Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Proteínas Análise de imunofluorescência de endógenos e exógenos Centromere-cinetócoro

Published: March 3, 2016 doi: 10.3791/53732

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

"centrômeros" foram classicamente definidos como regiões de recombinação meiótica suprimida em genética e, mais tarde reconhecida como a constrição primária de cromossomos mitóticos, que desempenha um papel essencial na segregação cromossômica precisas durante a mitose. "cinetócoros" foram descritos como as estruturas em camadas múltiplas que se ligam aos microtúbulos na superfície de centrómeros, conforme revelado por microscopia electrónica; "cinetócoros" foram definidos mais tarde, como o complexo macromolecular que localiza no centrômero dos cromossomos mitóticos. Apesar da divergência dramática de sequências de ADN centromérico entre os vertebrados, cinetócoro estrutura e composição são altamente conservadas. A interacção dinâmica entre os microtúbulos do fuso e do kinetochore é necessário para a segregação fiel de cromossomos durante a mitose e defeitos na função centrômero-kinetochore levam a aneuploidia e, assim, o câncer.

O centrómero na maioria dos eucariotasnão tem nenhuma sequência de ADN definida, mas é composto por matrizes grandes (0,3-5) Mb de ADN repetitivo consistindo alphoid de ADN satélite α-171-pb. Salvo em brotamento de levedura, identidade centrómero é conseguido não por a sequência de ADN mas pela presença de um nucleossoma especial que contém a variante histona H3 CenH3 (centrómero Proteína A [CENP-A] em seres humanos). 5 nucleossomas CENP-A localizar a placa interna de cinetócoros mamíferos 7 e se ligam ao DNA α-satélite 171 pb. centrômeros ativos requerem CENP-A contendo nucleossomos para dirigir o recrutamento de uma rede constitutiva associada ao centrômero (CCAN) e as proteínas cinetócoro, que em conjunto regulam a fixação dos cromossomas ao fuso mitótico e subsequente progressão do ciclo através do ponto de verificação do fuso.

À luz da evidência acima, CENP-A tem sido proposta para ser a marca epigenética do centrômero 8; No entanto, o processo pelo qual CENP-A é incorporada into de ADN centromérico e os fatores responsáveis ​​por essa incorporação ainda não foram bem caracterizados. Um domínio de direccionamento centrómero curta (CATD) reside na histona dobrar região de CENP-A, e a substituição da região correspondente de H3 com o CATD é suficiente para H3 directa ao centrómero. 9 Vários estudos sugeriram papéis funcionais para pós-translacional modificação (PTM) de CENP-A 12-16; No entanto, os mecanismos moleculares destes PTMs de CENP-A no recrutamento para centrómeros ainda não foram elucidados. Nós relatado anteriormente que a atividade ligase CUL4A-RBX1-COPS8 E3 é necessário para CENP-A K124 ubiquitinação e localização de CENP-A para centrômeros 17.

A descoberta e caracterização de proteínas cinetócoro levaram a nova visão sobre a segregação de cromossomas. 18 mais de 100 componentes cinetócoro foram identificados em células de vertebrados por várias abordagens. 19,20 Um sobpe de como cinetócoros montar e função também vem da caracterização das funções celulares de cada rede centrômero-kinetochore proteínas e proteína-proteína dentro das células. 19 visualização direta e de imagem avançados métodos de microscopia de fluorescência fornecer notável resolução de componentes centrômero-kinetochore e permitir observação direta de componentes moleculares específicos dos centrômeros e cinetócoros. Além disso, métodos de imunofluorescência indirecta (IIF) A coloração por utilização de anticorpos específicos são cruciais para estas observações. No entanto, apesar dos numerosos relatórios sobre protocolos de IFI, alguns problemas discutidos em de proteínas específicas de centrómero-cinetócoro detalhe. 1-4 Assim, o desenvolvimento de métodos e relatórios de coloração IIF e um ensaio quantitativo para o IFI analisar especificamente cada proteína centrómero-cinetócoro é extremamente importante. Na coloração IIF, deve-se proceder com o protocolo de coloração para evitar a perda da proteína de interesse ouo resto da célula. Contudo, a fixação destrói os locais antigénicos ocasionalmente, e diferentes combinações de anticorpos para o antigénio funcionar mal com um fixador, mas muito bem com a outra, 21 e escolha de fixador depende em grande parte da proteína (s) de interesse. Portanto, diferentes métodos fixadoras são cruciais na coloração IIF de proteínas centrômero-kinetochore.

Aqui métodos optimizados de imunofluorescência indirecta (IIF) e um ensaio de coloração para dirigir a localização de proteínas de centrómero-cinetócoro endógenos, incluindo CENP-A e CENP-A proteínas exógenas Bandeira-marcadas, e a quantificação destas proteínas em células humanas têm sido desenvolvidos. Estes métodos podem ser aplicados para a análise de proteínas de centrómero-cinetócoro em outras espécies.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Cultura de Células e Transfecção

  1. Colocar uma tampa de vidro (22 mm x 22 mm) numa placa de poliestireno de 6 poços. coat opcionalmente uma tampa de vidro com poli-L-Lisina, 0,1% w / v, em água (veja a lista de materiais / equipamentos) para manter as células mitóticas na tampa de vidro seguindo os passos abaixo:
    Nota: As condições óptimas deve ser determinada para cada linha celular e a aplicação.
    1. superfície da cultura, de forma asséptica revestimento com poli-L-lisina, 0,1% w / v, em água (0,4 ml / poço de uma placa de 6 poços de poliestireno). Balançar suavemente para assegurar mesmo o revestimento da superfície da cultura.
    2. Após 5 min, remover a solução por aspiração e lavar cuidadosamente a superfície com o tecido estéril água grau cultura.
    3. Seco, pelo menos 2 horas antes de introduzir células e meio.
  2. Sementes células HeLa 17 ou HeLa Tet-Off células 17,22 em uma tampa de vidro (22 mm x 22 mm) colocado em uma placa de poliestireno de 6 poços. Verifique se a densidade celular é de 5,4 x 10 5 por poço. células de culturaem DMEM de alto teor de glucose com 10% de FBS e 1% de penicilina-estreptomicina.
    Nota: Para obter resultados óptimos, determinar empiricamente a densidade celular para usar em semeadura.
  3. Incubar as células a 37 ° C numa atmosfera de 5% de CO 2 durante 18 h.
    Nota: No caso de células HeLa Tet-Off, a transcrição do gene exógeno é activo na ausência do indutor (ou seja, a tetraciclina / doxiciclina), por conseguinte, as células de cultura, sem tetraciclina / doxiciclina e transfectar transientemente com o vector de sobre-expressão pTRM4 (Tabela 2 ), cuja transcrição é regulada pelo promotor de TRE (ver abaixo).
  4. Dezoito horas após a sementeira de células, como se segue: transfectar
    1. Adicione solução A através da mistura de 1.5 ul de siRNA de oligo (20 uM banco de recozido; Tabela 1) e / ou 2,0 ug de plasmídeo (Tabela 2) em ul meio de soro reduzido 50 (ver lista de materiais / equipamentos), e incubar à TA durante 5 min .
      Nota: Nesta análise,CA-UTR siARN (uma mistura de 5 'e 3' UTR siARN; Tabela 1) foram co-transfectados para o uso em protocolos 3 e 4 (ver discussão).
    2. Adicione solução B por mistura de 0,75 mL de reagente de transfecção I (ver a Lista de Materiais / Equipment) em 50 ul de meio de soro reduzido, e incubar à TA durante 5 min.
      Nota: Um passo opcional é a adição de 1,0 mL de reagente de transfecção II (veja a lista de materiais / equipamentos).
    3. Misturar as soluções A e B, em conjunto, e incubar à TA durante 15 min.
    4. Lavam-se as células cultivadas uma vez com PBS e, em seguida adicionar 500 ul reduzidas meio de soro a cada poço da placa de poliestireno de 6 poços. Adicionar a mistura de soluções A e B (isto é, ARN e / ou de complexo de ADN-lípido) directamente a cada um dos indivíduos bem.
      Nota: A concentração final é de 3,3 ug / ml (plasmídeo); 50 nM (siRNA).
    5. Incubar as células a 37 ° C numa atmosfera de 5% de CO 2 durante 4,5 h. Alterar o médio a alto de glicose DMEM with 10% de FBS e 1% de penicilina-estreptomicina.
    6. Incubar as células a 37 ° C numa atmosfera de 5% de CO 2 durante 48-72 horas após transfecção.
      Nota: Para obter resultados óptimos, o tempo de incubação para o crescimento celular antes da fixação devem ser determinados empiricamente, e depleção de proteínas e / ou expressão tem de ser confirmada por análise de Western blot (ver Protocolo 6).
    7. Se a análise celular mitótica é de interesse, adicionar o paclitaxel (10 nM) a células cultivadas 24 horas antes da fixação, ou adicionar TN16 (0,5 uM) para a cultura de células de 2,5 h antes da fixação.

2. celular Fixação e imunofluorescência coloração para detectar proteínas endógenas Centromere-cinetócoro (paraformaldeído Fixation)

  1. Preparação do agente de fixao, tampões e reagentes.
    1. Recentemente preparar 50 ml de solução de paraformaldeído a 4% em PBS, pH 7,4.
      1. Adicionar 40 ml de 1 x PBS para uma proveta de vidro numa placa de agitação numa hotte ventilada. Calor enquanto mexendog a aproximadamente 60 ° C. Adicionar 2 g de paraformaldeído em pó para o PBS aquecido.
      2. Elevar-se lentamente o pH por adição de 1 mL de NaOH 1 N, no total, porque o pó não se dissolve imediatamente.
        Nota: A solução limpa após a adição de NaOH.
      3. Uma vez paraformaldeído se dissolveu, fresco e filtrar a solução.
      4. Ajustar o pH com HCl 1 N até pH 7,4 e o volume da solução com 1 x PBS a 50 ml.
        Nota: Alíquotas da solução pode ser congelada ou armazenada a 2-8 ° C durante o tempo que uma semana. A solução deve ser arrefecida com gelo ou armazenado a 4 ° C até que esteja a ser utilizado.
    2. Preparar 50 ml de tampão de KB1, que consiste em Tris-HCl a 10, pH 7,5; NaCl 150 mM; 0,5% de BSA; e 0,5% de Triton X-100.
      Nota: BSA deve ser adicionado de fresco.
      Nota: A KB série tampão baseiam-se em tampão de KB descrita em relatórios anteriores 1,2,4.
    3. Preparar 50 ml de KB2 tampão, que consiste em Tris-HCl a 10,pH 7,5; NaCl 150 mM; e 0,5% de BSA.
      Nota: BSA deve ser adicionado de fresco.
    4. Prepare 1 ml de tampão contendo DAPI KB3 (50 ng / ml).
    5. Preparação de 100 ml de meio de montagem, que consiste em 1 mg / mL de p-fenilenodiamina; 10% de PBS, e 90% de glicerol.
      1. Ajustar o pH de 1 × PBS para 9,8 com NaOH 1 N, dissolver-se p-fenilenodiamina na solução, e, em seguida, adicionar glicerol.
      2. Loja alíquotas de 1 ml a -80 ° C. Proteger da luz.
  2. Remova o meio de cultura por aspiração em 48-72 horas pós transfecção (ver Protocolo 1) para a fixação das células. células Enxaguar uma vez com PBS. Aplicar PBS para o lado das cavidades de cultura para evitar a perturbação da superfície das células.
    Nota: O ponto de tempo óptimo para a fixação das células deve ser determinada empiricamente.
  3. Fixar as células em 4% de paraformaldeído em PBS durante 30 min a 4 ° C. Lavar as células duas vezes com tampão de KB2 para remover suficientemente residual paraformaldeído a 4%.
  4. permeaLizé as amostras em KB1 tampão durante 30 min a RT. Lavar as células uma vez com tampão de KB2, e adicionar tampão de KB2 durante 5 min à temperatura ambiente para bloquear sites adicionais de ligação não específica.
    Nota: Tampão KB1 também contribui significativamente para o bloqueio.
  5. Retirar uma tampa de vidro (22 mm x 22 mm) a partir de uma placa de poliestireno de 6 poços utilizando fórceps. Usando uma caneta barreira hidrofóbica (veja a lista de materiais / equipamentos), desenhe um quadrado verde pálido ou círculo para formar uma barreira hidrofóbica ao redor de cada amostra de tampa de vidro. Não toque nem chegar muito perto para as células com a caneta barreira hidrofóbica. Coloque a tampa de vidro em uma nova placa de poliestireno de 6 poços.
  6. Dilui-se um anticorpo primário ao centrómero ou proteína cinetocoro (razão de diluição de 1: 100 a 1: 200; ver também a Lista de Materiais / Equipment) e, ou um anticorpo anti-CENP-B (razão de diluição de 1: 400) ou um anti- anticorpo centrómero (ACA) (razão de diluição de 1: 2000) como um marcador de localização de centrómero em KB2 tampão.
    Nota: Para melhores resultados, a Concentra finaisção do anticorpo primário nesta solução deve ser determinada empiricamente.
  7. Aplicar um volume suficiente (cerca de 30 ul) do anticorpo primário diluído para mergulhar a amostra de células. Incubar a amostra de células durante 1 h a 37 ° C. Lavar as células 3 vezes com tampão de KB2.
  8. Usando tampão KB2, dilui-se um anticorpo secundário conjugado com fluoróforo (razão de diluição de 1: 100 a 1: 200) dirigido contra cada anticorpo primário.
    Nota: Para melhores resultados, a concentração final do anticorpo secundário nesta solução deve ser determinada empiricamente.
  9. Aplicar um volume suficiente (cerca de uma gota de 30 ul sobre a tampa de vidro) do anticorpo secundário diluído para mergulhar a amostra de células. Incubar a amostra de células durante 1 h a 37 ° C. Lavar as células KB2 5 vezes com tampão durante um período de 30 minutos (6 cinco lavagens mínimo).
    Nota: Para melhores resultados (isto é, para uma perda mínima de células), a condição de lavagem ideal deve ser determinada Empirically.
  10. Aplicar um volume suficiente de tampão KB3 contendo DAPI (50 ng / ml), para imergir a amostra de células. Incubar a amostra de células durante 5 min à TA. Lavar as células KB2 1-2 vezes com tampão.
  11. Monte a tampa de vidro que contém a amostra de células para o micro slide.
    1. Colocar uma gota de meio de montagem no centro da micro lâmina.
    2. Remover o líquido a partir da amostra celular e, usando as mãos ou os fórceps, posicionar a amostra no centro da micro lâmina. Evitar bolhas de ar.
    3. Retire o excesso de meio de montagem com uma toalha de papel.

3. celular Fixação e coloração por imunofluorescência de C-terminal marcado com bandeira de CENP-A Proteínas (acetona Fixação)

  1. Preparação
    1. Prepare gelada 75% de acetona.
    2. Recentemente preparar 50 ml de PBS (pH 7,4) contendo 0,5% de leite desnatado e 0,5% de BSA.
    3. Recentemente preparar 50 ml de PBS (pH 7,4) contendo 0,1% de leite desnatado e 0,1% de BSA.
    4. Prepare 1 ml de PBS (pH 7,4) contendo DAPI (50-100 ng / ml).
    5. Preparação de 100 ml de meio de montagem tal como descrito em 2.1.5.
  2. Remova o meio de cultura por aspiração em 48-72 horas pós transfecção (ver Protocolo 1) para a fixação das células. células Enxaguar uma vez com PBS. Aplicar PBS para o lado do poço de cultura para evitar a perturbação da superfície das células.
    Nota: O ponto de tempo óptimo para a fixação das células deve ser determinada empiricamente.
  3. Fixar as células em gelo-acetona fria a 75%, e incuba-se as células durante 10 min a -20 ° C. células de secar sobre a tampa de vidro numa hotte durante 30-60 minutos a RT.
    Nota: Para obter resultados óptimos, o período de tempo necessário para a fixação de células e de secagem deve ser determinada empiricamente.
  4. Usando a caneta barreira hidrofóbica (veja a lista de materiais / equipamentos), desenhe um quadrado verde pálido ou círculo para formar uma barreira hidrofóbica ao redor de cada amostra de tampa de vidro. Não toque nem chegar muito perto para as células com a caneta barreira hidrofóbica.
  5. bloco nonspecific locais sobre as células de ligação pela adição de PBS contendo 0,5% de leite desnatado e 0,5% de BSA durante 5 min à TA.
  6. Utilizando PBS contendo 0,1% de leite desnatado e 0,1% de BSA, dilui-se um anticorpo anti-Flag (proporção de 1: 1000 de diluição) e, ou um anticorpo anti-CENP-B (razão de diluição de 1: 200) ou ACA (proporção de 1: 2000 de diluição ) como um marcador de local centrômero.
    Nota: Para melhores resultados, a concentração final do anticorpo primário nesta solução deve ser determinada empiricamente.
  7. Aplicar um volume suficiente (cerca de 30 ul) do anticorpo primário diluído para mergulhar a amostra de células. Incubar a amostra de células durante 1 h a 37 ° C. Lavar as células 5 vezes com o tampão de bloqueio durante um período de 30 min.
    Nota: As células podem ser lavadas com PBS. Para melhores resultados (isto é, para evitar a perda de células), as condições de lavagem óptimas devem ser determinadas empiricamente.
  8. Dilui-se um anticorpo secundário conjugado com fluoróforo (razão de diluição de 1: 100 a 1: 200) dirigido contraa cada anticorpo primário em PBS contendo 0,1% de leite desnatado e 0,1% de BSA.
    Nota: Para melhores resultados, a concentração final do anticorpo secundário nesta solução deve ser determinada empiricamente.
  9. Aplicar um volume suficiente (cerca de 30 ul) do anticorpo secundário diluído para mergulhar a amostra de células. Incubar a amostra de células durante 1 h a 37 ° C. Lavar as células 2 vezes com PBS contendo 0,1% de leite desnatado e 0,1% de BSA.
    Nota: PBS sozinho também pode ser usada para lavar as células.
  10. Aplicar um volume suficiente de PBS contendo DAPI (50-100 ng / ml), para imergir a amostra de células. Incubar a amostra de células durante 5 min à TA. Lavar as células 1-2 vezes com PBS.
  11. Monte a tampa de vidro contendo a amostra de células para o micro de slides como descrito em 2.11.

4. Fixação celular e imunofluorescência Coloração de terminal-N marcada com Flag CENP-A Proteínas (Metanol fixação)

  1. Preparação
    1. Prepare a metanol arrefecido em gelo.
    2. Prepare TBS (pH 7,4) contendo soro de cabra a 4%.
    3. Prepare 1 ml de TBS (pH 7,4) contendo DAPI (50-100 ng / ml).
    4. Preparação de 100 ml de meio de montagem tal como descrito em 2.1.5.
  2. Remova o meio de cultura por aspiração em 48-72 horas pós transfecção (ver Protocolo 1) para a fixação das células. células Enxaguar uma vez com TBS. Aplicar TBS para o lado das cavidades de cultura para evitar a perturbação da superfície de células.
    Nota: O ponto de tempo óptimo para a fixação das células deve ser determinada empiricamente.
  3. Fixar as células em metanol arrefecida com gelo, e incuba-se as células durante 6 minutos à temperatura de -20 ° C. Lavar as células duas vezes com TBS para remover metanol residual suficientemente.
  4. Usando uma caneta barreira hidrofóbica (veja a lista de materiais / equipamentos), desenhe um quadrado verde pálido ou círculo para criar uma barreira hidrofóbica ao redor de cada amostra de tampa de vidro. Não toque nem chegar muito perto para as células com a caneta barreira hidrofóbica.
  5. Bloquear os locais de ligação não específicos no cells por TBS acrescentando contendo soro de cabra 4%. Incubar durante 10 min à TA.
  6. Dilui-se um anticorpo anti-Flag (diluição 1: 1000) e, ou um anticorpo anti-CENP-B (razão de diluição de 1: 200) ou ACA (1: 2000 razão de diluição) como um marcador de localização de centrómero em TBS contendo soro de cabra a 4% .
    Nota: Para melhores resultados, a concentração final do anticorpo primário nesta solução deve ser determinada empiricamente.
  7. Aplicar um volume suficiente (cerca de 30 ul) do anticorpo primário diluído para mergulhar a amostra de células. Incubar a amostra de células durante 1 h a 37 ° C. Lavar as células 5 vezes com o tampão de bloqueio durante um período de 30 min. Para melhores resultados (isto é, a mínima perda de células), a condição de lavagem ideal deve ser determinada empiricamente.
  8. Dilui-se um anticorpo secundário conjugado com fluoróforo (razão de diluição de 1: 100 a 1: 200) dirigido contra cada anticorpo primário em TBS contendo soro de cabra a 4%.
    Nota: Para melhores resultados, a finaL concentração do anticorpo secundário nesta solução deve ser determinada empiricamente.
  9. Aplicar um volume suficiente (cerca de 30 ul) do anticorpo secundário diluído para mergulhar a amostra de células. Incubar a amostra de células durante 1 h a 37 ° C. Lavar as células 3 vezes com o tampão de bloqueio.
  10. Aplicar um volume suficiente de TBS contendo DAPI (50-100 ng / ml) para imergir a amostra celular. Incubar a amostra de células durante 5 min à TA. Lavar as células 1-2 vezes com TBS.
  11. Monte a tampa de vidro que contém a amostra de células para o micro de slides como descrito em 2.11.

5. Imunofluorescência Observação Imagem, Aquisição, quantificação e análise

  1. Observe a amostra de células através de um microscópio de fluorescência motorizado equipado com uma lente de 63X e 100X imersão em óleo, uma fonte de luz compacta externa, e uma câmera CCD digital.
  2. Realizar a aquisição de imagens e processamento, incluindo deconvolução, utilizando SoftwareA, ou Softwares B1 e B2 (veja a lista de materiais / equipamentos). Por favor, veja Suplementar Código Files (5.2.1) para todos os comandos usados ​​no Software A. Para todos os comandos usados ​​em Softwares B1 e B2, consulte (5.2.2) em Supplemental arquivos de código.
  3. Usar um método previamente descrito 23-25 ​​para quantificar os sinais de proteínas de centrómero-cinetocoro (por exemplo, mantendo-se sinais de CENP-A no centrómero) com as seguintes pequenas modificações:
    1. Selecionar área das proteínas centrômero-kinetochore ea do fundo da seguinte forma:
      1. células mitóticas: (região centrômero-kinetochore) Selecionar área sobrepondo-se cromossomas corados com DAPI; (região de fundo) e fora da área cromossomos, mas dentro da célula única idênticos (região, ou seja, citosólica).
      2. celular interfase: (região centrômero-kinetochore) Selecionar área sobreposição com cromatina corada com DAPI; (Região de fundo) e fora da área da cromatina, mas dentro da célula única idênticos (<em> isto é, a região citosólica).
        Nota: Ver também Suplementar arquivos de código (5.2.1.4.3) ou (5.2.2.6.4) para seleção de área com Software A ou B2 Software, respectivamente.
    2. Quantificar a percentagem de sinais restantes nos centrômeros usando Software A ou B. Para esta tarefa, use a seguinte fórmula:
      Restante sinais de proteína centrômero-kinetochore no centrômero-kinetochore
      equação1
      em que s é o brilho do sinal da área seleccionada, o que é confirmado por coloração ACA ou CENP-B; b é o brilho sinal de fundo; amostra r é os sinais de referência ou ACA CENP-B para ARNsi (s) de células tenha sido tratada com; e R ctrl é a ACA referência ou sinais de CENP-B para células Luc siRNA-transfectadas.
      Nota: Nesta análise, os sinais de CENP-B foram utilizados como sinais de referência para CUL4A e RBX1 como descrito em relatórios anteriores.
    3. Use um arquivo do Excel para esse cálculo depois de copiar e colar os dados brutos do software quantificação sinal descrito acima. Veja também Suplementar arquivos de código: (5.2.1.4) e (5.2.2.6) para obter detalhes. Um exemplo de cálculo é mostrado na Tabela 3.
  4. Analisar pelo menos 20 células para eliminar a variação na coloração e aquisição de imagem para cada nível de medição. Opcionalmente, use "valor médio" dos restantes sinais centrômero-kinetochore para cada analisados ​​celular para comparar esses valores entre diferentes proteínas centrômero-kinetochore.

6. Ocidental análise de mancha de proteína total

  1. Ressuspender as células em tampão de desnaturação A (20 mM de Tris-HCl, pH 7,4; NaCl 50 mM; 0,5% de Nonidet P-40; 0,5% de desoxicolato; SDS 0,5%; EDTA 1 mM; e cocktail inibidor da protease livre de EDTA completo), 26 sujeita a suspensão a ultra-sons e um processo de congelação-descongelação, e medidaAs concentrações de proteína como se segue:
    1. Para o processo de sonicação, adicionar 50 ul de tampão A para as células recolhidas a partir de duas cavidades de uma placa de poliestireno de 6 poços em 48-72 horas após transfecção (ver Protocolo 1). Operar um sonicador equipado com chifre disruptor e MICROTIP (veja a lista de materiais / equipamentos) para a duração total de 15 sec-pulso intermitente (ciclo de trabalho de 50%) por uma amostra.
    2. Para o processo de congelação-descongelação, congelar as células com azoto líquido e as células descongelar à temperatura ambiente.
    3. Medir as concentrações de proteína utilizando um ensaio de proteína reagente I comercial ou II (veja a lista de materiais / equipamentos).
      Nota: Os lisados ​​são diluídos com uma relação de 01:10 na medição das concentrações de proteína, quer com o reagente I ou II. Nesta diluição, a SDS presente em tampão A mostra pouca ou nenhuma interferência nesta medição.
  2. Misturar o lisado contendo 20-30 ug de proteína total com tampão de carregamento 2 x 4 ou x SDS-PAGE. 27 Ferver as amostras durante5 min e, em seguida, carregá-los em um 12,0% -15,0% desnaturante em gel de SDS-poliacrilamida para eletroforese.
  3. Transferir as proteínas separadas por SDS-PAGE para uma membrana de PVDF, utilizando um método de transferência de Western descrito anteriormente. 17,24,27-31
    1. Bloquear os sítios de ligação não específicos sobre a membrana com leite magro a 5% em 1 x PBS, e depois incubar a membrana com soluções de anticorpos primários diluídos durante 1 h à TA. Veja a lista de materiais / equipamentos para obter informações detalhadas (por exemplo, taxa de diluição) de cada anticorpo primário.
    2. Depois de se lavar a membrana 3-4 vezes (cada 3 a 5 minutos de incubação com agitação) com tampão PBS-T (1 x PBS e 0,1% de Tween-20), incubar a membrana numa mistura de infravermelho próximo (IV) Os anticorpos secundários conjugados com corantes fluorescentes (razão de diluição de 1: 20000), anticorpos secundários conjugados DyLight (razão de diluição de 1: 20.000), e / ou a peroxidase de rábano (HRP) -conjugated anticorpos secundários (diluído em PBS-T; dilutina proporção de 1: 10000) durante 1 h à TA. Veja a lista de materiais / equipamentos para obter informações detalhadas (por exemplo, taxa de diluição) de cada anticorpo secundário.
  4. Lave a membrana 3 vezes, e, então, verificar a membrana para analisar as proteínas com o sistema de imageamento infravermelho e / ou o gerador de imagens para detecção de quimiluminescência immunoblot (veja a lista de materiais / equipamentos).
    1. Para usar o sistema de imageamento infravermelho, consulte (6.4.1) em Supplemental arquivos de código.
    2. Para utilizar o gerador de imagens quimiluminescência, consulte (6.4.2) em Supplemental arquivos de código. Use um substrato ultra-sensível reforçada quimioluminescente (ECL) (veja a lista de materiais / equipamentos) para este sistema.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Análise por imunofluorescência da endógena CENP-A suporta a hipótese de que CUL4A-ligase E3 é necessário para a localização de CENP-A a centrómeros
Os nossos estudos recentes mostraram que a actividade de ligase CUL4A-RBX1-COPS8 E3 é necessária para a ubiquitinação de lisina 124 (K124) em CENP-A e localização de CENP-A a centrómeros. 17 Inicialmente, o complexo interfase-centrómero (ICEN) foi isolado pela anti-CENP-a: imunoprecipitação de cromatina nativo, 32-34 e foi levantada a hipótese de que algumas das proteínas ICEN pode desempenhar um papel na localização de CENP-a a centrómeros. Portanto, siRNA experiências knockdown foram realizados para o rastreio de proteínas cuja ausência de expressão induzida a deslocalização de CENP-A em centrómeros 17 (dados não mostrados): assincronamente o crescimento de células HeLa foram transfectadas com Cullin 4A (CUL4A) siRNA ou siRNA RBX1 para os tempos necessária para a depleção de proteína óptima (48 hr para CUL4A e 72 horas, para a RBX1). As células transfectadas com ARNsi CUL4A mostrou uma deslocalização significativa de CENP-A em centrómeros (Figura 1A-C). Como pode ser visto na Figura 2G, os níveis de proteína de CENP-A em lisados ​​celulares totais de células CUL4A siRNA-transfectadas foram semelhantes aos níveis de CENP-A em lisados ​​obtidos a partir de luciferase (Luc), as células transfectadas com ARNsi nas mesmas condições de cultura. A possibilidade de efeitos fora do alvo de CUL4A siARN foi excluída, porque a expressão ectópica de CUL4A-Flag resgatado a redução de CENP-A em centrómeros quando CUL4A siRNA alvo a UTR 3 '(Figura 2A-C). Os níveis de proteína de CENP-A em lisados ​​de células totais foram confirmadas como sendo semelhante a níveis CENP-A em lisados ​​de células transfectadas-Luc siARN sob as mesmas condições de cultura, independentemente de a (1B Figuras, 2G) fase do ciclo celular; Assim, a possibilidade de que a depleção CUL4A causada CENP-A degradação da proteína foi eliminado.

35 e contêm 3 elementos principais: um andaime cullin, uma proteína dedo anelar (RBX1 ou RBX2), e uma enzima E2 cobrado-ubiquitina que é recrutada por RBX1 ou RBX2, 36 proteína de dedo uM ANEL também recruta um adaptador de substrato que coloca substratos em proximidade com a enzima E2 para facilitar a transferência de ubiquitina. 36 siRNAs RBX1 induziu uma redução significativa de CENP-a em centrómeros (Figura 1D-f) sob as condições em que os níveis de proteína de CENP-a em lisados ​​celulares totais de células transfectadas com ARNsi RBX1 eram semelhantes aos níveis de CENP-a em lisados ​​de células Luc siRNA-transfectadas (Figura 2G). Degradação de CENP-A proteína quer por depleção RBX1 ou pela combinação de CUL4A e depleção RBX1 sob as mesmas condições de cultura não foi observado (Figura 2G). A possibilidade de efeitos fora do alvos de RBX1 siARN foi excluída, porque a expressão ectópica da Bandeira-RBX1 resgatado a redução de CENP-A em centrómeros quando RBX1 siRNA alvo a UTR 3 '(Figura 2D-F). Estes achados sugerem que CUL4A-RBX1-E3 ligase for formalmente exigido para a localização de CENP-A para centrômeros.

Análise por imunofluorescência da exógeno CENP-A - proteínas sinalizador indica que CENP-A K124 ubiquitinação é essencial para a localização de CENP-A a centrómeros
Anteriormente, a nossa análise de espectrometria de imunoprecipitação-de massa revelou que a lisina 124 (K124) de CENP-A-Flag é ubiquitylated em células HeLa. 17 na estrutura cristalina do CENP-A nucleossoma, K124 reside na hélice α3, embora o local é não dentro da região de CATD 17 Além disso., K124 é conservada entre mamíferos, aves, plantas, lagartos, e um grupo de fungos (por exemplo, budDing levedura). 17 CENP-A mutantes de lisina (Figura 3A) foram construídos e testados sua capacidade de localizar ao centrómero. Observou revogação substancial da localização centromérico de exógeno CENP-A mutante com K124R sinais de difuso em ambos os mitose e interfase células HeLa (Figura 3B, C). Centrômero localização não foi significativamente afectada nem por mutações K9A (K9 corresponde a histona H3 K9 metilação), nem as mutações K77R (K77 é um site de lisina único em CATD) (Figura 3B, C).

Com base nestes resultados, duas hipóteses são propostas a respeito da função in vivo de CENP-A ubiquitinação em K124. Em primeiro lugar, o papel de K124 ubiquitinação é para a proteólise mediada por ubiquitina para eliminar sobre-expresso e / ou mislocalized CENP-A a eucromatina. Em segundo lugar, o papel de CENP-A ubiquitinação em K124 é para carregar CENP-A sobre centrómeros. Para testar a fpossibilidade irst, as estabilidades de CENP-A-Flag tipo selvagem e do mutante K124R, bem como endógena CENP-A depois de cicloheximida (CHX) tratamento de CUL4A- ou células com depleção de RBX1 foram abordados. Estes dados sugerem que a ubiquitinação de K124, provavelmente, não está envolvido na proteólise mediada por ubiquitina para eliminar sobre-expresso e / ou mislocalized CENP-A (dados não apresentados). 17. Para além disso, confirmou-se que a mutação K124R anula putativos monoubiquitylation e diubiquitylation bandas, tanto em in vivo e em ensaios de ubiquitinação in vitro (dados não mostrados). 17 Em conjunto, estes dados sugerem que o complexo CUL4A-RBX1 contribui para ubiquitinação "sinalização", que é necessária para CENP-a localização em centrómeros.

Análise por imunofluorescência da bandeira exógena - proteínas CENP-A indica que a fusão monoubiquitin é suficiente para carregarCENP-A K124R em centrômeros
Com base nos resultados acima, foi colocada a hipótese de que monoubiquitin ligado covalentemente serve como um sinal para CENP-A carregamento em centrómeros. Para testar esta hipótese, um N-terminal e marcada com Flag C-terminal fundido com ubiquitina de tipo selvagem CENP-A e um mutante K124R CENP-A foi construído (Figura 4A). O mutante monoubiquitin Ub (K48R), que não possui um local importante para polyubiquitylation 37-39 também foi utilizado para prevenir fundido ubiquitina-CENP-A proteína de potencial polyubiquitylation. Ao capturar sinais de imunofluorescência anti-FLAG, a localização centromérica de proteínas codificadas por estas construções foi testado. Considerando Bandeira-CENP-A (K124) substancialmente revogada localização centrómero do CENP-A (Figura 4B e 4C, coluna [6]), ambos Bandeira-CENP-A (WT) e Bandeira-CENP-A (WT) -Ub ( WT) mantiveram a sua localização centrómero (Figura 4B e 4C, colunas [1] e [2]). oFlag-CENP-A (K124R) -Ub (K48R) proteína presumivelmente imitou monoubiquitylated CENP-A, tal como esta proteína restaurado substancialmente a localização centrómeros (Figura 4C, comparam colunas [5] e [6]) de forma mais eficiente do que CENP-A (K124R) -Ub (WT) (Figura 4C, compara colunas [4] - [6]). Estes dados demonstram que monoubiquitylation é suficiente para o recrutamento de CENP-A a centrómeros.

figura 1
Figura 1. Análise por imunofluorescência da endógena CENP-A suporta a hipótese de que CUL4A-ligase E3 é necessário para a localização de CENP-A a centrómeros (Figuras foram adaptados a partir Niikura et ai. 17). (A) CUL4A siRNA deslocalização induzido de CENP-A em centrômeros. As células HeLa foram transfectadas com ARNsi de luciferase ou CUL4A (Luc) e incubadas durante 48 horas (Tabela 1). A barra de escala representa 10 um. (B) Análise de transferência de Western de lisados ​​de células HeLa usando toda a mesma condição de cultura como em (a). As células foram colhidas 48 hr após transfecção com CUL4A siRNA ou Luc siRNA (Tabela 1). GAPDH serviu como um controlo de carga. (C) Os sinais de CENP-A quantificada endógenas, em centrómeros mostrado em (A). A normalização dos sinais foi realizada usando células Luc siRNA-transfectadas, e as percentagens médias (± SD) são mostrados. **** P <0,0001 vs células Luc siRNA-transfectadas (teste t de Student). (D) RBX1 siRNA deslocalização induzido de CENP-A partir de centrômeros. As células HeLa foram transfectadas com ARNsi RBX1 ou Luc (s) e incubou-se durante 72 horas (Tabela 1). A barra de escala representa 10 um. (E) Análise de transferência de Western de lisados ​​de células HeLa usando toda a mesma condição de cultura como em (D). As células foram colhidas 72 h após a transfecção com o RBX1R Luc siRNA (s) (Tabela 1). GAPDH serviu como um controlo de carga. (F) quantificado de sinais endógenos CENP-A em centrómeros mostrado em (D). A normalização dos sinais foi realizada usando células Luc siRNA-transfectadas, e as percentagens médias (± SD) são mostrados. **** P <0,0001 vs células Luc siRNA-transfectadas (teste t de Student). Por favor clique aqui para ver uma versão maior desta figura.

Figura 2
Figura 2. Informações suplementares relacionados com a Figura 1 centrômeros (Figuras foram adaptados a partir Niikura et al. 17). (A) exógena CUL4A-Flag resgatou a deslocalização de CENP-A, quando CUL4A siRNA alvo o 'UTR 3. HeLa Tet-Off celLS foram fixados em 48 h após a co-transfecção com ARNsi (CUL4A # 2: 3 'UTR ou alvo Luc; Tabela 1), mais a construção de plasmídeo (pTRM4-CUL4A-Flag ou vector; Tabela 2). imunocoloração 4-color: coloração para DAPI (azul); Bandeira; endógena CENP-B (vermelho); e endógena CENP-A (verde), foi realizado e as células Bandeira-positivos foram ordenados, mas as imagens da bandeira são omitidos para simplificar. Nota: CUL4A # 2 é o alvo idêntica como a mostrada na Figura 1A-C. A barra de escala representa 10 um. (B) Análise de transferência de Western de HeLa Tet-Off lisados ​​de células inteiras, seguindo a mesma condição de cultura, como mostrado em (A). GAPDH serviu como um controlo de carga. Sinais (C) CENP-A em centrómeros mostrado em (A) foram quantificados por microscopia após a triagem de células para isolar aqueles ligada por um anticorpo anti-Flag. A normalização dos sinais foi realizada com células transfectadas com ARNsi mais Luc vector, e as percentagens médias (± SD) são mostrados.**** P <0,0001 vs células transfectadas com ARNsi mais Luc vector (coluna da esquerda, teste t de Student). (D) exógena Bandeira-RBX1 resgatado a deslocalização de CENP-A no centrómero quando RBX1 siRNA alvo a UTR 3 ' . As células HeLa foram fixados em 72 h após a co-transfecção com ARNsi (RBX1 # 2: 'UTR 3-alvo ou Luc; Tabela 1), mais a construção de plasmídeo (pcDNA3-Flag-RBX1 ou vector; Tabela 2). imunocoloração 4-color: coloração para DAPI (azul); Bandeira; endógena CENP-B (vermelho); e endógena CENP-A (verde), foi realizado e as células Bandeira-positivos foram ordenados, mas as imagens da bandeira são omitidos para simplificar. A barra de escala representa 10 um. (E) Análise de transferência de Western de lisados ​​de células HeLa todo seguindo a mesma condição de cultura como em (D). GAPDH serviu como um controlo de carga. (F) sinais de CENP-A em centrómeros mostrado em (D) foram quantificados por microscopia após a triagem de células para isolar aqueles ligados por um n anticorpo anti-Flag. A normalização dos sinais foi realizada com células transfectadas com ARNsi mais Luc vector, e as percentagens médias (± SD) são mostrados. **** P <0,0001 vs células transfectadas com ARNsi mais Luc vector (coluna, teste t de Student esquerda). (L) Depleção de CUL4A RBX1 e não afectou os níveis de endógena CENP-A proteína. Níveis de endógena CENP-A proteína foram medidos em lisados ​​de células HeLa toda colhidas 72 horas após a transfecção com CUL4A, RBX1, CUL4A mais RBX1, ou Luc siRNA. Quarenta e oito horas após a transfecção, as células foram ou não tratados (Asyn) ou tratados com paclitaxel (+ impostos) para induzir a paragem na mitose, e elas foram cultivadas durante 24 h. GAPDH serviu como um controlo de carga. Por favor clique aqui para ver uma versão maior desta figura.

32 / 53732fig3highres.jpg "width =" 700 "/>
Figura 3. Análise de imunofluorescência de proteínas CENP-A-Flag exógenos indicou que CENP-A K124 ubiquitinação é necessário para CENP-A localização em centrómeros (Figuras foram adaptados a partir Niikura et ai. 17). (A) A sobre-expressão de CENP-A- construtos Flag (WT e mutantes KR) foi confirmada por análise de transferência de Western de células HeLa Tet-Off lisados ​​de células inteiras. As células foram colhidas 48 hr após transfecção com pTRM4-CENP-A-Flag WT, mutantes KR, ou vector pTRM4 (Tabela 2). A sobre-expressão de CENP-A-FLAG foi detectado por um anticorpo anti-Flag. GAPDH serviu como um controlo de carga. Putativo CENP-A-Flag dímero (##) e monômero CENP-A-Flag (#) são mostrados. Nota:-resistentes SDS dímeros CENP-A têm sido relatados previamente 40,41 (B) O CENP-A mutante K124R mostrou deslocalização difundido a partir centrômeros.. Sinais de DAPI (azul), Bandeira (green), e endógena CENP-B (vermelho, um centrômero controle local) são mostrados. Nota: Ao contrário endógena CENP-A em células transfectadas com CUL4A ou siRNA RBX1, os sinais de difuso apareceu em células que sobre-expressos exógeno CENP-A K124R-Flag como um fenótipo de a incapacidade de ser orientada para o centrómeros, presumivelmente porque o seu nível de expressão é de cerca de 10 - a 25-vezes maior do que a de endógena CENP-a (dados não mostrados) 17 a barra de escala representa 10 um (C) os histogramas dos padrões de localização mostrados em (B)... Mais de 50 prometáfase e metafásicas células pro / e mais de 200 células em interfase por experimento foram contadas (n ≥ 3 experimentos). Os percentuais médios (± SD) são mostrados. "Outros (Non-centrômero)" indica células danificadas principalmente, células mortas, ou células com localização nucleolar (apenas na interfase), presumivelmente por causa de transfecção ou outros tratamentos. *** P <0,001 vs CENP-A WT-Flag (teste t de Student).

Figura 4
Figura 4. A análise de imunofluorescência de proteínas exógenas Bandeira-CENP-A indicaram que CENP-A fusão monoubiquitin deslocalização resgatado do CENP-A mutante K124R de centrômeros (Figuras foram adaptados a partir Niikura et al. 17). (A) desenhos animados esquemáticas de cada construção utilizada neste estudo (ver também a Tabela 2). O local de mutação K124R no CENP-A (vermelho) e local de mutação do K48R em monoubiquitin (azul) são mostrados. (1) WT: Bandeira-CENP-A WT, (2) WT-Ub (WT): Flag-CENP-A WT-Ub (WT), (3) WT-Ub (K48R): Flag-CENP-A WT -Ub (K48R), (4) K124R-Ub (WT): Flag-CENP-A K124R-Ub (WT), (5) K124R-Ub (K48R): Flag-CENP-A K124R-Ub (K48R), (6) K124R: Bandeira-CENP-A K124R (B) exógena CENP-A fusão monoubiquitin deslocalização resgatado do CENP-A mutante K124R de centrômeros.. DAPI (azul), bandeira (verde), e endógena CENP-B (vermelho, um centrômero controle local) são mostrados. A barra de escala representa 10 um. (C) Os histogramas dos padrões de localização mostradas em (C). Mais de 50 prometáfase e metafásicas células pro / e mais de 200 células em interfase por experimento foram contadas (n ≥ 3 experimentos). Os percentuais médios (± SD) são mostrados. **** P <0,0001 e *** P <0,001 vs não-fundido Bandeira-CENP-A K124R (coluna [6]) (teste t de Student). Por favor clique aqui para ver uma versão maior desta figura.

-alvo siRNA Indicação no presente estudo tipo de destino número de banco de dados siRNA Sequência Forward (s) Fonte / Referência
Luciferase (GL3) - um alvo RKK9 CUUACGCUGAGUACUUCGAdTdT Elbashir et al., (2001)
CENP-A CA-UTR piscina siRNA (2 alvos mistura) RKK375 / 5 'UTR T1 CGAGCGGCGCGGACUUCUGCCdTdT Niikura et al., (2015)
RKK383 / 3 'UTR T1 UCCUGCACCCAGUGUUUCUGUdGdT Niikura et al., (2015)
CUL4A # 1 um alvo CRKK178 / RKK309 / T1 AGCGAUCGUAAUCAAUCCUGA Niikura et al., (2015)
# 2 (3'UTR) um alvo CRKK181 / RKK331 / T4 AUGCGGGUUUGAAAUAUGACA Niikura et al., (2015)
RBX1 / ROC1 # 1 siRNA piscina (4 alvos mistura) CRKK198 / RKK411 / T1 GAAGCGCUUUGAAGUGAAA Niikura et al., (2015)
CRKK198 / RKK413 / t2 GCAUAGAAUGUCAAGCUAA Niikura et al., (2015)
CRKK198 / RKK415 / t3 GCAAGAAGCGCUUUGAAGU Niikura et al., (2015)
CRKK198 / RKK417 / T4 CAACAGAGAGUGGGAAUUC Niikura et al., (2015)
# 2 (3 'UTR) um alvo CRKK206 / RKK425 / T8 UUCCCUGCUGUUACCUAAUUA Niikura et al., (2015)

Tabela 1. Sequências de siRNA utilizados neste estudo.

número B Característica relevante (s) Fonte / Referência
B288 pTRM4 Niikura et al., (2006)
B2067 pTRM4-humana CENP-A-Flag Niikura et al., (2015)
B2281 pTRM4-humana CENP-A K9A-Flag Niikura et al., (2015)
B2387 pTRM4-humana CENP-A K77R-Flag Niikura et al., (2015)
B2388 pTRM4-human CENP-A K124R-Flag Niikura et al., (2015)
B2512 pTRM4-Flag-humana CENP-A Niikura et al., (2015)
B2579 CENP-A pTRM4-Flag-humana K124R Niikura et al., (2015)
B2513 pTRM4-Flag-humana CENP-A-Ub (WT) Niikura et al., (2015)
B2559 pTRM4-Flag-humana CENP-A K124R-Ub (WT) Niikura et al., (2015)
B2515 pTRM4-Flag-humana CENP-A-Ub (K48R) Niikura et al., (2015)
B2560 pTRM4-Flag-humana CENP-A K124R-Ub (K48R) Niikura et al., (2015)
B2759 pTRM4-humana CUL4A-Flag Niikura et al., (2015)
B2624 RBX1 pcDNA3-Flag-humana Niikuraet al., (2015)
B1491 pcDNA3-Flag Niikura et al., (2015)

Tabela 2. vectores plasmídeo utilizado no presente estudo.

R (anti-CENP-B) Amostra b (anti-CENP-B) Amostra de R (subtraído) Ratio (amostra S: Amostra R) Rácio corrigida (S amostra: Amostra R)
520 514 6 -4,167 0.000
535 445 90 -1,033 0.000
515 431 84 0,274 0,274
562 483 79 0,506 0,506
902 562 340 0,509 0,509
1203 703 500 -0,560 0.000
1014 589 425 -0,819 0.000
768 510 258 -1,345 0.000
555 458 97 -1,845 0.000
781 576 205 -1,146 0.000
556 436 120 0,758 0,758
534 493 41 -1,634 0.000
702 543 159 0,667 0,667
482 429 53 -1.000 0.000 654 531 123 0.740 0.740
1190 607 583 0,384 0,384
552 454 98 0,969 0,969
489 413 76 0,539 0,539
511 452 59 -3,186 0.000
485 475 10 -2,700 0.000
481 441 40 -1,475 0.000
Soma 5,347
Média 0,255
R (anti-CENP-B) Ctrl b (anti-CENP-B) Ratio (S ctrl: R ctrl) Rácio corrigida (S ctrl: R ctrl)
543 483 60 3.017 3.017
526 466 60 2.667 2.667
532 460 72 1.792 1.792
507 457 50 3.520 3.520
491 458 33 4.273 4.273
545 464 81 2.160 2.160
518 484 34 3.559 3.559
461 404 57 2.404 2.404
487 447 40 3.550 3.550
534 477 57 3.965 3.965
528 456 72 3.097 3.097
707 601 106 1.868 1.868
615 528 87 2.828 2.828
660 481 179 1.620 1.620
565 476 89 1.607 1.607
527 455 72 3.583 3.583
560 474 86 2.930 2.930
510 451 59 4.017 4.017
729 586 143 2.678 2.678
634 576 58 3.655 3.655
507 476 31 3.935 3.935
Soma 62,725
Média 2.987
Restante sinais CENP-A em centrômero (%) 8,5

. Tabela 3. Um exemplo de cálculo dos restantes sinais CENP-A no centrómero (%) Um exemplo de Pro / Prometáfase na Figura 2F é mostrado: amostra é RBX1 # 2 (3'UTR) + Vec (coluna central na Figura 2F ) e controle é Luc + Vec (coluna da esquerda na Figura 2F). Como resultado, permanecendo sinais CENP-A acentrómero (%) = (0,255 / 2,987) x 100 = 8,5% é obtida (ou [5,347 / 62,725] x 100 = 8,5% com o mesmo número total de células [por exemplo, 21 células] analisados ​​entre duas amostras). Note-se que se o valor b é mais do que o valor S (ou seja, se o valor subtraído é negativo), valor da relação corrigida está definido para 0,00.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Nos últimos anos, muitos estudos têm desenvolvido diferentes ensaios de microscopia quantitativa em células fixas. 42 Progress em biologia centrômero-kinetochore muitas vezes requer uma compreensão da função específica do centrômero ou específicos de kinetochore de proteínas das quais regulação espacial-temporal subcelular reflete a evolução das funções do estas proteínas durante o ciclo celular. Portanto, aqui desenvolvemos métodos de coloração IIF e um ensaio quantitativo para o IFI analisar especificamente os níveis relativos de endógena e proteínas exógenas CENP-A, que pode ser aplicado em amostras tratadas de maneira diferente. Atualmente alcançado sucesso coloração IIF de endógena CENP-I, CENP-H, KNL1, Hec1 e Ska1 utilizando o protocolo de 2 neste estudo (ver Niikura et al 24 e dados não mostrados;. Lista de materiais / equipamentos para obter informações de anticorpos) . No futuro, pode-se aplicar o mesmo método para quantificar o nível de diferentes proteínas de centrómero-cinetocoro (ambos EndoGindí- e Flag-etiquetado proteínas exógenas) escolher os anticorpos específicos, no entanto, os nossos métodos IIF não cobrem a detecção destas proteínas em células vivas ou em uma única célula específica durante o ciclo de célula inteira. Uma vez que estes procedimentos requerem células a serem fixados e processados ​​em lamelas separadas, introduzimos os sinais de referência (por exemplo, ACA ou CENP-B), para a finalidade de normalização, a fim de comparar razoavelmente sinais entre diferentes amostras e aumentar a precisão do ensaio. Porque ACA envolvem ou sinais endógenos e exógenos / CENP-A, CENP-B como um sinal de referência com a finalidade de normalização seria mais apropriado para a comparação do que seria ACA em termos da exactidão do ensaio quantitativo de sinais de CENP-A. A região amino-terminal de CENP-B se liga ao motivo de 17 pb da sequência de caixa de CENP-B em ADN alphoid, e a região carboxilo-terminal de CENP-B forma homodímeros. O 43,44 CENP-B não completamente colocalize com CENP-A e / ou outro centrproteínas Omerê-cinetócoro, no entanto, está intimamente associada com eles. 45 Enquanto imunofluorescência com anticorpos anti-CENP-C normalmente dá dois pontos discretos, coloração com anti-CENP-B muitas vezes aparece como uma única barra brilhante ligando os dois centrômeros irmã. 46 No entanto , na nossa observação microscópica macro-escala, alguns sinais de CENP-B, aparentemente se sobrepõem com os sinais de CENP-a, especialmente em fases mitóticas anteriores (prophase-prometáfase que tarde metaphase), também em parte, em função do ângulo de observação e do tipo de fixador utilizado (dados não mostrados). Em contraste, num ensaio de IFI quantitativa dos sinais de CENP-A, localização da proteína de sinais de referência não devem ser afectadas pela depleção e / ou disfunção de CENP-A para análise justo, embora a localização da maior parte das proteínas de centrómero-cinetócoro é dependente CENP-a localização em centrómeros. montagem cinetócoro 47,48 CENP-a-independente é estabelecida substituindo as regiões de ligação ao ADN de CENP-C E CENP-T com domínios alternativos de direccionamento cromossómicas que recrutam estas proteínas para os loci ectópica. 49,50 Além disso, trabalho recente indicou que os componentes interiores cinetócoro CENP-C e CENP-T actuem em paralelo para recrutar KMN para a rede cinetócoros. 51-54 além disso, Nishino et al. sugeriram que as formas complexas CENP-TWSX uma estrutura nucleossomo-like exclusivo para gerar contactos com DNA, estendendo o "código de histonas" além proteínas nucleossomos canônicos. 55 Devido a localização do centrômero de CENP- C é dependente da localização do centrómero de CENP-a, 47,48 CENP-TWSX ou especialmente CENP-T poderia ser outro candidato (s) de proteína para fornecer sinais de referência num ensaio quantitativo de IFI CENP-a. No entanto, o candidato para a sinalização de referência devem ser cuidadosamente testadas antes do ensaio para determinar se a localização centrómeros é afectada pela depleção e / ou disfunção de CENP-A. consideração análogadevem ser tomadas para ensaios quantitativos de IFI de outras proteínas de centrómero-cinetócoro: localização de proteínas de sinais de referência não devem ser afectadas pela depleção e / ou disfunção da proteína alvo para análise justo. No estudo anterior, utilizou-ACA como um sinal de referência para o ensaio de IFI quantitativa de outras proteínas cinetócoro centrais-exterior. 24 ACA pode ser uma opção mais apropriada do que CENP-B único, como um controlo de posição, bem como um sinal de referência, se ACA sinais não são afectadas pela depleção e / ou disfunção da proteína alvo, mas co-localização da proteína alvo com CENP-B é deficiente como mencionado acima.

Bodor et ai. relatado que os níveis centroméricas CENP-A são regulados pela ação de massa, ou seja, a quantidade de centromérica CENP-A varia em proporção direta com o conteúdo celular. 56 Eles também mostraram que a indução transitória da CENP-A expressão leva a um aumento rápido em o centromérica CENP-A nível. Por outro lado, observou-se uma população de células grandes, com localizada-centrómero, Flag-tagged CENP-A WT após cotransfecção do vector de expressão pTRM4 com o CA-UTR siARN (uma mistura de 5 'e 3' UTR siARN; Tabela 1) (não de dados mostrando); esta população era maior do que a observada após a transfecção apenas com o vector de expressão pTRM4. O nível de exógeno marcada com Flag CENP-A proteína cuja expressão foi conduzida por pTRM4, foi de aproximadamente 1,0 a 1,4 ordens de grandeza (10 a 25 vezes) maior do que a de endógena CENP-A (dados não apresentados). Especula-se que a expressão de exógena CENP-A WT acima de um determinado limite podem afetar adversamente sua localização centromérica adequada.

Nas actuais protocolos, a fixação é um passo crítico para manter a estrutura celular e meio ambiente como situação proximal quanto possível para o estado nativo. Uma vez que as células são fixadas, deve-se proceder com o protocolo de coloração para evitar a perda da proteína de intedescansar ou o resto da célula. Contudo, a fixação destrói os locais antigénicos ocasionalmente, e diferentes combinações de anticorpos para o antigénio funcionar mal com um fixador, mas muito bem com a outra. 21 Devido a esta variação, a escolha do fixador depende em grande parte da proteína (s) de interesse. A duração do tempo de fixação pode afectar de forma significativa a detecção da proteína (s) por imunocoloração, e mais curto fixação é geralmente melhor para conservar a antigenicidade. 57 Portanto, ao determinar procedimentos de coloração para um novo alvo de outras proteínas de centrómero-cinetocoro, especialmente de incerto localização, ou quando se trabalha com um novo anticorpo, deve-se testar vários métodos de fixação e buffers para encontrar a condição ideal. Nas actuais protocolos, foram selecionadas duas classes de fixadores populares: fixadores aldeído (protocolo 2) e solventes orgânicos (protocolos 3 e 4). A pureza dos fixadores é também extremamente importante. No Protocolo 4, soro de cabra 4% é usado especially IgG para bloquear os receptores na superfície das células para reduzir o fundo inespecífico. 57 Geralmente, o soro para bloquear os receptores de IgG deve ser de uma espécie não relacionado com o anticorpo primário, e de preferência da mesma espécie como o anticorpo secundário. 57

Em cada um dos presentes protocolos, a escolha do anticorpo primário é o passo mais crítico para a realização bem sucedida imunocoloração. O anticorpo desejado é com a maior especificidade, pureza, afinidade e avidez. A concentração de partida de boa para os anticorpos monoclonais é geralmente 1-5 ug / ml. Diluições típicos da preparação de estoque de anticorpos policlonais varia de 1:20 a 1:. 500 57 Uma das necessidades para determinar empiricamente a concentração apropriada de anticorpo primário e o diluente para cada amostra. As amostras devem ser suavemente embalado mas não seca durante a incubação para a coloração homogênea. lavagem extensiva entre a incubação do anticorpo primário e um secundáriontibody pode ser necessário para evitar reacção cruzada com imunoglobulinas de outras espécies. No entanto, a condição de lavagem ideal deve ser determinada empiricamente para evitar a perda de células, especialmente células mitóticas, que completam e desprendem quando agitado (ou seja, mitótico shake-off). 58 Para o sucesso, um anticorpo secundário tem de ser escolhida para se ligar a o anticorpo primário com elevada afinidade. Por exemplo, para evitar a ligação não específica da porção Fc do anticorpo secundário a receptores Fc de IgG, Fb (ab ') 2 fragmentos pode ser usado em vez de anticorpo inteiro. 57 Para muitos anticorpos secundários, tempo de incubação pode ser minimizada a 30 min à TA para reduzir o fundo inespecífico.

Além de protocolo 5, microscopia laser confocal de varrimento poderia ser vantajoso para detectar e analisar a localização e a função das proteínas de centrómero-cinetócoro com as propriedades fluorescentes. Como mostrado na Lista de Materiais / Equipment, Alexa Fluor 488 e Alexa Fluor 594 são provavelmente os corantes fluorescentes utilizadas com mais frequência nos actuais protocolos. Para detectar duas proteínas múltiplas centrómero-cinetócoro e / ou diferentes na amostra, deve-se garantir que os anticorpos utilizados para detecção de uma proteína não impedem a detecção da segunda proteína 57 Nas actuais protocolos., Dois anticorpos primários são misturados e aplicados ao mesmo tempo. No entanto, deve-se optimizar as condições de imunocoloração para cada proteína separadamente antes da aplicação dos anticorpos primários ou secundários em conjunto: Se as duas proteínas estão em estreita proximidade, tal como no caso dos dois componentes centrómero-cinetocoro, um anticorpo primário pode estruturalmente impedir a ligação do segundo anticorpo primário. Outra preocupação de detecção de sinal múltiplo, é o problema da sobreposição espectral: a dificuldade na prevenção de sinal de um corante de "vazamento" para dentro do canal de espectro de outro. Este problema torna-se mais difícil para a convençãoai filtro de interferência de conjuntos de resolver quanto o número de corantes aumenta ou se a amostra contém sinais overenhanced (por exemplo, sinais ACA ou anti-Flag no presente estudo), incluindo a interferência da autofluorescência. Solução de problemas de autofluorescência foi realizado em outros estudos. 57,59,60 No presente estudo, otimizando conjuntos de filtros fluorescentes com controles de rótulo único em cada canal é suficiente na maioria dos casos para evitar esses problemas (veja abaixo).

Em cada um dos presentes protocolos, os controlos apropriados são essenciais. Cada novo anticorpo primário deve ser caracterizados antes da imunocoloração começa. A especificidade do anticorpo deve ser confirmada por análise de Western blot, se for o caso. Além disso, a confirmação de que a coloração não é causada por ligação não específica à superfície da célula deve ser obtida, e a concentração de trabalho óptima de um anticorpo primário específico deve ser determinada através da utilização de diluições em série(Isto é, uma curva de ligação devem ser desenvolvidos). Um controlo negativo (isto é, na ausência do anticorpo primário a partir do processo de coloração) deve ser incluída. Outra opção de controlo negativo é a substituição de IgG normal a partir da mesma espécie para o anticorpo primário. Para a detecção de vários rótulos, deve-se preparar os controlos sem anticorpos secundários (o controle de fundo), bem como controles de rótulo único para evitar artefatos de sobreposição espectral (ou seja, a infiltração, cruzado, crosstalk, ou tingir "vazamento", como descrito acima ). Pode-se quantificar a fração de "vazamento", comparando os sinais através dos filtros de "errado" com o sinal correto, usando estas proporções para remover computacionalmente todos "vazamento", e calcular a real distribuição e / ou co-localização de marcador fluorescente. 60 o controle de fundo deve ser examinado de forma independente com cada canal para definir os limites de ganho de sinal e compensar a ser adapted para a imagem final. Todos os canais que vão ser utilizados para obter uma imagem de uma amostra de múltiplo-etiqueta deve ser submetido a correcção de fundo independente, porque o nível de autofluorescência em cada canal varia substancialmente. O "vazamento" controles, como descrito acima são necessários para determinar a quantidade de ganho de sinal possível em cada canal sem detectar "vazamento" em canais adjacentes. 60

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Os autores declaram que não têm interesses financeiros concorrentes.

Acknowledgments

Este trabalho foi financiado pelo NIH conceder GM68418.

Materials

Name Company Catalog Number Comments
Lipofectamin 2000 Life Technologies/Invitrogen 11668 transfection reagent I
Lipofectamin RNAiMAX Life Technologies/Invitrogen 13778 transfection reagent II
Opti-MEM I Life Technologies/Invitrogen 31985 Reduced serum media, warm in 37 °C water bath before use
High-glucose DMEM (Dulbecco’s modified Eagle’s medium) Life Technologies/BioWhittaker 12-604 high-glucose DMEM, warm in 37 °C water bath before use
Fetal Bovine Serum, certified, heat inactivated, US origin Life Technologies/Gibco 10082 FBS (fetal bovine serum)
Poly-L-Lysine SOLUTION SIGMA-SLDRICH P 8920 Poly-L-Lysine, 0.1% w/v, in water
UltraPure Distilled Water Life Technologies/Invitrogen/Gibco 10977 Sterile tissue culture grade water 
Micro Cover glass (22 mm x 22 mm)  Surgipath 105 Cover glass (22 mm x 22 mm) 
6 Well Cell Culture Cluster Fisher/Corning Incorporated 07-200-83 6-well polystyrene plate 
Penicillin, Streptomycin; Liquid Fisher/Gibco 15-140 Penicillin-streptomycin
PAP PEN  Binding Site AD100.1 Hydrophobic barrier pen (for a water repellant barrier in immunofluorescent staining)
Paclitaxel (Taxol) SIGMA-SLDRICH T7402 Taxol for mitotic cell analysis
TN-16, microtubule inhibitor (TN16) Enzo Life Sciences BML-T120 TN16 for mitotic cell analysis
BSA (bovine serum albumin) SIGMA-SLDRICH A7906 Blocking reagent
Triton X-100 SIGMA-SLDRICH T8787 Detergent for permeabilization
Paraformaldehyde SIGMA-SLDRICH P6148 Fixation reagant
DAPI SIGMA-SLDRICH D9542 For nuclear staining
p-phenylenediamine SIGMA-SLDRICH P6001 For mounting medium
VWR Micro Slides, Frosted VWR International 48312-013 Micro slides 
Anti-CENP-A antibody Stressgen/Enzo Life Sciences KAM-CC006 Mouse monoclonal antibody; dilution ratio of 1:100 (IIF), 1:5000 (WB)
Anti-CENP-B antibody Novus Biologicals H00001059-B01P Mouse monoclonal antibody; dilution ratio of 1:200 (IIF, methanol/acetone fixation)-1:400 (IIF, paraformaldehyde fixation)
Anti-CENP-B antibody  abcam ab25734 Rabbit polyclonal antibody; dilution ratio of 1:200 (IIF, methanol/acetone fixation)-1:400 (IIF, paraformaldehyde fixation)
Anti-centromere antibody (ACA) Fitzgerald Industries International, Inc. 90C-CS1058 Human centromere antiserum; dilution ratio of 1:2000 (IIF)
Anti-CENP-H antibody Bethyl Laboratories BL1112 (A400-007A) Rabbit polyclonal antibody; dilution ratio of 1:200 (IIF)
Anti-CENP-H antibody BD 612142 Mouse monoclonal antibody; dilution ratio of 1:200 (IIF)
Anti-CENP-I antibody N/A, Dr. Katusmi Kitagawa N/A, Dr. Katusmi Kitagawa Rabbit polyclonal antibody; dilution ratio of 1:1000 (IIF); Niikura et al., Oncogene, 4133-4146 (2006)
Anti-KNL1 antibody Novus Biologicals NBP1-89223 Rabbit polyclonal antibody; dilution ratio of 1:100 (IIF)
Anti-Hec1 antibody Novus Biologicals / GeneTex NB 100-338 / GTX70268 Mouse monoclonal antibody; dilution ratio of 1:100 (IIF)
Anti-Hec1 antibody GeneTex GTX110735 Rabbit polyclonal antibody; dilution ratio of 1:100 (IIF)
Anti-Ska1 antibody abcam ab46826 Rabbit polyclonal antibody; dilution ratio of 1:100 (IIF)
Anti-Flag antibody SIGMA-ALDRICH F3165 Mouse monoclonal antibody; dilution ratio of 1:1000 (IIF), 1:5000 (WB)
Anti-Flag antibody SIGMA-ALDRICH F7425 Rabbit polyclonal antibody; dilution ratio of 1:1000 (IIF), 1:5000 (WB)
Anti-CUL4A antibody N/A, Dr. Pradip Raychaudhuri N/A, Dr. Pradip Raychaudhuri Rabbit polyclonal antibody; dilution ratio of 1:3000 (WB); Shiyanov et al., The Journal of biological chemistry, 35309-35312 (1999)
Anti-RBX1 antibody Cell Signaling 4397 Rabbit polyclonal antibody; dilution ratio of 1:2000 (WB)
Anti-GAPDH antibody Chemicon MAB374 Mouse monoclonal antibody; dilution ratio of 1:5000 (WB)
Alexa Fluor 488 Goat Anti-Mouse IgG Life Technologies/Invitrogen A11001 fluorophore-conjugated secondary antibody (Affinity-purified secondary antibody)
Alexa Fluor 594 Goat Anti-Mouse IgG Life Technologies/Invitrogen A11005 fluorophore-conjugated secondary antibody (Affinity-purified secondary antibody)
Alexa Fluor 488 Goat Anti-Rabbit IgG Life Technologies/Invitrogen A11008 fluorophore-conjugated secondary antibody (Affinity-purified secondary antibody)
Alexa Fluor 594 Goat Anti-Rabbit IgG Life Technologies/Invitrogen A11012 fluorophore-conjugated secondary antibody (Affinity-purified secondary antibody)
Non fat powdered milk (approved substitution for carnation powdered milk) Fisher Scientific NC9255871 (Reorder No. 190915; Lot# 90629) Skim milk
Leica DM IRE2 motorized fluorescence microscope  Leica motorized fluorescence microscope 
HCX PL APO 63x oil immersion lens Leica LEICA HCX PL APO NA 1.40 OIL PH 3 CS 63X oil immersion lens
HCX PL APO 100x oil immersion lens Leica LEICA HCX PL APO NA 1.40 OIL PHE 100X oil immersion lens
Leica EL6000 compact light source Leica External compact light source for fluorescent excitation
ORCA-R2 Digital CCD camera  Hamamatsu C10600-10B digital CCD camera 
Openlab version 5.5.2 Scientific Imaging Software  Perkin Elmer/Improvision For image observation, acquisition, quantification, and analysis
Velocity version 6.1.1 3D Image Analysis Software  Perkin Elmer/Improvision For image observation, acquisition, quantification, and analysis
Complete EDTA-free protease inhibitor cocktail Roche 11873580001/11836170001 Protease inhibitor cocktail tablets
PlusOne 2-D Quant Kit Amersham Biosciences 80-6483-56 Commercial protein assay reagent I for measurement of protein concentration (compatible with 2% SDS)
Bio-Rad Protein Assay Bio-Rad 500-0006 Commercial protein assay reagent II for measurement of protein concentration (compatible with 0.1% SDS)
Immobilon-FL EMD Millipore IPFL00010 PVDF membrane for transferring
IRDye 800CW Goat Anti-Mouse IgG LI-COR Biosciences 926-32210 IR fluorescent dye-conjugated secondary antibody (Affinity-purified secondary antibody); dilution ratio of 1:20000 (IIF)
IRDye 680 Goat Anti-Rabbit IgG LI-COR Biosciences 926-32221 IR fluorescent dye-conjugated secondary antibody (Affinity-purified secondary antibody); dilution ratio of 1:20000 (IIF)
Goat anti-Mouse IgG DyLight 549 Fisher Scientific PI35507 DyLight-conjugated secondary antibodyIR fluorescent dye-conjugated secondary antibody (Affinity-purified secondary antibody); dilution ratio of 1:20000 (IIF)
Goat anti-Rabbit DyLight 649 Fisher Scientific PI35565 DyLight-conjugated secondary antibodyIR fluorescent dye-conjugated secondary antibody (Affinity-purified secondary antibody); dilution ratio of 1:20000 (IIF)
Goat anti-mouse IgG-HRP Santa Cruz SC-2005 HRP-conjugated secondary antibodyDyLight-conjugated secondary antibodyIR fluorescent dye-conjugated secondary antibody (Affinity-purified secondary antibody); dilution ratio of 1:10000 (IIF)
Goat anti-rabbit IgG-HRP Santa Cruz SC-2004 HRP-conjugated secondary antibodyDyLight-conjugated secondary antibodyIR fluorescent dye-conjugated secondary antibody (Affinity-purified secondary antibody); dilution ratio of 1:10000 (IIF)
Openlab version 5.5.2. Scientific Imaging Software  Improvision/PerkinElmer Software A
Volocity version 6.3 3D Image Analysis Software (Volocity Acquisition) PerkinElmer Software B1
Volocity version 6.3 3D Image Analysis Software (Volocity Quantification) PerkinElmer Software B2
Branson SONIFIER 450 Sonicator
Branson Ultrasonics sonicator Microtip Step, Solid, Threaded 9.5 mm VWR Scientific Products Inc.  33995-325 Disruptor horn for sonication
Branson Ultrasonics sonicator Microtip Tapered 6.5 mm VWR Scientific Products Inc.  33996-185 Microtip for sonication
Odyssey CLx Infrared imaging System  LI-COR Biosciences Infrared imaging system for immunoblot detection
Image Studio Analysis Software Ver 4.0  LI-COR Biosciences Software C
Molecular Imager Versadoc MP4000 System  Bio-Rad Chemiluminescence imager for immunoblot detection
Quantity One 1-D analysis software  Bio-Rad Software D
SuperSignal West Femto Maximum Sensitivity Substrate Thermo 34095 Ultra-sensitive enhanced chemiluminescent (ECL) substrate

DOWNLOAD MATERIALS LIST

References

  1. DeLuca, J. G., et al. Hec1 and nuf2 are core components of the kinetochore outer plate essential for organizing microtubule attachment sites. Molecular biology of the cell. 16, 519-531 (2005).
  2. Earnshaw, W. C., Halligan, N., Cooke, C., Rothfield, N. The kinetochore is part of the metaphase chromosome scaffold. J Cell Biol. 98, 352-357 (1984).
  3. Hoffman, D. B., Pearson, C. G., Yen, T. J., Howell, B. J., Salmon, E. D. Microtubule-dependent changes in assembly of microtubule motor proteins and mitotic spindle checkpoint proteins at PtK1 kinetochores. Molecular biology of the cell. 12, 1995-2009 (2001).
  4. Regnier, V., et al. CENP-A is required for accurate chromosome segregation and sustained kinetochore association of BubR1. Mol Cell Biol. 25, 3967-3981 (2005).
  5. Bernad, R., Sanchez, P., Losada, A. Epigenetic specification of centromeres by CENP-A. Exp Cell Res. 315, 3233-3241 (2009).
  6. Black, B. E., Cleveland, D. W. Epigenetic centromere propagation and the nature of CENP-a nucleosomes. Cell. 144, 471-479 (2011).
  7. Warburton, P. E., et al. Immunolocalization of CENP-A suggests a distinct nucleosome structure at the inner kinetochore plate of active centromeres. Curr Biol. 7, 901-904 (1997).
  8. Karpen, G. H., Allshire, R. C. The case for epigenetic effects on centromere identity and function. Trends Genet. 13, 489-496 (1997).
  9. Black, B. E., et al. Structural determinants for generating centromeric chromatin. Nature. 430, 578-582 (2004).
  10. Black, B. E., et al. Centromere identity maintained by nucleosomes assembled with histone H3 containing the CENP-A targeting domain. Mol Cell. 25, 309-322 (2007).
  11. Fachinetti, D., et al. A two-step mechanism for epigenetic specification of centromere identity and function. Nat Cell Biol. 15, 1056-1066 (2013).
  12. Zeitlin, S. G., Shelby, R. D., Sullivan, K. F. CENP-A is phosphorylated by Aurora B kinase and plays an unexpected role in completion of cytokinesis. The Journal of cell biology. 155, 1147-1157 (2001).
  13. Zhang, X., Li, X., Marshall, J. B., Zhong, C. X., Dawe, R. K. Phosphoserines on maize CENTROMERIC HISTONE H3 and histone H3 demarcate the centromere and pericentromere during chromosome segregation. The Plant cell. 17, 572-583 (2005).
  14. Goutte-Gattat, D., et al. Phosphorylation of the CENP-A amino-terminus in mitotic centromeric chromatin is required for kinetochore function. Proc Natl Acad Sci U S A. 110, 8579-8584 (2013).
  15. Bailey, A. O., et al. Posttranslational modification of CENP-A influences the conformation of centromeric chromatin. Proc Natl Acad Sci U S A. 110, 11827-11832 (2013).
  16. Samel, A., Cuomo, A., Bonaldi, T., Ehrenhofer-Murray, A. E. Methylation of CenH3 arginine 37 regulates kinetochore integrity and chromosome segregation. Proc Natl Acad Sci U S A. 109, 9029-9034 (2012).
  17. Niikura, Y., et al. CENP-A K124 Ubiquitylation Is Required for CENP-A Deposition at the Centromere. Dev Cell. (2015).
  18. Chan, G. K., Liu, S. T., Yen, T. J. Kinetochore structure and function. Trends in cell biology. 15, 589-598 (2005).
  19. Hori, T., Okada, M., Maenaka, K., Fukagawa, T. CENP-O class proteins form a stable complex and are required for proper kinetochore function. Molecular biology of the cell. 19, 843-854 (2008).
  20. Fukagawa, T., Earnshaw, W. C. The centromere: chromatin foundation for the kinetochore machinery. Developmental cell. 30, 496-508 (2014).
  21. Kedersha, N. The Proteintech Blog.Proteintech. Grainger, D. Proteintech Group. (2012).
  22. Clontech Laboratories, Inc. HeLa Tet-Off Advanced Cell Line. Available from: http://www.clontech.com/CR/Products/Inducible_Systems/Tetracycline-Inducible_Expression/ibcGetAttachment.jsp?cItemId=26908&fileId=6712191&sitex=10020:22372:US (2012).
  23. Meraldi, P., Sorger, P. K. A dual role for Bub1 in the spindle checkpoint and chromosome congression. EMBO J. 24, 1621-1633 (2005).
  24. Niikura, Y., et al. 17-AAG, an Hsp90 inhibitor, causes kinetochore defects: a novel mechanism by which 17-AAG inhibits cell proliferation. Oncogene. 25, 4133-4146 (2006).
  25. Yang, Z., et al. Silencing mitosin induces misaligned chromosomes, premature chromosome decondensation before anaphase onset, and mitotic cell death. Mol Cell Biol. 25, 4062-4074 (2005).
  26. Wang, H., et al. Histone H3 and H4 ubiquitylation by the CUL4-DDB-ROC1 ubiquitin ligase facilitates cellular response to DNA damage. Mol Cell. 22, 383-394 (2006).
  27. Lamb, J. R., Tugendreich, S., Hieter, P. Tetratrico peptide repeat interactions: to TPR or not to TPR? Trends Biochem Sci. 20, 257-259 (1995).
  28. Kitagawa, K., Skowyra, D., Elledge, S. J., Harper, J. W., Hieter, P. SGT1 encodes an essential component of the yeast kinetochore assembly pathway and a novel subunit of the SCF ubiquitin ligase complex. Mol Cell. 4, 21-33 (1999).
  29. Niikura, Y., Dixit, A., Scott, R., Perkins, G., Kitagawa, K. BUB1 mediation of caspase-independent mitotic death determines cell fate. J Cell Biol. 178, 283-296 (2007).
  30. Niikura, Y., Kitagawa, K. Identification of a novel splice variant: human SGT1B (SUGT1B). DNA Seq. 14, 436-441 (2003).
  31. Niikura, Y., Ogi, H., Kikuchi, K., Kitagawa, K. BUB3 that dissociates from BUB1 activates caspase-independent mitotic death (CIMD). Cell Death Differ. 17, 1011-1024 (2010).
  32. Ando, S., Yang, H., Nozaki, N., Okazaki, T., Yoda, K. CENP-A, -B, and -C chromatin complex that contains the I-type alpha-satellite array constitutes the prekinetochore in HeLa cells. Mol Cell Biol. 22, 2229-2241 (2002).
  33. Izuta, H., et al. Comprehensive analysis of the ICEN (Interphase Centromere Complex) components enriched in the CENP-A chromatin of human cells. Genes to cells : devoted to molecular & cellular mechanisms. 11, 673-684 (2006).
  34. Obuse, C., et al. Proteomics analysis of the centromere complex from HeLa interphase cells: UV-damaged DNA binding protein 1 (DDB-1) is a component of the CEN-complex, while BMI-1 is transiently co-localized with the centromeric region in interphase. Genes Cells. 9, 105-120 (2004).
  35. Merlet, J., Burger, J., Gomes, J. E., Pintard, L. Regulation of cullin-RING E3 ubiquitin-ligases by neddylation and dimerization. Cell Mol Life Sci. 66, 1924-1938 (2009).
  36. Bennett, E. J., Rush, J., Gygi, S. P., Harper, J. W. Dynamics of cullin-RING ubiquitin ligase network revealed by systematic quantitative proteomics. Cell. 143, 951-965 (2010).
  37. Antonelli, A., et al. Efficient inhibition of macrophage TNF-alpha production upon targeted delivery of K48R ubiquitin. Br J Haematol. 104, 475-481 (1999).
  38. Codomo, C. A., Furuyama, T., Henikoff, S. CENP-A octamers do not confer a reduction in nucleosome height by AFM. Nat Struct Mol Biol. 21, 4-5 (2014).
  39. Thrower, J. S., Hoffman, L., Rechsteiner, M., Pickart, C. M. Recognition of the polyubiquitin proteolytic signal. The EMBO journal. 19, 94-102 (2000).
  40. Yoda, K., et al. Human centromere protein A (CENP-A) can replace histone H3 in nucleosome reconstitution in vitro. Proc Natl Acad Sci U S A. 97, 7266-7271 (2000).
  41. Shelby, R. D., Vafa, O., Sullivan, K. F. Assembly of CENP-A into centromeric chromatin requires a cooperative array of nucleosomal DNA contact sites. J Cell Biol. 136, 501-513 (1997).
  42. Majumder, S., Fisk, H. A. Quantitative immunofluorescence assay to measure the variation in protein levels at centrosomes. J Vis Exp. (2014).
  43. Masumoto, H., Masukata, H., Muro, Y., Nozaki, N., Okazaki, T. A human centromere antigen (CENP-B) interacts with a short specific sequence in alphoid DNA, a human centromeric satellite. J Cell Biol. 109, 1963-1973 (1989).
  44. Yoda, K., Kitagawa, K., Masumoto, H., Muro, Y., Okazaki, T. A human centromere protein, CENP-B, has a DNA binding domain containing four potential alpha helices at the NH2 terminus, which is separable from dimerizing activity. J Cell Biol. 119, 1413-1427 (1992).
  45. Sugata, N., et al. Human CENP-H multimers colocalize with CENP-A and CENP-C at active centromere--kinetochore complexes. Hum Mol Genet. 9, 2919-2926 (2000).
  46. Earnshaw, W. C., Ratrie, H. 3rd, Stetten, G. Visualization of centromere proteins CENP-B and CENP-C on a stable dicentric chromosome in cytological spreads. Chromosoma. 98, 1-12 (1989).
  47. Goshima, G., Kiyomitsu, T., Yoda, K., Yanagida, M. Human centromere chromatin protein hMis12, essential for equal segregation, is independent of CENP-A loading pathway. J Cell Biol. 160, 25-39 (2003).
  48. Liu, S. T., Rattner, J. B., Jablonski, S. A., Yen, T. J. Mapping the assembly pathways that specify formation of the trilaminar kinetochore plates in human cells. J Cell Biol. 175, 41-53 (2006).
  49. Gascoigne, K. E., Cheeseman, I. M. T time for point centromeres. Nat Cell Biol. 14, 559-561 (2012).
  50. Gascoigne, K. E., et al. Induced ectopic kinetochore assembly bypasses the requirement for CENP-A nucleosomes. Cell. 145, 410-422 (2011).
  51. Nishino, T., et al. CENP-T provides a structural platform for outer kinetochore assembly. EMBO J. 32, 424-436 (2013).
  52. Malvezzi, F., et al. A structural basis for kinetochore recruitment of the Ndc80 complex via two distinct centromere receptors. EMBO J. 32, 409-423 (2013).
  53. Schleiffer, A., et al. CENP-T proteins are conserved centromere receptors of the Ndc80 complex. Nat Cell Biol. 14, 604-613 (2012).
  54. Rago, F., Gascoigne, K. E., Cheeseman, I. M. Distinct organization and regulation of the outer kinetochore KMN network downstream of CENP-C and CENP-T. Curr Biol. 25, 671-677 (2015).
  55. Nishino, T., et al. CENP-T-W-S-X forms a unique centromeric chromatin structure with a histone-like fold. Cell. 148, 487-501 (2012).
  56. Bodor, D. L., et al. The quantitative architecture of centromeric chromatin. Elife. 3, e02137 (2014).
  57. Oliver, C. Ch 58. Molecular Biomethods Handbook. Rapely, R., Walker, J. M. Humana Press. 1063-1079 (2008).
  58. Terasima, T., Tolmach, L. J. Changes in x-ray sensitivity of HeLa cells during the division cycle. Nature. 190, 1210-1211 (1961).
  59. Levenson, G. B. R. Ch 8. Biomedical Photonics Handbook. Vo-Dinh, T. uan CRC Press LLC. 8-19 (2003).
  60. Sanderson, J. Fluorescence bleed-though. Available from: http://www.gum2012.fionastoreydesign.co.uk/Downloads/Bleed through text.pdf (2011).
Proteínas Análise de imunofluorescência de endógenos e exógenos Centromere-cinetócoro
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Niikura, Y., Kitagawa, K. Immunofluorescence Analysis of Endogenous and Exogenous Centromere-kinetochore Proteins. J. Vis. Exp. (109), e53732, doi:10.3791/53732 (2016).More

Niikura, Y., Kitagawa, K. Immunofluorescence Analysis of Endogenous and Exogenous Centromere-kinetochore Proteins. J. Vis. Exp. (109), e53732, doi:10.3791/53732 (2016).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter