Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Developmental Biology

जापानी बटेर भ्रूण की जर्दी थैली झिल्ली से प्राथमिक endodermal उपकला सेल संस्कृति

doi: 10.3791/53624 Published: March 10, 2016

Abstract

हम विकास के दौरान एवियन भ्रूण से पोषक तत्व उपयोग मध्यस्थता में कुछ एंजाइमों और प्रोटीन के समारोह के अध्ययन के लिए एक endodermal उपकला सेल संस्कृति मॉडल (ईईसी) की स्थापना की। निषेचित जापानी बटेर अंडे 5 दिनों के लिए 37 डिग्री सेल्सियस पर incubated रहे थे और फिर जर्दी थैली झिल्ली (वाईएसएम) ईईसी संस्कृति प्रणाली स्थापित करने के लिए एकत्र किए गए थे। हम वाईएसएम से भ्रूण एण्डोडर्म परत अलग-थलग, और 2 में झिल्ली कटा हुआ - 3 मिमी टुकड़े और आंशिक रूप से 24 अच्छी तरह से संस्कृति प्लेटों में बोने से पहले कोलैजिनेज़ के साथ पचा। EECS ऊतक से बाहर पैदा करना और सेल संस्कृति के अध्ययन के लिए तैयार हैं। हमने पाया है कि EECS उदाहरण के लिए विवो में वाईएसएम के विशिष्ट विशेषताओं, लिपिड बूंदों का संचय, sterol हे acyltransferase और लिपोप्रोटीन lipase की अभिव्यक्ति थी। आंशिक पाचन उपचार काफी ईईसी संस्कृति के सफल दर में वृद्धि हुई। EECS का उपयोग, हम दिखा दिया है कि SOAT1 की अभिव्यक्ति द्वारा शिविर डी विनियमित किया गया थाependent प्रोटीन इससे संबंधित एक मार्ग kinase। इस प्राथमिक जापानी बटेर ईईसी संस्कृति प्रणाली भ्रूण लिपिड परिवहन अध्ययन करने के लिए और एवियन भ्रूण के विकास के दौरान वाईएसएम में पोषक तत्वों के उपयोग में मध्यस्थता में शामिल जीन की भूमिका स्पष्ट करने के लिए एक उपयोगी उपकरण है।

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

एवियन भ्रूण के प्रमुख पोषण संसाधन की जर्दी, 33% लिपिड, 17% प्रोटीन से बना है, और 1% राख। 1 भ्रूण के विकास के दौरान, जर्दी थैली झिल्ली (वाईएसएम) भ्रूण उदर गुहा के भीतर से बढ़ता है और धीरे-धीरे जर्दी को शामिल किया सतह। भ्रूण दिन 2 में शुरू हुए जीन लिपिड चयापचय और angiogenesis के साथ जुड़े अभिव्यक्ति धीरे-धीरे वाईएसएम में वृद्धि हुई है, और धीरे-धीरे वाईएसएम अंकुर अनुमानों की तरह विकसित करता है। 8,9 इन अनुमानों भ्रूण के विकास का समर्थन करने के लिए जर्दी पोषक तत्वों के अवशोषण में वृद्धि। वाईएसएम एक extraembryonic ऊतक कि तीन रोगाणु परतों, endoderm, mesoderm और बाह्य त्वक स्तर होता है। 14 जर्दी थैली बाह्य त्वक स्तर पीतक झिल्ली धीरे जर्दी थैली को कवर करने के साथ अंडे की सफ़ेदी और लिंक चेहरे। Endodermal उपकला कोशिकाओं अंडे की जर्दी की ओर सीधे सामना करना पड़ा और पोषक तत्व उपयोग पोर्टल के रूप में endodermal उपकला सेल (EECS) सेवा करते हैं। 6 वाईएसएम फैलता है, कर रहे हैं shap से विभाजित किया जा सकता हैई और दो ​​समूहों, क्षेत्र पीतक और क्षेत्र vasculosa में कार्यक्षमता। 7

क्षेत्र पीतक endodermal कोशिकाओं से बना है और भ्रूण से दूर है; क्षेत्र vasculosa mesodermal कोशिकाओं से बना है और रक्त वाहिकाओं और संयोजी ऊतक के साथ भेदभाव EECS शामिल किया गया है। भ्रूण दिन 5, जर्दी पूरी तरह से बाहरी झिल्ली और वाईएसएम के एण्डोडर्म द्वारा कवर किया जाता है और नाड़ी क्षेत्र तेजी से बढ़ा है। वाईएसएम अवशोषित कर लेता है, recomposes और रिलीज लिपिड (के रूप में की जर्दी व्युत्पन्न बहुत कम घनत्व वाले लिपोप्रोटीन) और प्रोटीन भ्रूण संचार प्रणाली में। 9, 2 इसलिए, हम एक प्राथमिक जापानी बटेर भ्रूण endodermal उपकला सेल संस्कृति प्रणाली की स्थापना की, लिपिड के तंत्र का अध्ययन करने के लिए एवियन भ्रूण के विकास के दौरान वाईएसएम में उपयोग।

ऐसे triacylglycerol, लेसिथिन, फॉस्फोलिपिड और कोलेस्ट्रॉल एस्टर (सीई) के रूप में लिपिड एवियन भ्रूण के लिए प्राथमिक ऊर्जा स्रोत हैं। विकास के प्रारंभिक दौर में, जर्दी लिपिड ग रहे हैंकेवल 1.3% सीई की omposed और यह एवियन भ्रूण के विकास के 3 के मध्य अवधि में 10-15% तक बढ़ जाता है, 11। कोलेस्ट्रॉल एस्टर एवियन भ्रूण वाईएसएम में sterol हे acyltransferase 1 (SOAT1) द्वारा कोलेस्ट्रॉल से संश्लेषित है। 4

कोलेस्ट्रॉल के भंडारण के रूप हैच से पहले वहाँ एवियन भ्रूण का तेजी से विकास एक सप्ताह सीई, सीई लिपो प्रोटीन में किया जाता है, और लिपो प्रोटीन ऊतकों को प्रचलन से ले जाया जाता है। 13। लगभग जर्दी में शेष लिपिड सामग्री के 68% इस चरण के दौरान अवशोषित कर रहे हैं। 10 व्यवस्था है जिसके द्वारा जर्दी लिपिड उपयोग किया जाता है एक ईईसी अनुसंधान मॉडल के आधार पर स्पष्ट किया जा सकता है। एक चिकन ईईसी संस्कृति प्रोटोकॉल ऊतक explants की सफलता दर कम, एक बेहतर ईईसी सेल संस्कृति प्रक्रिया से पोषक तत्व उपयोग मध्यस्थता में कुछ एंजाइमों और प्रोटीन के समारोह का अध्ययन करने की जरूरत है के कारण इस लक्ष्य को प्राप्त करने के लिए अनुसंधान स्थापना की थी। 2, 9 हालांकि, विकास के दौरान एवियन भ्रूण।

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

नोट:।। यह प्रक्रिया एक चिकन मॉडल संस्कृति एट अल Bauer 2013 और Nakazawa एट अल, 2011 2,9 द्वारा विकसित प्रोटोकॉल के एक संशोधन है

1. स्वस्थ भ्रूण दिन 5 जापानी बटेर से भ्रूण तैयार

  1. 1 पुरुष और 3 महिला यौन परिपक्व जापानी बटेर एक ही पिंजरे में एक साथ रखें। आपूर्ति चारा और पानी यथेच्छ। प्रकाश की 14 घंटा और अंधेरे के 10 घंटा के लिए पशु कमरे में प्रकाश को समायोजित करें।
  2. दोपहर में हर दिन प्लास्टिक की थैलियों में निषेचित अंडे ले लीजिए और उन्हें एक 16 डिग्री सेल्सियस फ्रिज में रखने के भ्रूण के विकास दर को धीमा करने के लिए।
  3. एक दो सप्ताह की अवधि के भीतर अंडे के लिए पर्याप्त संख्या में इकट्ठा करने के बाद, पांच दिनों के लिए अच्छा वेंटिलेशन के साथ एक 37 डिग्री सेल्सियस इनक्यूबेटर में निषेचित अंडे सेते हैं।

2. बेसल मध्यम और धो समाधान तैयार

  1. मध्यम विकास के रूप में DMEM / F-12 मध्यम (पीएच 7.2 करने के लिए समायोजित) का उपयोग करें, और यह पूरक10% नवजात बछड़ा सीरम (NBCS) और 1% कलम strep Ampho के साथ। समाधान (पीएसए, पेनिसिलिन, 10 5 इकाइयों / एल, स्ट्रेप्टोमाइसिन, 100 मिलीग्राम / एल; Amphotericin बी, 0.25 मिलीग्राम / एल)।
  2. भंडारण के लिए एक 10x एकाग्रता में फॉस्फेट बफर खारा (पीबीएस) समाधान तैयार है; 1x पीबीएस समाधान का उपयोग (; KCl, २.६६७ मिमी, के.एच. 2 4 पीओ, 1.471 मिमी, ना 2 HPO 4 -7h 2 हे, 8.06 मिमी, सोडियम क्लोराइड, १३७.९३ मिमी युक्त पीएच 7.2 करने के लिए समायोजित) धोने के लिए और जर्दी थैली झिल्ली, जबकि गीला अंडे की जर्दी और एल्बुमिन से एण्डोडर्म अलग।
  3. DMEM मध्यम (पीएच 7.2 करने के लिए समायोजित) का उपयोग करें एण्डोडर्म छर्रों फिर से निलंबित करने के लिए।

3. जापानी बटेर YSMs से प्राथमिक EECS का संग्रह

  1. 5 दिन (1.3 चरण) के लिए एकत्र अंडे सेते हैं। एक अंडा Candler द्वारा अंडे की जांच करना सामान्य भ्रूण विकास पुष्टि करने के लिए।
    नोट: भ्रूण दिन 5, वाईएसएम mesoderm की सीमा बहुत स्पष्ट है और 3 भ्रूण परतों कम कसकर एक साथ जुड़े हुए हैं, तो यह ओब करने के लिए आसान हैटाइन एण्डोडर्म। केवल वाईएसएम संग्रह के लिए सामान्य केशिका परिसंचरण विकास दिखा अंडे का उपयोग करें।
  2. ध्यान से खोल ताजा पानी और 75% इथेनॉल का उपयोग साफ करें। कैंची की एक जोड़ी द्वारा हवा सेल की स्थिति से खोल खोलें, धीरे बाहर छील और संदंश और एक 10 सेमी संस्कृति 37 डिग्री सेल्सियस 1x पीबीएस के साथ भरा पकवान में जगह द्वारा पूरे वाईएसएम इकट्ठा।
  3. का प्रयोग कैंची की एक जोड़ी भ्रूण, जर्दी और अंडे के सफेद हटाने, और धीरे 1x पीबीएस के साथ वाईएसएम धो तीन बार और एक 10 सेमी संस्कृति डिश में पीबीएस समाधान में वाईएसएम जगह है।
  4. संदंश और कैंची की एक जोड़ी का उपयोग वाईएसएम से बाहरी झिल्ली को हटा दें। 2 संदंश का प्रयोग करें, एक मजबूती endodermal सेल परत धारण करने के लिए, और केशिका mesoderm धारण करने के लिए अन्य।
  5. एक विदारक माइक्रोस्कोप के तहत, अलग खींच और भ्रूण की ओर दिशा में mesoderm के किनारे से एण्डोडर्म अलग। एक 37 डिग्री सेल्सियस वाट में एक ड्रॉपर और मध्यम विकास के 15 मिलीलीटर में जगह का उपयोग कर 50 मिलीलीटर अपकेंद्रित्र ट्यूब में हल्के पीले एण्डोडर्म लीजिएएर स्नान जब तक सभी ऊतक संग्रह पूरा कर रहे हैं।

4. एण्डोडर्म स्लाइस कोलेजिनेस पाचन द्वारा की पाचन

  1. हौसले DMEM के 10 मिलीलीटर में प्रकार चतुर्थ collagenase के 6.5 इकाइयों को भंग।
  2. आरटी पर 3 मिनट के लिए 130 XG पर 50 मिलीलीटर ट्यूब (3.4) अपकेंद्रित्र। मध्यम Aspirate और एक पिपेट का उपयोग कर एक 6 सेमी संस्कृति डिश में सभी endoderm जगह है। इस संस्कृति डिश के लिए 1 मिलीलीटर collagenase समाधान जोड़ें।
  3. एण्डोडर्म प्रत्येक टुकड़ा के आकार तक घुमावदार कैंची की एक जोड़ी के साथ 2 बटेर भ्रूण से एकत्र स्लाइस लगभग 2 से 3 मिमी है। एक dropper का प्रयोग करें, ताजा collagenase समाधान के 9 मिलीलीटर के साथ एक 50 मिलीलीटर अपकेंद्रित्र ट्यूब में सभी स्लाइस इकट्ठा।
  4. 175 rpm पर एक 37 डिग्री सेल्सियस मिलाते नहाने के पानी में 30 मिनट के लिए collagenase साथ ऊतक को पचाने। कोलैजिनेज़ साथ यह आंशिक पाचन explant सेल प्रसार में सुधार करने के लिए प्रयोग किया जाता है।
  5. आरटी पर 3 मिनट के लिए 130 XG पर अपकेंद्रित्र और धीरे से एक पिपेट का उपयोग कर सतह पर तैरनेवाला अंश हटाने। 20 मिलीलीटर DMEM में निलंबन से गोली धो लें और 3 मिनट के लिए 130 XG centrifugation के बाद सतह पर तैरनेवाला अंश हटा दें।
  6. पुनः निलंबित मध्यम विकास (10% NBCS और 1% पीएसए के साथ DMEM / F12) के 12 मिलीलीटर के साथ गोली और धीरे और समान रूप से एक 24 अच्छी तरह से थाली में (प्रत्येक में अच्छी तरह से 500 μl सेल समाधान) बीज।
  7. ऊतक explants 37 डिग्री सेल्सियस पर 2 दिनों के लिए हवा में सीओ 2 5% में सेते कोशिकाओं ऊतकों से बाहर पैदा करने के लिए अनुमति देने के लिए।
  8. एक और 2 दिनों के लिए कोशिकाओं को सेते हैं और एक सेल व्यवहार्यता परख प्रोटोकॉल द्वारा सेल व्यवहार्यता के लिए विशेषताएँ। 15
    नोट: जीवित कोशिकाओं के भीतर एक cytosol को कम करने के माहौल बनाए रखें। Resazurin, सक्रिय संघटक, एक गैर विषैले, सेल पारगम्य यौगिक है कि नीले रंग में है और लगभग गैर फ्लोरोसेंट है। जब सेल संस्कृतियों के लिए कहा, resazurin mitochondrial एंजाइमों द्वारा cytosol में resorufin के लिए कम है। Resorufin रंग में लाल और अत्यधिक फ्लोरोसेंट है। व्यवहार्य कोशिकाओं लगातार परिवर्तित resorufin को resazurin, increसमग्र प्रतिदीप्ति और कोशिकाओं के आसपास मध्यम संस्कृति के रंग asing।
  9. एण्डोडर्म उपकला कोशिका कुल शाही सेना अलगाव प्रदर्शन, के रूप में वर्णित किया प्रतिलेखन और मात्रात्मक वास्तविक समय मार्कर जीन mRNA अभिव्यक्ति की पीसीआर रिवर्स। 16,17
    1. ईईसी कोशिकाओं के लिए एक विशिष्ट मार्कर के रूप में SOAT1 mRNA पता लगाने के लिए रिवर्स ट्रांसक्रिपटेस पीसीआर का उपयोग करें (पीसीआर उत्पाद = 168 बीपी भावना: 5'-GAAGGGGCCTATCTGGAACG -3 '; 5'-ATCTGCACGTGACATGACCA -3 antisense')। एक गृह व्यवस्था जीन और आंतरिक नियंत्रण के रूप में β-actin mRNA (पीसीआर उत्पाद = 151 बीपी: '; 5'- GTGATGGACTCTGGTGATGG -3 antisense' 5'- TGGTGAAGCTGTAGCCTCTC -3 भावना) का प्रयोग करें।
    2. RT-qPCR के उत्पाद आकार का पता लगाने के लिए जेल वैद्युतकणसंचलन का प्रयोग करें। 1% agarose जेल तैयार करें, और 2 μl लोडिंग डाई के साथ मिश्रण 10 μl qPCR उत्पाद। अच्छी तरह से 1% agarose जेल में प्रत्येक में लोड 10 μl मिश्रण है, और 30 मिनट के लिए 100V द्वारा जेल चला रहे हैं।

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

आदेश में एक सुसंगत और उपयोगी सेल मॉडल की स्थापना के लक्ष्य को प्राप्त करने के लिए, हम विस्तार और प्रसार दर और एवियन EECS के प्रदर्शन को स्थिर करने की जरूरत है। हम एण्डोडर्म आंशिक रूप से इस तरह के कोलैजिनेज़ या कोलैजिनेज़ प्लस Dispase के 0.6 यू के रूप में एंजाइमों, साथ पचा साथ कोई एंजाइम पाचन के साथ एण्डोडर्म के प्रत्यक्ष ऊष्मायन की तुलना में। Dispase एक एमिनो endopeptidase कि गैर ध्रुवीय अमीनो एसिड के अवशेष के एन टर्मिनल पेप्टाइड बांडों hydrolyzes है। जबकि प्रोटीज पाचन उपचार कोई पाचन (चित्रा 1) के साथ तुलना में सेल प्रसार में वृद्धि हुई है, सेल के विकास को स्पष्ट रूप से पांच दिन ऊष्मायन (चित्रा 2) के बाद दो एंजाइम उपचार के बीच अलग नहीं था। हालांकि, कोलैजिनेज़ उपचार एक बेहतर विकास की अवस्था में हुई और पता चला कि EECS 6-9 दिनों (चित्रा 2) के लिए तेजी से proliferated। इस प्रकार, आंशिक collagenase पाचन से EECS के विकास में सुधारपूर्व vivo explants और पर्याप्त और कार्यात्मक ईईसी प्राप्त करने के लिए सिफारिश की है।

बाद 4 दिन ऊष्मायन, EECS एक वसाकोशिका की तरह दिखने formalin निर्धारण और तेल-लाल हे धुंधला (चित्रा 3) के बाद पता चला था, संवर्धित कोशिकाओं का सही शारीरिक विशेषताओं का सुझाव दे।

हम धारणा है कि चक्रीय adenosine monophosphate (शिविर) एक प्रतिलेखन नियामक एजेंट, शिविर phosphodiesterase अवरोध, 3-isobutyl-1-methylxanthine है (IBMX; शिविर की गिरावट में कमी करने के लिए) और adenyl साइक्लेज उत्प्रेरक, forskolin (शिविर के संश्लेषण में वृद्धि करने के लिए) दोनों 24 घंटा उपचार (चित्रा 4) के बाद उत्तेजित SOAT1 mRNA अभिव्यक्ति। इन उपचार भी SREBP2, एक कोलेस्ट्रॉल संश्लेषण नियामक प्रतिलेखन कारक की अभिव्यक्ति वृद्धि हुई है, और forskolin perilipin -2 (PLIN2) की अभिव्यक्ति बढ़ाया, सतह प्रोटीन मार्कर ओएफ लिपिड बूंदों (चित्रा 5)। वास्तविक समय पीसीआर द्वारा मात्रा lipogenic जीनों के लिए ईईसी mRNA प्रोफाइल adipocytes के समान (चित्रा 5) कर रहे हैं।

आकृति 1
चित्रा 1. endodermal उपकला कोशिकाओं पर आंशिक collagenase पाचन का प्रभाव। ऊतक explants कोशिकाओं ऊतक से बाहर पैदा करने के लिए अनुमति देने के लिए 2 दिनों के लिए incubated रहे थे। हमने देखा है और सफलतापूर्वक उगाया EECS की संख्या की गणना। कोई नंबर पाचन और कोशिकाओं को आंशिक रूप से collagenase के साथ पचा साथ कोशिकाओं के लिए गणना कर रहे थे; दोनों 24 अच्छी तरह प्लेटों में बड़े हो रहे थे। वाई अक्ष की 24 अच्छी तरह से सेल संस्कृति की थाली में सफलतापूर्वक proliferated EECS की अच्छी तरह से संख्या है। डेटा मतलब ± SEM के रूप में प्रस्तुत किया गया। विश्लेषण बनती टी परीक्षण के द्वारा निर्धारित किया गया है। पी <0.0001। कृपया यहाँ क्लिक करेंयह आंकड़ा का एक बड़ा संस्करण देखने के लिए।

चित्र 2
2. EECS की कोशिकाओं की वृद्धि प्रदर्शन आंशिक एंजाइम पाचन के बाद चित्रा। प्रसार दर सेल व्यवहार्यता परख द्वारा खोजा गया था। परख निहित resazurin, एक नीले रंग की यौगिक कमजोर प्रतिदीप्ति और resazurin है कि कोशिकाओं में प्रवेश करने पर resorufin के लिए कम है। व्यवहार्य कोशिकाओं लगातार resorufin को resazurin परिवर्तित, समग्र प्रतिदीप्ति और कोशिकाओं के आसपास मीडिया के रंग में वृद्धि। व्यवहार्य कोशिकाओं 600 एनएम पर सामान्य बनाने के साथ 570 एनएम पर absorbance से पता चला रहे थे। डेटा मतलब ± SEM के रूप में प्रस्तुत किया गया। विश्लेषण Bonferroni के बाद परीक्षण (; कोलैजिनेज़ + Dispase समूह N = 11 कोलैजिनेज़ समूह N = 10) के साथ दो तरह से एनोवा द्वारा निर्धारित किया गया है। * पी <0.05, ** पी <0.01, *** पी <0.001। सीएलआई कृपयायह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहाँ सी.के.।

चित्र तीन
चित्रा 3. संवर्धित EECS की आकृति विज्ञान। के बाद 4 दिन ऊष्मायन, EECS एक वसाकोशिका की तरह दिखने formalin निर्धारण और तेल-लाल हे धुंधला के बाद पता चला था। तेल-लाल हे और hematoxylin साथ धुंधला करने के बाद उज्ज्वल क्षेत्र में ईईसी के 100X बढ़ाई साथ, 200X बढ़ाई साथ उज्ज्वल क्षेत्र में और 200x बढ़ाई में: बाएं से दाएं। अब तक छोड़ दिया चित्रा के बाईं अंधेरे स्थान पर आंशिक रूप से पच एण्डोडर्म (झिल्ली) है। स्केल बार 200 माइक्रोन का प्रतिनिधित्व करता है। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

चित्रा 4
चित्रा 4. SOAT1 द्विलिंगीशिविर Activators के साथ व्यवहार EECS की cription। हम 24 घंटे के लिए 5 दिन में IBMX की सांद्रता या forskolin में वृद्धि के साथ EECS इलाज किया। हम इलाज कोशिकाओं से mRNAs निकाले और रिवर्स प्रतिलेखन पीसीआर द्वारा सीडीएनए में शाही सेना बदल दिया। हम वास्तविक समय मात्रात्मक पीसीआर द्वारा प्रतिलेखन स्तरों का विश्लेषण किया। β-actin गृह व्यवस्था जीन के रूप में इस्तेमाल किया गया था। डेटा मतलब ± SEM के रूप में प्रस्तुत किया गया। विश्लेषण Tukey के बाद परीक्षण के साथ एक तरह से एनोवा से थे (एन = 6) (* P≤ 0.05, ** P≤ 0.01)। IBMX एक प्रतिस्पर्धी गैर-चयनशील फोस्फोडाईस्टेरेज अवरोध है, जो intracellular शिविर उठाती PKA को सक्रिय करता है, टीएनएफ-अल्फा और leukotriene संश्लेषण को रोकता है, सूजन और प्रतिरोधक क्षमता को कम कर देता है और एक जन्मजात गैर-चयनित एडेनोसाइन रिसेप्टर प्रतिपक्षी है। Forskolin यूकेरियोटिक adenylyl साइक्लेज की एक सर्वव्यापी उत्प्रेरक, सामान्यतः शिविर के स्तर को बढ़ाने के लिए प्रयोग किया जाता है। इस figu का एक बड़ा संस्करण देखने के लिए यहां क्लिक करेंफिर से।

चित्रा 5
चित्रा 5. पांच दिनों के लिए ईईसी की उगाई के mRNA भाव, तो 24 घंटे के लिए शिविर Activators साथ इलाज किया। चित्रा 4 में सीडीएनए की वास्तविक समय से जीन अभिव्यक्ति के स्तर का विश्लेषण करने के लिए मात्रात्मक पीसीआर इस्तेमाल किया गया। β-actin गृह व्यवस्था जीन के रूप में इस्तेमाल किया और आंतरिक नियंत्रण के रूप में कार्य किया था। डेटा मतलब ± SEM के रूप में प्रस्तुत किया गया। विश्लेषण Tukey के बाद टेस्ट (n≤ 6) नियंत्रण करने के लिए उपचार के साथ तुलना करने के लिए एक तरह से एनोवा से थे। SREBP2, स्टेरोल नियामक तत्व बाध्यकारी प्रोटीन 2; LPL, लिपोप्रोटीन lipase; PLIN2, perilipin -2। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

क्योंकि पिछले संस्कृति प्रणाली केवल सीमित सफलता है, एक बेहतर संस्कृति प्रणाली की जरूरत है। जापानी बटेर वाईएसएम एण्डोडर्म ऐसे कोलैजिनेज़ पूर्व vivo explants में बेहतर विकास के प्रदर्शन को प्राप्त करने सेल सेल जंक्शनों ढीला करने के लिए के रूप में एंजाइमों के साथ उपचार की आवश्यकता है। हमारे आंकड़े बताते हैं कि आंशिक पाचन उपचार से सेल नंबर 2 दिन (चित्रा 1) के लिए बोने के बाद पचाया टिशू कल्चर से अधिक से अधिक थे। इसलिए, आंशिक प्रोटिओलिटिक पाचन वाईएसएम से सेल उपज में सुधार करने के लिए एक महत्वपूर्ण कदम है।

वर्तमान संस्कृति प्रोटोकॉल में महत्वपूर्ण संशोधन आंशिक प्रोटिओलिटिक पाचन है। इस उपचार बहुत सेल उपज और जीने EECS प्राप्त करने के सफल दर बढ़ाया। पाचन समय बहुत महत्वपूर्ण है, जबकि अंडर पाचन से कम सेल उपज में हुई है, क्योंकि अधिक-पाचन ऊतक कोशिकाओं से अलग कर देगा और कोशिकाओं, थाली को देते नहीं होगाऊतक explants। हमने पाया है कि 30 से 40 मिनट की स्थिति ऊपर वर्णित का उपयोग कर पाचन इष्टतम है।

वर्तमान प्रोटोकॉल उच्च तकनीकी प्रशिक्षण EECS प्राप्त करने के लिए की आवश्यकता है। EECS इकट्ठा करने का समय बिंदु प्रतिबंधित है, उदाहरण के लिए, हम केवल भ्रूण 5. दिन में EECS इकट्ठा कारण यह है कि के रूप में एवियन भ्रूण बढ़ती है, जर्दी थैली झिल्ली में परतों के बीच कनेक्शन और अधिक जटिल हैं और इसे इकट्ठा करने का सफल दर कम हो जाती है EECS। प्रोटोकॉल प्रारंभिक चरण भ्रूण के EECS नहीं लेकिन देर चरण भ्रूण प्राप्त करने के लिए इस्तेमाल किया जा सकता है। यह देर से मंच EECS पर प्रत्यक्ष अनुसंधान की संभावना को सीमित करता है।

SOAT1 और लिपोप्रोटीन lipase, और लिपिड संचय की अभिव्यक्ति वाईएसएम 4,5,11, विशेष रूप से EECS के आवश्यक विशेषताएं हैं। वर्तमान अध्ययन, SOAT1, LPL, और perilipin 2 (PLN2) mRNA में EECS में अत्यधिक व्यक्त कर रहे थे, संस्कृति प्रणाली सही शारीरिक charact के साथ कोशिकाओं को उत्पन्न कर सकते हैं सुझावeristics। मौजूदा तकनीक प्राथमिक EECS की एक बड़ी मात्रा में उत्पादन किया। जब हम पिछले 9 वर्णित प्रक्रिया का इस्तेमाल किया, ईईसी संस्कृति की सफलता की दर 24 अच्छी तरह से है, जबकि मौजूदा प्रोटोकॉल EECS उत्पन्न पर लगभग 100% सफलता दर के सेल संस्कृति प्लेटों में लगभग 60% थी।

जर्दी थैली झिल्ली प्रोटीन, लिपिड, और जर्दी से कोलेस्ट्रॉल को अवशोषित करने के लिए, इस प्रकार के विकास के दौरान भ्रूण को जर्दी से पोषक तत्वों को हस्तांतरण करने के लिए कार्य कर मुख्य ऊतक है। क्योंकि SOAT1 एवियन भ्रूण विकास की देर चरणों में नाटकीय रूप से बढ़ जाती है जब बड़े पैमाने पर होता है कोलेस्ट्रॉल एस्टरीफिकेशन 4 कोलेस्ट्रॉल एस्टर गठन के लिए मुख्य एंजाइम है SOAT1। 11, हम सुसंस्कृत EECS की विशेषताओं के मूल्यांकन के लिए मार्कर जीन के रूप में SOAT1 mRNA अभिव्यक्ति का इस्तेमाल किया। हमने दिखा दिया है कि इस प्राथमिक ईईसी संस्कृति प्रणाली की उम्मीद कर उत्पादन शारीरिक विशेषताओं। इसलिए, ईईसी संस्कृति प्रणाली embryon अध्ययन करने के लिए एक महत्वपूर्ण उपकरण हो सकता हैआईसी लिपिड परिवहन और एवियन भ्रूण के विकास के दौरान वाईएसएम में पोषक तत्वों के उपयोग में मध्यस्थता में शामिल जीन की भूमिका स्पष्ट करने के लिए।

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgments

वर्तमान प्रोटोकॉल के विकास के लिए अनुदान विशेष रूप से नेशनल ताइवान विश्वविद्यालय, ताइवान के (अनुदान आईडी 104R350144), साथ ही विज्ञान और ताइवान की प्रौद्योगिकी मंत्रालय (अनुदान आईडी "शीर्ष विश्वविद्यालय योजना के लिए उद्देश्य" द्वारा समर्थित है: मोस्ट 104 -2,313-B-002-039-MY3)। हम विशेष रूप से वर्तमान अध्ययन के लिए एक जानवर कक्ष और प्रयोगशाला अंतरिक्ष प्रदान करने के लिए नेशनल ताइवान विश्वविद्यालय के जैव प्रौद्योगिकी के लिए केंद्र धन्यवाद।

Materials

Name Company Catalog Number Comments
Dulbecco's Modified Eagle Medium Gibco by Life technologies 12800-017 10 X 1 L For wash the EECs pellets
D-MEM/F-12 Gibco by Life technologies 12400-024 10 X 1 L As the basal medium in culturing EECs
NBCS Gibco by Life technologies 16010-159 As the supplyment serum in culturing EECs
Pen-Strep Ampho. Solution BI (Biological Industries) 03-033-1B 100 ml For attenuating the possible infection 
Collagenase Type IV Gibco by Life technologies 17104-019 1 g  Collagenase is a protease with specificity for the bond between a neutral amino acid (X) and glycine in the sequence Pro-XGly-Pro. As the protease for dissociation of cells from primary tissue.
24-well plate FALCON® REF-353047 For EECs to attach and extension
50 ml PP centrifuge tubes Corning® CentriStarTM 430829 For transportion of membranes and enzyme digestion
50 ml Conical bottomed Tube with Cap PRO TECH CT-50-PL-TW For transportion of membranes and enzyme digestion
Reciprocal shaking bath DEAGLE SB302 For better enzymatic digestion on membranes

DOWNLOAD MATERIALS LIST

References

  1. Abeyrathne, E. D., Lee, H. Y., Ahn, D. U. Egg white proteins and their potential use in food processing or as nutraceutical and pharmaceutical agents--a review. Poult Sci. 92, (12), 3292-3299 (2013).
  2. Bauer, R., Plieschnig, J. A., Finkes, T., Riegler, B., Hermann, M., Schneider, W. J. The developing chicken yolk sac acquires nutrient transport competence by an orchestrated differentiation process of its endodermal epithelial cells. J Biol Chem. 288, (2), 1088-1098 (2013).
  3. Ding, S. T., Nestor, K. E., Lilburn, M. S. The concentration of different lipid classes during late embryonic development in a randombred turkey population and a subline selected for increased body weight at sixteen weeks of age. Poult Sci. 74, (2), 374-382 (1995).
  4. Ding, S. T., Lilburn, M. S. The developmental expression of acyl-coenzyme A: cholesterol acyltransferase in the yolk sac membrane, liver, and intestine of developing embryos and posthatch turkeys. Poult Sci. 79, (10), 1460-1464 (2000).
  5. Ding, S. T., Lilburn, M. S. The ontogeny of fatty acid-binding protein in turkey (Meleagridis gallopavo) intestine and yolk sac membrane during embryonic and early posthatch development. Poult Sci. 81, (7), 1065-1070 (2002).
  6. Kanai, M., Soji, T., Sugawara, E., Watari, N., Oguchi, H., Matsubara, M., Herbert, D. C. Participation of endodermal epithelial cells on the synthesis of plasma LDL and HDL in the chick yolk sac. Microsc Res Tech. 35, (4), 340-348 (1996).
  7. Mobbs, I. G., McMillan, D. B. Structure of the endodermal epithelium of the chick yolk sac during early stages of development. Am J Anat. 155, (3), 287-309 (1979).
  8. Mobbs, I. G., McMillan, D. B. Transport across endodermal cells of the chick yolk sac during early stages of development. Am J Anat. 160, (3), 285-308 (1981).
  9. Nakazawa, F., Alev, C., Jakt, L. M., Sheng, G. Yolk sac endoderm is the major source of serum proteins and lipids and is involved in the regulation of vascular integrity in early chick development. Dev Dyn. 240, (8), 2002-2010 (2011).
  10. Noble, R. C., Cocchi, M. Lipid metabolism and the neonatal chicken. Prog Lipid Res. 29, (2), 107-140 (1990).
  11. Shand, J. H., West, D. W., McCartney, R. J., Noble, R. C., Speake, B. K. The esterification of cholesterol in the yolk sac membrane of the chick embryo. Lipids. 28, (7), 621-625 (1993).
  12. Speier, J. S., Yadgary, L., Uni, Z., Wong, E. A. Gene expression of nutrient transporters and digestive enzymes in the yolk sac membrane and small intestine of the developing embryonic chick. Poult Sci. 91, (8), 1941-1949 (2012).
  13. Walzem, R. L., Hansen, R. J., Williams, D. L., Hamilton, R. L. Estrogen Induction of VLDLy Assembly in Egg-Laying Hens. J Nutr. 129, (2), 467S-472S (1999).
  14. Yoshizaki, N., Soga, M., Ito, Y., Mao, K. M., Sultana, F., Yonezawa, S. Two-step consumption of yolk granules during the development of quail embryos. Dev Growth Differ. 46, (3), 229-238 (2004).
  15. alamarBlue Cell Viability Assay Protocol. Source: https://www.lifetechnologies.com/us/en/home/references/protocols/cell-and-tissue-analysis/cell-profilteration-assay-protocols/cell-viability-with-alamarblue.html#4 (2008).
  16. Lin, H. Y., Chen, C. C., Chen, Y. J., Lin, Y. Y., Mersmann, H. J., Ding, S. T. Enhanced Amelioration of High-Fat Diet-Induced Fatty Liver by Docosahexaenoic Acid and Lysine Supplementations. Biomed Res Int. 2014, (1), 310981 (2014).
  17. Lin, Y. Y., et al. Adiponectin receptor 1 regulates bone formation and osteoblast differentiation by GSK-3β/β-Catenin signaling in mice. Bone. 64, 147-154 (2014).
जापानी बटेर भ्रूण की जर्दी थैली झिल्ली से प्राथमिक endodermal उपकला सेल संस्कृति
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Lin, H. J., Wang, S. H., Pan, Y. H., Ding, S. T. Primary Endodermal Epithelial Cell Culture from the Yolk Sac Membrane of Japanese Quail Embryos. J. Vis. Exp. (109), e53624, doi:10.3791/53624 (2016).More

Lin, H. J., Wang, S. H., Pan, Y. H., Ding, S. T. Primary Endodermal Epithelial Cell Culture from the Yolk Sac Membrane of Japanese Quail Embryos. J. Vis. Exp. (109), e53624, doi:10.3791/53624 (2016).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter