Effektiv neurale differentiering ved hjælp af enkelt cellekultur af humane embryonale stamceller

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Præsenteret her er en protokol til generering af en enkelt cellekultur af humane embryonale stamceller og deres efterfølgende differentiering i neurale progenitorceller. Protokollen er enkel, robust, skalerbar og egnet til lægemiddel screening og regenerativ medicin applikationer.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Jeon, K., Park, K., Jetten, A. M. Efficient Neural Differentiation using Single-Cell Culture of Human Embryonic Stem Cells. J. Vis. Exp. (155), e60571, doi:10.3791/60571 (2020).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

In vitro-differentiering af humane embryonale stamceller (hESCs) har ændret evnen til at studere menneskelig udvikling på både biologiske og molekylære niveauer og forudsat celler til brug i regenerativ applikationer. Standard tilgange til hESC kultur ved hjælp af koloni type kultur til at opretholde udifferentierede hESCs og embryo OID krop (EB) og Rosette dannelse for differentiering i forskellige kimlag er ineffektive og tidskrævende. Præsenteret her er en enkelt cellekultur metode ved hjælp af hESCs i stedet for en koloni-type kultur. Denne metode gør det muligt at vedligeholde de karakteristiske træk ved udifferentierede Hesc'er, herunder udtryk for hESC-markører på niveauer, der kan sammenlignes med koloni typen hESCs. Hertil kommer, at protokollen præsenterer en effektiv metode til neurale progenitorcelle (NPC) generation fra enkelt celletype hESCs, der producerer NPCs inden for 1 uge. Disse celler udtrykker meget flere NPC-markørgener og kan differentiere sig i forskellige neurale celletyper, herunder dopaminerge neuroner og astrocytter. Dette encellet kultur system til hESCs vil være nyttigt til at undersøge de molekylære mekanismer i disse processer, undersøgelser af visse sygdomme, og Drug Discovery skærme.

Introduction

Humane embryonale stamceller (hESCs) har potentialet til at differentiere sig til de tre primære kimlag, som derefter differentieres i forskellige Multipotente progenitorcellelager. Disse nedstamningens efterfølgende give anledning til alle celletyper i den menneskelige krop. In vitro hESC kultur systemer har forvandlet evnen til at studere menneskelige embryonale udvikling og har tjent som et værdifuldt redskab til at opnå ny indsigt i, hvordan disse processer er reguleret på det biologiske og molekylære niveau. Tilsvarende undersøgelser af inducerede pluripotente stamceller (iPSCs) genereret fra omprogrammering somatiske celler isoleret fra humane patienter giver ny indsigt i forskellige sygdomme. Desuden kan progenitorceller og differentierede celler afledt af hESCs være nyttige for forskning, der involverer stamcelleterapi og Drug screening1,2,3,4.

hESCs kan induceres til at differentiere sig i neurale stamceller (NPC'er), som er multi potentielle celler med en omfattende selv fornyelseskapacitet. Efterfølgende kan disse celler differentieres i neuroner, astrocytter, og oligodendrocytter5,6. NPCs tilbyder også et cellulært system til in vitro-studier af neuroudviklingsmæssige biologi og forskellige neurologiske sygdomme. Men, nuværende koloni type kultur metoder, der involverer hESCs og deres differentiering i NPCs er ineffektive og involverer ofte coculture samt embryo OID krop (EB) og Rosette dannelse5,7,8,9. Disse protokoller udviser lavere overlevelsesrater og spontan differentiering og er mere tidskrævende.

Præsenteret her er et forbedret og robust kultur system, der er let skalerbar og bruger høj densitet enkelt celletype kultur af hESCs10. Inddragelsen af Roh-kinase (rock) inhibitor bidrog til signifikant forbedret overlevelse effektivitet under enkelt celletype kultur af hesc10,11,12,13,14. I dette kultur system kan hESCs nemt vedligeholdes og udvides. Hertil kommer, at protokollen præsenterer en effektiv metode til at generere NPCs fra enkelt-celletype kultur af hESCs, som tillader produktion af meget rene NPC'er. hæmning af BMP/tgfβ/Activity signalering veje med ALK-hæmmere effektivt fremkalde differentiering af enkelt celletype hESCs i NPCs15,16, som derefter kan blive induceret til at differentiere sig til funktionelle neurale lineages, såsom dopaminerge neuroner og astrocytter.

Kort sagt, den enkelt-celletype kultur protokol ved hjælp af hESCs tilbyder en attraktiv model til at studere differentieringen af disse celler i forskellige lineages, herunder NPCs. Denne protokol er let skalerbar og derfor egnet til at generere celler til forskning, der involverer regenerativ terapi og Drug screening.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. fremstilling af hESC-kvalificerede kælder membran matrix-belagte plader

  1. Tø langsomt den hESC-kvalificerede kælder membran matrix (Se tabel over materialer) opløsning ved 4 °c i mindst 2 – 3 timer eller natten for at undgå dannelse af en gel.
  2. For at forberede kælder membran matrix-belagte plader, fortyndet matrix i kold DMEM/F12 til en 2% endelig koncentration. Bland godt og pels hver brønd af en 6 brønd plade med 1 mL af den fortyndede matrix opløsning.
  3. Inkuber de matrix overtrukne plader i kælder membranen ved stuetemperatur (RT) i mindst 3 timer eller ved 4 °C natten over.
    Bemærk: plader med kælder membran matrix kan opbevares ved 4 °C i 1 uge før matrix opløsningen fjernes og pladerne anvendes.

2. tilpasning af koloni type hESCs til encellet hESC kultur

  1. Til passage af feeder-fri kulturer af koloni type H9 (WA09) hESCs dyrket på kælderen membran matrix, aspirere mediet fra brøndene (figur 1A)9.
  2. Vask 1x med 1 mL DPBS. Tilsæt 1 mL dispase opløsning (1 e/mL) pr. brønd og Inkuber ved 37 °C i 20 minutter.
  3. Fjern dispasen, vask cellerne 1x forsigtigt med 2 mL DMEM/F12, Fjern mediet, og tilsæt 2 mL DMEM/F12 til hver plade.
  4. Frigør forsigtigt kolonier ved forsigtigt at pipettere op og ned og overføre dem til et 15 mL rør.
  5. Centrifuger pellets i 2 min ved 370 x g og Aspirér mediet.
  6. At adskille celle pellets i enkeltceller, tilsættes 2 mL celle løsrivelse løsning (1x koncentration, se tabel over materialer) og inkuberes ved 37 °c i 10 min.
  7. Centrifuger cellerne i 2 min ved 370 x g og fjern løsrivelse opløsningen.
  8. Tilføj frisk mTeSR1 humant ESC medium og dissocier cellerne i enkeltceller ved blid pipettering op og ned.
  9. For at tilpasse koloni type hESCs til en enkelt celletype kultur, plade ca 1.5-2,0 x 106 hESCs i hver brønd af kælderen membran matrix-coated 6 brønd plade i 2 ml mTeSR1 indeholdende 10 μM rock inhibitor for 24 h (figur 1a).
  10. Efter 24 timer skal hESC-mediet udskiftes med Fresh mTeSR1 uden klippe hæmmer, og hESCs kan vokse som en enkelt celletype i 3 dage. Skift mellem mediet dagligt.
  11. På dag 4, når kulturer nå næsten 100% confluency, dissociere celler i løsrivelse løsning, derefter replate som beskrevet i trin 2,6.
    Bemærk: ROCK inhibitor forbedrer celle overlevelse under den indledende 24 h af enkelt celletype hESC kultur.

3. embryo OID krop dannelse og differentiering i tre kimlag (figur 2)

  1. For at danne EBs skal du først resuspendere cellerne i 3 mL mTeSR1 medium med 10 μM ROCK hæmmer i løbet af de første 24 timer, og derefter inkubere natten i 60 mm lave vedhæftnings retter i en 37 °C inkubator for at tillade aggregering.
  2. Efter 24 timer overføres den lille EBs til et 15 mL rør. Lad EBs bosætte sig i bunden af røret og forsigtigt fjerne mediet med en pipette. Overfør EBs til EB medium (knockout-DMEM suppleret med 20% knockout serum udskiftning, 1x Glutamin supplement [Se tabel over materialer], 1% neaa [ikke-essentielle aminosyrer; Se tabel over materialer], og 0,2% β-mercaptoethanol) og give dem mulighed for at ekspandere i lave vedhæftnings retter i 7 dage. Mediet kan skiftes hver anden dag som beskrevet ovenfor (figur 2A).
  3. På dag 7, Saml EBs fra skålene og overfør dem til et 15 mL rør. Fjern forsigtigt mediet med en pipette, og Overfør EBs til en kælder membran matrix belagt 6-brønd plade.
  4. EBs kan fastgøres til pladen og inkubateres i 12 dage i EB-medium, hvor de vil differentiere sig til de tre kimlag (figur 2B). Skift mellem mediet hver anden dag.
    Bemærk: under aggregering af celler hjælper den lave vedhæftnings skål med at undgå EB-fastgørelse.

4. differentiering af enkelt celle-type hESCs i NPC'er (figur 3)

  1. For at inducere NPC-differentiering skal enkelt celle typen hESCs adskilles med 1 mL løsrivelse (1x) og inkuberes i 10 min ved 37 °C.
  2. Centrifuger cellerne i 2 min ved 370 x g , og fjern løsrivelse opløsningen supernatant. Tilsæt 1 mL DMEM/F12, og resuspender cellerne ved skånsom pipettering.
  3. Plade celler på en kælder membran matrix-belagt 6 brønd plade ved en densitet på 2 x 105 celler/godt i 2 ml mTeSR1 indeholdende 10 μM rock inhibitor.
  4. Efter 24 timer udskiftes dyrkningsmediet med neurale induktions medium (DMEM med 1% B27 minus vitamin A) suppleret med 1 μM dorsomorphin og 5 μM SB431542.
  5. Skift mellem mediet hver anden dag i løbet af de første 4 dage af neurale induktion, derefter hver dag, indtil de når sammenløbet på dag 7 (figur 3B).
    Bemærk: (1) Dorsomorphin hæmmer BMP pathway ved målretning ALK2, 3, 6 receptorer og hæmmer også AMPK; SB431542 er en hæmmer af TGFβ/Activin-vejen ved at målrette mod ALK5, 7. (2) den samme protokol blev afprøvet med en anden ESC-linje (WA01), som gav tilsvarende resultater som WA0916. (3) vi har generelt brugt Matrigel til kælderen membran matrix; celler kan dog dyrkes på Geltrex og derefter differentieres i NPC'er med meget lignende resultater, som indikeret ved ekspression af flere NPC-markører (figur 4D, E). Geltrex håndteres på samme måde som Matrigel (se punkt 1).

5. NPC-udvidelse og Cryopreservation

  1. Efter 7 dages neurale induktion adskilles celler med 1 mL løsrivelse (1x) og inkuberes i 10 min ved 37 °C.
  2. Centrifuger cellerne i 2 min ved 370 x g , og fjern løsrivelse opløsningen supernatant. Tilsæt 1 mL NPC-udvidelses medium (Se tabel over materialer), og resuspender cellerne ved skånsom pipettering.
  3. Plade 1 x 105 celler i 2 ml NPC ekspansions medium på kælder membran matrix-coated 6 brønd plader.
  4. Passage NPCs flere gange, når det er nødvendigt, når kulturer nå næsten 90% konfluency. I løbet af de første 3 – 4 passager tilsættes 10 μM ROCK hæmmer under den indledende 24 h for at forhindre celledød. Efter disse passager, kan celler være urerne og kultiveret uden rock inhibitor. Skift mellem mediet hver anden dag under ekspansionen.
  5. Cryopreserve NPCs når kulturer nå confluency.
    1. Ved Kryopreservation adskilles cellerne i 1 mL løsrivelse (1x) i 5 min ved 37 °C, hvorefter centrifugeringen centrifugeres i 2 min ved 370 x g for at fjerne løsningens opløsning.
    2. Tilsæt celle frysning opløsning (Se tabel over materialer) til dissocierede NPCs ved 1 x 106 celler/mL og distribuere 1 ml aliquoter til cryovials.
    3. Placer cryovialerne i fryse beholderen og opbevar dem natten over i a-80 °C fryser.
  6. Opbevar cryovialerne i det flydende nitrogen.

6. fremstilling af poly-L-ornithin (PLO) og laminerede plader med belægning

  1. For at tilberede PLO/laminerede plader fortyndes PLO-stamopløsningen til PBS eller vand til en endelig koncentration på 10 μg/mL. Bland godt og pels hver brønd af en 6 brønd plade med 1 mL fortyndet PLO opløsning.
  2. Inkuber i mindst 2 timer ved 37 °C eller natten over ved 4 °C.
  3. Vask hver brønd med PBS.
  4. Fortyndet laminat stamopløsning i kold PBS eller vand ved 10 μg/mL. Bland Laminin opløsningen godt. Fjern PBS og straks pels hver brønd med 1 mL Laminin opløsning. Hold pladerne ved 4 °C, og brug den inden for 1 uge. Vask med PBS og tilsæt straks kulturmedium.
    Bemærk: Lad ikke PLO/laminerede plader tørre ud.

7. differentiering af hESC-afledte NPC'er i dopaminerge neuroner (figur 6A)

  1. Plade NPCs i PLO/laminerede retter i NPC-udvidelses mediet med en densitet på ca. 50%.
  2. Efter 24 h, ændre medium til DA1 medium (neurobasal medium indeholdende 2 mM glutamin supplement, 1x NEAA, 1x B27, 200 ng/mL SHH, og 100 ng/mL FGF8) og ændre medium hver anden dag.
  3. Passage kulturer, når de når confluency. Dissocierer celler med 1 mL løsrivelse (1x) og inkuberes i 10 min ved 37 °C.
  4. Centrifuger cellerne i 2 min ved 370 x g , og fjern løsrivelse opløsningen supernatant. Tilsæt 1 mL DA1 medium, og gensuspender cellerne med en blid pipettering.
  5. Plade 1 x 105 celler i 2 ml DA1 medium på PLO/Laminin-coated 6 brønd plader.
  6. Efter 10 dage, skifte til DA2 medium (neurobasal medium indeholdende 2 mM glutamin supplement, 1x NEAA, 1x B27, 200 μM ascorbinsyre, 20 ng/mL BDNF, og 20 ng/mL GNDF) og skifte medium hver anden dag i yderligere 20 dage (figur 6A).
    Bemærk: Tilsæt frisk ascorbinsyre dagligt til DA2 mediet. Inden for de første 14 dage skal de differentierede celler overføres, når de når 90% sammenhæng, men ikke længere efter.

8. differentiering af ESC-afledte NPC'er i astrocytter

  1. Plade neurale stamceller på PLO/laminerede plader i NPC-udvidelses mediet med en densitet på ca. 50%.
  2. Efter 24 h, ændre medium til astrocyt medium (DMEM/F12 medium herunder 1:100 N2, 1:100 B27, 200 ng/mL IGF, 10 ng/mL Activity A, 10 ng/mL heregulin β-1, og 8 ng/mL bFGF) og ændre medium hver anden dag.
  3. Passage kulturer, når de når confluency. Dissocierer celler med 1 mL løsrivelse (1x) og inkuberes i 10 min ved 37 °C.
  4. Centrifuger cellerne i 2 min ved 370 x g , og fjern løsrivelse opløsningen supernatant. Tilsæt 1 mL astrocyt medium og resuspension cellerne ved blid pipettering.
  5. Plade 1 x 105 celler i 2 ml astrocyt medium på PLO/Laminin-coated 6 brønd retter.
  6. Tillad, at differentieringen fortsætter i i alt 5 – 6 uger (figur 6B).

9. immunofluorescens farvning

  1. Dyrknings celler i 35 mm μ-retter som beskrevet ovenfor for hver celletype. Aspirér mediet, og tilsæt 1 mL 4% PFA-opløsning pr. skål, og Inkuber i 20 minutter ved RT.
  2. Vask 2x i 5 minutter med PBS.
    Bemærk: når cellerne er fastgjort, kan analyse pladerne forsegles med parafilm og opbevares ved 4 °C. Med et antistof inden for 1 uge efter fiksering.
  3. Tilsæt 300 μL blokerende opløsning (ged eller æsel serum i PBS) pr. skål og Inkuber ved RT i 30 – 60 minutter.
  4. Vask skålen 2x med PBS i 5 min.
  5. Tilsæt 300 μL primær antistof (tabel 1) opløsning (fortyndet i blokerende opløsning) og INKUBER ved RT for 1,5 h eller natten over ved 4 °c.
  6. Vask 2x med PBS i 10 min.
  7. Tilsæt 300 μL fluorescerende konjugeret sekundært antistof (tabel 1) i blokerende opløsning, og Inkuber i mørke i 1 time ved rt.
  8. Vask cellerne 2x i 10 minutter med PBS.
  9. Hoechst-farvningsopløsning (1 μM slutkoncentration i PBS) tilsættes til plette kerner. Inkubatér cellerne i mørket i 5 minutter ved RT.
  10. Vask cellerne 1x med PBS i 5 min og tilsæt derefter 500 μL PBS. Hold retterne i mørke, og Observer derefter fluorescens med et Konfokal mikroskop (figur 2b, figur 5C, figur 6aog figur 7b).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Præsenteret her er en forbedret protokol for vedligeholdelse og udvidelse af enkelt celletype kultur af hESCs og deres effektive differentiering i neurale stamceller, som efterfølgende differentierer i forskellige downstream neurale lineages, herunder dopaminerge neuroner og astrocytter.

Repræsentative fasekontrast billeder viser celle morfologi på forskellige trin under tilpasningen af koloni type hESCs til enkelt celle typen kultur (figur 1A). Gennem en enkelt cellekultur blev det konstateret, at de tilpassede Hesc'er var i stand til at opretholdes ved høj densitet, derefter let og effektivt under kulet, når de nåede confluency (figur 1A, B). Disse celler bibeholdt celle cyklus karakteristika (dvs. en kort G1 fase og høj andel af celler i S fase) typisk for koloni type hESCs (figur 1C, D). De udtrykte også ESC-markører (dvs. OCT4, TRA 1-81, SOX2 og NANOG) på niveauer, der kan sammenlignes med koloni typen hESCs, som indikeret ved QRT-PCR og immunofarvnings analyse (figur 7, tabel 2). Desuden blev det påvist, at encellet hESCs var i stand til at danne embryooide organer, der indeholder celler fra alle tre kimlag: endoderm (SOX17 Expression), mesoderm (SMA-udtryk) og ectoderm (tuj-1-udtryk) (figur 2).

Dernæst blev det påvist, at enkelt celletype hESCs effektivt differentieret til neurale stamceller ved hjælp af en NPC-protokol (figur 3A), som indikeret af tabet af typisk hesc morfologi og udseendet af NPC morfologi (figur 3B)16. NPC-differentiering blev understøttet af det øgede udtryk for signatur-NPC-markører (dvs. SOX1, OTX2, ZIC1 og OTX1; Figur 5A, tabel 2) og bekræftet ved immunofarvning og FACS analyse. Den samme analyse viste også, at mere end 90% af cellerne farves positive for SOX1, PAX6 og NCAM protein (figur 5B, C). For at undersøge evnen af encellet hESC-afledte NPC'er til at differentiere sig i forskellige downstream neurale lineages, blev differentieringen af disse celler til dopaminerge neuroner og astrocytter undersøgt. Som vist i figur 6A, B, enkelt celle Hesc-afledte NPC'er var i stand til at differentiere sig til dopaminerge neuroner og astrocytter, som indikeret af udseendet af karakteristiske morfologier og udtryk for Lineage-specifikke dopaminerge markører (dvs., th; Figur 6A) og astrocyt markører (dvs. GFAP og S100B; Figur 6B).

Figure 1
Figur 1: tilpasning af koloni type hESCs til enkelt celletype kultur. (A) repræsentative fasekontrast billeder af enkelt cellekulturer af H9 hESCs på forskellige tidspunkter efter plating på 2% kælder membran matrix-belagte retter. Lav (venstre) og høj (højre) forstørrelse. Toppanel: repræsentativt billede af koloni type hESCs. Andre paneler viser repræsentative billeder af kulturer på forskellige tidspunkter under tilpasningen til enkelt celletype hESCs. Scale bar = 200 μm. (B) vækstkurver af H9 hESCs blev overvåget i 2% kælder membran matrix-belagte plader med 10 μM rock inhibitor for de første 24 h under enkelt cellekultur tilstand. (C, D) Celle cyklus analyse af koloni type (C) og enkelt celletype (D) H9 hESCs ved flowcytometri. Venligst klik her for at se en større version af dette tal.

Figure 2
Figur 2: in vitro-differentiering af tilpassede enkelt celle-type hESCs i tre kimlag. A) repræsentative fase billeder af embryonale organer (EB) afledt af en enkelt celletype af hESCs. Scale bar = 100 μm. (B) Immunofluorescent billeder af differentierede hESCs analyseret for ekspression af de tre forskellige kimlag MARKØRER: SOX17 (endoderm), sma (mesoderm), og tuj-1 (ectoderm). Kerner blev plettet med DAPI. Scale bar = 50 μm. Venligst klik her for at se en større version af dette tal.

Figure 3
Figur 3: differentiering af enkelt celle-type hESCs i neurale stamceller ved direkte differentiering. (A) skematisk af differentierings protokollen for hESCs til neurale stamceller (NPC'er). hESCs blev behandlet med dorsomorphin (DMH) og SB431542 (SB) 1 dag efter plating. (B) repræsentative fasekontrast billeder af celle morfologi under neurale differentiering. Scale bar = 200 μm. Venligst klik her for at se en større version af dette tal.

Figure 4
Figur 4: hESC kultur på forskellige kælder membran matrix produkter. (A) hESCs dyrket på Matrigel eller Geltrex udstillet en evne til at vokse og differentiere sig til NPC'er, der var magen til den enkelte celle-kultur. Celler blev plettet med et NESTIN-antistof. Kerner blev plettet med DAPI. Scale bar = 50 μm. B) hesc'er, der dyrkes på Matrigel eller Geltrex, viste et lignende potentiale for at differentiere sig til NPC'erne som angivet i procentdelen af nestin-og PAX6-positive celler. Celler blev analyseret ved flow cytometri på dag 7 af NPC-differentiering. Venligst klik her for at se en større version af dette tal.

Figure 5
Figur 5: udtryk for NPC-markører. (A) efter 7 dages neurale differentiering blev ekspression af NPC-markørgener (dvs., OTX1, OTX2, SOX1 og ZIC1) analyseret af QRT-PCR. Værdierne blev normaliseret til GAPDH og beregnet i forhold til værdierne for hESCs (p < 0,05). B) PROCENTEN af SOX1-, nestin-, SOX2-og ncam-positive celler blev bestemt af flowcytometri på dag 7 i NPC-differentieringen. (C) på dag 7 NPC differentiering, celler blev farvet med antistoffer mod neurale markører SOX1, NESTIN, NCAM, OTX2, og PAX6. Kerner blev plettet med DAPI. Scale bar = 100 μm. Venligst klik her for at se en større version af dette tal.

Figure 6
Figur 6: dopaminerge neuron og astrocyt differentiering af NPC'er afledt af enkelt celletype hESCs. (A) repræsentativt fasekontrast billede af dopaminerge neuroner (øverste panel). Scale bar = 100 μm. Differentierede celler blev plettet med antistoffer mod dopaminerge neuron markør TH (tyrosin hydroxylase) som angivet. Kerner blev plettet med DAPI. Scale bar = 50 μm. (B) repræsentative fasekontrast billede af astrocytter (øverste panel). Scale bar = 100 μm. Differentierede celler blev farvet med antistoffer mod astrocyt markør GFAP (glial fibrillært syreholdigt protein) og S100-B (S100 calcium bindende protein B) som indikeret. Kerner blev plettet med DAPI. Scale bar = 50 μm. Venligst klik her for at se en større version af dette tal.

Figure 7
Figur 7: karakterisering af enkelt celletype hESCs. (A) hESCs, der er tilpasset enkelt celletype, blev analyseret med henblik på ekspression af ESC-markører (dvs., OCT4, NANOG og SOX2) af QRT-PCR. Værdier blev normaliseret til GAPDH (p < 0,05). B) Immunofluorescent billeder af hESCs, som er plettet med henblik på udtryk af pluripotens markører OCT4, TRA-1-81 og ssea-1. Kerner blev plettet med DAPI. Scale bar = 50 μm. Venligst klik her for at se en større version af dette tal.

Primære antistoffer Arter Fortynding Katalognummer Virksomhed
OCT4 Musen 1:1000 SC-5279 Santa Cruz
TRA 1-81 Musen 1:500 SC-21706 Santa Cruz
SSEA-1 Musen 1:500 SC-21702 Santa Cruz
SOX1 Ged 1:500 AF-3369 R & D
SOX2 Kanin 1:1000 SC-20088 Santa Cruz
Sma Kanin 1:500 AB-5694 Abcam
Tuj1 Musen 1:1000 T8578 Sigma
NESTIN Musen 1:1000 AB-22035 Abcam
OTX2 Musen 1:250 AB-21990 Abcam
hNCAM Musen 1:200 SC-106 Santa Cruz
hPAX6 Musen 1:250 561664 Bd
TH Musen 1:500 T1299 Sigma
S100b Musen 1:250 ab4066 Abcam
NEDLÆGGES Kanin 1:1000 ab7260 Abcam
Sekundære antistoffer
Anti-mus Ged 1:1000 AF 488 eller 647 Life Technologies
Anti-kanin Ged 1:1000 AF 488 eller 647 Life Technologies

Tabel 1: antistoffer, der anvendes i immuncytokemi og FACS analyse.

Primer-navn Primer sekvens
OCT4 F: GGAAGGTATTCAGCCAAACG
R: CTCCAGGTTGCCTCTCACTC
NANOG F: GGTTCCAGAACCAGAGAATGA
R: ATTGGAAGGTTCCCAGTCG
SOX1 F: CCTTAGGTTTCCCCTCGCTTT
R: CAGGCTGAATTCGGTTCTCATT
OTX1 F: AAGATCAACCTGCCGGAGTCT
R: CGTGAATTGGCCACTGCTTT
OTX2 F: TGGAAGCACTGTTTGCCAAG
R: TAAACCATACCTGCACCCTCG
ZIC1 F: AACCCCAAAAAGTCGTGCAAC
R: TCCTCCCAGAAGCAGATGTGA
GAPDH F: CCCATCACCATCTTCCAGGAG
R: CTTCTCCATGGTGGTGAAGACG

Tabel 2: liste over primere anvendt i QRT-PCR-analyse.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Skalerbare og effektive metoder til differentiering af hESCs i forskellige nedstamningens og generering af et tilstrækkeligt antal differentierede celler er vigtige kriterier for lægemiddel screening og stamcelleterapi. Forskellige enkelt-celle forbipasserende metoder er blevet offentliggjort, hvor cellerne dyrkes i nærværelse af rock inhibitor eller andre små molekyler til at forbedre overlevelsen, men de endelige produkter af disse dyrkningsmetoder er koloni type hESCs17,18,19,20,21. Den enkelt-cellet ESC-protokol, som er delvist baseret på tidligere offentliggjorte metoder19,20,21,22, med succes genererer og vedligeholder enkelt celle-type hesc kulturer og forhindrer koloni type hesc kultur. Det omfatter høj densitet enkelt celle plating, multicellulær Association, enkeltlags vækst, og effektiv subkultur (figur 1). Sidstnævnte blev opnået ved tilsætning af rock inhibitor under den indledende 24 h af enkelt celletype kultur af hESCs, hvilket forbedrer celle overlevelse17,18,19,20,21. Denne protokol er lettere skalerbar og tillader udvidelse af disse celler til terapeutiske anvendelser i Drug screening og stamcelle.

Det er endvidere påvist, at enkelt celle-type hESCs effektivt kan skelne til NPC-Lineage (figur 3) uden brug af et mellemstadium, såsom EB og Rosette dannelse23,24,25. Høj neurale omdannelse fra enkelt celletype hESCs blev opnået gennem hæmning af BMP/tgfβ/Activity signalering Pathways ved behandling med ALK-hæmmere, dorsomorphin og SB43154215,16,26. Med denne protokol kan den tilpassede enkelt celle-type hESCs effektivt differentiere sig til NPC'er uden behov for EB og Rosette dannelse (figur 5) og eller blive induceret til at differentiere sig til dopaminerge neuroner og astrocytter (figur 6).

Kort sagt, enkelt celletype kultur af hESCs giver et hurtigt og effektivt system til at studere de molekylære mekanismer, der regulerer multi trin differentiering til forskellige lineages. Specifikt, denne protokol udnyttet NPCs og beskrev deres efterfølgende differentiering i yderligere neurale lineages, såsom astrocytter og dopaminerge neuroner. Protokollen er en platform for enkel, robust og skalerbar produktion af stamceller og differentierede blodlegemer, der kan være velegnede til grundlæggende undersøgelser, lægemiddel screening og anvendelser i regenerativ medicin.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne erklærer ingen interessekonflikter.

Acknowledgments

Vi takker Dr. Carl D. Bortner (NIEHS) for hans hjælp til FACS-analysen. Denne forskning blev støttet af det Intramural forsknings program af National Institute of Environmental Health Sciences, National Institutes of Health, Z01-ES-101585 til AMJ.

Materials

Name Company Catalog Number Comments
35 mm m-dishes ibidi 81156 Cell culture dish
6-well plates Corning 3516
Accutase Innovative Cell Technologies AT104-500 Cell detachment solution
Activin A R&D system 338-AC-050
Ascorbic Acid Sigma Aldrich A4403
B27 supplement Thermo Fisher 17504044
B27 supplement (-Vit A) Thermo Fisher 12587010
BDNF Applied Biological Materials Z100065
bFGF Peprotech 100-18C
Centrifuge DAMON/ICE 428-6759
CO2 incubator Thermo Fisher 4110
Corning hESC-qulified Matrix (Magrigel) Corning 354277 Basement membrane matrix (used for most of the protocol here)
Cryostor CS 10 Stemcell Technologies 7930 Cell freezing solution
Dispase Stemcell Technologies 7923
DMEM Thermo Fisher 10569-010
DMEM/F12 Thermo Fisher 10565-018
Dorsomorphin Tocris 3093
EGF Peprotech AF-100-16A
Fetal Bovine Serum Fisher Scientific SH3007003HI
FGF8 Applied Biological Materials Z101705
GDNF Applied Biological Materials Z101057
Geltrex matrix Thermo Fisher A1569601 Basement membrane matrix
GlutaMax Thermo Fisher 35050061 Glutamine supplement, 100X
H9 (WA09) human embryonic stem cell line WiCell WA09
Heregulin b-1 Peprotech 100-3
IGF Peprotech 100-11
Knockout DMEM Thermo Fisher 10829018
Knockout Serum Replacement Thermo Fisher 10828028
Laminin Sigma Aldrich L2020
mTeSR1 Stemcell Technologies 85850 hESC culture medium
N2 supplement Thermo Fisher 17502001
NEAA Thermo Fisher 11140050
Neurobasal Thermo Fisher 21103049
Poly-L-ornithine Sigma Aldrich P3655
ROCK inhibitor Tocris 1254
SB431542 Tocris 1614
SHH Applied Biological Materials Z200617
Stemdiff Neural Progenitor medium Stemcell Technologies 5833 NPC expansion medium

DOWNLOAD MATERIALS LIST

References

  1. Thomson, J. A., et al. Embryonic stem cell lines derived from human blastocysts. Science. 282, (5391), 1145-1147 (1998).
  2. Rosler, E. S., et al. Long-term culture of human embryonic stem cells in feeder-free conditions. Developmental Dynamics. 229, (2), 259-274 (2004).
  3. Mallon, B. S., Park, K. Y., Chen, K. G., Hamilton, R. S., McKay, R. D. Toward xeno-free culture of human embryonic stem cells. The International Journal of Biochemistry & Cell Biology. 38, (7), 1063-1075 (2006).
  4. Hoffman, L. M., Carpenter, M. K. Characterization and culture of human embryonic stem cells. Nature Biotechnology. 23, (6), 699-708 (2005).
  5. Yan, Y., et al. Efficient and rapid derivation of primitive neural stem cells and generation of brain subtype neurons from human pluripotent stem cells. Stem Cells Translational Medicine. 2, (11), 862-870 (2013).
  6. Goncalves, J. T., Schafer, S. T., Gage, F. H. Adult Neurogenesis in the Hippocampus: From Stem Cells to Behavior. Cell. 167, (4), 897-914 (2016).
  7. Watanabe, K., et al. A ROCK inhibitor permits survival of dissociated human embryonic stem cells. Nature Biotechnology. 25, (6), 681-686 (2007).
  8. International Stem Cell Initiative. Characterization of human embryonic stem cell lines by the International Stem Cell Initiative. Nature Biotechnology. 25, (7), 803-816 (2007).
  9. Hartung, O., Huo, H., Daley, G. Q., Schlaeger, T. M. Clump passaging and expansion of human embryonic and induced pluripotent stem cells on mouse embryonic fibroblast feeder cells. Current Protocols in Stem Cell Biology. 14, (1), Chapter 1 Unit 1C 10 (2010).
  10. Chen, K. G., et al. Non-colony type monolayer culture of human embryonic stem cells. Stem Cell Research. 9, (3), 237-248 (2012).
  11. Chen, G., Hou, Z., Gulbranson, D. R., Thomson, J. A. Actin-myosin contractility is responsible for the reduced viability of dissociated human embryonic stem cells. Cell Stem Cell. 7, (2), 240-248 (2010).
  12. Li, X., Krawetz, R., Liu, S., Meng, G., Rancourt, D. E. ROCK inhibitor improves survival of cryopreserved serum/feeder-free single human embryonic stem cells. Human Reproduction. 24, (3), 580-589 (2009).
  13. Ohgushi, M., et al. Molecular pathway and cell state responsible for dissociation-induced apoptosis in human pluripotent stem cells. Cell Stem Cell. 7, (2), 225-239 (2010).
  14. Pakzad, M., et al. Presence of a ROCK inhibitor in extracellular matrix supports more undifferentiated growth of feeder-free human embryonic and induced pluripotent stem cells upon passaging. Stem Cell Reviews and Reports. 6, (1), 96-107 (2010).
  15. Chambers, S. M., et al. Highly efficient neural conversion of human ES and iPS cells by dual inhibition of SMAD signaling. Nature Biotechnology. 27, (3), 275-280 (2009).
  16. Jeon, K., et al. GLIS3 Transcriptionally Activates WNT Genes to Promote Differentiation of Human Embryonic Stem Cells into Posterior Neural Progenitors. Stem Cells. 37, (2), 202-215 (2019).
  17. Emre, N., et al. The ROCK inhibitor Y-27632 improves recovery of human embryonic stem cells after fluorescence-activated cell sorting with multiple cell surface markers. PLoS ONE. 5, (8), e12148 (2010).
  18. Hanna, J., et al. Human embryonic stem cells with biological and epigenetic characteristics similar to those of mouse ESCs. Proceedings of the National Academy of Sciences of the United States of America. 107, (20), 9222-9227 (2010).
  19. Saha, K., et al. Surface-engineered substrates for improved human pluripotent stem cell culture under fully defined conditions. Proceedings of the National Academy of Sciences of the United States of America. 108, (46), 18714-18719 (2011).
  20. Tsutsui, H., et al. An optimized small molecule inhibitor cocktail supports long-term maintenance of human embryonic stem cells. Nature Communications. 2, 167 (2011).
  21. Xu, Y., et al. Revealing a core signaling regulatory mechanism for pluripotent stem cell survival and self-renewal by small molecules. Proceedings of the National Academy of Sciences of the United States of America. 107, (18), 8129-8134 (2010).
  22. Ungrin, M. D., Joshi, C., Nica, A., Bauwens, C., Zandstra, P. W. Reproducible, ultra high-throughput formation of multicellular organization from single cell suspension-derived human embryonic stem cell aggregates. PLoS ONE. 3, (2), e1565 (2008).
  23. Kim, D. S., et al. Highly pure and expandable PSA-NCAM-positive neural precursors from human ESC and iPSC-derived neural rosettes. PLoS ONE. 7, (7), e39715 (2012).
  24. Sun, Y., Hu, J., Zhou, L., Pollard, S. M., Smith, A. Interplay between FGF2 and BMP controls the self-renewal, dormancy and differentiation of rat neural stem cells. Journal of Cell Science. 124, (Pt 11), 1867-1877 (2011).
  25. Zhou, J. M., Chu, J. X., Chen, X. J. An improved protocol that induces human embryonic stem cells to differentiate into neural cells in vitro. Cell Biology International. 32, (1), 80-85 (2008).
  26. Smith, J. R., et al. Inhibition of Activin/Nodal signaling promotes specification of human embryonic stem cells into neuroectoderm. Developmental Biology. 313, (1), 107-117 (2008).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics