Materials
Name | Company | Catalog Number | Comments |
Yeast Strain CTY10-5d erg3Δ/erg11Δ | Our lab | CTY10-5d yeast was double knocked out ERG3 and ERG11 (erg3Δ/erg11Δ) genes6 . | |
YPD Growth Medium | BD Biosciences | 630409 | |
Difco Yeast Nitrogen Base (YNB) w/o Amino Acids and Ammonium Sulfate | BD Biosciences | 233520 | |
Bacto Agar | BD Biosciences | 214010 | |
CSM-His/-Leu Complete Supplement Mixture | MP Biomedicals | 4250-412 | |
ONPG (o-Nitrophenyl Β-D- Galactopyranoside). | Sigma-Aldrich | N1127 | |
2-Mercaptoethanol | Sigma-Aldrich | M6250 | |
Luria Broth (LB) | Sigma-Aldrich | L3022 | |
X-Gal | Fisher | BP-1615 | |
Sonicated Salmon Sperm DNA boiled (10 mg/ml) | Life Technology | 156-017 | |
Ampicillin | Acros Organics | 61177 | |
Ketoconazole | Sigma-Aldrich | K1003 | |
N,N-Dimethylformamide | Acros Organics | 326871000 | |
Lithium Acetate | Sigma-Aldrich | L4158 | |
50% PEG-3350 solution, filter-sterilized | Sigma-Aldrich | P-3640 | |
Nitrocellulose Membrane | Whatman | 10402091 | |
10 cm Petri Dish | Fisher | 875712 | |
5'-ACCGGATCCCGATGAAGA AGGAGATGATCATGTCC-3' | our lab | PXR LBD forward primer for pSH2-1 | |
5'-AGAGTCGACTCAGCTA CCTGTGATGCC -3' | our lab | PXR LBD reverse primer for pSH2-1 | |
5'-TATAGC GGCCGCATGAGTG GCCTCGGGGACAGTTCATCC -3' | our lab | SRC-1 forward primer for pGADNOT | |
5'-GCGGTCGACTTATTCAGTCA GTAGCTG -3' | our lab | SRC-1 reverse primer for pGADNOT | |
Platinum PCR Supermix | Invitrogen | 11306-016 | |
BamHI | our lab | R0136 | |
SalI | our lab | R0138 | |
NotI | our lab | R0189 |
References
- Kliewer, S. A., et al. An orphan nuclear receptor activated by pregnanes defines a novel steroid signaling pathway. Cell. 92 (1), 73-82 (1998).
- Blumberg, B., et al. a novel steroid and xenobiotic-sensing nuclear receptor. Genes Dev. 12 (20), 3195-3205 (1998).
- Biswas, A., Mani, S., Redinbo, M. R., Krasowski, M. D., Li, H., Ekins, S. Elucidating the 'Jekyll and Hyde' Nature of PXR: The Case for Discovering Antagonists. Pharm. Res. 26 (8), 1807-1815 (2009).
- Pondugula, S. R., Mani, S. Pregnane xenobiotic receptor in cancer pathogenesis and therapeutic response. Cancer Lett. 328 (1), 1-9 (2013).
- Mani, S., Dou, V., Redinbo, M. R. PXR antagonists and implications for drug metabolism. Drug Metab. Rev. 45 (1), 60-72 (2013).
- Li, H., et al. Novel Yeast-Based Strategy Unveils Antagonist Binding Regions on the Nuclear Xenobiotic Receptor PXR. J. Biol. Chem. 288 (19), 13655-13668 (2013).
- Hollenberg, S. M., et al. Identification of a new family of tissue-specific basic helix-loop-helix proteins with a two-hybrid system. Mol. Cell. Biol. 15 (7), 3813-3822 (1995).
- Vojtek, A. B., Hollenberg, S. M., Cooper, J. A. Mammalian Ras interacts directly with the serine/threonine kinase Raf. Cell. 74 (1), 205-214 (1993).
- Wang, H., et al. The phytoestrogen coumestrol is a naturally occurring antagonist of the human pregnane X receptor. Mol. Endocrinol. 22 (4), 838-857 (2008).
- Kalpana, G. V., Goff, S. P. Genetic analysis of homomeric interactions of human immunodeficiency virus type 1 integrase using the yeast two-hybrid system. Proc. Natl. Acad. Sci. U.S.A. 90 (22), 10593-10597 (1993).
- Hamdi, A., Colas, P. Yeast two-hybrid methods and their applications in drug discovery. TiPS. 33 (2), 109-118 (2012).
- Battesti, A., Bouveret, E. The bacterial two-hybrid system based on adenylate cyclase reconstitution in Escherichia coli. Methods. 58 (4), 325-334 (2012).
- Caufield, J. H., Sakhawalkar, N., Uetz, P. A comparison and optimization of yeast two-hybrid systems. Methods. 58 (4), 317-324 (2012).
- Albers, M., et al. Automated yeast two-hybrid screening for nuclear receptor-interacting proteins. Mol. Cell Proteomics. 4 (2), 205-213 (2005).
- Takeshita, A., Taguchi, M., Koibuchi, N., Ozawa, Y. Putative role of the orphan nuclear receptor SXR (steroid and xenobiotic receptor) in the mechanism of CYP3A4 inhibition by xenobiotics. J. Biol. Chem. 277 (36), 32453-32458 (2002).
- Huang, H., et al. Inhibition of drug metabolism by blocking the activation of nuclear receptors by ketoconazole. Oncogene. 26 (2), 258-268 (2007).
- Wang, H., et al. Activated pregnenolone X- receptor is a target for ketoconazole and Its analogs. Clin. Cancer Res. 13 (8), 2488-2495 (2007).
- Ghannoum, M. A., Rice, L. B. Antifungal agents: mode of action, mechanisms of resistance, and correlation of these mechanisms with bacterial resistance. Clin. Microbiol. Rev. 12 (4), 501-517 (1999).
- Kaur, R., Bachhawat, A. K. The yeast multidrug resistance pump, Pdr5p, confers reduced drug resistance in erg mutants of Saccharomyces cerevisiae. Microbiology. 145, 809-818 (1999).
- White, T. C., Marr, K. A., Bowden, R. A., cellular, Clinical, cellular, and molecular factors that contribute to antifungal drug resistance. Clin. Microbiol. Rev. 11 (2), 382-402 (1998).
- Serebriiskii, I. G., et al. Detection of peptides, proteins, and drugs that selectively interact with protein targets. Genome Res. 12, 1785-1791 (2002).
- Yang, L., et al. Central role for PELP1 in nonandrogenic activation of the androgen receptor in prostate cancer. Mol Endocrinol. 26 (4), 550-561 (2012).
- Zhan, Y. Y., et al. The orphan nuclear receptor Nur77 regulates LKB1 localization and activates AMPK. Nat Chem Biol. 8 (11), 897-904 (2012).