Engineering and Evolution of Synthetic Adeno-Associated Virus (AAV) Gene Therapy Vectors via DNA Family Shuffling

Summary

We demonstrate the basic technique to molecularly engineer and evolve synthetic Adeno-associated viral (AAV) gene therapy vectors via DNA family shuffling. Moreover, we provide general guidelines and representative examples for selection and analysis of individual chimeric capsids with enhanced properties on target cells in culture or in mice.

Abstract

Adeno-associated viral (AAV) vectors represent some of the most potent and promising vehicles for therapeutic human gene transfer due to a unique combination of beneficial properties¹. These include the apathogenicity of the underlying wildtype viruses and the highly advanced methodologies for production of high-titer, high-purity and clinical-grade recombinant vectors². A further particular advantage of the AAV system over other viruses is the availability of a wealth of naturally occurring serotypes which differ in essential properties yet can all be easily engineered as vectors using a common protocol^1,2. Moreover, a number of groups including our own have recently devised strategies to use these natural viruses as templates for the creation of synthetic vectors which either combine the assets of multiple input serotypes, or which enhance the properties of a single isolate. The respective technologies to achieve these goals are either DNA family shuffling³, i.e. fragmentation of various AAV capsid genes followed by their re-assembly based on partial homologies (typically >80% for most AAV serotypes), or peptide display^4,5, i.e. insertion of usually seven amino acids into an exposed loop of the viral capsid where the peptide ideally mediates re-targeting to a desired cell type. For maximum success, both methods are applied in a high-throughput fashion whereby the protocols are up-scaled to yield libraries of around one million distinct capsid variants. Each clone is then comprised of a unique combination of numerous parental viruses (DNA shuffling approach) or contains a distinctive peptide within the same viral backbone (peptide display approach). The subsequent final step is iterative selection of such a library on target cells in order to enrich for individual capsids fulfilling most or ideally all requirements of the selection process. The latter preferably combines positive pressure, such as growth on a certain cell type of interest, with negative selection, for instance elimination of all capsids reacting with anti-AAV antibodies. This combination increases chances that synthetic capsids surviving the selection match the needs of the given application in a manner that would probably not have been found in any naturally occurring AAV isolate. Here, we focus on the DNA family shuffling method as the theoretically and experimentally more challenging of the two technologies. We describe and demonstrate all essential steps for the generation and selection of shuffled AAV libraries (Fig. 1), and then discuss the pitfalls and critical aspects of the protocols that one needs to be aware of in order to succeed with molecular AAV evolution.

Protocol

1. Preparation of Plasmid Sets Encoding AAV Capsid Genes

1. To facilitate routine preparation of sufficient amounts of the various AAV capsid (cap) genes for subsequent DNA shuffling, initially subclone these genes into a common plasmid backbone. It is important to include identical flanking sequences of >20 nucleotides for later use as primer binding sites for nested PCR and for cloning (Fig. 2).
2. Using appropriate primers (see Table for exemplary primers for AAV5), PCR amplify desired cap genes from commonly available AAV plasmids that typically contain the AAV2 rep gene next to the cap gene of c....

Discussion

Here, we have outlined essential experimental steps and guidelines for AAV capsid engineering via DNA family shuffling and for evolution in cells or in animals. In essence, these protocols are standardized versions of the procedures we first reported within the AAV field in 2008³. While a flurry of follow-up studies by others have reported numerous modifications e.g.,^10-13, our present versions represent basic strategies yielding reproducible results while being amenable to up-scaling and a.......

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
DNase I	Invitrogen	18068-015
Polyethylenimine (PEI)	Sigma-Aldrich	408727
Restriction enzymes	New England Biolabs	Various
T4 DNA Ligase	New England Biolabs	M0202T
Gel extraction kit	Qiagen	28704
Phusion II polymerase Kit	Finnzymes	F-540S
HotStar Hifi polymerase Kit	Qiagen	202602
DMSO	Finnzymes	F-540S (part of kit)
EDTA (25 mM)	Invitrogen	18068-015 (part of kit)
Tris	Carl Roth Gmbh	4855.2
Ampicilin sodium salt	Carl Roth Gmbh	K029.2
dNTPs (10 mM, 100 μl)	Invitrogen	18427013
Iodixanol (OptiPrep)	Axis-Shield	1114739
Phenolred	Merck & Co., Inc.	107241
Plasmid mega prep kit	Qiagen	12181
Ultracentrifuge	Beckman Coulter Inc.	Optima L90K
Quick-Seal centrifuge tubes	Beckman Coulter Inc.	342414
Electroporation unit	Bio-Rad	GenePulserXcell
Thermal cycler	Eppendorf	Vapo Protect
Heating block	BIOER	MB-102
Fluorescence microscope	Olympus Corporation	IX81
FACS analyser	Beckman Coulter Inc.	Cytomics FC500 MLP
MegaX DH10B T1R cells	Invitrogen	C640003
Benzonase	Merck & Co., Inc.	101695
Adenovirus-5	ATCC	VR-5
pBlueScript II KS(+) plasmid	Stratagene, Agilent Technologies	212207
cap5F (Pac I site in yellow, cap5-specific sequences in bold): GACTCTTAATTAACAGGTATGTCTTTTGTTGATCACCCTCC	IDT	Custom primer
cap5R (Asc I site in green, cap5-specific sequences in bold): GTGAGGGCGCGCCTTAAAGGGGTCGGGTAAGGTATC	IDT	Custom primer