Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Immunofluorescentie analyse van endogene en exogene Centromere-kinetochoor Eiwitten

Published: March 3, 2016 doi: 10.3791/53732

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

"Centromeren" werden klassiek gedefinieerd als gebieden onderdrukt meiotische recombinatie in de genetica en later gezien als het belangrijkste vernauwing van mitotische chromosomen, die een essentiële rol speelt nauwkeurige chromosoomsegregatie in mitose. "Kinetochoren" werden beschreven als het meerlagige structuren die binden aan microtubuli aan het oppervlak centromeren, zoals aangetoond door elektronenmicroscopie; "Kinetochoren" werden later gedefinieerd als macromoleculaire complex localiseert in het centromeer van mitotische chromosomen. Ondanks een dramatisch verschil in centromeer DNA-sequenties bij vertebraten, kinetochoor structuur en samenstelling sterk geconserveerd. Een dynamische interactie tussen spindel microtubuli en het kinetochoor vereist voor trouwe segregatie van chromosomen tijdens de mitose en defecten in centromeer-kinetochoor functie leidt tot aneuploïdie en daardoor kanker.

Het centromeer in de meeste eukaryotengeen gedefinieerde DNA-sequentie, maar is samengesteld uit grote arrays (0,3-5 Mb) repeterende alphoid DNA bestaat uit 171 bp α-satelliet DNA. Behalve in gist, wordt centromeer identiteit bereikt niet de DNA-sequentie, maar door de aanwezigheid van een speciale nucleosomen die de histon H3 variant CenH3 bevat (centromeer eiwit A [CENP-A] bij de mens). 5 CENP-A nucleosomen lokaliseren de binnenste plaat van zoogdier kinetochoren 7 en binden aan de 171-bp α-satelliet DNA. Actieve centromeres vereisen CENP-A-bevattende nucleosomen voor de aanwerving van een constitutieve-centromeer geassocieerd netwerk (CKan) en de kinetochoor eiwitten te leiden, die samen reguleren van de aanhechting van de chromosomen van de mitotische spindel en de daarop volgende cyclus progressie door de spil checkpoint.

In het licht van het bovenstaande bewijs heeft CENP-A voorgesteld om de epigenetische merkteken van het centromeer 8 zijn; echter, het proces waardoor CENP-A opgenomen into centromeer DNA en de factoren die tot deze opname nog niet goed gekarakteriseerd. Een korte-centromeer doeldomein (CATD) ligt in het histon voudige regio CENP-A, en vervanging van het overeenkomstige gebied van H3 de CATD zorgdragen om H3 het centromeer. 9 Verschillende studies suggereerde functionele rol voor post-translationele modificatie (PTM) van CENP-A 12-16; De moleculaire mechanismen van deze PTMs van CENP-A in de rekrutering van centromeren nog niet opgehelderd. We hebben eerder gemeld dat CUL4A-RBX1-COPS8 E3 ligase activiteit is vereist voor CENP-A K124 ubiquitinering en lokalisatie van CENP-A naar centromeres. 17

De ontdekking en karakterisering van kinetochore eiwitten hebben geleid tot nieuwe inzichten over chromosoomscheiding. 18 meer dan 100 kinetochoor componenten zijn in gewervelde cellen die door verschillende benaderingen. 19,20 Een onderstaande hoe kinetochoren assembleren en functie komt ook uit het karakteriseren van de cellulaire functies van elke centromeer-kinetochoor eiwitten en eiwit-eiwit netwerk in cellen. 19 Directe visualisatie en geavanceerde imaging werkwijzen fluorescentiemicroscopie bieden opmerkelijke resolutie van centromeer-kinetochore componenten en laat directe observatie van de specifieke moleculaire componenten van de centromeren en kinetochoren. Bovendien, de methoden van indirecte immunofluorescentie (IIF) kleuring met behulp van specifieke antilichamen zijn cruciaal voor deze waarnemingen. Ondanks talrijke rapporten over IIF protocollen weinig besproken problemen specifieke centromeer-kinetochore eiwitten. 1-4 Zo ontwikkelen en rapporteringsmethoden van IIF kleuring en een kwantitatieve bepaling om IIF specifiek wat elke centromeer-kinetochoor eiwit is zeer belangrijk. In IIF kleuring, moet men overgaan tot de kleuringsprotocol verlies van het eiwit van belang voorkomen ofde rest van de cel. Echter, fixatie vernietigt antigene plaatsen af en verschillende antilichaam-antigeen combinaties werken slecht met een fixatief, maar zeer goed met elkaar, en 21 keuze fixeermiddel hangt grotendeels af van de eiwit (ten) van belang. Daarom verschillende fixerende methoden zijn van cruciaal belang in IIF kleuring van centromeer-kinetochoor eiwitten.

Hier geoptimaliseerde werkwijzen voor indirecte immunofluorescentie (IIF) kleuring en een test om lokalisatie van endogeen centromeer-kinetochore eiwitten, waaronder CENP-A en Flag-tagged exogene CENP-A eiwitten en kwantificering van deze eiwitten in menselijke cellen aanpakken ontwikkeld. Deze methoden kunnen worden toegepast op de analyse van centromeer-kinetochore eiwitten in andere species.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Cel Cultuur en Transfectie

  1. Zet een deksel glas (22 mm x 22 mm) in een 6-well polystyreen plaat. Eventueel jas een cover glas met Poly-L-lysine, 0,1% w / v, in water (zie lijst van materialen / Equipment) tot mitotische cellen op de cover glas van de volgende stappen te houden:
    Let op: Optimale voorwaarden moeten worden bepaald voor elke cellijn en toepassing.
    1. Aseptisch laag kweekoppervlak met Poly-L-lysine, 0,1% w / v in water (0,4 ml / putje van een 6-well polystyreen platen). Rock zachtjes om zelfs coating van de cultuur oppervlak te garanderen.
    2. Na 5 minuten, verwijder oplossing door aspiratie en grondig afspoelen oppervlak met steriele weefselkweek kwaliteit water.
    3. Droge minstens 2 uur vóór de invoering van de cellen en medium.
  2. Seed HeLa-cellen 17 of HeLa Tet-Off cellen 17,22 op een cover glas (22 mm x 22 mm) in een 6-well polystyreen plaat. Controleer of de cel dichtheid is 5,4 x 10 5 per putje. kweekcellenhoog-glucose DMEM met 10% FBS en 1% penicilline-streptomycine.
    Opmerking: Voor een optimaal resultaat, empirisch bepalen van de celdichtheid om te gebruiken in zaaien.
  3. Incubeer de cellen bij 37 ° C in een atmosfeer van 5% CO2 gedurende 18 uur.
    Opmerking: Bij HeLa Tet-Off cellen, transcriptie van het exogene gen actief in afwezigheid van de inducer (bijv tetracycline / doxycycline) derhalve kweekcellen zonder tetracycline / doxycycline en transfecteren tijdelijk de pTRM4 overexpressie vector (Tabel 2 ), waarvan de transcriptie wordt geregeld door de TRE promoter (zie hieronder).
  4. Achttien uur na het uitzaaien, transfecteren cellen als volgt:
    1. Maak oplossing A door het mengen van 1,5 pl siRNA oligo (20 uM versmolten beelden; Tabel 1) en / of 2,0 ug plasmide (Tabel 2) in 50 pl verlaagde serum medium (zie lijst Materiaal / Equipment) en incubeer bij kamertemperatuur gedurende 5 min .
      Let op: In deze analyse,CA-UTR siRNA (een mengsel van 5 'en 3' UTR siRNA; Tabel 1) werden gecotransfecteerd voor gebruik in protocollen 3 en 4 (zie discussie).
    2. Maak oplossing B door het mengen van 0,75 pl transfectiereagens I (zie lijst Materiaal / Equipment) in 50 pl verminderde serum medium en incubeer bij kamertemperatuur gedurende 5 minuten.
      Opmerking: Een optionele stap is de toevoeging van 1,0 ul transfectiereagens II (zie lijst van materialen / Equipment).
    3. Mix A en B samen, en incuberen bij kamertemperatuur gedurende 15 min.
    4. Was de gekweekte cellen eenmaal met PBS en voeg 500 ul gereduceerd serum medium aan elk putje van de 6-well polystyreen platen. Voeg het mengsel van A en B (dat wil zeggen, RNA en / of DNA-lipide-complex) direct naar elk van de afzonderlijke put.
      Opmerking: Final concentratie 3,3 ug / ml (plasmide); 50 Nm (siRNA).
    5. Incubeer de cellen bij 37 ° C in een atmosfeer van 5% CO2 gedurende 4,5 uur. Verander het medium tot high-glucose DMEM with 10% FBS en 1% penicilline-streptomycine.
    6. Incubeer de cellen bij 37 ° C in een atmosfeer van 5% CO2 gedurende 48-72 uur na transfectie.
      Opmerking: Voor een optimaal resultaat moet de incubatietijd voor celgroei voordat fixatie empirisch worden bepaald, en eiwit uitputting en / of expressie moet worden bevestigd door Western blot-analyse (zie Protocol 6).
    7. Als mitose analyse plaats, voeg paclitaxel (10 nM) aan gekweekte cellen 24 uur voor fixatie, of de gekweekte cellen 2,5 uur toe TN16 (0,5 uM) voor fixatie.

2. Cell Fixatie en immunofluorescentiekleuring endogeen Centromere-kinetochoor Eiwitten Detect (paraformaldehyde Fixation)

  1. Bereiding van fixatief, buffers en reagentia.
    1. Vers bereid 50 ml 4% paraformaldehyde oplossing in PBS, pH 7,4.
      1. Voeg 40 ml van 1 x PBS om een ​​bekerglas op een roerplaat in een geventileerde afzuigkap. Hitte terwijl Stirring tot ongeveer 60 ° C. Voeg 2 g paraformaldehyde poeder aan het verwarmde PBS.
      2. Langzaam verhogen van de pH door toevoeging van 1 ml 1 N NaOH in totaal, omdat het poeder niet onmiddellijk oplossen.
        Opmerking: De oplossing verdwijnt na toevoeging van NaOH.
      3. Zodra paraformaldehyde is opgelost, cool en filteren van de oplossing.
      4. Stel de pH met 1 N HCl tot pH 7,4 en het volume van de oplossing met 1 x PBS tot 50 ml.
        Opmerking: Monsters van de oplossing kan worden ingevroren of zolang 1 week bewaard bij 2-8 ° C. De oplossing moet ijskoud of bewaard bij 4 ° C totdat het wordt gebruikt.
    2. Bereid 50 ml buffer KB1, bestaande uit 10 mM Tris-HCl, pH 7,5; 150 mM NaCl; 0,5% BSA; en 0,5% Triton X-100.
      Opmerking: BSA moet vers worden toegevoegd.
      Opmerking: De buffer KB-serie zijn gebaseerd op de buffer KB in eerdere rapporten beschreven 1,2,4.
    3. Bereid 50 ml buffer KB2, bestaande uit 10 mM Tris-HCl,pH 7,5; 150 mM NaCl; en 0,5% BSA.
      Opmerking: BSA moet vers worden toegevoegd.
    4. Bereid 1 ml buffer bevattende KB3 DAPI (50 ng / ml).
    5. Bereid 100 ml fixeermiddel, bestaande uit 1 mg / ml p-fenyleendiamine; 10% PBS, en 90% glycerol.
      1. Stel de pH van 1 x PBS tot 9,8 met 1 N NaOH, oplossen p-fenyleendiamine in de oplossing en voeg glycerol.
      2. WINKEL 1 ml porties bij -80 ° C. Beschermen tegen licht.
  2. Verwijder het kweekmedium door afzuiging op 48-72 uur na transfectie (zie Protocol 1) voor mobiele fixatie. Spoel de cellen eenmaal met PBS. Toepassen PBS aan de zijkant van de kweekputjes voorkomen het oppervlak van de cellen te verstoren.
    Opmerking: De optimale tijd voor cel fixatie moet empirisch worden bepaald.
  3. Bevestig de cellen in 4% paraformaldehyde in PBS gedurende 30 minuten bij 4 ° C. Spoel de cellen tweemaal met buffer KB2 voldoende te verwijderen resterende 4% paraformaldehyde.
  4. PermeabiLize de monsters in buffer KB1 gedurende 30 minuten bij kamertemperatuur. Spoel de cellen eenmaal met buffer KB2 en voeg buffer KB2 gedurende 5 minuten bij kamertemperatuur om extra sites blokkeren van niet-specifieke binding.
    Opmerking: Buffer KB1 ook aanzienlijk bijdraagt ​​aan blokkeren.
  5. Verwijderen van een dekking van glas (22 mm x 22 mm) van een 6-well polystyreen plaat met behulp van een tang. Met behulp van een hydrofobe barrière pen (zie lijst van materialen / Equipment), teken een lichtgroen vierkant of een cirkel om een ​​hydrofobe barrière rond elk deksel glas te vormen. Niet aanraken of te dicht bij de cellen met de hydrofobe barrière pen. Plaats het deksel glas in de nieuwe 6-well polystyreen plaat.
  6. Verdun een primair antilichaam tegen centromeer of kinetochoor eiwit (verdunningsverhouding van 1: 100 tot 1: 200; zie ook Lijst van materialen / apparatuur) en ofwel een anti-CENP-B-antilichaam (verdunningsverhouding van 1: 400) of een anti- centromeer antilichaam (ACA) (verdunningsverhouding van 1: 2000) als een centromeer locatiemarkering in buffer KB2.
    Opmerking: Voor een optimaal resultaat, de laatste Concentratie van het primaire antilichaam in deze oplossing moet empirisch worden bepaald.
  7. Breng een voldoende (ongeveer 30 ui) van de verdunde primaire antilichaam aan het celmonster dompelen. Incubeer het celmonster gedurende 1 uur bij 37 ° C. Spoel de cellen 3 maal met buffer KB2.
  8. Met bufferoplossingen KB2, verdun een fluorofoor geconjugeerd secundair antilichaam (verdunningsverhouding van 1: 100 tot 1: 200) tegen elke primaire antilichaam.
    Opmerking: Voor optimale resultaten dient de uiteindelijke concentratie van het tweede antilichaam in deze oplossing empirisch worden bepaald.
  9. Breng een voldoende (een daling van ongeveer 30 ui op de dekglas) van het verdunde secundaire antilichaam aan het celmonster dompelen. Incubeer het celmonster gedurende 1 uur bij 37 ° C. Spoel de cellen 5 maal met buffer KB2 gedurende een periode van 30 min (6 min vijf wasbeurten).
    Opmerking: Voor optimale resultaten (dwz voor minimaal verlies van cellen), moet de optimale conditie wassen bepaald empirically.
  10. Breng een voldoende hoeveelheid buffer KB3 met DAPI (50 ng / ml) aan het celmonster dompelen. Incubeer het celmonster gedurende 5 minuten bij kamertemperatuur. Spoel de cellen 1-2 keer met buffer KB2.
  11. Monteer de dekking van glas dat de cel monster op de micro dia bevat.
    1. Een druppel van montage medium in het midden van het micro dia.
    2. Verwijdert vloeistof uit het celmonster en gebruik handen of tang, plaatst het monster in het midden van het micro dia. Vermijd luchtbellen.
    3. Verwijder overtollige montage medium met een papieren handdoek.

3. Cel fixatie en immunofluorescentiekleuring van C-terminale Flag-tagged CENP-A eiwitten (Aceton Fixation)

  1. Voorbereiding
    1. Bereid ijskoude 75% aceton.
    2. Vers bereid 50 ml PBS (pH 7,4) met 0,5% magere melk en 0,5% BSA.
    3. Vers bereid 50 ml PBS (pH 7,4) met 0,1% magere melk en 0,1% BSA.
    4. Bereid 1 ml PBS (pH 7,4) met DAPI (50-100 ng / ml).
    5. Bereid 100 ml fixeermiddel zoals beschreven in 2.1.5.
  2. Verwijder het kweekmedium door afzuiging op 48-72 uur na transfectie (zie Protocol 1) voor mobiele fixatie. Spoel de cellen eenmaal met PBS. Toepassen PBS aan de zijkant van de kweek om te vermijden het oppervlak van de cellen te verstoren.
    Opmerking: De optimale tijd voor cel fixatie moet empirisch worden bepaald.
  3. Fixeer de cellen in ijskoude 75% aceton, en incubeer de cellen gedurende 10 minuten bij -20 ° C. Droge cellen op de cover glas in een zuurkast gedurende 30-60 min bij RT.
    Opmerking: Voor een optimaal resultaat moet de tijd die nodig is voor fixatie en drogen cel empirisch worden bepaald.
  4. Met behulp van de hydrofobe barrière pen (zie lijst van materialen / Equipment), teken een lichtgroen vierkant of een cirkel om een ​​hydrofobe barrière rond elk deksel glas te vormen. Niet aanraken of te dicht bij de cellen met de hydrofobe barrière pen.
  5. Block nonspecific bindingsplaatsen op de cellen door toevoeging van PBS dat 0,5% magere melk en 0,5% BSA gedurende 5 minuten bij kamertemperatuur.
  6. Gebruik PBS bevattende 0,1% magere melk en 0,1% BSA verdund anti-Flag-antilichaam (1: 1000 verdunning ratio) en ofwel een anti-CENP-B-antilichaam (verdunningsverhouding van 1: 200) of ACA (1: 2000 verdunningsverhouding ) als een centromeer locatie marker.
    Opmerking: Voor optimale resultaten dient de uiteindelijke concentratie van het primaire antilichaam in deze oplossing empirisch worden bepaald.
  7. Breng een voldoende (ongeveer 30 ui) van de verdunde primaire antilichaam aan het celmonster dompelen. Incubeer het celmonster gedurende 1 uur bij 37 ° C. Spoel de cellen 5 maal met blokkerende buffer gedurende 30 min.
    Opmerking: De cellen kunnen worden gespoeld met PBS. Voor optimale resultaten (dat wil zeggen het verlies van cellen te voorkomen), moet de optimale wasomstandigheden empirisch worden bepaald.
  8. Verdun een fluorofoor geconjugeerd secundair antilichaam (verdunningsverhouding van 1: 100 tot 1: 200) tegende elk primair antilichaam in PBS met 0,1% magere melk en 0,1% BSA.
    Opmerking: Voor optimale resultaten dient de uiteindelijke concentratie van het tweede antilichaam in deze oplossing empirisch worden bepaald.
  9. Breng een voldoende (ongeveer 30 ui) van de verdunde secundaire antilichaam aan het celmonster dompelen. Incubeer het celmonster gedurende 1 uur bij 37 ° C. Spoel de cellen 2 maal met PBS bevattende 0,1% magere melk en 0,1% BSA.
    Opmerking: PBS alleen kan ook worden gebruikt om de cellen te wassen.
  10. Breng een voldoende volume van PBS dat DAPI (50-100 ng / ml) aan het celmonster dompelen. Incubeer het celmonster gedurende 5 minuten bij kamertemperatuur. Spoel de cellen 1-2 keer met PBS.
  11. Monteer het deksel glas met de cel monster op de micro dia zoals beschreven in 2.11.

4. Cell Fixatie en immunofluorescentiekleuring van N-terminale Flag-tagged CENP-A eiwitten (Methanol Fixation)

  1. Voorbereiding
    1. Bereid ijskoude methanol.
    2. Bereid TBS (pH 7,4) bevattende 4% geit serum.
    3. Bereid 1 ml TBS (pH 7,4) met DAPI (50-100 ng / ml).
    4. Bereid 100 ml fixeermiddel zoals beschreven in 2.1.5.
  2. Verwijder het kweekmedium door afzuiging op 48-72 uur na transfectie (zie Protocol 1) voor mobiele fixatie. Spoel de cellen eenmaal met TBS. Toepassen TBS aan de zijkant van de kweekputjes voorkomen het oppervlak van cellen te verstoren.
    Opmerking: De optimale tijd voor cel fixatie moet empirisch worden bepaald.
  3. Fixeer de cellen in ijskoude methanol en incubeer de cellen gedurende 6 min bij -20 ° C. Spoel de cellen tweemaal met TBS voldoende te verwijderen resterende methanol.
  4. Met behulp van een hydrofobe barrière pen (zie lijst van materialen / Equipment), teken een lichtgroen vierkant of een cirkel om een ​​hydrofobe barrière rond elk deksel glas monster te creëren. Niet aanraken of te dicht bij de cellen met de hydrofobe barrière pen.
  5. Blok-specifieke bindingsplaatsen op de cells door toevoeging TBS bevattende 4% geit serum. Incubeer gedurende 10 minuten bij kamertemperatuur.
  6. Verdun een anti-Flag-antilichaam (1: 1000 verdunning) en ofwel een anti-CENP-B-antilichaam (verdunningsverhouding van 1: 200) of ACA (1: 2000 verdunningsverhouding) als een centromeer locatiemarkering in TBS bevattende 4% geitenserum .
    Opmerking: Voor optimale resultaten dient de uiteindelijke concentratie van het primaire antilichaam in deze oplossing empirisch worden bepaald.
  7. Breng een voldoende (ongeveer 30 ui) van de verdunde primaire antilichaam aan het celmonster dompelen. Incubeer het celmonster gedurende 1 uur bij 37 ° C. Spoel de cellen 5 maal met blokkerende buffer gedurende 30 min. Voor optimale resultaten (dat wil zeggen de minimaal verlies van cellen), moet de optimale conditie wassen empirisch worden bepaald.
  8. Verdun een fluorofoor geconjugeerd secundair antilichaam (verdunningsverhouding van 1: 100 tot 1: 200) gericht tegen elk primair antilichaam in TBS bevattende 4% geit serum.
    Opmerking: Voor een optimaal resultaat, de final concentratie van het tweede antilichaam in deze oplossing moet empirisch worden bepaald.
  9. Breng een voldoende (ongeveer 30 ui) van de verdunde secundaire antilichaam aan het celmonster dompelen. Incubeer het celmonster gedurende 1 uur bij 37 ° C. Spoel de cellen 3 maal met de blokkerende buffer.
  10. Breng een voldoende hoeveelheid TBS dat DAPI (50-100 ng / ml) aan het celmonster dompelen. Incubeer het celmonster gedurende 5 minuten bij kamertemperatuur. Spoel de cellen 1-2 keer met TBS.
  11. Monteer de dekking van glas dat de cel monster op de micro dia bevat, zoals beschreven in 2.11.

5. Immunofluorescentie Afbeelding Observation, Acquisition, Kwantificering en analyse

  1. Houd u aan de cel monster door een gemotoriseerde fluorescentiemicroscoop uitgerust met een 63x en 100x olie-immersie lens, een externe compacte lichtbron, en een digitale CCD-camera.
  2. Voer het capturen en verwerken, met inbegrip van deconvolutie, met behulp van SoftwareEen of Softwares B1 en B2 (zie lijst van materialen / Equipment). Zie Aanvullende Code Files (5.2.1) voor alle opdrachten die in Software A. Voor alle opdrachten die in Softwares B1 en B2, zie (5.2.2) in de Aanvullende Code Files.
  3. Een eerder beschreven werkwijze 23-25 ​​signalen van centromeer-kinetochoor eiwitten te kwantificeren (bijv resterende signalen CENP-A aan het centromeer) met de volgende kleine wijzigingen:
    1. Selectiegebied van de centromeer-kinetochore eiwitten en dat van de achtergrond als volgt:
      1. Mitotische cel: (centromeer-kinetochoor regio) Kies een gebied overlapt chromosomen gekleurd met DAPI; (achtergrond regio) en gebied buiten chromosomen maar binnen de identieke enkele cel (dat wil zeggen, cytosolische regio).
      2. Interphase cel: (centromeer-kinetochoor regio) Kies een gebied overlapt chromatine gekleurd met DAPI; (Achtergrond regio) en gebied buiten chromatine maar binnen de identieke enkele cel (<em> dwz cytosolische regio).
        Opmerking: zie ook Aanvullende Code Files (5.2.1.4.3) of (5.2.2.6.4) voor het gebied selectie met Software A of Software B2, respectievelijk.
    2. Kwantificeren van het percentage van de resterende signalen aan de centromeren met Software A of B. Voor deze taak, gebruikt u de volgende formule:
      Resterende signalen centromeer-kinetochoor eiwit op het centromeer-kinetochoor
      Equation1
      waarin s het helderheidssignaal van het geselecteerde gebied, hetgeen wordt bevestigd door ACA of CENP-B kleuring, b de helderheid achtergrondsignaal; r monster de referentie-ACA of CENP B-signalen voor siRNA (s) behandelde cellen; en r ctrl is de referentie ACA of CENP-B signalen voor Luc siRNA-getransfecteerde cellen.
      Opmerking: In deze analyse werden CENP-B-signalen als referentiesignalen voor CUL4A en RBX1 zoals in eerdere rapporten.
    3. Gebruik een Excel-bestand voor deze berekening na het kopiëren en plakken van de ruwe data uit het signaal kwantificering software zoals hierboven beschreven. Zie ook Aanvullende Code Files: (5.2.1.4) en (5.2.2.6) voor details. Een voorbeeld van de berekening is weergegeven in tabel 3.
  4. Analyseer ten minste 20 cellen om variatie in kleuring en beeld aanwinst voor elke meting niveau te elimineren. Eventueel gebruik "gemiddelde waarde" resterende centromeer-kinetochoor signalen voor elke geanalyseerde cel om deze waarden te vergelijken tussen verschillende centromeer-kinetochore eiwitten.

6. Western blot analyse van totaal eiwit

  1. Resuspendeer de cellen in denaturerende buffer A (20 mM Tris-HCl, pH 7,4; 50 mM NaCl; 0,5% Nonidet P-40, 0,5% deoxycholaat, 0,5% SDS, 1 mM EDTA en volledig EDTA-vrije proteaseremmer cocktail), 26 onder de schorsing van een sonicatie en vries-dooi-proces, en meteneiwitconcentraties als volgt:
    1. Voor de ultrasoonapparaat proces, voeg 50 ul van buffer A om de verzamelde twee putjes van een 6-well polystyreen plaat bij 48-72 uur na transfectie cellen (zie Protocol 1). Exploiteren van een ultrasoonapparaat voorzien verstoorder hoorn en micropunt (zie lijst van materialen / apparatuur) voor in totaal 15 sec intermitterende-pulsduur (duty cycle 50%) per één monster.
    2. Voor bevriezen en ontdooien proces bevriezen cellen met vloeibare stikstof en ontdooien cellen bij kamertemperatuur.
    3. Meet eiwitconcentraties met behulp van een commercieel proteïne testreagens I of II (zie lijst van materialen / Equipment).
      Noot: Lysaten worden verdund met een verhouding van 01:10 in de meting van eiwitconcentraties met hetzij reagens I of II. Bij deze verdunning, de SDS aanwezig in buffer A weinig of geen interferentie in deze meting.
  2. Meng het lysaat met 20-30 ug totaal eiwit met 2 x of 4 x SDS-PAGE laadbuffer. 27 Kook de monsters5 min en plaats ze op een 12,0% -15,0% denaturerende SDS-polyacrylamidegel voor elektroforese.
  3. Breng de eiwitten gescheiden door SDS-PAGE op een PVDF membraan door Western blotting onder toepassing van een eerder beschreven werkwijze. 17,24,27-31
    1. Blokkeert de niet-specifieke bindingsplaatsen op het membraan met 5% vetvrije melk in 1 x PBS, en vervolgens incuberen van de membraan met oplossingen van verdunde primaire antilichamen gedurende 1 uur bij KT. Zie lijst van materialen / Apparatuur voor gedetailleerde informatie (bv verdunning ratio) van elke primaire antilichaam.
    2. Na wassen van het membraan 3-4 maal (elke 3 tot 5 minuten incubatie met schudden) met PBS-T buffer (1 x PBS en 0,1% Tween-20), incubeer het membraan in een mengsel van nabij-infrarood (IR) fluorescerende kleurstof-geconjugeerde secundaire antilichamen (verdunningsverhouding van 1: 20.000), DyLight-geconjugeerde secundaire antilichamen (verdunningsverhouding van 1: 20.000) en / of mierikswortelperoxidase (HRP) geconjugeerde secundaire antilichamen (verdund in PBS-T; dilutibetreffende verhouding van 1: 10.000) gedurende 1 uur bij KT. Zie lijst van materialen / Apparatuur voor gedetailleerde informatie (bv verdunning ratio) van elke secundaire antilichaam.
  4. Was het membraan 3 maal, en vervolgens scant het membraan naar de eiwitten met de infrarood-imaging systeem en / of de chemiluminescentie imager voor immunoblot detectie te analyseren (zie lijst van materialen / Equipment).
    1. Voor het gebruik van de infrarood-imaging systeem, zie (6.4.1) in de Aanvullende Code Files.
    2. Voor het gebruik van de chemiluminescentie imager, zie (6.4.2) in de Aanvullende Code Files. Gebruik een ultragevoelige verbeterde chemiluminescentie (ECL) substraat (zie lijst van materialen / apparatuur) voor dit systeem.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Immunofluorescentie analyse van endogene CENP-A ondersteunt de hypothese dat CUL4A-E3 ligase nodig voor het lokaliseren van CENP-A centromeren
Onze recente studies is gebleken dat CUL4A-RBX1-COPS8 E3 ligase activiteit is vereist voor ubiquitinering van lysine 124 (K124) op CENP-A en lokalisatie van CENP-A centromeren. 17 Aanvankelijk interfase-centromeer complex (Icen) werd geïsoleerd door anti-CENP-a: natieve chromatine immunoprecipitatie, 32-34 en wordt geopperd dat sommige Icen eiwitten een rol bij het ​​lokaliseren CENP-a centromeren kunnen spelen. Daarom werden siRNA knockdown experimenten uitgevoerd om te screenen op eiwitten waarvan de afwezigheid van expressie induceerde de delocalisatie van CENP-A in centromeren 17 (gegevens niet getoond): asynchroon groeiende HeLa cellen werden getransfecteerd met Cullin 4A (CUL4A) siRNA of RBX1 siRNA voor tijden vereist voor optimale eiwit depletie (48 hr CUL4A en 72 uur voor RBX1). Cellen getransfecteerd met siRNA CUL4A vertoonden een significante delocalisatie van CENP-A in centromeren (Figuur 1 A-C). Zoals blijkt uit figuur 2G, de eiwitniveaus van CENP-A in totaal cellysaten van CUL4A siRNA getransfecteerde cellen waren vergelijkbaar met CENP-A niveaus in lysaten van luciferase (Luc)-siRNA getransfecteerde cellen onder dezelfde kweekomstandigheden. De mogelijkheid van off-target effecten van CUL4A siRNA werd uitgesloten omdat ectopische expressie van CUL4A-Flag de reductie van CENP-A bij centromeren gered toen CUL4A siRNA gericht op de 3 'UTR (Figuur 2A-C). De eiwitniveaus van CENP-A in totaal cellysaten werden bevestigd Soortgelijke CENP-A niveaus in lysaten van Luc-siRNA getransfecteerde cellen onder dezelfde kweekomstandigheden ongeacht de celcyclus stadium (figuren 1B, 2G) zijn; dus de mogelijkheid dat CUL4A depletie veroorzaakte CENP-A proteïne degradatie geëlimineerd.

35 en bevat 3 belangrijke elementen: een Cullin steiger, een RING-vinger eiwit (RBX1 of RBX2) en een ubiquitine geladen E2 enzym dat recruteert RBX1 of RBX2, 36 a RING-vinger eiwit rekruteert een substraat adapter substraten plaatsen nabij de E2 enzym om ubiquitine te vergemakkelijken. 36 RBX1 siRNAs induceerde een significante afname van CENP-A in centromeren (figuur 1D-F) onder de omstandigheden waarin de eiwit niveaus van CENP-A in totaal cellysaten van RBX1-siRNA getransfecteerde cellen waren vergelijkbaar met CENP-A niveaus in lysaten van Luc siRNA getransfecteerde cellen (fig 2G). Afbraak van CENP-A proteïne hetzij RBX1 depletie of de combinatie van CUL4A en RBX1 depletie onder dezelfde kweekomstandigheden werd niet waargenomen (figuur 2G). De mogelijkheid van off-target effects van RBX1 siRNA werd uitgesloten omdat ectopische expressie van Flag-RBX1 vermindering van CENP-A in centromeren geredde wanneer RBX1 siRNA gericht op de 3 'UTR (figuur 2D-F). Deze bevindingen suggereerden dat CUL4A-RBX1-E3 ligase specifiek voor de lokalisatie van CENP-A centromeren vereist.

Immunofluorescentie analyse van exogeen CENP-A - eiwitten vlag aangeeft dat CENP-A K124 ubiquitinering is essentieel voor het lokaliseren van CENP-A centromeren
Voorheen onze immunoprecipitatie-massaspectrometrie analyse toonde aan dat lysine 124 (K124) van CENP-A-vlag is ubiquitylated in HeLa-cellen. 17 In de kristalstructuur van de CENP-A nucleosoom, K124 ligt in het α3 helix, hoewel de site niet binnen de regio CATD. 17 Bovendien wordt K124 geconserveerd onder zoogdieren, vogels, hagedissen, planten, en een groep van schimmels (bijvoorbeeld knopding gist). 17 CENP-A lysine mutanten (figuur 3A) werden gebouwd en getest hun vermogen om te lokaliseren om het centromeer. Substantiële beëindiging van de centromerische lokalisatie van exogeen CENP-A K124R mutant met diffuse signalen in zowel de mitose en HeLa-cellen werd waargenomen (Figuur 3B, C). Centromeer lokalisatie werd niet significant beïnvloed noch door K9A mutaties (K9 overeenkomt met histon H3 K9 methylatie) of mutaties K77R (K77 is een uniek lysine site in CATD) (Figuur 3B, C).

Op basis van deze resultaten zijn twee hypothesen voorgesteld met betrekking tot de in vivo functie van CENP-A ubiquitinering van K124. Ten eerste, de rol van K124 ubiquitinering is voor ubiquitine afhankelijke proteolyse overexpressie en / of mislocalized CENP-A elimineren euchromatin. Ten tweede, de rol van CENP-A ubiquitinering op K124 is voor het laden CENP-A op centromeren. Om de F-toetsirst mogelijkheid, de stabiliteiten van CENP-A-Flag wild-type en de K124R mutant evenals endogene CENP-A na cycloheximide (CHX) behandeling van CUL4A- of-RBX1 uitgeputte cellen werden aangepakt. Deze gegevens suggereerden dat ubiquitinering van K124 is waarschijnlijk niet betrokken bij ubiquitine afhankelijke proteolyse overexpressie en / of mislocalized CENP-A elimineren (gegevens niet getoond). 17. Bovendien werd bevestigd dat de K124R mutatie heft vermeende monoubiquitylation en diubiquitylation bands, zowel in vivo als in vitro ubiquitinering testen (gegevens niet getoond). 17 Gezamenlijk suggereren deze gegevens dat de CUL4A-RBX1 complex draagt ​​bij tot "signalering" ubiquitinering, die nodig is voor CENP-A lokalisatie in centromeren.

Immunofluorescentie analyse van exogene Flag - CENP-A eiwitten geeft aan dat monoubiquitin fusie voldoende is om te ladenCENP-A K124R in centromeren
Op basis van de bovenstaande resultaten werd de hypothese dat covalent gebonden monoubiquitin dient als een signaal voor CENP-A laden op centromeren. Om deze hypothese, een N-terminale Flag-tag en C-terminale ubiquitine gefuseerd wildtype CENP-A en K124R mutant CENP-A werd geconstrueerd (Figuur 4A) testen. De monoubiquitin mutant Ub (K48R), die een belangrijke plaats voor polyubiquitylation 37-39 mist werd ook gebruikt om te voorkomen ubiquitine gefuseerd CENP-Eiwit van potentiële polyubiquitylation. Door het vastleggen van anti-Flag immunofluorescentie signalen, de centromere lokalisatie van eiwitten waarvoor deze constructen werd getest. Overwegende dat de vlag-CENP-A (K124) in hoofdzaak ingetrokken centromeer lokalisatie van CENP-A (figuur 4B en 4C, kolom [6]), zowel vlag-CENP-A (WT) en de Vlag-CENP-A (WT) -UB ( WT) handhaafden hun centromeer lokalisatie (figuur 4B en 4C, kolommen [1] en [2]). DeFlag-CENP-A (K124R) -UB (K48R) eiwit vermoedelijk nagebootst monoubiquitylated CENP-A, aangezien dit eiwit in hoofdzaak hersteld lokalisatie centromeren (Figuur 4C, vergelijk kolommen [5] en [6]) efficiënter dan wel CENP-A (K124R) -UB (WT) (Figuur 4C, vergelijk kolommen [4] - [6]). Deze gegevens laten zien dat monoubiquitylation voldoende is voor de aanwerving van CENP-A naar centromeres.

Figuur 1
Figuur 1. Immunofluorescentie analyse van endogene CENP-A ondersteunt de hypothese dat CUL4A-E3 ligase nodig voor het lokaliseren van CENP-A centromeren (figuren zijn overgenomen van Niikura et al. 17). (A) CUL4A siRNA veroorzaakte delocalisatie van CENP-A bij centromeren. HeLa cellen werden getransfecteerd met CUL4A of luciferase (Luc) siRNA en gedurende 48 uur (Tabel 1). Schaalbalk vertegenwoordigt 10 urn. (B) Western blot analyse van HeLa lysaten van gehele cellen met hetzelfde kweekomstandigheid als in (A). Cellen werden geoogst 48 uur na transfectie met siRNA CUL4A of Luc siRNA (tabel 1). GAPDH diende als beladingscontrole. (C) gekwantificeerde endogene CENP-A signalen bij centromeren getoond in (A). Normalisatie van signalen werd uitgevoerd door Luc siRNA getransfecteerde cellen en de gemiddelde percentages (± SD) getoond. **** P <0,0001 vs Luc siRNA getransfecteerde cellen (t-toets). (D) RBX1 siRNA veroorzaakte delocalisatie van CENP-A van centromeren. HeLa cellen werden getransfecteerd met siRNA RBX1 of Luc (s) en gedurende 72 uur (Tabel 1). Schaalbalk vertegenwoordigt 10 urn. (E) Western blot analyse van HeLa lysaten van gehele cellen met hetzelfde kweekomstandigheid als in (D). Cellen werden geoogst 72 uur na transfectie met RBX1 or Luc siRNA (s) (tabel 1). GAPDH diende als beladingscontrole. (F) gekwantificeerde endogene CENP-A signalen bij centromeren getoond in (D). Normalisatie van signalen werd uitgevoerd door Luc siRNA getransfecteerde cellen en de gemiddelde percentages (± SD) getoond. **** P <0.0001 vs Luc siRNA-getransfecteerde cellen (t-toets). Klik hier om een grotere versie van deze figuur te bekijken.

figuur 2
Figuur 2. Aanvullende informatie met betrekking tot Figuur 1 centromeren (cijfers werden aangepast van Niikura et al. 17). (A) exogeen CUL4A-Flag redde de delocalisatie van CENP-A wanneer CUL4A siRNA gericht op de 3 'UTR. HeLa Tet-Off cells vastgesteld op 48 uur na cotransfectie met siRNA (CUL4A # 2: 3 'UTR prisma- of Luc; Tabel 1) plus het plasmide construct (pTRM4-CUL4A-vlag of vector; Tabel 2). 4-kleuren immunokleuring: kleuring voor DAPI (blauw); Vlag; endogene CENP-B (rood); en endogene CENP-A (groen), werd uitgevoerd en de Vlag-positieve cellen werden gesorteerd, maar Vlag beelden worden weggelaten voor de eenvoud. Opmerking: CUL4A # 2 is hetzelfde doel als getoond in Figuur 1A-C. Schaalbalk vertegenwoordigt 10 urn. (B) Western blot analyse van HeLa Tet-Off gehele cellysaten volgens dezelfde kweekomstandigheid zoals in (A). GAPDH diende als beladingscontrole. (C) CENP-A signalen bij centromeren getoond in (A) werden gekwantificeerd door microscopie na het sorteren van cellen die gebonden zijn anti-Flag-antilichaam te isoleren. Normalisering signalen werd uitgevoerd met cellen getransfecteerd met siRNA Luc plus vector en de gemiddelde percentages (± SD) getoond.**** P <0,0001 versus cellen getransfecteerd met siRNA plus Luc vector (linkerkolom, t-toets). (D) exogeen Flag-RBX1 redde de delocalisatie van CENP-A aan het centromeer wanneer RBX1 siRNA gericht op de 3 'UTR . HeLa cellen werden gefixeerd op 72 uur na cotransfectie met siRNA (RBX1 # 2: 3 'UTR prisma- of Luc; Tabel 1) plus het plasmide construct (pcDNA3-Flag-vector of RBX1; Tabel 2). 4-kleuren immunokleuring: kleuring voor DAPI (blauw); Vlag; endogene CENP-B (rood); en endogene CENP-A (groen), werd uitgevoerd en de Vlag-positieve cellen werden gesorteerd, maar Vlag beelden worden weggelaten voor de eenvoud. Schaalbalk vertegenwoordigt 10 urn. (E) Western blot analyse van HeLa lysaten van gehele cellen volgens dezelfde kweekomstandigheid als in (D). GAPDH diende als beladingscontrole. (F) CENP-A signalen bij centromeren getoond in (D) werden gekwantificeerd door microscopie na het sorteren van cellen die gebonden is door een isoleren n anti-Flag antilichaam. Normalisering signalen werd uitgevoerd met cellen getransfecteerd met siRNA Luc plus vector en de gemiddelde percentages (± SD) getoond. **** P <0,0001 versus cellen getransfecteerd met siRNA plus Luc vector (linkerkolom, t-toets). (G) Uitputting van CUL4A en RBX1 geen invloed niveaus van endogeen CENP-A eiwit. Niveaus van endogene CENP-A eiwit werden gemeten in HeLa hele cellysaten geoogst 72 uur na transfectie met CUL4A, RBX1, CUL4A plus RBX1 of Luc siRNA. Achtenveertig uur na transfectie werden cellen ofwel onbehandeld (Asyn) of behandeld met paclitaxel (+ BTW) arrestatie in mitose te induceren en ze werden gedurende 24 uur. GAPDH diende als een laad controle. Klik hier om een grotere versie van deze figuur te bekijken.

32 / 53732fig3highres.jpg "width =" 700 "/>
Figuur 3. Immunofluorescentie analyse van exogeen CENP-A-vlag eiwitten aangegeven dat CENP-A K124 ubiquitinering is vereist voor CENP-A lokalisatie in centromeren (Cijfers zijn overgenomen van Niikura et al. 17). (A) Overexpressie van CENP-A- vlag constructen (WT en mutanten KR) werd bevestigd door Western blot analyse van HeLa Tet-Off gehele cellysaten. Cellen werden geoogst 48 uur na transfectie met pTRM4-CENP-A-vlag WT, KR mutanten of pTRM4 vector (Tabel 2). Overexpressie van CENP-A-vlag werd gedetecteerd door een anti-Flag-antilichaam. GAPDH diende als een laad controle. Vermeende CENP-A-vlag dimeer (##) en CENP-A-vlag monomeer (#) getoond. Opmerking: SDS-resistant CENP-A dimeren zijn eerder beschreven 40,41 (B) De CENP-A K124R mutant toonde gediffundeerd delocalisatie van centromeren.. Signalen van DAPI (blauw), de Vlag (green) en endogene CENP-B (rood, een centromeer locatiebeheer) getoond. Opmerking: In tegenstelling tot endogeen CENP-A in cellen getransfecteerd met CUL4A of RBX1 siRNA verscheen diffuse signalen in cellen die exogeen CENP-A K124R-vlag overexpressie een fenotype van het onvermogen om te worden gericht op centromeren, vermoedelijk omdat het expressieniveau ongeveer 10 - tot 25-maal hoger dan endogeen CENP-A (gegevens niet getoond) 17 Schalingsbalk geeft 10 pm (C) Histogrammen van de lokalisatie patronen getoond in (B)... Meer dan 50 pro / prometaphase en metafasecellen en meer dan 200 interfase cellen per experiment werden geteld (n ≥ 3 experimenten). De gemiddelde percentages (± SD) getoond. "Anderen (Non-centromeer)" duidt meestal beschadigde cellen, dode cellen of cellen met nucleolair lokalisatie (alleen in interfase), waarschijnlijk vanwege transfectie of andere behandelingen. *** P <0,001 vs CENP-A WT-Flag (t-toets).

figuur 4
Figuur 4. Immunofluorescentie analyse van exogeen vlag-CENP-A eiwitten gaf aan dat CENP-A monoubiquitin fusie gered delokalisatie van de CENP-A K124R mutant van centromeren (cijfers werden aangepast van Niikura et al. 17). (A) Schematische prenten van elk construct gebruikt in deze studie (zie ook tabel 2). De K124R mutatie plaats op CENP-A (rood) en de K48R mutatie site op monoubiquitin (blauw) getoond. (1) WT: Vlag-CENP-A WT, (2) WT-Ub (WT): De vlag-CENP-A WT-Ub (WT), (3) WT-Ub (K48R): De vlag-CENP-A WT -UB (K48R), (4) K124R-Ub (WT): De vlag-CENP-A K124R-Ub (WT), (5) K124R-Ub (K48R): De vlag-CENP-A K124R-Ub (K48R), (6) K124R: Vlag-CENP-A K124R (B) exogeen CENP-A monoubiquitin fusie gered delokalisatie van de CENP-A K124R mutant van centromeren.. DAPI (blauw), de Vlag (groen), en endogene CENP-B (rood; een centromeer locatie controle) getoond. Schaalbalk vertegenwoordigt 10 urn. (C) Histogrammen van de lokalisatie patronen getoond in (C). Meer dan 50 pro / prometaphase en metafasecellen en meer dan 200 interfase cellen per experiment werden geteld (n ≥ 3 experimenten). De gemiddelde percentages (± SD) getoond. **** P <0,0001 en *** P <0,001 versus niet-gefuseerde vlag-CENP-A K124R (kolom [6]) (t-toets). Klik hier om een grotere versie van deze figuur te bekijken.

siRNA doel Vermelding in de huidige studie Target soort siRNA-database nummer Forward sequentie (s) Bron / Reference
Luciferase (GL3) - 1 doel RKK9 CUUACGCUGAGUACUUCGAdTdT Elbashir et al., (2001)
CENP-A CA-UTR siRNA zwembad (2 targets mengsel) RKK375 / 5 'UTR t1 CGAGCGGCGCGGACUUCUGCCdTdT Niikura et al., (2015)
RKK383 / 3 'UTR t1 UCCUGCACCCAGUGUUUCUGUdGdT Niikura et al., (2015)
CUL4A # 1 1 doel CRKK178 / RKK309 / T1 AGCGAUCGUAAUCAAUCCUGA Niikura et al., (2015)
# 2 (3'UTR) 1 doel CRKK181 / RKK331 / T4 AUGCGGGUUUGAAAUAUGACA Niikura et al., (2015)
RBX1 / ROC1 # 1 siRNA zwembad (4 targets mengsel) CRKK198 / RKK411 / T1 GAAGCGCUUUGAAGUGAAA Niikura et al., (2015)
CRKK198 / RKK413 / T2 GCAUAGAAUGUCAAGCUAA Niikura et al., (2015)
CRKK198 / RKK415 / T3 GCAAGAAGCGCUUUGAAGU Niikura et al., (2015)
CRKK198 / RKK417 / T4 CAACAGAGAGUGGGAAUUC Niikura et al., (2015)
# 2 (3 'UTR) 1 doel CRKK206 / RKK425 / t8 UUCCCUGCUGUUACCUAAUUA Niikura et al., (2015)

Tabel 1. siRNA sequenties die in deze studie.

B nummer Relevante eigenschap (pen) Bron / Reference
B288 pTRM4 Niikura et al., (2006)
B2067 pTRM4-menselijke CENP-A-Flag Niikura et al., (2015)
B2281 pTRM4-menselijke CENP-A K9A-Flag Niikura et al., (2015)
B2387 pTRM4-menselijke CENP-A K77R-Flag Niikura et al., (2015)
B2388 pTRM4-human CENP-A K124R-Flag Niikura et al., (2015)
B2512 pTRM4-Flag-menselijke CENP-A Niikura et al., (2015)
B2579 pTRM4-Flag-menselijke CENP-A K124R Niikura et al., (2015)
B2513 pTRM4-Flag-menselijke CENP-A-Ub (WT) Niikura et al., (2015)
B2559 pTRM4-Flag-menselijke CENP-A K124R-Ub (WT) Niikura et al., (2015)
B2515 pTRM4-Flag-menselijke CENP-A-Ub (K48R) Niikura et al., (2015)
B2560 pTRM4-Flag-menselijke CENP-A K124R-Ub (K48R) Niikura et al., (2015)
B2759 pTRM4-menselijke CUL4A-Flag Niikura et al., (2015)
B2624 pcDNA3-vlag-menselijke RBX1 Niikuraet al., (2015)
B1491 pcDNA3-Flag Niikura et al., (2015)

Tabel 2. Plasmide vectoren die in deze studie.

R (anti-CENP-B) monster b (anti-CENP-B) R monster (afgetrokken) Ratio (S sample: R monster) Gecorrigeerd Ratio (S sample: R monster)
520 514 6 -4,167 0.000
535 445 90 -1,033 0.000
515 431 84 0.274 0.274
562 483 79 0,506 0,506
902 562 340 0,509 0,509
1203 703 500 -0,560 0.000
1014 589 425 -0,819 0.000
768 510 258 -1,345 0.000
555 458 97 -1,845 0.000
781 576 205 -1,146 0.000
556 436 120 0,758 0,758
534 493 41 -1,634 0.000
702 543 159 0,667 0,667
482 429 53 -1,000 0.000 654 531 123 0.740 0.740
1190 607 583 0,384 0,384
552 454 98 0,969 0,969
489 413 76 0,539 0,539
511 452 59 -3,186 0.000
485 475 10 -2,700 0.000
481 441 40 -1,475 0.000
Som 5,347
Gemiddelde 0,255
R (anti-CENP-B) ctrl b (anti-CENP-B) Ratio (S ctrl: R ctrl) Gecorrigeerd Ratio (S ctrl: R ctrl)
543 483 60 3,017 3,017
526 466 60 2.667 2.667
532 460 72 1.792 1.792
507 457 50 3.520 3.520
491 458 33 4,273 4,273
545 464 81 2.160 2.160
518 484 34 3,559 3,559
461 404 57 2,404 2,404
487 447 40 3.550 3.550
534 477 57 3,965 3,965
528 456 72 3,097 3,097
707 601 106 1,868 1,868
615 528 87 2,828 2,828
660 481 179 1.620 1.620
565 476 89 1,607 1,607
527 455 72 3,583 3,583
560 474 86 2.930 2.930
510 451 59 4,017 4,017
729 586 143 2,678 2,678
634 576 58 3,655 3,655
507 476 31 3,935 3,935
Som 62,725
Gemiddelde 2,987
Resterende CENP-A signalen centromeer (%) 8.5

. Tabel 3. Een voorbeeld van de berekening van de resterende CENP-A signalen bij het ​​centromeer (%) Een voorbeeld van Pro / prometaphase in figuur 2F wordt getoond: het monster is RBX1 # 2 (3'UTR) + Vec (middelste kolom in figuur 2F ) en de controle is Luc + Vec (linkerkolom in figuur 2F). Hierdoor blijft CENP-A signalen bijcentromeer (%) = (0,255 / 2,987) x 100 = 8,5% wordt verkregen (of [5,347 / 62,725] x 100 = 8,5% met dezelfde totale celaantal [dwz 21 cellen] gesplitst in twee monsters). Merk op dat als b waarde meer dan S waarde (dwz als afgetrokken waarde negatief), gecorrigeerde verhouding wordt ingesteld op 0,00.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

De laatste jaren zijn veel studies verschillende kwantitatieve microscopie assays ontwikkeld voor gefixeerde cellen. 42 Progress in centromeer-kinetochoor biologie vereist vaak een begrip van de centromeer-specifieke of kinetochoor specifieke functie van eiwitten waarvan subcellulaire ruimtelijk-temporele regulering weerspiegelt de veranderende functies deze eiwitten tijdens celcyclus. Daarom hier ontwikkelden wij werkwijzen IIF kleuring en een kwantitatieve bepaling om IIF specifiek wat de relatieve niveaus van endogene en exogene CENP-A eiwitten, die anders behandelde monsters toepassing kan zijn. Op dit moment realiseerden we succesvol IIF kleuring van endogene CENP-I, CENP-H, KNL1, Hec1 en Ska1 behulp van Protocol 2 in dit onderzoek (zie Niikura et al 24 en data niet getoond;. Lijst van materialen / Apparatuur voor de informatie van antilichamen) . In de toekomst kan men dezelfde methode toegepast om het niveau van verschillende centromeer-kinetochoor eiwit gekwantificeerd (beide endogEnous en Flag-tagged exogene eiwitten) het kiezen van de specifieke antilichamen, maar onze IIF methoden hebben geen betrekking op de detectie van deze eiwitten in levende cellen of in een specifieke enkele cel gedurende hele celcyclus. Omdat deze procedures moeten cellen worden vastgesteld en verwerkt afzonderlijke dekglaasjes introduceerden we referentiesignalen (bijvoorbeeld ACA of CENP-B) ten behoeve van normalisatie om vrij signalen tussen verschillende monsters te vergelijken en verhogen de nauwkeurigheid van de test. Omdat ACA omvatten endogene en / of exogene CENP-A signalen, CENP-B als een referentiesignaal ten behoeve van normalisering geschikter zou zijn dan zou ACA vergelijking wat betreft de nauwkeurigheid van de kwantitatieve bepaling van CENP-A signalen. De aminoterminale regio CENP-B bindt aan het 17-bp motief van de CENP B-box sequentie in alphoid DNA en het carboxy-terminale gebied van CENP-B vormt homodimeren. 43,44 CENP-B niet volledig colocaliseren met CENP-A en / of andere centromere-kinetochore eiwitten, echter, is nauw gekoppeld. 45 Terwijl immunofluorescentie met anti-CENP-C antilichamen geeft typisch twee discrete plaatsen, kleuring met anti-CENP-B verschijnt vaak als een enkele heldere verbindingsstaaf beide zuster centromeren. 46 Echter in onze macroschaal microscopische observatie, wat CENP-B-signalen kennelijk overlappen CENP-A signalen, vooral bij oudere mitotische stadia (profase-prometafase dan laat metafase), ook deels afhankelijk van de waarnemingen hoek en het type fixatief (gegevens niet getoond). In tegenstelling, in een kwantitatieve IIF bepaling van CENP-A signalen, eiwit lokalisatie referentiesignalen mag niet worden beïnvloed door uitputting en / of disfunctie van CENP-A onpartijdige analyse, hoewel de lokalisatie van de meeste centromeer-kinetochore eiwitten afhankelijk CENP-A lokalisatie in centromeren. 47,48 CENP-A-onafhankelijke kinetochoor samenstel wordt vastgesteld door het vervangen van het DNA-bindende gebieden van CENPC en CENP-T met alternatieve chromosoom targeting domeinen die deze eiwitten rekruteren ectopische loci. 49,50 Bovendien recent werk aangetoond dat het binnenste kinetochoor componenten CENP-C en CENP T-act parallel aan de KMN netwerk werven kinetochoren. 51-54 Verder Nishino et al. gesuggereerd dat de CENP-TWSX complex vormt een unieke nucleosoom-achtige structuur om de contacten met DNA te genereren, de uitbreiding van de 'histon code' voorbij canonieke nucleosomen eiwitten. 55 Omdat de centromere lokalisatie van CENP- C is afhankelijk van de lokalisatie van centromere CENP-a kon 47,48 CENP-TWSX of in het bijzonder CENP-V kandidaat ander eiwit (en) referentiesignalen voorzien in een kwantitatieve bepaling van IIF CENP-a. Toch moet de kandidaat referentie signalering zorgvuldig worden getest voor de test te bepalen of lokalisatie in centromeren wordt beïnvloed door uitputting en / of disfunctie van CENP-A. analoog overwegingmoeten worden genomen voor de kwantitatieve IIF bepaling van andere centromeer-kinetochoor eiwitten: lokalisatie van referentiesignalen mag niet worden beïnvloed door uitputting en / of disfunctie van het doelwit eiwit voor eerlijke analyse. In eerder onderzoek gebruikten we ACA als een referentiesignaal voor de kwantitatieve IIF bepaling van andere centrale-outer kinetochore eiwitten. 24 ACA kan een geschikte optie dan één CENP-B als een positieregeling en een referentiesignaal, indien zijn ACA signalen worden niet beïnvloed door uitputting en / of storing van het doelwiteiwit maar colokalisatie van het doeleiwit met CENP-B slecht zoals hierboven vermeld.

Bodor et al. gemeld dat centromere CENP-A niveaus worden gereguleerd door massa-actie, namelijk, de hoeveelheid centromere CENP-A varieert rechtevenredig aan de cellulaire inhoud. 56 Tevens bleken tijdelijke inductie van CENP-A expressie leidt tot een snelle toename van de centromere CENP-A niveau. Omgekeerd zagen we een grote celpopulatie centromeer gelokaliseerd, Flag-tag CENP-A WT na cotransfectie van de pTRM4 expressievector met CA-UTR siRNA (een mengsel van 5 'en 3' UTR siRNA; Tabel 1) (gegevens niet getoond); deze populatie was groter dan die waargenomen na transfectie met alleen het pTRM4 expressievector. Het niveau van exogeen Flag-tagged CENP-A proteïne waarvan de expressie werd gedreven door pTRM4, ongeveer 1,0 tot 1,4 grootteordes (10- tot 25-voudig) hoger dan dat van endogeen CENP-A (gegevens niet getoond). Er wordt gespeculeerd dat expressie van exogeen CENP-A WT boven een bepaalde drempel nadelig kunnen beïnvloeden zijn juiste centromerische lokalisatie.

In de onderhavige protocollen fixatie is een belangrijke stap om celstructuur en milieu handhaven proximale situatie mogelijk bij de natieve toestand. Zodra cellen gefixeerd, moet men overgaan tot de kleuringsprotocol verlies van het eiwit van inte voorkomenrusten of de rest van de cel. Echter, fixatie vernietigt antigene plaatsen af en verschillende antilichaam-antigeen combinaties werken slecht met een fixatief, maar zeer goed met elkaar. 21 Vanwege deze variatie de keuze fixeermiddel hangt grotendeels af van de eiwit (ten) van belang. De tijdsduur van de fixatie kan significante invloed op de detectie van het eiwit (ten) van immunokleuring en kortere fixatie algemeen beter antigeniteit behouden. 57 Wanneer derhalve bepalen kleuringen voor een nieuwe doelstelling andere centromeer-kinetochore eiwitten, in het bijzonder van onzekere lokalisatie, of bij het werken met een nieuw antilichaam, moet men verschillende methoden van fixatie en buffers testen voor de optimale condities te vinden. In dit protocol werden twee klassen van populaire fixatieven geselecteerd: aldehyde fixeermiddelen (protocol 2) en organische oplosmiddelen (Protocollen 3 en 4). De zuiverheid van de fixeermiddelen is ook zeer belangrijk. In Protocol 4, wordt 4% geit serum gebruikt especially IgG receptoren op het celoppervlak blokkeren algemeen niet-specifieke achtergrond te verminderen. 57, het serum voor het blokkeren van IgG receptoren moet worden van een species die niets met het primaire antilichaam en bij voorkeur van dezelfde soort als het secundaire antilichaam. 57

In elk van deze protocollen, de keuze van primair antilichaam de meest cruciale stap in het bereiken van succesvolle immunokleuring. Het antilichaam met de grootste specificiteit, zuiverheid, affiniteit en aviditeit wordt gewenst. Een goede uitgangsconcentratie van monoklonale antilichamen is gewoonlijk 1-5 ug / ml. Typische verdunningen van de voorraadoplossing bereiden van polyklonale antilichamen varieert van 1:20 tot 1:. 500 57 Men moet empirisch bepalen van de juiste concentratie van het primaire antilichaam en het verdunningsmiddel voor elk monster. De monsters moeten voorzichtig worden geschud, maar niet tijdens de incubatie voor homogene kleuring gedroogd. Uitvoerig wassen tussen de incubatie van primaire en secundaire antilichaam eenntibody kan nodig zijn om kruisreactie met immunoglobulinen van andere species voorkomen. Wel moet de optimale wassen conditie empirisch worden bepaald om het verlies van cellen, met name mitotische cellen die ronden en verwijderen, wanneer geschud (bijvoorbeeld, mitotische shake-off). 58 Voor succes moet voor een secundair antilichaam gekozen binden aan het primaire antilichaam met een hoge affiniteit. Bijvoorbeeld, niet-specifieke binding van het Fc-gedeelte van het secundaire antilichaam IgG Fc-receptoren te voorkomen, Fb (ab ') 2-fragmenten kunnen worden gebruikt in plaats van het gehele antilichaam. 57 voor vele secundaire antilichamen kunnen incubatietijd worden geminimaliseerd in 30 min bij KT het verminderen van de niet-specifieke achtergrond.

Naast Protocol 5, kan laser-scanning confocale microscopie van voordeel bij het detecteren en analyseren van de lokalisatie en de functie van centromeer-kinetochore eiwitten met fluorescerende eigenschappen zijn. Zoals blijkt uit de lijst van materialen / Equipment, Alexa Fluor 488 en Alexa Fluor 594 zijn waarschijnlijk de meest gebruikte fluorescerende kleurstoffen in de onderhavige protocollen. Tot twee en / of meerdere verschillende centromeer-kinetochore eiwitten in het monster te detecteren, moet men ervoor zorgen dat de wijze van een eiwit detecteren antilichamen niet de detectie van de tweede eiwit voorkomen. 57 In de onderhavige protocollen zijn twee primaire antilichamen gemengd en toegepast tegelijkertijd. Echter, men moet de immunokleuring voorwaarden voor elk eiwit optimaliseren afzonderlijk voor elkaar aanbrengen van de primaire of secundaire antilichamen: als de twee eiwitten in de nabijheid zoals in het geval van twee centromeer-kinetochore componenten, kan een primair antilichaam de binding van het structureel voorkomen tweede primaire antilichaam. Een andere zorg van meerdere signaaldetectie het probleem van spectrale overlap: de moeilijkheid bij het voorkomen signaal van een kleurstof "lekken" in de spectrale kanaal van een ander. Dit probleem wordt moeilijker conventieal interferentiefilter bevat te lossen als het aantal kleurstoffen toeneemt of wanneer het monster overenhanced signalen (bijvoorbeeld ACA of anti-Flag signalen in deze studie), inclusief de interferentie van autofluorescentie. Oplossen van autofluorescentie is uitgevoerd in andere studies. 57,59,60 In deze studie optimaliseren fluorescent filter sets met enkelvoudige label controles in elk kanaal volstaat meestal om deze problemen (zie hieronder) te vermijden.

In elk van deze protocollen juiste controles essentieel. Elke nieuwe primaire antilichaam moet worden gekarakteriseerd voor immunokleuring begint. De specificiteit van het antilichaam moet worden bevestigd door Western blot analyse, indien van toepassing. Bovendien dient een bevestiging dat de kleuring niet wordt veroorzaakt door niet-specifieke binding aan het celoppervlak worden verkregen, en de optimale werking concentratie van een bepaalde primaire antilichaam worden bepaald door middel van seriële verdunningen(Dat wil zeggen, een bindende curve moet worden ontwikkeld). Een negatieve controle (dat wil zeggen, zonder de primaire antilichaam uit het beitsen) vermelden. Een andere mogelijkheid van negatieve controle is de vervanging van normaal IgG van dezelfde soort voor het primaire antilichaam. Voor detectie van meerdere labels, moet men controles bereiden, zonder secundaire antilichamen (de achtergrond controle) en controles enkelvoudige label spectrale overlap artefacten (dwz doorbloeding, crossover, overspraak voorkomen of kleurstof 'lekken', zoals hierboven beschreven ). Men kan de fractie van "lekken" te kwantificeren door het vergelijken van signalen via de "verkeerde" filters met het juiste signaal, met behulp van deze proporties computationeel alles verwijderen "lekken", en het berekenen van de echte distributie en / of co-lokalisatie van fluorescent label. 60 de achtergrond controle moet onafhankelijk worden onderzocht elk kanaal naar de grenzen van de signaalversterking te stellen en offset te ada zijnpted de uiteindelijke beeldvorming. Alle kanalen die worden gebruikt om een ​​beeld van een meervoudige-label monster te verkrijgen zijn via een onafhankelijke achtergrondcorrectie, omdat het niveau van autofluorescentie in elk kanaal in hoofdzaak varieert. Het "lekken" controles zoals hierboven beschreven moeten de hoeveelheid signaalversterking mogelijk in elk kanaal bepalen zonder dat er "lekken" in aangrenzende kanalen. 60

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

De auteurs verklaren dat ze geen concurrerende financiële belangen.

Acknowledgments

Dit werk werd ondersteund door NIH-subsidie ​​GM68418.

Materials

Name Company Catalog Number Comments
Lipofectamin 2000 Life Technologies/Invitrogen 11668 transfection reagent I
Lipofectamin RNAiMAX Life Technologies/Invitrogen 13778 transfection reagent II
Opti-MEM I Life Technologies/Invitrogen 31985 Reduced serum media, warm in 37 °C water bath before use
High-glucose DMEM (Dulbecco’s modified Eagle’s medium) Life Technologies/BioWhittaker 12-604 high-glucose DMEM, warm in 37 °C water bath before use
Fetal Bovine Serum, certified, heat inactivated, US origin Life Technologies/Gibco 10082 FBS (fetal bovine serum)
Poly-L-Lysine SOLUTION SIGMA-SLDRICH P 8920 Poly-L-Lysine, 0.1% w/v, in water
UltraPure Distilled Water Life Technologies/Invitrogen/Gibco 10977 Sterile tissue culture grade water 
Micro Cover glass (22 mm x 22 mm)  Surgipath 105 Cover glass (22 mm x 22 mm) 
6 Well Cell Culture Cluster Fisher/Corning Incorporated 07-200-83 6-well polystyrene plate 
Penicillin, Streptomycin; Liquid Fisher/Gibco 15-140 Penicillin-streptomycin
PAP PEN  Binding Site AD100.1 Hydrophobic barrier pen (for a water repellant barrier in immunofluorescent staining)
Paclitaxel (Taxol) SIGMA-SLDRICH T7402 Taxol for mitotic cell analysis
TN-16, microtubule inhibitor (TN16) Enzo Life Sciences BML-T120 TN16 for mitotic cell analysis
BSA (bovine serum albumin) SIGMA-SLDRICH A7906 Blocking reagent
Triton X-100 SIGMA-SLDRICH T8787 Detergent for permeabilization
Paraformaldehyde SIGMA-SLDRICH P6148 Fixation reagant
DAPI SIGMA-SLDRICH D9542 For nuclear staining
p-phenylenediamine SIGMA-SLDRICH P6001 For mounting medium
VWR Micro Slides, Frosted VWR International 48312-013 Micro slides 
Anti-CENP-A antibody Stressgen/Enzo Life Sciences KAM-CC006 Mouse monoclonal antibody; dilution ratio of 1:100 (IIF), 1:5000 (WB)
Anti-CENP-B antibody Novus Biologicals H00001059-B01P Mouse monoclonal antibody; dilution ratio of 1:200 (IIF, methanol/acetone fixation)-1:400 (IIF, paraformaldehyde fixation)
Anti-CENP-B antibody  abcam ab25734 Rabbit polyclonal antibody; dilution ratio of 1:200 (IIF, methanol/acetone fixation)-1:400 (IIF, paraformaldehyde fixation)
Anti-centromere antibody (ACA) Fitzgerald Industries International, Inc. 90C-CS1058 Human centromere antiserum; dilution ratio of 1:2000 (IIF)
Anti-CENP-H antibody Bethyl Laboratories BL1112 (A400-007A) Rabbit polyclonal antibody; dilution ratio of 1:200 (IIF)
Anti-CENP-H antibody BD 612142 Mouse monoclonal antibody; dilution ratio of 1:200 (IIF)
Anti-CENP-I antibody N/A, Dr. Katusmi Kitagawa N/A, Dr. Katusmi Kitagawa Rabbit polyclonal antibody; dilution ratio of 1:1000 (IIF); Niikura et al., Oncogene, 4133-4146 (2006)
Anti-KNL1 antibody Novus Biologicals NBP1-89223 Rabbit polyclonal antibody; dilution ratio of 1:100 (IIF)
Anti-Hec1 antibody Novus Biologicals / GeneTex NB 100-338 / GTX70268 Mouse monoclonal antibody; dilution ratio of 1:100 (IIF)
Anti-Hec1 antibody GeneTex GTX110735 Rabbit polyclonal antibody; dilution ratio of 1:100 (IIF)
Anti-Ska1 antibody abcam ab46826 Rabbit polyclonal antibody; dilution ratio of 1:100 (IIF)
Anti-Flag antibody SIGMA-ALDRICH F3165 Mouse monoclonal antibody; dilution ratio of 1:1000 (IIF), 1:5000 (WB)
Anti-Flag antibody SIGMA-ALDRICH F7425 Rabbit polyclonal antibody; dilution ratio of 1:1000 (IIF), 1:5000 (WB)
Anti-CUL4A antibody N/A, Dr. Pradip Raychaudhuri N/A, Dr. Pradip Raychaudhuri Rabbit polyclonal antibody; dilution ratio of 1:3000 (WB); Shiyanov et al., The Journal of biological chemistry, 35309-35312 (1999)
Anti-RBX1 antibody Cell Signaling 4397 Rabbit polyclonal antibody; dilution ratio of 1:2000 (WB)
Anti-GAPDH antibody Chemicon MAB374 Mouse monoclonal antibody; dilution ratio of 1:5000 (WB)
Alexa Fluor 488 Goat Anti-Mouse IgG Life Technologies/Invitrogen A11001 fluorophore-conjugated secondary antibody (Affinity-purified secondary antibody)
Alexa Fluor 594 Goat Anti-Mouse IgG Life Technologies/Invitrogen A11005 fluorophore-conjugated secondary antibody (Affinity-purified secondary antibody)
Alexa Fluor 488 Goat Anti-Rabbit IgG Life Technologies/Invitrogen A11008 fluorophore-conjugated secondary antibody (Affinity-purified secondary antibody)
Alexa Fluor 594 Goat Anti-Rabbit IgG Life Technologies/Invitrogen A11012 fluorophore-conjugated secondary antibody (Affinity-purified secondary antibody)
Non fat powdered milk (approved substitution for carnation powdered milk) Fisher Scientific NC9255871 (Reorder No. 190915; Lot# 90629) Skim milk
Leica DM IRE2 motorized fluorescence microscope  Leica motorized fluorescence microscope 
HCX PL APO 63x oil immersion lens Leica LEICA HCX PL APO NA 1.40 OIL PH 3 CS 63X oil immersion lens
HCX PL APO 100x oil immersion lens Leica LEICA HCX PL APO NA 1.40 OIL PHE 100X oil immersion lens
Leica EL6000 compact light source Leica External compact light source for fluorescent excitation
ORCA-R2 Digital CCD camera  Hamamatsu C10600-10B digital CCD camera 
Openlab version 5.5.2 Scientific Imaging Software  Perkin Elmer/Improvision For image observation, acquisition, quantification, and analysis
Velocity version 6.1.1 3D Image Analysis Software  Perkin Elmer/Improvision For image observation, acquisition, quantification, and analysis
Complete EDTA-free protease inhibitor cocktail Roche 11873580001/11836170001 Protease inhibitor cocktail tablets
PlusOne 2-D Quant Kit Amersham Biosciences 80-6483-56 Commercial protein assay reagent I for measurement of protein concentration (compatible with 2% SDS)
Bio-Rad Protein Assay Bio-Rad 500-0006 Commercial protein assay reagent II for measurement of protein concentration (compatible with 0.1% SDS)
Immobilon-FL EMD Millipore IPFL00010 PVDF membrane for transferring
IRDye 800CW Goat Anti-Mouse IgG LI-COR Biosciences 926-32210 IR fluorescent dye-conjugated secondary antibody (Affinity-purified secondary antibody); dilution ratio of 1:20000 (IIF)
IRDye 680 Goat Anti-Rabbit IgG LI-COR Biosciences 926-32221 IR fluorescent dye-conjugated secondary antibody (Affinity-purified secondary antibody); dilution ratio of 1:20000 (IIF)
Goat anti-Mouse IgG DyLight 549 Fisher Scientific PI35507 DyLight-conjugated secondary antibodyIR fluorescent dye-conjugated secondary antibody (Affinity-purified secondary antibody); dilution ratio of 1:20000 (IIF)
Goat anti-Rabbit DyLight 649 Fisher Scientific PI35565 DyLight-conjugated secondary antibodyIR fluorescent dye-conjugated secondary antibody (Affinity-purified secondary antibody); dilution ratio of 1:20000 (IIF)
Goat anti-mouse IgG-HRP Santa Cruz SC-2005 HRP-conjugated secondary antibodyDyLight-conjugated secondary antibodyIR fluorescent dye-conjugated secondary antibody (Affinity-purified secondary antibody); dilution ratio of 1:10000 (IIF)
Goat anti-rabbit IgG-HRP Santa Cruz SC-2004 HRP-conjugated secondary antibodyDyLight-conjugated secondary antibodyIR fluorescent dye-conjugated secondary antibody (Affinity-purified secondary antibody); dilution ratio of 1:10000 (IIF)
Openlab version 5.5.2. Scientific Imaging Software  Improvision/PerkinElmer Software A
Volocity version 6.3 3D Image Analysis Software (Volocity Acquisition) PerkinElmer Software B1
Volocity version 6.3 3D Image Analysis Software (Volocity Quantification) PerkinElmer Software B2
Branson SONIFIER 450 Sonicator
Branson Ultrasonics sonicator Microtip Step, Solid, Threaded 9.5 mm VWR Scientific Products Inc.  33995-325 Disruptor horn for sonication
Branson Ultrasonics sonicator Microtip Tapered 6.5 mm VWR Scientific Products Inc.  33996-185 Microtip for sonication
Odyssey CLx Infrared imaging System  LI-COR Biosciences Infrared imaging system for immunoblot detection
Image Studio Analysis Software Ver 4.0  LI-COR Biosciences Software C
Molecular Imager Versadoc MP4000 System  Bio-Rad Chemiluminescence imager for immunoblot detection
Quantity One 1-D analysis software  Bio-Rad Software D
SuperSignal West Femto Maximum Sensitivity Substrate Thermo 34095 Ultra-sensitive enhanced chemiluminescent (ECL) substrate

DOWNLOAD MATERIALS LIST

References

  1. DeLuca, J. G., et al. Hec1 and nuf2 are core components of the kinetochore outer plate essential for organizing microtubule attachment sites. Molecular biology of the cell. 16, 519-531 (2005).
  2. Earnshaw, W. C., Halligan, N., Cooke, C., Rothfield, N. The kinetochore is part of the metaphase chromosome scaffold. J Cell Biol. 98, 352-357 (1984).
  3. Hoffman, D. B., Pearson, C. G., Yen, T. J., Howell, B. J., Salmon, E. D. Microtubule-dependent changes in assembly of microtubule motor proteins and mitotic spindle checkpoint proteins at PtK1 kinetochores. Molecular biology of the cell. 12, 1995-2009 (2001).
  4. Regnier, V., et al. CENP-A is required for accurate chromosome segregation and sustained kinetochore association of BubR1. Mol Cell Biol. 25, 3967-3981 (2005).
  5. Bernad, R., Sanchez, P., Losada, A. Epigenetic specification of centromeres by CENP-A. Exp Cell Res. 315, 3233-3241 (2009).
  6. Black, B. E., Cleveland, D. W. Epigenetic centromere propagation and the nature of CENP-a nucleosomes. Cell. 144, 471-479 (2011).
  7. Warburton, P. E., et al. Immunolocalization of CENP-A suggests a distinct nucleosome structure at the inner kinetochore plate of active centromeres. Curr Biol. 7, 901-904 (1997).
  8. Karpen, G. H., Allshire, R. C. The case for epigenetic effects on centromere identity and function. Trends Genet. 13, 489-496 (1997).
  9. Black, B. E., et al. Structural determinants for generating centromeric chromatin. Nature. 430, 578-582 (2004).
  10. Black, B. E., et al. Centromere identity maintained by nucleosomes assembled with histone H3 containing the CENP-A targeting domain. Mol Cell. 25, 309-322 (2007).
  11. Fachinetti, D., et al. A two-step mechanism for epigenetic specification of centromere identity and function. Nat Cell Biol. 15, 1056-1066 (2013).
  12. Zeitlin, S. G., Shelby, R. D., Sullivan, K. F. CENP-A is phosphorylated by Aurora B kinase and plays an unexpected role in completion of cytokinesis. The Journal of cell biology. 155, 1147-1157 (2001).
  13. Zhang, X., Li, X., Marshall, J. B., Zhong, C. X., Dawe, R. K. Phosphoserines on maize CENTROMERIC HISTONE H3 and histone H3 demarcate the centromere and pericentromere during chromosome segregation. The Plant cell. 17, 572-583 (2005).
  14. Goutte-Gattat, D., et al. Phosphorylation of the CENP-A amino-terminus in mitotic centromeric chromatin is required for kinetochore function. Proc Natl Acad Sci U S A. 110, 8579-8584 (2013).
  15. Bailey, A. O., et al. Posttranslational modification of CENP-A influences the conformation of centromeric chromatin. Proc Natl Acad Sci U S A. 110, 11827-11832 (2013).
  16. Samel, A., Cuomo, A., Bonaldi, T., Ehrenhofer-Murray, A. E. Methylation of CenH3 arginine 37 regulates kinetochore integrity and chromosome segregation. Proc Natl Acad Sci U S A. 109, 9029-9034 (2012).
  17. Niikura, Y., et al. CENP-A K124 Ubiquitylation Is Required for CENP-A Deposition at the Centromere. Dev Cell. (2015).
  18. Chan, G. K., Liu, S. T., Yen, T. J. Kinetochore structure and function. Trends in cell biology. 15, 589-598 (2005).
  19. Hori, T., Okada, M., Maenaka, K., Fukagawa, T. CENP-O class proteins form a stable complex and are required for proper kinetochore function. Molecular biology of the cell. 19, 843-854 (2008).
  20. Fukagawa, T., Earnshaw, W. C. The centromere: chromatin foundation for the kinetochore machinery. Developmental cell. 30, 496-508 (2014).
  21. Kedersha, N. The Proteintech Blog.Proteintech. Grainger, D. Proteintech Group. (2012).
  22. Clontech Laboratories, Inc. HeLa Tet-Off Advanced Cell Line. Available from: http://www.clontech.com/CR/Products/Inducible_Systems/Tetracycline-Inducible_Expression/ibcGetAttachment.jsp?cItemId=26908&fileId=6712191&sitex=10020:22372:US (2012).
  23. Meraldi, P., Sorger, P. K. A dual role for Bub1 in the spindle checkpoint and chromosome congression. EMBO J. 24, 1621-1633 (2005).
  24. Niikura, Y., et al. 17-AAG, an Hsp90 inhibitor, causes kinetochore defects: a novel mechanism by which 17-AAG inhibits cell proliferation. Oncogene. 25, 4133-4146 (2006).
  25. Yang, Z., et al. Silencing mitosin induces misaligned chromosomes, premature chromosome decondensation before anaphase onset, and mitotic cell death. Mol Cell Biol. 25, 4062-4074 (2005).
  26. Wang, H., et al. Histone H3 and H4 ubiquitylation by the CUL4-DDB-ROC1 ubiquitin ligase facilitates cellular response to DNA damage. Mol Cell. 22, 383-394 (2006).
  27. Lamb, J. R., Tugendreich, S., Hieter, P. Tetratrico peptide repeat interactions: to TPR or not to TPR? Trends Biochem Sci. 20, 257-259 (1995).
  28. Kitagawa, K., Skowyra, D., Elledge, S. J., Harper, J. W., Hieter, P. SGT1 encodes an essential component of the yeast kinetochore assembly pathway and a novel subunit of the SCF ubiquitin ligase complex. Mol Cell. 4, 21-33 (1999).
  29. Niikura, Y., Dixit, A., Scott, R., Perkins, G., Kitagawa, K. BUB1 mediation of caspase-independent mitotic death determines cell fate. J Cell Biol. 178, 283-296 (2007).
  30. Niikura, Y., Kitagawa, K. Identification of a novel splice variant: human SGT1B (SUGT1B). DNA Seq. 14, 436-441 (2003).
  31. Niikura, Y., Ogi, H., Kikuchi, K., Kitagawa, K. BUB3 that dissociates from BUB1 activates caspase-independent mitotic death (CIMD). Cell Death Differ. 17, 1011-1024 (2010).
  32. Ando, S., Yang, H., Nozaki, N., Okazaki, T., Yoda, K. CENP-A, -B, and -C chromatin complex that contains the I-type alpha-satellite array constitutes the prekinetochore in HeLa cells. Mol Cell Biol. 22, 2229-2241 (2002).
  33. Izuta, H., et al. Comprehensive analysis of the ICEN (Interphase Centromere Complex) components enriched in the CENP-A chromatin of human cells. Genes to cells : devoted to molecular & cellular mechanisms. 11, 673-684 (2006).
  34. Obuse, C., et al. Proteomics analysis of the centromere complex from HeLa interphase cells: UV-damaged DNA binding protein 1 (DDB-1) is a component of the CEN-complex, while BMI-1 is transiently co-localized with the centromeric region in interphase. Genes Cells. 9, 105-120 (2004).
  35. Merlet, J., Burger, J., Gomes, J. E., Pintard, L. Regulation of cullin-RING E3 ubiquitin-ligases by neddylation and dimerization. Cell Mol Life Sci. 66, 1924-1938 (2009).
  36. Bennett, E. J., Rush, J., Gygi, S. P., Harper, J. W. Dynamics of cullin-RING ubiquitin ligase network revealed by systematic quantitative proteomics. Cell. 143, 951-965 (2010).
  37. Antonelli, A., et al. Efficient inhibition of macrophage TNF-alpha production upon targeted delivery of K48R ubiquitin. Br J Haematol. 104, 475-481 (1999).
  38. Codomo, C. A., Furuyama, T., Henikoff, S. CENP-A octamers do not confer a reduction in nucleosome height by AFM. Nat Struct Mol Biol. 21, 4-5 (2014).
  39. Thrower, J. S., Hoffman, L., Rechsteiner, M., Pickart, C. M. Recognition of the polyubiquitin proteolytic signal. The EMBO journal. 19, 94-102 (2000).
  40. Yoda, K., et al. Human centromere protein A (CENP-A) can replace histone H3 in nucleosome reconstitution in vitro. Proc Natl Acad Sci U S A. 97, 7266-7271 (2000).
  41. Shelby, R. D., Vafa, O., Sullivan, K. F. Assembly of CENP-A into centromeric chromatin requires a cooperative array of nucleosomal DNA contact sites. J Cell Biol. 136, 501-513 (1997).
  42. Majumder, S., Fisk, H. A. Quantitative immunofluorescence assay to measure the variation in protein levels at centrosomes. J Vis Exp. (2014).
  43. Masumoto, H., Masukata, H., Muro, Y., Nozaki, N., Okazaki, T. A human centromere antigen (CENP-B) interacts with a short specific sequence in alphoid DNA, a human centromeric satellite. J Cell Biol. 109, 1963-1973 (1989).
  44. Yoda, K., Kitagawa, K., Masumoto, H., Muro, Y., Okazaki, T. A human centromere protein, CENP-B, has a DNA binding domain containing four potential alpha helices at the NH2 terminus, which is separable from dimerizing activity. J Cell Biol. 119, 1413-1427 (1992).
  45. Sugata, N., et al. Human CENP-H multimers colocalize with CENP-A and CENP-C at active centromere--kinetochore complexes. Hum Mol Genet. 9, 2919-2926 (2000).
  46. Earnshaw, W. C., Ratrie, H. 3rd, Stetten, G. Visualization of centromere proteins CENP-B and CENP-C on a stable dicentric chromosome in cytological spreads. Chromosoma. 98, 1-12 (1989).
  47. Goshima, G., Kiyomitsu, T., Yoda, K., Yanagida, M. Human centromere chromatin protein hMis12, essential for equal segregation, is independent of CENP-A loading pathway. J Cell Biol. 160, 25-39 (2003).
  48. Liu, S. T., Rattner, J. B., Jablonski, S. A., Yen, T. J. Mapping the assembly pathways that specify formation of the trilaminar kinetochore plates in human cells. J Cell Biol. 175, 41-53 (2006).
  49. Gascoigne, K. E., Cheeseman, I. M. T time for point centromeres. Nat Cell Biol. 14, 559-561 (2012).
  50. Gascoigne, K. E., et al. Induced ectopic kinetochore assembly bypasses the requirement for CENP-A nucleosomes. Cell. 145, 410-422 (2011).
  51. Nishino, T., et al. CENP-T provides a structural platform for outer kinetochore assembly. EMBO J. 32, 424-436 (2013).
  52. Malvezzi, F., et al. A structural basis for kinetochore recruitment of the Ndc80 complex via two distinct centromere receptors. EMBO J. 32, 409-423 (2013).
  53. Schleiffer, A., et al. CENP-T proteins are conserved centromere receptors of the Ndc80 complex. Nat Cell Biol. 14, 604-613 (2012).
  54. Rago, F., Gascoigne, K. E., Cheeseman, I. M. Distinct organization and regulation of the outer kinetochore KMN network downstream of CENP-C and CENP-T. Curr Biol. 25, 671-677 (2015).
  55. Nishino, T., et al. CENP-T-W-S-X forms a unique centromeric chromatin structure with a histone-like fold. Cell. 148, 487-501 (2012).
  56. Bodor, D. L., et al. The quantitative architecture of centromeric chromatin. Elife. 3, e02137 (2014).
  57. Oliver, C. Ch 58. Molecular Biomethods Handbook. Rapely, R., Walker, J. M. Humana Press. 1063-1079 (2008).
  58. Terasima, T., Tolmach, L. J. Changes in x-ray sensitivity of HeLa cells during the division cycle. Nature. 190, 1210-1211 (1961).
  59. Levenson, G. B. R. Ch 8. Biomedical Photonics Handbook. Vo-Dinh, T. uan CRC Press LLC. 8-19 (2003).
  60. Sanderson, J. Fluorescence bleed-though. Available from: http://www.gum2012.fionastoreydesign.co.uk/Downloads/Bleed through text.pdf (2011).
Immunofluorescentie analyse van endogene en exogene Centromere-kinetochoor Eiwitten
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Niikura, Y., Kitagawa, K. Immunofluorescence Analysis of Endogenous and Exogenous Centromere-kinetochore Proteins. J. Vis. Exp. (109), e53732, doi:10.3791/53732 (2016).More

Niikura, Y., Kitagawa, K. Immunofluorescence Analysis of Endogenous and Exogenous Centromere-kinetochore Proteins. J. Vis. Exp. (109), e53732, doi:10.3791/53732 (2016).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter