 (2016).
  19. Donato, M. T., et al. Cytometric analysis for drug-induced steatosis in HepG2 cells. Chemico-Biological Interactions. 181, (3), 417-423 (2009).
  20. Hellerer, T., Axäng, C., Brackmann, C., Hillertz, P., Pilon, M., Enejder, A. Monitoring of lipid storage in Caenorhabditis elegans using coherent anti-Stokes Raman scattering (CARS) microscopy. Proceedings of the National Academy of Sciences. 104, (37), 14658-14663 (2007).
  21. Le, T. T., Ziemba, A., Urasaki, Y., Brotman, S., Pizzorno, G. Label-free evaluation of hepatic microvesicular steatosis with multimodal coherent anti-Stokes Raman scattering microscopy. PLoS One. 7, (11), 51092 (2012).
  22. Guillouzo, A., Corlu, A., Aninat, C., Glaise, D., Morel, F., Guguen-Guillouzo, C. The human hepatoma HepaRG cells: a highly differentiated model for studies of liver metabolism and toxicity of xenobiotics. Chemico-Biological Interactions. 168, (1), 66-73 (2007).
  23. Nelson, L. J., et al. Human hepatic HepaRG cells maintain an organotypic phenotype with high intrinsic CYP450 Activity/metabolism and significantly outperform standard HepG2/C3A cells for pharmaceutical and therapeutic applications. Basic & Clinical Pharmacology & Toxicology. 120, (1), 30-37 (2017).
  24. Gerets, H. H. J., Tilmant, K., Gerin, B., Chanteux, H., Depelchin, B. O., Dhalluin, S., Atienzar, F. A. Characterization of primary human hepatocytes, HepG2 cells, and HepaRG cells at the mRNA level and CYP activity in response to inducers and their predictivity for the detection of human hepatotoxins. Cell Biology and Toxicology. 28, (2), 69-87 (2012).
  25. Pusl, T., et al. Free fatty acids sensitize hepatocytes to bile acid-induced apoptosis. Biochemical and Biophysical Research Communications. 371, (3), 441-445 (2008).
  26. Gentile, C. L., Pagliassotti, M. J. The role of fatty acids in the development and progression of nonalcoholic fatty liver disease. The Journal of Nutritional Biochemistry. 19, (9), 567-576 (2008).
  27. Mei, S., et al. Differential roles of unsaturated and saturated fatty acids on autophagy and apoptosis in hepatocytes. Journal of Pharmacological Experimental Therapy. 339, 487-498 (2011).
  28. Malhi, H., Bronk, S. F., Werneburg, N. W., Gores, G. J. Free fatty acids induce JNK-dependent hepatocyte lipoapoptosis. Journal of Biological Chemistry. 281, 12093-12101 (2006).
  29. Moravcová, A., Červinková, Z., Kučera, O., Mezera, V., Rychtrmoc, D., Lotková, H. The effect of oleic and palmitic acid on induction of steatosis and cytotoxicity on rat hepatocytes in primary culture. Physiological Research. 64, Suppl 5 627-636 (2015).
  30. Ohsaki, Y., Shinohara, Y., Suzuki, M., Fujimoto, T. A pitfall in using BODIPY dyes to label lipid droplets for fluorescence microscopy. Histochemistry and Cell Biology. 133, (4), 477-480 (2010).
  31. Rinia, H. A., Burger, K. N., Bonn, M., Müller, M. Quantitative label-free imaging of lipid composition and packing of individual cellular lipid droplets using multiplex CARS microscopy. Biophysical Journal. 95, (10), 4908-4914 (2008).
  32. Waschatko, G., Billecke, N., Schwendy, S., Jaurich, H., Bonn, M., Vilgis, T. A., Parekh, S. H. Label-free in situ imaging of oil body dynamics and chemistry in germination. Journal of The Royal Society Interface. 13, (123), (2016).
  33. Jüngst, C., Winterhalder, M. J., Zumbusch, A. Fast and long term lipid droplet tracking with CARS microscopy. Journal of Biophotonics. 4, (6), 435-441 (2011).
  34. Welte, M. A., Gould, A. P. Lipid droplet functions beyond energy storage. Biochimica et Biophysica Acta - Molecular and Cell Biology of Lipids. 1862, (10), Pt B 1260-1272 (2017).
  35. Cohen, S. Lipid droplets as organelles. International Review of Cell and Molecular Biology. 337, 83-110 (2018).
  36. Farese, R. V., Walther, T. C. Lipid droplets finally get a little R-E-S-P-E-C-T. Cell. 139, (5), 855-860 (2009).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics