Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
JoVE Journal Biology
Click here for the English version

Biology

포유류의 핵 수용체 잔류를 확인하기 위해 효모 두 하이브리드 시스템을 반전하는 리간드 및 / 또는 길항제와 상호 작용

Published: November 15, 2013 doi: 10.3791/51085
Automatic Translation
*1, *2, 1, 1
1Department of Genetics, Albert Einstein College of Medicine, 2Shanghai Key Laboratory of Complex Prescription and MOE Key Laboratory for Standardization of Chinese Medicines, Institute of Chinese Materia Medica, Shanghai University of Traditional Chinese Medicine
* These authors contributed equally

Abstract

약물 대사 및 염증의 중요한 조절 제로, Pregnane X 수용체 (PXR)는, 대사 및 염증 (예, 간 지방증) 1,2 연결 질병 병태 생리에서 중요한 역할을한다. PXR에 대한 효능 리간드의 식별에 많은 진전이 있었다, 그러나, 마약과 같은 길항제 및 PXR 3,4,5 그들의 결합 부위의 제한에 대한 설명이 있습니다. 중요한 장벽을 효율적으로 PXR는 1998 년에 복제 및 특징되었다는 사실에도 불구하고 길항제와 구조 연구에 대한 전체 길이의 단백질을 정화하는 무능력이다. 우리 연구소는 PXR 6 잔류 물을 결합, 길항제, 케토코나졸의를 정의하는 기반으로 소설 높은 처리량 효모 두 하이브리드 분석을 개발했다. 우리의 방법은 케토코나졸과 상호 작용 할 것으로 예상 PXR의 AF-2면에 하나의 돌연변이의 효과를 구출 할 돌연변이 라이브러리를 만드는 작업이 포함됩니다. 구조 또는 "기능 획득"세코ND 돌연변이 PXR에 케토코나졸의 유전 적 상호 작용과 표면 잔기 (들)에 관한 결론이 실현 가능하도록 만들어 질 수있다. 따라서, 우리는 그것의 보조 활성화, SRC-1과 상호 작용 PXR 돌연변이의 높은 처리량을 두 하이브리드 효모 화면을 개발했다. 효모는 항진균제, 케토코나졸의 연구를 수용하기 위해 수정 된이 방식을 사용하여, 우리는 케토코나졸에 바인딩 할 수 없습니다 클론 풍부한 PXR의 특정 변이를 설명 할 수 있습니다. 반대 논리에 의해, 우리는 원래의 잔류 케토코나졸과의 직접적인 상호 작용 잔류 있다는 결론을 내린다. 이 분석은 소설, 핵 수용체 길항제 표면에 결합 부위에 대한 화면으로 다루기 쉬운 유전자 분석을 나타냅니다. 이 분석은 효모뿐만 아니라 표준 구조 생물학 또는 단백체 기반 방법을 사용하여 연구 할 수없는 세포 단백질 (들)에 관계없이 세포 독성 가능성의 약물에 적용 할 수 있습니다. 잠재적 인 함정은 데이터의 해석 (보완적인 방법으로 유용), 신뢰성을 포함단일 Y2H 방법, 효모 처리 또는 효모 두 하이브리드 분석을 수행하는 전문 지식 및 분석 최적화에 ANCE.

Materials

Name Company Catalog Number Comments
Yeast Strain CTY10-5d erg3Δ/erg11Δ Our lab CTY10-5d yeast was double knocked out ERG3 and ERG11 (erg3Δ/erg11Δ) genes6 .
YPD Growth Medium BD Biosciences 630409
Difco Yeast Nitrogen Base (YNB) w/o Amino Acids and Ammonium Sulfate BD Biosciences 233520
Bacto Agar BD Biosciences 214010
CSM-His/-Leu Complete Supplement Mixture MP Biomedicals 4250-412
ONPG (o-Nitrophenyl Β-D- Galactopyranoside). Sigma-Aldrich N1127
2-Mercaptoethanol Sigma-Aldrich M6250
Luria Broth (LB) Sigma-Aldrich L3022
X-Gal Fisher BP-1615
Sonicated Salmon Sperm DNA boiled (10 mg/ml) Life Technology 156-017
Ampicillin Acros Organics 61177
Ketoconazole Sigma-Aldrich K1003
N,N-Dimethylformamide Acros Organics 326871000
Lithium Acetate Sigma-Aldrich L4158
50% PEG-3350 solution, filter-sterilized Sigma-Aldrich P-3640
Nitrocellulose Membrane Whatman 10402091
10 cm Petri Dish Fisher 875712
5'-ACCGGATCCCGATGAAGA AGGAGATGATCATGTCC-3' our lab PXR LBD forward primer for pSH2-1
5'-AGAGTCGACTCAGCTA CCTGTGATGCC -3' our lab PXR LBD reverse primer for pSH2-1
5'-TATAGC GGCCGCATGAGTG GCCTCGGGGACAGTTCATCC -3' our lab SRC-1 forward primer for pGADNOT
5'-GCGGTCGACTTATTCAGTCA GTAGCTG -3' our lab SRC-1 reverse primer for pGADNOT
Platinum PCR Supermix Invitrogen 11306-016
BamHI our lab R0136
SalI our lab R0138
NotI our lab R0189

DOWNLOAD MATERIALS LIST

References

  1. Kliewer, S. A., et al. An orphan nuclear receptor activated by pregnanes defines a novel steroid signaling pathway. Cell. 92 (1), 73-82 (1998).
  2. Blumberg, B., et al. a novel steroid and xenobiotic-sensing nuclear receptor. Genes Dev. 12 (20), 3195-3205 (1998).
  3. Biswas, A., Mani, S., Redinbo, M. R., Krasowski, M. D., Li, H., Ekins, S. Elucidating the 'Jekyll and Hyde' Nature of PXR: The Case for Discovering Antagonists. Pharm. Res. 26 (8), 1807-1815 (2009).
  4. Pondugula, S. R., Mani, S. Pregnane xenobiotic receptor in cancer pathogenesis and therapeutic response. Cancer Lett. 328 (1), 1-9 (2013).
  5. Mani, S., Dou, V., Redinbo, M. R. PXR antagonists and implications for drug metabolism. Drug Metab. Rev. 45 (1), 60-72 (2013).
  6. Li, H., et al. Novel Yeast-Based Strategy Unveils Antagonist Binding Regions on the Nuclear Xenobiotic Receptor PXR. J. Biol. Chem. 288 (19), 13655-13668 (2013).
  7. Hollenberg, S. M., et al. Identification of a new family of tissue-specific basic helix-loop-helix proteins with a two-hybrid system. Mol. Cell. Biol. 15 (7), 3813-3822 (1995).
  8. Vojtek, A. B., Hollenberg, S. M., Cooper, J. A. Mammalian Ras interacts directly with the serine/threonine kinase Raf. Cell. 74 (1), 205-214 (1993).
  9. Wang, H., et al. The phytoestrogen coumestrol is a naturally occurring antagonist of the human pregnane X receptor. Mol. Endocrinol. 22 (4), 838-857 (2008).
  10. Kalpana, G. V., Goff, S. P. Genetic analysis of homomeric interactions of human immunodeficiency virus type 1 integrase using the yeast two-hybrid system. Proc. Natl. Acad. Sci. U.S.A. 90 (22), 10593-10597 (1993).
  11. Hamdi, A., Colas, P. Yeast two-hybrid methods and their applications in drug discovery. TiPS. 33 (2), 109-118 (2012).
  12. Battesti, A., Bouveret, E. The bacterial two-hybrid system based on adenylate cyclase reconstitution in Escherichia coli. Methods. 58 (4), 325-334 (2012).
  13. Caufield, J. H., Sakhawalkar, N., Uetz, P. A comparison and optimization of yeast two-hybrid systems. Methods. 58 (4), 317-324 (2012).
  14. Albers, M., et al. Automated yeast two-hybrid screening for nuclear receptor-interacting proteins. Mol. Cell Proteomics. 4 (2), 205-213 (2005).
  15. Takeshita, A., Taguchi, M., Koibuchi, N., Ozawa, Y. Putative role of the orphan nuclear receptor SXR (steroid and xenobiotic receptor) in the mechanism of CYP3A4 inhibition by xenobiotics. J. Biol. Chem. 277 (36), 32453-32458 (2002).
  16. Huang, H., et al. Inhibition of drug metabolism by blocking the activation of nuclear receptors by ketoconazole. Oncogene. 26 (2), 258-268 (2007).
  17. Wang, H., et al. Activated pregnenolone X- receptor is a target for ketoconazole and Its analogs. Clin. Cancer Res. 13 (8), 2488-2495 (2007).
  18. Ghannoum, M. A., Rice, L. B. Antifungal agents: mode of action, mechanisms of resistance, and correlation of these mechanisms with bacterial resistance. Clin. Microbiol. Rev. 12 (4), 501-517 (1999).
  19. Kaur, R., Bachhawat, A. K. The yeast multidrug resistance pump, Pdr5p, confers reduced drug resistance in erg mutants of Saccharomyces cerevisiae. Microbiology. 145, 809-818 (1999).
  20. White, T. C., Marr, K. A., Bowden, R. A., cellular, Clinical, cellular, and molecular factors that contribute to antifungal drug resistance. Clin. Microbiol. Rev. 11 (2), 382-402 (1998).
  21. Serebriiskii, I. G., et al. Detection of peptides, proteins, and drugs that selectively interact with protein targets. Genome Res. 12, 1785-1791 (2002).
  22. Yang, L., et al. Central role for PELP1 in nonandrogenic activation of the androgen receptor in prostate cancer. Mol Endocrinol. 26 (4), 550-561 (2012).
  23. Zhan, Y. Y., et al. The orphan nuclear receptor Nur77 regulates LKB1 localization and activates AMPK. Nat Chem Biol. 8 (11), 897-904 (2012).
포유류의 핵 수용체 잔류를 확인하기 위해 효모 두 하이브리드 시스템을 반전하는 리간드 및 / 또는 길항제와 상호 작용
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Li, H., Dou, W., Padikkala, E.,… More

Li, H., Dou, W., Padikkala, E., Mani, S. Reverse Yeast Two-hybrid System to Identify Mammalian Nuclear Receptor Residues that Interact with Ligands and/or Antagonists. J. Vis. Exp. (81), e51085, doi:10.3791/51085 (2013).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter