Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Medicine

דגם bm12 העין מתנהל של זאבת אדמנתית המערכתית (לופוס) בC57BL עכברים / 6

doi: 10.3791/53319 Published: November 1, 2015

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

זאבת אדמנתית מערכתית (לופוס) היא מחלה אוטואימונית מורכבת המאופיינת prototypically על ידי נוגדן אנטי-גרעיני ייצור (ANA) וגלומרולונפריטיס. סיבוכים רבים אחרים, כוללים עורי, לב-ריאה, ונגעים בכבד קשורים למחלה אצל אנשים מסוימים. הערכות שכיחות בארה"ב משתנות במידה רבה, מ150,000-1,500,000 1,2, עם שכיחות גבוהה במיוחד בנשים ומיעוטים 3. למרות אטיולוגיה של SLE כבר קשה להבחין, הוא חשב שינבע ממשחק הגומלין של גורמים גנטיים וסביבתיים שונים, שיגיעו לשיאו באוטואימוניות המערכתית.

מודלים של בעלי חיים רבים כבר מועסקים ללמוד גורמים מובילים להופעת מחלה והתקדמות. מודלים עכבר קלאסיים של SLE כוללים זני נטייה גנטית עכבר כוללים NZB x מודל NZW F1 ונגזרי NZM, המתח / LPR הקה"ע, ומתח BXSB / Yaa, ומערכות מושרה, כגון pristane ודגמי מחלת שתל נגד המארח כרוני (cGVHD) 4. דיווחים מוקדמים של ייצור נוגדנים בדגמי GVHD משמשים זנים שונים עכבר או זני אוגר להורה להעברות F1 5 - 8; שיטות נפוצות יותר בשימוש ללמוד מחלה כמו זאבת-כיום כוללות הורה DBA / 2 → (DBA / 2 x C57BL / 6) F1, ומודל העברת bm12 המתואר כאן. לכל אחד יש מודל האזהרות שלה, אבל הם בדרך כלל לשתף מערך משותף של תכונות המתואמים עם מאפיינים קליניים של מחלה אנושית. הפרמטרים לרוב דיווחו במודלים של עכברים כוללים splenomegaly, בלוטות הלימפה, דלקת כליות, ייצור ANA, וברמה התאית, ההתרחבות של תאי T זקיקי עוזר (TFH), תאי B נבטי מרכז (GC), ותאי פלזמה.

מודל bm12 מושרה מושגת על ידי העברת המאמצת של לימפוציטים מIA bm12 B6 (C) - H2 - עכברים (bm12) AB1 bm12 / KhEgJ, מתח אניdentical לC57BL / 6 למעט 3 החלפות חומצת אמינו בכיתת MHC II, לIA ב C57BL / 6 עכברים (B6). Alloactivation של תורם CD4 T תאים על ידי נמען נגמ"שים מוביל לcGVHD עם תסמינים דומים SLE מקרוב. באופן ספציפי, אלה כוללים הרחבת TFH תורם נגזרות, התרחבות של תאי שמקורם נמען GC B ותאי פלזמה, וייצור של אנאס כולל אנטי-dsDNA, אנטי-ssDNA, אנטי-הכרומטין, ונוגדנים נגד RBC 9. לאורך זמן, עכברי נמען לפתח גלומרולונפריטיס הקשורים פיקדונות IgG בגלומרולרי, ביניים, ואזורים של כלי דם של הכליות 10. הראינו לאחרונה כי, בדומה למחלות של בני אדם, יש גם תפקיד קריטי עבור סוג אני IFN במודל זה 11. יש לציין, הקריטריונים המגדירים עבור SLE האנושי כוללים את הפיתוח של דלקת כליות תואמות עם SLE בנוכחות נוגדנים נגד dsDNA 12, שניהם מאפיינים בולטים של מודל עכבר זה.

יש seיתרונות veral של מודל bm12 על המודלים ספונטניים. מודלים קלאסיים שלפתח סימנים כמו SLE-ספונטני להסתמך על שני זנים היברידיים עכבר, זנים טהורים עכבר לא על רקע B6, או לוקוסים גנטיים גדולים על רקע B6, שהופכים את מעבר לפצצה או עכברים מהונדסים גנטי אחר קשה זמן רב. עם המודל מושרה bm12, עכברים מהונדסים גנטי יכולים לשמש גם תורם או נמען, המאפשרים זיהוי מהיר יותר של התא הסלולרי שבגנים מסוימים עשויים להיות חשובים למחלה. יתר על כן, התפתחות מחלה במודל bm12 היא הרבה יותר מהר, הדורש רק 2 שבועות עד להופעת אנאס, בהשוואה למספר חודשים לדגמים ספונטניים ביותר. יתר על כן, בניגוד לדגמים ספונטניים שמתפתחים מחלה בנקודות זמן שונה, תחילת המחלה וההתקדמות במודל B6 → bm12 מסונכרנת מאוד. זה מאפשר לדור של קבוצות בגודל המתאימה שיכולות בהדואר משמש לאסטרטגיות התערבותית או טיפוליות בכל שלב של התפתחות מחלה.

להלן פרוטוקול מפורט לייזום אוטואימוניות כמו SLE-ידי העברת המאמצת של לימפוציטים bm12 לעכברי C57BL / 6, או וריאנטים גנטיים על רקע B6. בנוסף, אנו מתארים פרוטוקול מכתים הזרימה cytometric לספירת TFH, GC תאי B, וסוגי תאי פלזמה תאים הקשורים למחלות אנושיות. חשוב לציין, יכולים לשמש גם פרוטוקולים אלה לאפיין מחלה ברוב דגמי עכבר של SLE ולזהות TFH, GC תאי B ותאי פלזמה בדגמי מחלה אחרים.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

עבודה בוצעה בבעלי חיים בתנאי הפתוגן ללא ספציפיים בהתאם להנחיות שנקבעו על ידי האגודה להערכה והסמכה של מעבדה טיפול בבעלי חיים בינלאומיים והמוסדי הטיפול בבעלי חיים שלנו והשתמשנו הוועדה (IACUC).

עכברים לשלב להביע סמן congenic כגון CD45.1 שני תורם או בעלי חיים נמען אם אפשר, כי זה מאפשר לניטור של יעילות שתל תורם והרחבה מסוימת של אוכלוסיית תאי CD4 T תורם: הערה. אם שוקל את השימוש בעכברים מהונדסים גנטי אחר כתורם או המקבלים, להבטיח את המתח הוא backcrossed כראוי לרקע B6, או תאים הועברו ניתן יהיה להתייחס ביתר פירוט בתוצאות הנציג וחתכים דיון זה נדחו.

הערה: כרכי פירוט ההליכים הבאים לקציר 4 תורם bm12 עכברים, שאמור להניב מספיק תאים להזריק 12-16 עכברים. ששלשנתי עשרה עכברי bm12 בן שבוע-להניב כ 100-140.000.000 ימפוציטים עם כ 25% תאי CD4 T. אם מתחיל עם מספרים שונים של עכברים, או זנים שונים עכבר, כרכים בקנה מידה למעלה או למטה בהתאם. C57BL / 6 עכברים בדרך כלל נותנים תשואות דומות עם קרוב יותר לרק 20% תאי CD4 T.

הערה: בצע את כל השלבים ב RT ולהשתמש במדי RT כדי למנוע הלם חום וקור, אשר יכול לפגוע בכדאיות הלימפוציטים לטווח ארוך. לבצע רקמת קציר ומדרגות עיבוד רקמות בברדס בתרבית רקמה באמצעות טכניקת aseptic. כל כלי התקשורת בפרוטוקול זה הוא IMDM עם 10% FBS, אלא אם כן צוין אחרת, ופשוט להיות המכונה חום מומת "תקשורת מלאה."

1. שיטה חדשה לעכברי Genotyping bm12

הערה: פרוטוקול הגבלה קצרה המבוסס על תקציר עבור genotyping מסופק כאן, כאלטרנטיבה פשוטה וזולה לרצף, שנמצא כרגע בשיטת genotyping פורסמה רקלעכברים אלו.

  1. לבודד הדנ"א הגנומי מזנבות עכבר. עיין במאמר קודם יופיטר לפרוטוקולים מפורטים על גזיר זנב עכבר והדור של cDNA מזנב מעכל 13.
  2. בצע תגובה ההפוכה-טרנסקריפטאז שרשרת פולימר (PCR) 14 כדי להגביר קטע DNA 474 נ"ב נפוץ מMHC-II IA ב וIA bm12 באמצעות פריימרים ותנאי thermocycling מפורטים בטבלה 1.
  3. לבצע הגבלה לעכל על ~ 7 μl של מוצר ה- PCR באמצעות אנזים PsuI, או אחד מisoschizomers (BstX2I, BstYI, MflI, או XhoII), אשר חותך סוג בר IA ב, אך לא המוטציה IA bm12. עקוב לעכל פרוטוקול המסופק על ידי היצרן, אשר יפורט בתערובת של מים, חיץ ואנזים, ודגירה של 5 דקות. לכמה שעות בC 37 ° 15.
  4. לטעון לעכל מוצר ולרוץ על 1% ג'ל polyacrylamide עם ברומיד 14 במשך 30-45 דקות. ב 150V-פי הגדרות מתח והזמן אופטימליות משתנות בהתאם למנגנון ג'ל PCR בשימוש. דמיינו להקות DNA עם הפנס UV. נציגי תוצאות מוצגות באיור 1.

איור 1
נציג 1. איור bm12 תוצאות genotyping.
לזהות עכברים הומוזיגוטים לIA bm12 / bm12, DNA הזנב הוקרן לbm12 ידי PCR / הגבלה לעכל genotyping (שלב 1). סוג בר הומוזיגוטים (IA B / B) DNA מניב שתי להקות ב227 ו247 נ"ב (דמיינו כלהקה אחת עבה ב ~ 250 נ"ב); תשואות bm12 הומוזיגוטים (IA bm12 / bm12) DNA להקה אחת ב474 נ"ב; והטרוזיגוטיים (bm12 IA / ב) DNA מניב שתי להקות ב ~ 250 ו474 נ"ב. אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

תורם 2. קצירתאים

  1. עכברי תורם קורבן באמצעות מוסדי טיפול בבעלי חי ועדת שימוש (IACUC) -approved שיטות המתת חסד ראשוניות ומשנית. לדוגמא, להרדים עכברים בחנק עם CO 2 ואחריו נקע בצוואר הרחם.
  2. באמצעות טכניקה האספטי, טחולי קציר ובלוטות לימפה (צוואר רחם שטחי, לסת, זרוע, בית השחי, mesenteric, ומפשעה) ל -15 מיליליטר צינורות המכילים 10 מיליליטר תקשורת מלאה כמו ב11-13.
    הערה: עיין בדוחות קודמים לפרוטוקולי נתיחת בלוטה לימפה מפורטת 16-18. מודל זה הוא גם מוצלח באמצעות splenocytes עכבר רק להעברה, אך התוספת של בלוטות לימפה מפחיתה את המספר הנדרש של עכברים תורמים באופן משמעותי.
  3. צור השעיה תא בודד על ידי רסוק רקמות הלימפה שנאספו בשלב 2.2 באמצעות 70 מיקרומטר מסננות תא באמצעות הבוכנה של מזרק. לתשואות טובות יותר, לא להעמיס מסננות שימוש ~ 6 מסננות לכל 4עכברי מעובד, ולשטוף מסננות לעתים קרובות בזמן עיבוד. לשלב רקמות מ4 עכברים לתוך צינורות חרוטי שני 50 מיליליטר, ואז תאי צנטריפוגות במשך 5 דקות ב 400 XG ולמזוג supernatant.
  4. תאי Resuspend משני צינורות חרוטי 50 מיליליטר בתקשורת והעברה לצינור חרוטי חדש שלמות. שמור צינור זה ב RT.
    הערה: השומן שומר על הצדדים של הצינור, ואם הצינור אינו מוחלף, תשואות סלולריות סופיות יכולות לסבול.

ספירת תאים 3. תורמות

הערה: כדי לשמר את תמוגה הכדאיות הגבוהה ביותר, תא דם אדום (RBC) של המדגם כולו אינו מומלץ.

  1. מערבבים השעיה תא בודדת מצעד 2.4 גם, להסיר 1 מ"ל ולהעביר אותו לחרוטים נפרדים 50 מיליליטר. מניח בצד הנותר, תאים לא נגעו (49 מיליליטר) ב RT תוך ספירה.
  2. להוסיף 3 מיליליטר של חיץ תמוגה תא דם אדום מבוסס אמוניום כלוריד למדגם התא התורם 1 מיליליטר. מערבבים בעדינות דקות 1. על ידי נדנדה, ואז למלא 50 מיליליטר עם תקשורת מלאה,ND צנטריפוגות במשך 5 דקות. ב 400 XG וsupernatant למזוג.
  3. Resuspend RBC, lysed תאים ב 10 מיליליטר תקשורת מלאה וספירה (למשל, עם trypan הכחול באמצעות hemocytometer). תוצאת כפל על ידי 49-זה הוא המספר הכולל של תאים שנותרו במדגם-lysed לא שמניח בצד. בטל RBC, lysed תאים.

4. תיוג תא התורם ו / או טיהור תאי CD4 T

  1. אם תרצה, לטהר תאי CD4 T בשלב זה, אם כי זה לא הכרחי. בנוסף, אם תרצה בכך, תאי תווית עם CFSE, כב -19, או צבעי מעקב תא אחרים, למשל של שמוצג באיור 4 של סעיף תוצאות הנציג.
    הערה: לטיהור תאי CD4 T, בחירה מגנטית שלילית מומלצת, כפי שהוא יכול להשיג את טוהר גבוה ומשאיר תאים נגעו עם כדאיות גבוהה כפי שמתואר ב -20. חשוב שהמאגרים ללא רעלן פנימי משמשים; לכן, במקום BSA, להפוך את שנינות חיץ הפרדהh 2% FBS והריכוז המומלץ של EDTA.

5. הזרקה של תאי bm12 תורמים

  1. לאחר ספירת לימפוציטים מסוג תורם בשלב 3 (ומטוהר או שכותרתו כמו בשלב 4, כרצוי), תאי צנטריפוגות במשך 5 דקות ב 400 x גרם. למזוג תאי supernatant וגלולים בPBS ב -120 מיליון ימפוציטים לכל מיליליטר (או 30 מיליון תאי CD4 T מטוהרים לכל מיליליטר). העברת תאי 5 מיליליטר סטרילי צינור מסביב לתחתית, או צינור סטרילי אחר שבקלות להכיל מצויד בx 13 מ"מ 27.5 מחט G מזרק 1 מיליליטר.
  2. לפני ההזרקה, להפריש מדגם קטן של תאי תורם מצעד 5.1 על 4 מעלות צלזיוס לזרימה מכתימה כדי לקבוע את אחוז תאי CD4 T בתוך דגימות תורם. כתם דגימות אלה, כמתואר בשלב 8 באמצעות הלוח המינימלי נוגדן (טבלה 2).
    הערה: אם תאים מזנים שונים עכבר משמשים כתורמים נפרדים, זה הוא שיקול חשוב, ואם אחוזי תאי CD4 T להשתנות באופן משמעותי, PURification ייתכן שיידרש.
  3. מערבבים בעדינות את תאים, אך ביסודיות. ניתן לעשות זאת על ידי pipetting תאים למעלה ולמטה באמצעות מזרק 1 מיליליטר ללא מחט מחוברת. לאחר הערבוב, לצייר תאים לתוך מזרק 1 מיליליטר. צרף מחט לאחר הסרת כל בועות אוויר. שמירה על המחט ומאילו תחול המזרק מסייעת לשמור על כדאיות תא.
  4. להזריק 250 μl לכל עכבר (שהוא שווה 30 מיליון לימפוציטים, או 7.5 מיליון תאי CD4 T מטוהרים לכל עכבר) intraperitoneally, כפי שתואר ב -21.
    הערה: בניסויים שמוצגים כאן ובעבודה לפנינו 11, כל עכבר מוזרק עם 30 מיליון לימפוציטים מוחלט מbm12 תורמים, ולא 100 מיליון splenocytes הכולל משמש באופן מסורתי. בנתונים שלא פורסמו מהמעבדה שלנו, לא נצפה הבדל באנטי-סרום dsDNA ביום 14 הבאים זריקות של 30 או 100 מיליון לימפוציטים לכל עכבר. אמנם זה מפחית את מספר העכברים הדרושים לניסויים, הפיתוח של שנינות דלקת כליות באופן משמעותישעות מספר זה של תאים לא העריך.

6. לקבוע השתלה יעילה

הערה 1: סעיף זה יתאר כיצד לקבוע את מידת השתלת תאי תורם בנמען ביום 3 במטרה לזהות כל עכברים שייתכן שקיבלו זריקות לא טובים (למשל, את השתל בעכבר אחד הוא <10% מזה שנראה ב כל עכברים אחרים מאותה הקבוצה). נתונים אלה יכולים גם לעזור לקבוע אם תאים מזן עכבר מהונדס גנטי נדחים בנקודות זמן מאוחר יותר (לפרטים, ראו סעיף תוצאות נציג, איור 6).

הערה 2: סעיף זה אפשרי רק אם תורמים ומקבליהם מעכברים על רקע שונה congenic, למשל, בעת שימוש בתורמי CD45.1 bm12 וCD45.2 C57BL / 6 נמענים, או כאשר תאי תורם מסומנים עם צבע תא מעקב. חשוב לציין, ב3 ימים לאחר הזרקה, תאי CD4 T עברו הרחבה מינימאלית (SEסעיף ה נציג תוצאות, איור 4), כך ההבדלים שנצפו במידת ההשתלה נובעים שונות בזריקות, לא הרחבה.

  1. הרדימי עכברים עם isoflurane 4% או שיטה אחרת שאושרה על-IACUC. בדוק את הרפלקסים של רגל אחורית כדי להבטיח עכבר הוא הרדים כראוי לפני שימשיך ללקיחת הדם.
  2. דם 100-200 μl קציר באמצעות שיטה שאושרה IACUC, כגון ניקור רטרו מסלולית כב -22. איסוף דם לתוך 0.5 מיליליטר צינורות microcentrifuge בודדים המכילים נוגדת קרישה, כגון צינורות איסוף הפלזמה הפניה בטבלת החומרים, המכילים dipotassium lyophilized EDTA. לאחר איסוף דם, להפעיל לחץ עדין לעין העכבר באמצעות מגבת או גזה סטרילית על מנת להבטיח שהדימום ייפסק, ואז למקם את העכבר בחזרה בכלוב בבית שלה שבו הוא יישאר עד הקציר הסופי רקמות (שלב 7).
    הערה: אל תשאיר עכברים ללא השגחה עד העכברים חזרו להכרה מספקת ללשמור על כיבה הגחון, ולא לחזור עכברים לחברתם של אחרים עד התאושש לחלוטין.
  3. להביא נפח דם 500 μl עם 21 מעלות צלזיוס PBS ולהעביר לצינור microcentrifuge חרוטי-תחתון, אז עמד ביסוד לאט 200 μl של 21 מעלות פתרון הפרדת תא צפיפות גבוהה C עם pipet μl 200, להיות זהיר, כדי למזער את הערבוב בין שני השלבים ( ראה לוח חומרים לפתרונות מומלצים). תאי צנטריפוגה ב 700 XG במשך 20 דקות במעלות צלזיוס 20-25 עם בלם צנטריפוגות מוגדר נמוך.
  4. הסר שכבה עליונה המכילה לימפוציטים עם pipet 1 מ"ל ולהעביר צינור microcentrifuge חדש המכיל 800 μl תקשורת מלאה קרה. בעדינות המערבולת לערבב תאים. תאי צנטריפוגה ב 700 XG במשך 5 דקות על 4 מעלות צלזיוס וsupernatant למזוג.
  5. תאי Resuspend ב -200 μl תקשורת מלאה, העברה לצלחת 96-היטב U-תחתונה, וכתם לcytometry זרימה כפי שמתואר בשלב 8 באמצעות פנל מינימאלי נוגדן (טבלה 2) כדי לקבוע tהוא שפע יחסי של שתל תאי CD4 T כאחוז מPBMCs.

7. רקמות סופיות קציר

הערה: הניסויים מתוארים בסעיף התוצאות נקצרה 14 ימים לאחר ההזרקה של תאי תורם (או במקרים מסוימים פחות זמן), כפי שהם מתמקדים בפיתוח הראשוני של תאי TFH ותאי פלזמה; עם זאת, מאז מודל זה הוא מודל GVHD כרוני של SLE, מחלה יכולה להיות במעקב בהרבה נקודות זמן מאוחר יותר. הזמן האופטימלי יהיה תלוי בשאלת המחקר שהוצגה בכל ניסוי בודד.

  1. בנקודת זמן שנקבעה מראש לאחר ההזרקה של תאי תורם bm12 (שלב 5.4), להקריב את העכברים באמצעות שיטה שאושרה IACUC של המתת חסד. מחנק עם CO 2 ואחריו exsanguination מומלץ. נקע בצוואר הרחם יכול לתפקד כשיטת משנית של המתת חסד, אבל זה עשוי להפחית את תיקו דם התשואה.
  2. להרטיב את הבטן של העכבר קל עם בקבוק תרסיס המכיל 70%אתנול. לעשות חתך קטן, שטחי עם מספריים כירורגיות כ 1 סנטימטר מעל לאברי המין. לסגת העור של הבטן לכיוון עצם החזה, להיות זהיר, כדי לשמור על fascia הצפק בשלמותה.
    הערה: עכברים שחלו בדרך כלל בהווה עם 0.5-3 מיליליטר מיימת ביום 14, אשר, למרות שזה עדיין לא מאופיין היטב, ניתן למדוד ולנתח כפרמטר מחלה נוסף.
  3. להתאים מזרק 5 מיליליטר עם מחט 18 G. הכנס את המחט לתוך רבע הימני התחתון של הבטן עם המחט מופנה לכיוון ראשו של בעל החיים ועל 15 מעלות זווית למישור של fascia. מקם את קצה המחט ליד cecum כדי למנוע את המחט ממקבלת סתום עם מעי תוך aspirating מיימת.
  4. לסובב בזהירות את העכבר על צידו, ולאחר מכן לצייר לאט מיימת לתוך המזרק. ברגע שמיימת כבר התאוששה, להסיר את המזרק ולהקליט לשאוב נפח, המבוסס על סימוני הנפח בצד של syringe.
  5. מיימת הפריקה לתוך צינור 5 מיליליטר מסביב לתחתית וחנות על קרח לעיבוד מאוחר יותר.
  6. דם קציר באמצעות תיקו מנחות הווריד הנבוב (IVC) במהות כב -22. בעזרת מלקחיים משעממים, בעדינות להזיז מעיים לצד השמאלי של העכבר, חשיפת IVC. הכנס מצוידת למזרק 1 מיליליטר לIVC מחט 27.5 G ולצייר 400-500 μl דם באיטיות.
  7. כדי למזער המוליזה, לאט להזריק דם לתוך צינור סרום microcentrifuge 0.5 מיליליטר או אוסף פלזמה. לניתוח מאוחר יותר של סרום אנאס ידי ELISA, לשמור דם על קרח.
  8. לנתח ולקבל נוסף רקמות רלוונטיות (טחול ו, אם תרצה בכך, בלוטות הלימפה וכליות, במיוחד אם איסוף בנקודות זמן מאוחר יותר וגלומרולונפריטיס יהיה כבש). הסר טחול בעדינות על ידי הצבת המעיים חזרה לכיוון צד ימין של בעלי החיים, ומושך בלבלב, שהוא רקמת החיבור הראשונית של הטחול.
  9. הסר את כל לבלב שנותר, אז לשקולטחולים על איזון ברמת דיוק גבוה מייד לאחר נתיחה, כsplenomegaly ברוטו הוא פרמטר נפוץ דיווח במודלים של עכברים של SLE. מניחים רקמות הלימפה לתוך צינורות 1.5 מיליליטר פרט מלא בתקשורת מלאה 1ml על קרח. תקן כליות ב 10% ניטראלי שנאגרו פורמלין או הצמד להקפיא כליות להיסטולוגיה מאוחר יותר כב -23.
  10. דם צנטריפוגה בשעה 2 של אוסף 3 דקות. ב10,000 XG (4 מעלות צלזיוס). הסר סרום ולאחסן ב -80 ° C לניתוח מאוחר יותר של ANA ידי ELISA. עיין בדוחות קודמים לפרוטוקולי ANA ELISA מפורטים 24,25. סרום חנות במספר רב של 10-20 aliquots μl כדי למזער מחזורי הקפאה / הפשרה, ולאפשר למספר גדול יותר של מבחני עתיד.
  11. צנטריפוגה מיימת 400 XG במשך 5 דקות. הסר את supernatant עם pipet 1 מיליליטר וaliquot לכמה צינורות 0.5 מיליליטר. להקפיא supernatant ב -80 ° C לניתוח מאוחר יותר של נוגדנים נגד גרעין (Anas) או מתווכים דלקתיים מסיסים אחרים.
  12. fract הסלולרי גלול יון בתקשורת מלאה 1 מיליליטר ולהעביר כ -200 μl לצלחת 96-היטב U-תחתונה לזרימת צביעה (כמו בשלב 8).
  13. מועכים כל טחול דרך 70 מיקרומטר מסננות תא לתוך צינורות נפרדים ולשטוף עם תקשורת מלאה. Resuspend splenocytes עם 1 מיליליטר חיץ תמוגה RBC קר דקות 1. ומערבבים בעדינות על ידי נדנדה. תביא נפח 10 מיליליטר עם תקשורת מלאה קרה וצנטריפוגות במשך 5 דקות ב 400 XG ולמזוג supernatant.
  14. גלולה תא גלולה ב 5 מיליליטר תקשורת ושלמה לספור באמצעות hemocytometer. להתאים את עוצמת הקול באופן ש200 μl של מדיה מלאה מכיל 1-3,000,000 תאים. בגין מכתים לcytometry זרימה (שלב 8) באמצעות רכב מורחב (טבלה 2) לכמת תורם בידול CD4 T תא ותא B הנמען והתרחבות.
    הערה: בהתאם למה לייזר, שילובי צינור מכפיל (PMT), ומערכת סינון זמינות, הפרדת פנל ניתוח תא T ו- B ללוחות מרובים עשויה להיות נחוצה.
ve_title "> 8. תזרים מכתים

  1. העברה 1-3,000,000 splenocytes בתקשורת מלאה 200 μl לתוך 5 מיליליטר בודד צינורות מסביב לתחתית, או לתוך בארות נפרדות של צלחת 96-היטב U-תחתונה.
    הערה: שימוש בצלחת 96-היטב היא דרך יעילה להכתים דוגמאות רבות, אך דואג לצלחת דגימות בכל גם אחרים על מנת למנוע זיהום צולב. צלחת 96-היטב אחד בהתאם יכולה להחזיק 24 דגימות.
  2. צלחת צנטריפוגה XG ב 500 במשך 3 דקות., אז supernatant קפיצי מצלחת לתוך המכל מתאים (Biohazard).
  3. Resuspend את כדורי תא עם זרימת חיץ (1% FBS PBS) 100 μl מכילים צבע כדאיות ניתן לתקן בריכוז והמטוהר אנטי-CD16 / אנטי CD32 קוקטייל נוגדנים ב1 מיקרוגרם / מיליליטר המומלצים של היצרן. דגירה של 10 דקות ב 20-25 מעלות צלזיוס, ולאחר מכן להוסיף 100 מדיה מלאה קרה μl כדי להרוות את צבע כדאיות.
    הערה: Splenocytes מעכברים חולים בדרך כלל מכיל מספרים גבוהים יחסית של תאים מתים או גוססים;לכן, ההכללה של צבע כדאיות מומלצת להימנע תיוג נוגדן שאינו ספציפי למוות תאים, וכתוצאה מכך נתונים נקיים, אמין יותר. באופן דומה, הקוקטייל אנטי-CD16 / אנטי CD32 כלול לחסום נוגדני fluorescently שכותרתו אינם ספציפיים מחייבים על ידי קולטני Fc.
  4. צלחת צנטריפוגה XG ב 500 במשך 3 דקות., אז supernatant קפיצי מצלחת לתוך מיכל Biohazard. תאי Resuspend ב -200 זרימת חיץ μl. צלחת צנטריפוגה XG ב 500 במשך 3 דקות., אז supernatant קפיצי מצלחת לתוך מיכל Biohazard.
  5. תאים גלולים בקוקטייל נוגדנים המכילים 50 זרימת חיץ μl (טבלה 2). דגירה של 20 דקות ב 4 מעלות צלזיוס, ולאחר מכן להוסיף 150 זרימת μl חיץ. שלב לשטוף חזור על 8.4.
  6. תאי Resuspend עם paraformaldehyde 100 μl 2% ב- PBS. דגירה של 30 דקות ב 4 מעלות צלזיוס, ולאחר מכן להוסיף 100 זרימת μl חיץ. צלחת צנטריפוגה XG ב 500 במשך 3 דקות., אז supernatant קפיצי מצלחת לתוך מיכל Biohazard.
  7. Resuspend בזרימה 200 חיץ μl, להעביר לזרום מוסיף צינור או צינורות זרימה סטנדרטיים, להוסיף זרימת חיץ נוסף 100-200 μl, וחנות ב 4 ° C בחושך עד רכישה על cytometer זרימה.
  8. לרכוש על cytometer זרימה מצויד בלייזרים המתאימים וPMTs ללוחות נוגדן שנבחרו בתוך כמה ימים של כתמים. רוחב שיא קדימה פיזור ו / או גובה בנוסף להעברת שטח פיזור, אזור פיזור צד, ושטח של הפרמטרים הניאון נוצלו. לקבלת תוצאות אמינות, לרכוש ≥1,000 תאי תורם בכל דגימת WT, או מספר שווה של לימפוציטים מסוג הכולל בעכברים מהונדסים גנטי מניפולציות או אחרים שמראים הרחבה מינימאלית של תאי תורם, שבו אוסף של אירועים רבים כל כך לא יכול להיות אפשרי.
    הערה: Cytometry זרימת ניתוח מתואר בפירוט בסעיף תוצאות הנציג (איורים 3-6).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

עכברים חולים לפתח splenomegaly קטן כמו 14 ימים, מציגים טחולים 2-3 פעמים בגודל של עכברים בריאים במונחים של מסה וcellularity (איור 2).

Splenocytes הם מגודרת ברצף על פיזור אור (FSC-ידי SSC-), חיסול כפילויות (FSC-W או -H ידי FSC-A), תאי קיימא (הכתמה נמוכה של צבע כדאיות), וCD4 + TCRβ + (איור 3A). תאי תורם נבדלים מתאי נמען מבוססים על CD45.1 וCD45.2 (איור 3, שמאלי תחתון). תאי תורם בעיקר לאמץ פנוטיפ תא עוזר זקיקי T (TFH), כמאופיינים גברת הביטוי של PD-1, CXCR5, Bcl-6, וICOS (איור 3, C). חלק מאוכלוסיית תא נמען CD4 T גם מבדיל לTFH (איור 3, ימני תחתון). לאחר למות מראשוני ו / או הגירה של תאים הועברו, הרחבת TFH תורם נגזרות היא לוגריתמים, reaching 10-20 מיליון תאים בטחול של עכברים 14 ימים לאחר ההזרקה (איור 3D).

CFSE תיוג של לימפוציטים הועבר הוכיח כי תורם תאי CD4 T להתמיין TFH מוקדם לאחר הפעלה; בעצם כל התאים מתחלקים נצפו בימים 3, 7, ו -14 הוגברו CXCR5 וPD-1 (איור 4). פרופילי שיא ההתפשטות גם מצביעים על כך שאחוז נמוך יחסי של תורם תאי CD4 T עבר alloactivation וחטיבה. ביום 14, רוב תאי התורם לגילוי הם אלה שמחולקים מעבר למספר המרבי של חטיבות למדידה על ידי CFSE.

הרחבת TFH תורם נגזרות מלווה בהצטברות מקבילה של תאי B GC אנדוגני ותאי פלזמה (איור 5 א). הצטברות של תאי פלזמה בטחול מתעכבת בהשוואה לזו של TFH, שאינה מראה שום עלייה מעל בעלי חיים תמימים בימים 3 או 7 (איור 5). Accordingly, נוגדנים נגד גרעין אינם קלות לזיהוי לפני היום 9 (מידע לא מוצג), אך ניתן לכמת באופן מהימן ביום 14 11.

באמצעות השימוש בסמנים congenic, שראינו דחייה של תאי תורם בזנים מרובים. בזמן הזה הוא בעיה נפוצה כאשר עכברים לא מספיק backcrossed לרקע C57BL / 6, שגם נצפו דחייה כאשר תאי bm12 הועברו לעכברים / CyJ (CD90.1) B6.PL- Thy1 שנחשבים בדרך כלל להיות באופן מלא backcrossed. לכן, עכברים מוקרנים באופן שגרתי ביום ~ 3 על ידי דגימות דם זרימה מכתימה להעריך את היעילות של שתל תאי CD4 T הראשוני; אנחנו יודעים מניסויי התפשטות CFSE שמורכבים תאים הרחיבו מעט מאוד בתחילת נקודת זמן זו. תוצאות אלו אז בהשוואה לתוצאות שהתקבלו מקציר יום 14. במקרה דוגמא של דחייה, 30 מ'CD45.1 + bm12 ימפוציטים הועברו לCardif - / - עכברים שהיה backcrossed לעכברי C57BL / 6 במשך 12 דורות. ביום 5, כל העכברים מוצגים השתלה שווה ערך (2-3% במחזור של תאי CD4 T), אבל ביום 14, bm12 תאי תורם בוטלו לחלוטין מהנמען המהונדס הגנטית (איור 6).

איור 2
קינטיקה צמיחת 2. טחול איור לאחר ההזרקה של לימפוציטים bm12. הטחולים נשקלו על איזון ברמת דיוק גבוה ישירות לאחר כריתה (משמאל). מספרי תא חיים נקבעו על ידי ספירה עם hemocytometer באמצעות trypan הכחול להוציא תאים מתים (מימין). תוצאות מוצגות כממוצע ± SEM, כאשר n = 9, 4, 3, ו -6, בהתאמה. אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

jpg "/>
איור 3. ניתוח של הרחבת תא עוזר זקיקי T במודל bm12 של SLE. CD45.1 + bm12 ימפוציטים הועברו לC57BL / 6 המקבלים וטחולים נותחו 14 ימים לאחר מכן. () אסטרטגית gating נציג מראה "לימפוציטים" (פנל ראשון), "תאים בודדים" (פנל שני), "תאי חיים" (פנל שלישי), ו" תאי CD4 T "(פנל הרביעי). תאים (B) תורמים הם מכובדים מנמען CD4 T תאים על ידי CD45.1 וצביעת CD45.2 ונותח לביטוי של PD-1 וCXCR5. תאים תורמים (C) לאמץ פנוטיפ TFH, כפי שצוין על ידי גברת הביטוי של כמה חלבונים נפוצים הקשורים TFH. (ד) תוצאות אופייניות המראות את הרחבת TFH תורם נגזרות (המוגדרת כPD-1 + תאי חיים CXCR5 + CD4 + CD45.1 +) ב 3 ימים, 7, ו -14 שלאחר העברה. תוצאות מתוארותשל ממוצע ± SEM, כאשר n = 5, 4, 3, ו -6, בהתאמה. אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

איור 4
איור 4. PD-1 וCXCR5 הם שהוגברו על חלוקת תאים. תאי Bm12 תויגו עם CFSE לפני ההזרקה לתוך C57BL / 6 נמענים. זרימת חלקות נציג מוצגות לתורם תאי CD4 T ב 3, 7, ו -14 ימים לאחר ההזרקה. אנא לחצו כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

איור 5
הרחבת איור 5. של תאי פלזמה הטחול וGC תאי B. () זרימת חלקות נציג מטחולי עכבר נאיביים, או אלה מעכברים 14 ימים לאחר CD45.1 + bm12 העברה. תאי פלזמה מוגדרים כתאי חיים נמוכים CD138 + CD19 (לוחות העליונים). GC תאי B הם קבוצת משנה של CD19 + תאי B, המבטאים GL-7 ופאס (לוחות תחתון). נתונים (B) Quantitave מראים את ההצטברות של תאי פלזמה הטחול לאורך זמן. תוצאות מוצגות כממוצע ± SEM, כאשר n = 5, 4, 3, ו -6, בהתאמה. אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

איור 6
שתלי איור 6. Bm12 נדחים על ידי כמה עכברי נמען מהונדסים גנטי. CD45.1 + bm12 ימפוציטים הועברו לאו עכברים מהונדסים גנטי (לוחות העליונים) או / 6 (לוחות תחתון) עכברי נמען C57BL. עכברים דיממו שבלאחר הזרקה 5 ימים והעריכו ליעילות שתל. Splenocyteים מאותו העכברים נותחו 14 ימים לאחר מכן. אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

שם פריימר רצף (5 '- 3') טמפרטורת חישול
Bm12F CGTGGTCCCCGCTGTCCCCC * 65 מעלות צלזיוס
Bm12R GGGCAGAGGGCAGAGGTGAG
מגזר מספר המחזורים טמפרטורה משך
1 1 95 מעלות צלזיוס 2 דקות.
2 40 95 מעלות צלזיוס 15 שניות.
* 65-0.5 ° C / צעד 15 שניות.
72 מעלות צלזיוס 45 שניות.
3 1 72 מעלות צלזיוס 10 דקות.

טבלה 1:. תחל ותנאי thermocycling לgenotyping bm12 תנאי thermocycling אופטימליים יהיו תלויים בחומרים הכימיים המדויקים והמכשירים המשמשים. תנאים אלה מותאמים לthermocycler מסוגל לשנות טמפרטורת חישול בכל שלב, אם כי ייתכן שגם הפרוטוקול לעבוד באמצעות חישול בטמפרטורה סטטית.

טבלה 2
טבלה 2:. לוחות נוגדן לTFH הטחול, GC B ותאי פלזמה זיהוי על ידי cytometry זרימת פירוט לוחות השתמשנו בהצלחהלהערכת יעילות שתל ביום 3 (משמאל) והניתוח של תאי T ו- B ביום 14 לאחר הזרקת bm12 תא (באמצע). אלה כבר מותאמים לLSRII עם 5 לייזרים (355, 405, 488, 561, 640 וננומטר). מערכות סינון מומלצים לכל fluorochrome רשומות (מימין), אם כי אלה לא יכולים להיות האפשרות הטובה ביותר עבור כל מכונה. תלוי מה לייזר, PMT, ושילובי מערכת סינון זמינים, הפרדת פנל ניתוח תא T ו- B ללוחות מרובים עשויה להיות נחוצה.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

המודל מושרה bm12 הוא דרך קלה יחסית ויעילה ללמוד את התהליכים התאיים ומולקולריים של SLE. הפעלה כרונית של תאי CD4 T הועברו adoptively המכוון נגד אנטיגנים עצמיים מובילה להצטברות של TFH, GC תאי B, ותאי פלזמה אשר ניתן למדוד על ידי cytometry זרימה, כפי שתואר כאן. מחקרים עתידיים באמצעות מודל זה יכול לחקור את התפקיד של גני מועמדים וטיפולים חדשניים בתהליכי המרכז נבטי אוטואימוניות שדומות לאלו המתרחשים בחולים עם SLE, וסופו של דבר קובעים את ההצטברות פתולוגית של נוגדנים עצמיים במהירות ובקלות. יתר על כן, ניתוח התזרים cytometric המתואר כאן יכול לשמש כדי לחקור מודלים עכבר נוספים שכרוכים בפיתוח של נוגדנים כוללים, אך לא מוגבל לאוטואימוניות, זיהום, ואלרגיה.

כמו כל המודלים של בעלי החיים למחלות אנושיות, מודל זה יש גם המגבלות שלה. בהתחשב במהירות שבה devel המחלהוops גודלה, לא כל המעורבים בפיתוח של SLE גנים עשויים להיות נחוצים לפתוגניות במודל זה. בנוסף, יש להקפיד על מנת לשלול דחיית שתל נתונים כאשר מציעים הרחבה מינימאלית של TFH במקבלים מהונדסים גנטי. יש להשתמש בסמני Congenic כדי לאשר את קיומם של תאי תורם בקציר במיוחד מאז תאי נמען יכולים גם להתמיין TFH (איור 3), שעלולים להסוות את היעדרם של תאי תורם. שימוש בסמני congenic, צפינו חיסול של תאי תורם שכנראה טיפחו אנטיגנים דחייה ביום 14 (איור 6) שלם. אנחנו השתמשנו בהצלחה CD45.1 + וbm12 CD45.2 + bm12 עכברים כתורמים, וCD45.1 + BoyJ (B6.SJL- Ptprc Pepc b / BoyJ) וCD45.2 + C57BL / 6 עכברים כמקבלים (איורים 3, 6, 7, ונתונים שלא פורסמו). עם זאת, congenic סוג ברCD90.1 + תאים מB6.PL- Thy1 זן העכבר / CyJ לא להשתיל גם, ולא לעשות CD90.2 + bm12 תאי שתל גם בCD90.1 + נמען (נתונים שלא פורסמו), תופעה שהיא כנראה לא ייחודי למודל זה 26.

כך או C57BL / 6 או bm12 עכברים יכולים לשמש כתורם או הנמען, כמו בתחילה דווח על ידי אח מוריס אל. 9 עם זאת, במעבדה שלנו אנו מוצאים את ההעברה של תאי bm12 לעכברים B6 מייצרת הרחבת תא T ו- B תא עקבית יותר אוכלוסיות ביום 14. יתר על כן, תורם והמקבל עכברים מקבוצות שונות צריכים להיות מגדר וגיל בהתאמה. למרות שניסויים שדווחו בתיאור הראשון של המודל bm12 לא מצאו הבדל משמעותי בכל פרמטר מחלה בין הגברים → הזכר ונקבה העברות → נקבת 9, העברות נקבת → זכר לא מומלצת, כאנטיגן זכר (HY) באו לידי ביטוי בתאי CD4 T הועברו עשוי לגרום לreje שתלction במקבלי נקבה 27.

בעת בחירת נוגדנים וfluorochromes לסמני congenic, יש לציין כי תאי תורם הפכו חיוביים עבור סמן congenic נמען בדרגות שונות, כך שCD45.2 - השער לא מהווים כל CD45.1 + שתל. התופעה באה לידי ביטוי באופן ברור השוואת ביטוי CD45.2 ידי CD45.1 + נאיבי, CD45.1 + תורם, וCD45.2 + נמען תאי CD4 T (איור 7). יש לציין, נראים תאי תורם גם לupregulate ביטוי של סמן congenic שלהם, בהשוואה לקבוצת ביקורת נאיבית (איור 7). תוצאות דומות נראות גם עם CD45.2 + bm12 העברה לעכברים CD45.1 + BoyJ (מידע לא מוצג). יש להניח, רכישה של תוצאות CD45 הנמען מtrogocytosis 28 על ידי תאי CD4 T מופעלים הבאה חזרו אינטראקציות עם תאי B הנמען. למעשה, המצב bm12l עשוי להוכיח כלי שימושי בלימוד התהליך של trogocytosis in vivo.

איור 7
איור 7. תאי תורם לרכוש נמען CD45 סמן congenic. CD45.1 + bm12 ימפוציטים הועברו לCD45.2 + C57BL / 6 נמענים. תורם, נמען, ונאיבי (+ CD45.1) תאי CD4 T מוערכים לCD45.1 וביטוי CD45.2 14 ימים לאחר ההעברה. אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

הוכח כי ההעברה של תאי CD4 T bm12 מטוהרים לC57BL עכברים / 7 היא מספיק כדי ליזום מחלה 29; עם זאת, מחלה שווה ערך מתפתחת כאשר כל ימפוציטים מועברים, והטיהור אינה נדרשת בהכרח ללמוד תלות מחלה על לסה"נ TLL-פנימי ביטוי גנים. אייזנברג ועמיתים, בבירור שהתא מייצר נוגדנים במודל bm12 הוא כמעט אך ורק ממוצא נמען 30. יתר על כן, הדרישה לנמען CD4 T תאים 10 מוגבלת ל'הטיפוח 'של תאי B במהלך התפתחותם, שיכול להיות על ידי התוספת של IL-4 אקסוגני 31-יצא לדרך, הנתונים שלנו מצביעים אף נמען שתאי T יכולים להשתתף במידה מסוימת בתגובת המרכז נבטי, כחלק מהם לעשות לפתח פנוטיפ TFH (איור 3, ימני תחתון).

החלטה קריטית אחת שחייב להיעשות עבור כל ניסוי bm12 היא כאשר למסוק רקמות לניתוחים. כמובן ההחלטה תלויה בדיוק מה גורמים חשובים למחקר הנוכחי, אשר עשוי להשתנות. הניסויים שתוארו כאן לקחת עד 14 ימים, כפי שהם מתמקדים בפיתוח הראשוני של תאי TFH ותאי פלזמה; עם זאת, מאז מודל זה הוא כרונימודל GVHD של SLE, מחלה יכולה להיות במעקב ארוך הרבה יותר. למעשה, תכונות מסוימות קליניות של SLE, כוללים גלומרולונפריטיס, לפתח מאוחר יותר. פרוטאינוריה זוהתה מוקדם ככל 2 שבועות לאחר הזרקה, אך מגיעה לרמות שיא ב4-8 שבועות לאחר הזרקה 10,31. בנוסף, תזרים cytometric ניתוחים שתואר כאן כבר מותאם לניסויים שנמשכים 2 שבועות. אנו מוצאים מספר לא מבוטל של GC תאי B ותאי פלזמה בנקודה זו בזמן; למרות, נתן זמן נוסף, אחוז גדול של תאי פלזמה ANA-מפריש עשוי להימצא במח העצם 32. יתר על כן, תאי הפלזמה זוהו על ידי פנל צביעת זרימה זה סביר כוללים גם plasmablasts-מנת להבחין בין שני סוגים אלה תא, נוגדנים נוספים יידרשו. הרחבת TFH כנראה מגיעה לשיא בשלב מסוים אחרי החלון של 14 היום שבו אנו מתמקדים. עם זאת, למיטב ידיעתנו, אין מחקרים דיווחו bm12 מספר תא תורם מעבר 2 שבועות, או שימושסמני congenic ד לעקוב אחר תאים הועברו adoptively.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
B6.SJL-Ptprca Pepcb/BoyJ The Jackson Laboratory 001162 CD45.1+ BoyJ mouse strain
B6(C)-H2-Ab1bm12/KhEgJ The Jackson Laboratory 001162 Bm12 mouse strain
FastDigest PsuI Life Technologies FD1554 Restriction digest enzyme for genotyping
1X RBC Lysis Buffer eBioscience 00-4333-57
IMDM GE Healthcare SH30228.01
Plasma Separation Tube (PST) BD 365974 Blood collection tube with Dipotassium EDTA
Serum Separation Tube (SST) BD 365967 Blood collection tube with Clot activator / SST Gel
Ficoll GE Healthcare 17-1440-02  High density cell separation solution
Lympholyte-M Cedarlane CL5030 High density cell separation solution
GL-7-biotin eBioscience 13-5902-82 
Streptavidin-BUV395 BD 564176
CD138-BV421 BioLegend 142508
CD4-BV510 BioLegend 100559
TCRβ-BV605 BD 562840
CD45.1-BV711 BioLegend 110739
CD45.2-FITC BioLegend 109806
PD-1-PE BioLegend 135206
CD19-PerCP BioLegend 115532
Fas-PE-Cy7 BD 557653
CXCR5-APC BioLegend 145506
Fixable Viability Dye ef780 eBioscience 65-0865-18
CD4-BV421 BioLegend 100443
1.2 ml FACS tube inserts, racked USA Scientific 1412-1400
BD Falcon™ Round-Bottom Tubes BD 352017

DOWNLOAD MATERIALS LIST

References

  1. Helmick, C. G., Felson, D. T., et al. Part I. Arthritis Rheum. Estimates of the prevalence of arthritis and other rheumatic conditions in the United States. 58, 15-25 (2008).
  2. Lupus Foundation of America Web Site. Available from: http://www.lupus.org/answers/entry/what-is-lupus (2015).
  3. Somers, E. C., Marder, W., et al. Population-based incidence and prevalence of systemic lupus erythematosus: The Michigan lupus epidemiology and surveillance program. Arthritis and Rheumatol. 66, 369-378 (2014).
  4. Perry, D., Sang, A., Yin, Y., Zheng, Y. -Y., Morel, L. Murine models of systemic lupus erythematosus. J Biomed Biotechnol. 2011, 271694 (2011).
  5. Lindholm, L., Rydberg, L., Strannegård, O. Development of host plasma cells during graft-versus-host reactions in mice. Eur J Immunol. 3, (8), 511-515 (1973).
  6. Fialkow, P. J., Gilchrist, C., Allison, A. C. Autoimmunity in chronic graft-versus-host disease. Clin Exp Immunol. 13, 479-486 (1973).
  7. Streilein, J. W., Stone, M. J., Duncan, W. R. Studies on the Specificity of Autoantibodies Produced in Systemic Graft-vs-Host Disease. J Immunol. 114, (1), 255-260 (1975).
  8. Gleichmann, E., Gleichmann, H. Diseases caused by reactions of T lymphocytes to in compatible structures of the major histocompatibility complex. I. Autoimmune hemolytic anemia. Eur J Immunol. 6, (12), 899 (1976).
  9. Morris, S., Cohen, P. L., Eisenberg, R. Experimental induction of systemic lupus erythematosus by recognition of foreign Ia. Clin Immunol Immunopathol. 57, (2), 263-273 (1990).
  10. Chen, F., Maldonado, M., Madaio, M., Eisenberg, R. The Role of Host (Endogenous) T Cells in Chronic Graft-Versus-Host Autoimmune Disease. J Immunol. 161, (11), 5880-5885 (1998).
  11. Klarquist, J., Hennies, C. M., Lehn, M. A., Reboulet, R. A., Feau, S., Janssen, E. M. STING-Mediated DNA Sensing Promotes Antitumor and Autoimmune Responses to Dying Cells. J Immunol. 193, 6124-6134 (2014).
  12. Petri, M., Orbai, A. -M., et al. Derivation and validation of systemic lupus international collaborating clinics classification criteria for systemic lupus erythematosus. Arthritis Rheum. 64, (8), 2677-2686 (2012).
  13. Zangala, T. Isolation of genomic DNA from mouse tails. J Vis Exp. (6), e246 (2007).
  14. Lorenz, T. C. Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies. J Vis Exp. (63), e3998 (2012).
  15. Product information: Thermo Scientific FastDigest PsuI. Thermo Scientific. Available from: https://tools.lifetechnologies.com/content/sfs/manuals/MAN0012567_FastDigest_PsuI_UG.pdf (2012).
  16. Matheu, M. P., Parker, I., Cahalan, M. D. Dissection and 2-photon imaging of peripheral lymph nodes in mice. J Vis Exp. (7), e265 (2007).
  17. Harrell, M. I., Iritani, B. M., Ruddell, A. Lymph node mapping in the mouse. J Immunol Methods. 332, (1-2), 170-174 (2008).
  18. Covelli, V. Chapter 3, Internal examination. Guide to the necroscopy of the mouse. Available from: http://eulep.pdn.cam.ac.uk/Necropsy_of_the_Mouse/index.php?file=Chapter_3.html (2009).
  19. Quah, B. J. C., Parish, C. R. The use of carboxyfluorescein diacetate succinimidyl ester (CFSE) to monitor lymphocyte proliferation. J Vis Exp. (44), e2259 (2010).
  20. Matheu, M. P., Cahalan, M. D. Isolation of CD4+ T cells from mouse lymph nodes using Miltenyi MACS purification. J Vis Exp. (9), e53319 (2007).
  21. Machholz, E., Mulder, G., Ruiz, C., Corning, B. F., Pritchett-Corning, K. R. Manual Restraint and Common Compound Administration Routes in Mice and Rats. J Vis Exp. (67), e2771 (2012).
  22. Hoff, J. Methods of Blood Collection in the Mouse. Lab Animal. 29, (10), 47-53 (2000).
  23. Cohen, M., Varki, N. M., Jankowski, M. D., Gagneux, P. Using Unfixed, Frozen Tissues to Study Natural Mucin Distribution. J Vis Exp. (67), e3928 (2012).
  24. Cohen, P. L., Maldonado, M. A. Animal models for SLE. Curr Protoc Immunol.. Chapter 15, Unit 15.20 (2003).
  25. Seavey, M. M., Lu, L. D., Stump, K. L. Animal models of systemic lupus erythematosus (SLE) and ex vivo assay design for drug discovery. Curr Protoc Pharmacol. Chapter 5, Unit 5 (2011).
  26. McKenna, K. C., Vicetti Miguel, R. D., Beatty, K. M., Bilonick, R. A. A caveat for T cell transfer studies: generation of cytotoxic anti-Thy1.2 antibodies in Thy1.1 congenic mice given Thy1.2+ tumors or T cells. J Leukoc Biol. 89, (2), 291-300 (2011).
  27. Scott, D. M., Ehrmann, I. E., et al. Identification of a mouse male-specific transplantation antigen H-Y. Nature. 376, 695-698 (1995).
  28. Joly, E., Hudrisier, D. What is trogocytosis and what is its purpose. Nat Immunol. 4, (9), 815 (2003).
  29. Brown, D. R., Calpe, S., et al. Cutting edge: an NK cell-independent role for Slamf4 in controlling humoral autoimmunity. J Immunol. 187, (1), 21-25 (2011).
  30. Morris, S. C., Cheek, R. L., Cohen, P. L., Eisenberg, R. A. Allotype-specific immunoregulation of autoantibody production by host B cells in chronic graft-versus host disease. J Immunol. 144, (3), 916-922 (1990).
  31. Choudhury, A., Cohen, P. L., Eisenberg, R. A. B cells require “nurturing” by CD4 T cells during development in order to respond in chronic graft-versus-host model of systemic lupus erythematosus. Clin Immunol. 136, (1), 105-115 (2010).
  32. Slifka, M. K., Antia, R., Whitmire, J. K., Ahmed, R. Humoral immunity due to long-lived plasma cells. Immunity. 8, (3), 363-372 (1998).
דגם bm12 העין מתנהל של זאבת אדמנתית המערכתית (לופוס) בC57BL עכברים / 6
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Klarquist, J., Janssen, E. M. The bm12 Inducible Model of Systemic Lupus Erythematosus (SLE) in C57BL/6 Mice. J. Vis. Exp. (105), e53319, doi:10.3791/53319 (2015).More

Klarquist, J., Janssen, E. M. The bm12 Inducible Model of Systemic Lupus Erythematosus (SLE) in C57BL/6 Mice. J. Vis. Exp. (105), e53319, doi:10.3791/53319 (2015).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter