Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

חלבונים Immunofluorescence ניתוח של אנדוגני אקסוגניים centromere-קינטוכור

Published: March 3, 2016 doi: 10.3791/53732

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

"צנטרומר" הוגדר קלסי כאזורים של רקומבינציה meiotic מורחקת בגנטיקה ומאוחר יותר הוכר ההתכווצות העיקרית של הכרומוזומים mitotic, אשר ממלאת תפקיד חיוני פרדת כרומוזום מדויקת במהלך מיטוזה. "קינטוכור" תואר מבנים הרבים השכבתיים אשר נקלטים על ידי microtubules על פני השטח של צנטרומר, כפי שהיא מתגלה על ידי מיקרוסקופי אלקטרונים; "קינטוכור" הוגדרו מאוחר כמתחם macromolecular שמתאימה בבית centromere של הכרומוזומים mitotic. למרות הבדלים דרמטיים של רצפי DNA centromeric בין חוליות, מבנה קינטוכור ורכב הם שמורים ביותר. אינטראקציה דינמית בין microtubules ציר ואת קינטוכור נדרשת הפרדה נאמן של הכרומוזומים במהלך מיטוזה, ופגמים בעופרת פונקציה centromere-קינטוכור כדי aneuploidy ובכך סרטן.

Centromere ברוב אאוקריוטיםאין רצף DNA מוגדר, אבל מורכב מערכים גדולים (0.3-5 Mb) של DNA alphoid החוזר מורכב 171-נ"ב DNA α-הלווין. למעט ניצני שמרים, זהות centromere מושגת לא על ידי רצף ה- DNA אלא על ידי נוכחות של הנוקלאוזום מיוחד המכיל את גרסה H3 היסטון CenH3 (חלבון centromere [CENP-א] בבני אדם). 5 נוקלאוזום CENP-A למקם אל צלחת פנימית של קינטוכור יונק 7 ו נקשר לדנ"א 171-נ"ב α-הלווין. צנטרומר Active דורש CENP-A-המכיל נוקלאוזום לכוון את הגיוס של רשת centromere קשור מכוננת (CCAN) והחלבונים קינטוכור, שביחד להסדיר את הקובץ המצורף של הכרומוזומים אל ציר mitotic והתקדמות מחזור לאחר מכן במחסום הכישור.

לאור הראיות הנ"ל, CENP-A הוצע להיות סימן אפיגנטיים של centromere 8; עם זאת, התהליך שבאמצעותו-A CENP משולב iDNA centromeric n כדי וגורמי אחראי התאגדות זה טרם מאופיין היטב. תחום קצר מיקוד-centromere (CATD) מתגורר היסטון לקפל באזור CENP-A, והחלפת באזור המקביל H3 עם CATD מספיקה כדי H3 ישירה centromere. 9 מספר מחקרים הציעו תפקידים פונקציונאליים-translational פוסט שינוי (PTM) של CENP-A 12-16; עם זאת, המנגנונים המולקולריים של PTMs אלה של-A CENP בגיוס כדי צנטרומר טרם הובהר. דיווחנו בעבר כי CUL4A-RBX1-COPS8 פעילות האנזים E3 נדרש CENP-A K124 ubiquitylation ולוקליזציה של CENP-א 'עד צנטרומר. 17

התגלית ואפיון של חלבונים קינטוכור הובילו לתובנה חדשה לגבי הפרדה כרומוזום. 18 יותר מ -100 רכיבים קינטוכור זוהו בתאים חוליות ידי גישות שונות. 19,20 תחתמעמדו של איך קינטוכור להרכיב ותפקוד מגיע גם מן האפיון של התפקודים התאיים של כל חלבוני centromere-קינטוכור ורשת החלבונים בתוך תאים. 19 להדמיה ישירה ושיטות הדמיה מתקדמת מיקרוסקופ פלואורסצנטי לספק רזולוציה מרשימה של רכיבים-קינטוכור centromere ולאפשר תצפית ישירה של רכיבים מולקולריים ייחודיים של צנטרומר ו קינטוכור. בנוסף, שיטות immunofluorescent העקיף (IIF) מכתים באמצעות נוגדנים ספציפיים הם קריטיים תצפיות אלה. עם זאת, למרות דיווחים רבים על פרוטוקולים IIF, כמה דנו בבעיות פרט חלבונים centromere-קינטוכור ספציפיים. 1-4 לפיכך, פיתוח ודיווח שיטות מכתים IIF וכן assay IIF כמותית לנתח באופן ספציפי כל חלבון centromere-קינטוכור חשוב מאוד. בשנת מכתים IIF, אחד צריך להמשיך עם הפרוטוקול המכתים כדי למנוע אובדן של החלבון של עניין אושאר התא. עם זאת, קיבעון הורס אתרים אנטיגני מדי פעם, ושילובי נוגדן-אנטיגן שונים לעבוד היטב עם מקבע אחד, אבל טוב מאוד עם אחר, 21 ובחירה מקבע תלויים במידה רבה על החלבון (ים) של עניין. לכן, שיטות מקבעים שונות הן קריטיות מכתים IIF של חלבונים-קינטוכור centromere.

הנה שיטות אופטימיזציה של immunofluorescent עקיף (IIF) מכתים ו assay להתייחס לוקליזציה של חלבונים centromere-קינטוכור אנדוגני, כולל CENP-A ודגל מתוייגים אקסוגניים חלבונים CENP-A, ו לכמת את החלבונים האלה בתאים אנושיים פותחו. ניתן ליישם שיטות אלה כדי הניתוח של חלבונים-קינטוכור centromere במינים אחרים.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. תרבות Transfection ניידות

  1. שים כוס כיסוי (22 מ"מ x 22 מ"מ) בצלחת קלקר 6 באר. מעיל לחלופין כוס כיסוי עם פולי- L- ליזין, 0.1% w / v, במים (ראה רשימה של חומרים / ציוד) כדי לשמור על התאים mitotic על הזכוכית המכסה ביצוע השלבים הבאים:
    הערה: תנאים אופטימליים צריכים להיקבע עבור כל קו תא ויישום.
    1. משטח תרבות מעיל בסביבה נקייה מחיידקים עם פולי- L- ליזין, 0.1% w / v, במים (0.4 מ"ל / גם צלחת 6-גם קלקר). רוק בעדינות כדי להבטיח אפילו ציפוי של משטח התרבות.
    2. לאחר 5 דקות, להסיר פתרון על ידי שאיפה לשטוף ביסודיות משטחת במי כיתת רקמת סטרילית התרבות.
    3. יבש לפחות שעה 2 לפני החדרת התאים ובינוניים.
  2. תאי זרע הלה 17 או הלה ט-Off תאים 17,22 על כוס כיסוי (22 מ"מ x 22 מ"מ) להכניס צלחת קלקר 6 באר. בדוק כי צפיפות התאים הוא 5.4 x 10 5 לכל טוב. תרבות תאיםב DMEM גבוהה גלוקוז עם FBS 10% ו -1%, סטרפטומיצין פניצילין.
    הערה: לקבלת תוצאות אופטימליות, באופן אמפירי לקבוע את צפיפות התאים לשימוש ב זריעה.
  3. דגירת התאים ב 37 מעלות צלזיוס אווירה של 5% CO 2 עבור 18 שעות.
    הערה: במקרה של תאים הלה ט-Off, שעתוק של הגן אקסוגניים פעילה בהעדר inducer (כלומר, טטרציקלין / דוקסיציקלין) ולכן התרבות תאים ללא טטרציקלין / דוקסיציקלין ו transfect זמני עם וקטור ביטוי יתר pTRM4 (טבלה 2 ), מוסדר שעתוק אשר על ידי אמרגן TRE (ראה להלן).
  4. שמונה עשר שעות לאחר הזריעה, תאי transfect כדלקמן:
    1. בצע פתרון על ידי ערבוב אוליגו siRNA 1.5 μl (20 מיקרומטר המניות annealed; טבלה 1) ו / או 2.0 מיקרוגרם פלסמיד (טבלה 2) ב 50 μl בינוני סרום מופחת (ראה רשימת חומרים / ציוד), דגירה על RT במשך 5 דקות .
      הערה: בניתוח זה,CA-UTR siRNAs (תערובת של 5 'ו 3' UTR siRNA; טבלה 1) היו-טרנספקציה שיתוף לשימוש הפרוטוקולים 3 ו -4 (ראה דיון).
    2. הפוך B פתרון על ידי ערבוב 0.75 מגיב transfection μl לי (ראה רשימה של חומרים / ציוד) ב 50 μl המופחתים בינוני בסרום, לדגור על RT במשך 5 דקות.
      הערה: צעד אופציונלי הוא תוספת של 1.0 מיקרוליטר מגיב transfection השנייה (ראה רשימה של חומרים / ציוד).
    3. מערבבים פתרונות A ו- B יחד, לדגור על RT במשך 15 דקות.
    4. שוטפים את התאים בתרבית פעם עם PBS, ולאחר מכן להוסיף 500 μl מופחת בינוני בסרום היטב בכל צלחת קלקר 6 באר. מוסיפים את תערובת של פתרונות ו- B (כלומר, RNA ו / או מורכבות השומנים-DNA) ישירות זה של הפרט היטב.
      הערה: הריכוז הסופי הוא 3.3 מיקרוגרם / מ"ל ​​(פלסמיד); 50 ננומטר (siRNA).
    5. דגירת התאים ב 37 מעלות צלזיוס אווירה של 5% CO 2 עבור 4.5 שעות. שינוי בינוני עד שנינות DMEM גלוקוז גבוההh 10% FBS ו -1%, סטרפטומיצין פניצילין.
    6. דגירה התאים ב 37 מעלות צלזיוס אווירה של 5% CO 2 עבור 48-72 שעות לאחר transfection.
      הערה: לקבלת תוצאות אופטימליות, תקופת הדגירה של צמיחת תאים לפני הקיבוע צריכה להיקבע באופן אמפירי, ודלדול חלבון ו / או ביטוי חייב להיות מאושר על ידי ניתוח כתם מערבי (ראה פרוטוקול 6).
    7. אם בניתוח תא mitotic הוא עניין, להוסיף פקליטקסל (10 ננומטר) תאים בתרבית 24 שעות לפני קיבעון, או להוסיף TN16 (0.5 מיקרומטר) אל hr 2.5 תאים בתרבית לפני קיבעון.

2. תא קיבוע Immunofluorescent מכתים כדי זיהוי חלבונים אנדוגניים centromere-קינטוכור (קיבוע Paraformaldehyde)

  1. הכנה מקבע, מאגרים, וכן חומרים כימיים.
    1. טרי להכין 50 מ"ל של תמיסת paraformaldehyde 4% ב- ​​PBS, pH 7.4.
      1. הוסף 40 מ"ל של 1 × PBS על כוס זכוכית על צלחת ומערבבים במנדף מאוורר. מחממים תוך בערבובגרם לכ -60 מעלות צלזיוס. הוסף 2 גרם של אבקת paraformaldehyde אל PBS המחומם.
      2. הרם לאט את ה- pH על ידי הוספת 1 מ"ל של 1 N NaOH בסך הכל, כי האבקה לא מיד לפזר.
        הערה: הפתרון מנקה לאחר תוספת של NaOH.
      3. לאחר paraformaldehyde נמס, קריר לסנן את הפתרון.
      4. התאם את ה- pH עם 1 N HCl pH 7.4 והיקף הפתרון עם 1 × PBS 50 מ"ל.
        הערה: Aliquots של הפתרון אפשר להקפיא או מאוחסן ב 2-8 מעלות צלזיוס למשך כל עוד 1 בשבוע. הפתרון צריך להיות קר כקרח או לאחסן 4 ° C עד שהוא לשמש.
    2. הכן 50 מ"ל של חיץ KB1, אשר מורכב של 10 mM Tris-HCl, pH 7.5; 150 מ"מ NaCl; 0.5% BSA; ו -0.5% Triton X-100.
      הערה: BSA יש להוסיף טרי.
      הערה: סדרת חיץ KB מבוססת על KB חיץ המתוארים בדוחות קודמים 1,2,4.
    3. הכן 50 מ"ל של חיץ KB2, אשר מורכב של 10 mM Tris-HCl,pH 7.5; 150 מ"מ NaCl; ו -0.5% BSA.
      הערה: BSA יש להוסיף טרי.
    4. הכן 1 מ"ל של חיץ KB3 המכיל DAPI (50 ng / ml).
    5. הכן 100 מ"ל של מדיום הרכבה, אשר מורכב של 1 מ"ג / מ"ל ​​p-phenylenediamine; 10% PBS, ו -90% גליצרול.
      1. התאם את ה- pH של 1 × PBS ל 9.8 עם 1 N NaOH, לפזר p-phenylenediamine בתמיסה, ולאחר מכן להוסיף גליצרול.
      2. חנות 1 aliquots מ"ל ב -80 ° C. להגן מפני אור.
  2. הסר את מדיום התרבות על ידי שאיפה ב transfection 48-72 שעות שלאחר (ראה פרוטוקול 1) עבור קיבוע תא. תאים לשטוף פעם עם PBS. החל PBS לצד של בארות התרבות להימנע משיבוש פני השטח של התאים.
    הערה: נקודת הזמן האופטימלית עבור קיבוע תא צריכה להיקבע באופן אמפירי.
  3. תקן את התאים paraformaldehyde 4% ב PBS במשך 30 דקות ב 4 °. שוטפים את התאים פעמיים עם חיץ KB2 להסיר paraformaldehyde 4% שיורית מספיק.
  4. PermeabiLize הדגימות במאגר KB1 למשך 30 דקות ב RT. שוטפים את התאים פעם עם חיץ KB2, ולהוסיף חיץ KB2 במשך 5 דקות ב RT לאתרים גוש נוסף של מחייב ספציפי.
    הערה: הצפת KB1 גם תורם משמעותי חסימה.
  5. הסרת מכסה זכוכית (22 מ"מ x 22 מ"מ) מתוך צלחת קלקר 6-גם באמצעות מלקחיים. באמצעות עט מחסום הידרופובי (ראה רשימה של חומרים / ציוד), לצייר ריבוע ירוק חיוור או מעגל כדי ליצור מחסום הידרופובי סביב מדגם מכסה זכוכית. אין לגעת או להתקרב יותר מדי אל התאים עם עט מחסום הידרופובי. תניח את כוס כיסוי צלחת קלקר 6-באר חדשה.
  6. לדלל נוגדן ראשוני כדי centromere או חלבון קינטוכור (יחס דילול של 1: 100 עד 1: 200; ראו רשימה גם של חומרים / ציוד) ואו נוגדן אנטי CENP-B (יחס דילול של 1: 400) או אנטי centromere נוגדן (ACA) (יחס דילול של 1: 2,000) כסמן מיקום centromere במאגר KB2.
    הערה: לקבלת תוצאות אופטימליות, את Concentra הסופיtion של הנוגדן הראשוני בפתרון זה צריך להיקבע באופן אמפירי.
  7. החל נפח מספיק (בערך 30 μl) של הנוגדן הראשוני המדולל לטבול מדגם התא. דגירת מדגם התא עבור שעה 1 ב 37 מעלות צלזיוס. שוטפים את התאים 3 פעמים עם חיץ KB2.
  8. באמצעות חיץ KB2, לדלל נוגדנים משני fluorophore מצומדות (יחס דילול של 1: 100 עד 1: 200) המכוונים נגד נוגדן ראשוני.
    הערה: לקבלת תוצאות אופטימליות, את הריכוז הסופי של נוגדנים משני בפתרון זה צריך להיקבע באופן אמפירי.
  9. החל נפח מספיק (ירידה של μl בקירוב 30 על הזכוכית המכסה) של נוגדנים משני בדילול לטבול מדגם התא. דגירת מדגם התא עבור שעה 1 ב 37 מעלות צלזיוס. שוטפים את התאים 5 פעמים עם חיץ KB2 במהלך תקופה של 30 דקות (חמש 6 שטיפות דקות).
    הערה: לקבלת תוצאות אופטימליות (כלומר, עבור הפסד מינימאלי של תאים), תנאי הכביסה האופטימלי צריך להיקבע Empirically.
  10. החל נפח מספיק של חיץ KB3 המכיל DAPI (50 ng / ml) לטבול את המדגם התא. דגירת מדגם התא במשך 5 דקות ב RT. יש לשטוף את התאים 1-2 פעמים עם חיץ KB2.
  11. הר זכוכית המכסה המכיל מדגם התא לשקופית מייקרו.
    1. מניחים ירידה של הרכבה בינונית במרכז השקופית מיקרו.
    2. הסר נוזל מן המדגם התא, באמצעות הידיים או מלקחיים, מקם את המדגם במרכז השקופית מיקרו. הימנע בועות אוויר.
    3. הסר בינוני הרכבה עודף עם מגבת נייר.

3. תא קיבוע Immunofluorescent מכתים של בטרמינל C-דגל-tagged CENP-A חלבונים (קיבוע אצטון)

  1. הכנה
    1. כן אצטון 75% קרים כקרח.
    2. טרי להכין 50 מ"ל של PBS (pH 7.4) המכיל חלב 0.5% דל שומן 0.5% BSA.
    3. טרי להכין 50 מ"ל של PBS (pH 7.4) המכיל חלב 0.1% דל שומן 0.1% BSA.
    4. כן 1 מיליליטר של PBS (pH 7.4) המכיל DAPI (50-100 ng / ml).
    5. הכן 100 מ"ל של מדיום הרכבה כמתואר 2.1.5.
  2. הסר את מדיום התרבות על ידי שאיפה ב transfection 48-72 שעות שלאחר (ראה פרוטוקול 1) עבור קיבוע תא. תאים לשטוף פעם עם PBS. החל PBS לצד באר התרבות להימנע משיבוש פני השטח של התאים.
    הערה: נקודת הזמן האופטימלית עבור קיבוע תא צריכה להיקבע באופן אמפירי.
  3. תקנו את תאי אצטון קר כקרח 75%, ו דגירת התאים במשך 10 דקות ב -20 מעלות צלזיוס. תאי ניקוי על הזכוכית המכסה במנדף 30-60 דקות ב RT.
    הערה: לקבלת תוצאות אופטימליות, את משך הזמן הדרוש לייבוש קיבעון תא צריך להיקבע באופן אמפירי.
  4. באמצעות עט מחסום הידרופובי (ראה רשימה של חומרים / ציוד), לצייר ריבוע ירוק חיוור או מעגל כדי ליצור מחסום הידרופובי סביב מדגם מכסה זכוכית. אין לגעת או להתקרב יותר מדי אל התאים עם עט מחסום הידרופובי.
  5. בלוק nonspecific אתרי הקישור שבין התאים על ידי הוספת PBS המכיל חלב 0.5% דל שומן BSA 0.5% במשך 5 דקות ב RT.
  6. באמצעות PBS המכיל חלב 0.1% דל שומן BSA 0.1%, לדלל נוגדן אנטי הדגל (1: 1,000 יחס דילול) ואו נוגדן אנטי CENP-B (יחס דילול של 1: 200) או ACA (1: יחס דילול 2,000 כמו) סמן centromere מיקום.
    הערה: לקבלת תוצאות אופטימליות, את הריכוז הסופי של הנוגדן הראשוני בפתרון זה צריך להיקבע באופן אמפירי.
  7. החל נפח מספיק (בערך 30 μl) של הנוגדן הראשוני המדולל לטבול מדגם התא. דגירת מדגם התא עבור שעה 1 ב 37 מעלות צלזיוס. שוטף את התאים 5 פעמים עם חיץ החסימה במהלך תקופה של 30 דקות.
    הערה: תאים ניתן לשטוף עם PBS. לקבלת תוצאות אופטימליות (כלומר, כדי למנוע אובדן של תאים), תנאי הכביסה האופטימליים צריכים להיקבע באופן אמפירי.
  8. לדלל נוגדנים משני fluorophore מצומדות (יחס דילול של 1: 100 עד 1: 200) מכוונים נגדכל נוגדן ראשוני PBS המכיל חלב 0.1% דל שומן 0.1% BSA.
    הערה: לקבלת תוצאות אופטימליות, את הריכוז הסופי של נוגדנים משני בפתרון זה צריך להיקבע באופן אמפירי.
  9. החל נפח מספיק (בערך 30 μl) של נוגדנים משני בדילול לטבול מדגם התא. דגירת מדגם התא עבור שעה 1 ב 37 מעלות צלזיוס. יש לשטוף את התאים 2 פעמים עם PBS המכיל 0.1% חלב דל שומן 0.1% BSA.
    הערה: PBS לבד יכול לשמש גם כדי לשטוף את התאים.
  10. החל נפח מספיק של PBS המכיל DAPI (50-100 ng / ml) לטבול את המדגם התא. דגירת מדגם התא במשך 5 דקות ב RT. יש לשטוף את התאים 1-2 פעמים עם PBS.
  11. הר זכוכית המכסה המכיל מדגם התא לשקופית המייקר כמתואר 2.11.

4. תא קיבוע Immunofluorescent מכתים של N-terminal דגל-tagged CENP-A חלבונים (קיבוע מתנול)

  1. הכנה
    1. כן מתנול קר כקרח.
    2. כן TBS (pH 7.4) המכיל 4% נסיוב עז.
    3. הכן 1 מ"ל של TBS (pH 7.4) המכיל DAPI (50-100 ng / ml).
    4. הכן 100 מ"ל של מדיום הרכבה כמתואר 2.1.5.
  2. הסר את מדיום התרבות על ידי שאיפה ב transfection 48-72 שעות שלאחר (ראה פרוטוקול 1) עבור קיבוע תא. תאים לשטוף פעם עם TBS. החל TBS לצד של בארות התרבות להימנע משיבוש פני השטח של תאים.
    הערה: נקודת הזמן האופטימלית עבור קיבוע תא צריכה להיקבע באופן אמפירי.
  3. תקן את תאי מתנול קר כקרח, דגירת התאים למשך 6 דקות ב -20 מעלות צלזיוס. שוטפים את התאים פעמיים עם TBS להסיר מתנול שיורית מספיק.
  4. באמצעות עט מחסום הידרופובי (ראה רשימה של חומרים / ציוד), לצייר ריבוע ירוק חיוור או מעגל ליצור חיץ הידרופובי סביב מדגם מכסה זכוכית. אין לגעת או להתקרב יותר מדי אל התאים עם עט מחסום הידרופובי.
  5. חסום ספציפי אתרי קישור על cells ידי TBS הוספה המכיל 4% נסיוב עז. דגירה של 10 דקות ב RT.
  6. לדלל נוגדן אנטי הדגל (1: 1,000 דילול) ואו נוגדן אנטי CENP-B (יחס דילול של 1: 200) או ACA (1: 2,000 יחס דילול) כסמן מיקום centromere ב TBS המכילה סרום עיזים 4% .
    הערה: לקבלת תוצאות אופטימליות, את הריכוז הסופי של הנוגדן הראשוני בפתרון זה צריך להיקבע באופן אמפירי.
  7. החל נפח מספיק (בערך 30 μl) של הנוגדן הראשוני המדולל לטבול מדגם התא. דגירת מדגם התא עבור שעה 1 ב 37 מעלות צלזיוס. שוטף את התאים 5 פעמים עם חיץ החסימה במהלך תקופה של 30 דקות. לקבלת תוצאות אופטימליות (כלומר, ההפסד המינימאלי של תאים), תנאי הכביסה האופטימלי צריך להיקבע באופן אמפירי.
  8. לדלל נוגדנים משני fluorophore מצומדות (יחס דילול של 1: 100 עד 1: 200) המכוונים נגד נוגדן ראשוני ב TBS המכילה סרום עיזים 4%.
    הערה: לקבלת תוצאות אופטימליות, את Finaריכוז l של נוגדנים משני בפתרון זה צריך להיקבע באופן אמפירי.
  9. החל נפח מספיק (בערך 30 μl) של נוגדנים משני בדילול לטבול מדגם התא. דגירת מדגם התא עבור שעה 1 ב 37 מעלות צלזיוס. שוטפים את התאים 3 פעמים עם חיץ חסימה.
  10. החל נפח מספיק של TBS המכיל DAPI (50-100 ng / ml) לטבול את המדגם התא. דגירת מדגם התא במשך 5 דקות ב RT. יש לשטוף את התאים 1-2 פעמים עם כפות.
  11. הר זכוכית המכסה המכיל מדגם התא לשקופית המייקר כמתואר 2.11.

5. תצפית תמונה Immunofluorescence, רכישה, כימות, וניתוח

  1. שים מדגם התא דרך מיקרוסקופ פלואורסצנטי ממונע מצויד עדשת טבילת שמן 63X ו 100X, מקור אור קומפקטי חיצוני, ומצלמת CCD דיגיטלית.
  2. בצע רכישת תמונה ועיבוד, כולל deconvolution, באמצעות תוכנהA, או תוכנות B1 ו- B2 (רואים רשימה של חומרים / ציוד). עיין קבצי קוד משלימה (5.2.1) עבור כל הפקודות הנמצאות בשימוש ב א תוכנה עבור כל הפקודות בשימוש תוכנות B1 ו- B2, עיין (5.2.2) ב משלים קוד קבצים.
  3. השתמש שיטה שתואר לעיל 23-25 ​​לכמת אותות של חלבונים-קינטוכור centromere (למשל, הנותרים אותות של-A CENP בבית centromere) עם שינויים קלים הבאים:
    1. בחירת האזור של חלבונים-קינטוכור centromere וכי הרקע כדלקמן:
      1. תא mitotic: (אזור קינטוכור-centromere) בחירת האזור חופף עם כרומוזומים מוכתמים DAPI; (אזור ברקע) ואת האזור שמחוץ הכרומוזומים אבל בתוך התא הבודד הזהה (כלומר, cytosolic באזור).
      2. שלבי ביניים תא: (אזור-קינטוכור centromere) בחירת האזור חופף עם הכרומטין מוכתם DAPI; (אזור ברקע) ואת האזור שמחוץ הכרומטין אבל בתוך התא הבודד הזהה (<em> כלומר, באזור cytosolic).
        הערה: ראה גם קבצי קוד משלימה (5.2.1.4.3) או (5.2.2.6.4) לבחירה באזור עם תוכנה או תוכנת B2, בהתאמה.
    2. לכמת אחוז אותות הנותרים צנטרומר באמצעות תוכנה או B. עבור משימה זו, השתמש בנוסחה הבאה:
      הנותרים אותות של חלבון centromere-קינטוכור בבית-קינטוכור centromere
      Equation1
      כאשר s בוהק האות של האזור הנבחר, אשר אושר על ידי ACA או מכתים CENP-B; ב בוהקת ברקע אות; מדגם r הוא ACA התייחסות או CENP-B אותות עבור siRNA (הים) תאי -treated; ו r ctrl הוא ACA או CENP-B אותות הייחוס עבור תאי-טרנספקציה siRNA לוק.
      הערה: בניתוח זה, אותות CENP-B שימשו אותות הייחוס עבור CUL4A ו RBX1 כמתואר בדוחות קודמים.
    3. השתמש בקובץ אקסל לחישוב זה אחרי שאתה מעתיק ומדביק את הנתונים הגולמיים מתוכנת quantitation האות שתוארה לעיל. ראה גם קבצי קוד משלימה: (5.2.1.4) ו (5.2.2.6) לפרטים. דוגמא החישוב אחת מוצגת בטבלה 3.
  4. לנתח לפחות 20 תאים לחסל וריאציה מכתימה רכישת תמונה עבור כל רמת מדידה. לחלופין להשתמש "ערך בממוצע" של הנותרים אותות-קינטוכור centromere לכל מנותח תא להשוות ערכים אלה בקרב חלבונים centromere-קינטוכור שונים.

6. ניתוח כתם המערבי של חלבון סה"כ

  1. Resuspend התאים denaturing הצפת (20 mM Tris-HCl, pH 7.4, 50 mM NaCl; 0.5% Nonidet P-40; 0.5% deoxycholate; 0.5% SDS; 1 mM EDTA; קוקטייל ומלא-EDTA חינם מעכבי פרוטאז), נושא 26 את ההשעיה sonication ותהליך להקפיא להפשיר, ולמדודריכוזי חלבון כדלקמן:
    1. לקבלת מידע אודות תהליך sonication, להוסיף 50 μl של חיץ אל התאים שנאספו משתי הבארות של צלחת קלקר 6-היטב transfection 48-72 שעות שלאחר (ראה פרוטוקול 1). להפעיל sonicator מצויד צופר משבש ו microtip (ראה רשימה של חומרים / ציוד) למשך לסירוגין דופק הכולל 15 שניות (מחזור העבודה 50%) לדגימה אחד.
    2. כדי שתהליך להקפיא להפשיר, להקפיא תאים עם חנקן נוזלי להפשיר תאים ב RT.
    3. מדוד ריכוז חלבון באמצעות שאני מגיב assay החלבון מסחרי או שני (ראה רשימה של חומרים / ציוד).
      הערה: Lysates מדולל ביחס של 1:10 במדידת ריכוזי חלבון או עם אני מגיב או שני. בדילול זה, בהווה SDS חיץ תערוכות מעט או ללא הפרעה במדידה זו.
  2. מערבבים את lysate המכיל 20-30 מיקרוגרם של החלבון הכולל עם 2 × או 4 × חיץ טעינת SDS-PAGE. 27 מרתיחים את הדגימות למשך5 דקות ולאחר מכן לטעון אותם על% 12.0% -15.0 denaturing ג'ל SDS-polyacrylamide אלקטרופורזה.
  3. מעביר את החלבונים מופרדים על ידי SDS-PAGE על קרום PVDF באמצעות שיטה מערבית סופגת שתוארה לעיל. 17,24,27-31
    1. חסום את אתרי הקישור ספציפי על הממברנה עם 5% חלב דל שומן ב 1 × PBS, ולאחר מכן דגירה הממברנה עם פתרונות של נוגדנים ראשוניים בדילול עבור שעה 1 ב RT. ראה רשימה של חומרים / ציוד עבור מידע מפורט (כדוגמת: יחס דילול) של כל נוגדן ראשוני.
    2. לאחר שטיפת פעמי קרום 3-4 (כל דגירת 3 עד 5 דקות עם רעד) עם חיץ PBS-T (1 × PBS ו -0.1% Tween-20), הדגירה הממברנה בתערובת של קרוב אינפרא אדום (IR) צבען מצומדות פלורסנט נוגדנים משני (יחס דילול של 1: 20,000), נוגדנים משני DyLight מצומדות (יחס דילול של 1: 20,000), ו / או peroxidase חזרת (HRP), מצומדות נוגדנים משני (בדילול מלא PBS-T; dilutiעל יחס של 1: 10,000) במשך שעה 1 ב RT. ראה רשימה של חומרים / ציוד עבור מידע מפורט (כדוגמת: יחס דילול) של נוגדן זה משני.
  4. לשטוף את הממברנה 3 פעמים, ולאחר מכן לסרוק את קרום לנתח את החלבונים עם מערכת הדמיית אינפרא אדום ו / או תרמי chemiluminescence לגילוי immunoblot (ראה רשימה של חומרים / ציוד).
    1. עבור שימוש במערכת ההדמיה אינפרא האדומה, ראה (6.4.1) ב קבצי קוד משלימה.
    2. לקבלה באמצעות תרמי chemiluminescence, ראה (6.4.2) ב קבצי קוד משלימה. השתמש chemiluminescent משופרת אולטרה רגיש (ECL) מצע (ראה רשימה של חומרים / ציוד) עבור מערכת זו.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

ניתוח Immunofluorescence של CENP-A אנדוגני תומך בהשערה כי האנזים CUL4A-E3 נדרש עבור לוקליזציה של CENP-א 'עד צנטרומר
המחקרים האחרונים שלנו הראו כי CUL4A-RBX1-COPS8 פעילות אנזים E3 נדרשה ubiquitylation של ליזין 124 (K124) על CENP-A ולוקליזציה של CENP-א 'עד צנטרומר. 17 בתחילה, המתחם-centromere ביניים (ICEN) היה מבודד על ידי אנטי CENP-A: immunoprecipitation הכרומטין הילידים, 32-34 וזה כבר שיערו כי בחלק מהחלבונים ICEN עשוי לשחק תפקיד ללוקליזציה-A CENP כדי צנטרומר. לכן, ניסויי מציאת siRNA בוצעו למסך חלבונים אשר בהעדר ביטוי מושרה delocalization של CENP-A ב צנטרומר 17 (מידע לא מוצג): אסינכרוני גדלו תאי הלה היו transfected עם Cullin 4A (CUL4A) siRNA או siRNA RBX1 עבור הפעמים נדרש עבור דלדול חלבון אופטימלי (48 שעות r עבור CUL4A ו -72 שעות עבור RBX1). תאים transfected עם siRNA CUL4A הראו delocalization משמעותי CENP-A ב צנטרומר (איור 1 א-ג). כפי שניתן לראות באיור 2G, רמות החלבון של CENP-A lysates תא הכולל של תאים-טרנספקציה siRNA CUL4A היו דומים לרמות-A CENP ב lysates מ בלוציפראז (לוק) תאי-טרנספקציה siRNA באותם תנאים תרבות. האפשרות של השפעות חוץ-יעד של siRNA CUL4A הוצאה, משום ביטוי אקטופי של CUL4A-הדגל הציל הפחתת CENP-A ב צנטרומר כאשר CUL4A siRNA ממוקד 3 'UTR (איור 2 א-ג). רמות החלבון של CENP-A lysates תא הכולל אושרו להיות דומה רמות-A CENP ב lysates מ לוק siRNA-transfected תאים באותם תנאים תרבות ללא תלות בגיל מחזור התא (איורים 1B, 2G); וכך, את האפשרות כי דלדול CUL4A שנגרם CENP-A פירוק חלבונים חוסל.

FO: keep-together.within-page = "1"> ליגאזות היוביקוויטין Cullin-RING-E3 (CRLs) הם המעמד הבולט של היוביקוויטין ליגאזות 35 ומכילים 3 מרכיבים מרכזיים: פיגום Cullin, חלבון הקמיצה (RBX1 או RBX2), וכן אנזים E2 טעון היוביקוויטין כי הוא גויס על ידי RBX1 או RBX2, 36 טבעת אצבע חלבון כמו כן, מגייסת מתאם מצע מציב מצעים בסמיכות אנזים E2 כדי להקל על העברת היוביקוויטין. 36 siRNAs RBX1 מושרה הפחתה משמעותית של CENP-A ב צנטרומר (איור 1D-F) תחת התנאים שבהם רמות החלבון של CENP-A lysates תא הכולל של תאים RBX1-טרנספקציה siRNA היו דומים לרמות CENP-A ב lysates מתאי-טרנספקציה siRNA לוק (איור 2G). הביזוי של CENP-חלבון או על ידי דלדול RBX1 או על ידי שילוב של CUL4A ודלדול RBX1 באותם תנאים תרבות לא נצפתה (איור 2G). האפשרות של השפעה מחוץ היעדים של RBX1 siRNA הוצא, משום ביטוי אקטופי של דגל-RBX1 הצילה הפחתת CENP-A ב צנטרומר כאשר RBX1 siRNA ממוקד 3 'UTR (איור 2 ד-ו). ממצאים אלה הציעו אנזים CUL4A-RBX1-E3 נדרש במיוחד עבור הלוקליזציה של CENP-א 'עד צנטרומר.

ניתוח Immunofluorescence של CENP-A אקסוגניים - חלבוני הדגל מציין כי CENP-A ubiquitylation K124 חיוני לוקליזציה של CENP-א 'עד צנטרומר
בעבר, ניתוח ספקטרומטריית immunoprecipitation-מסה שלנו הראה כי ליזין 124 (K124) של CENP-A-דגל ubiquitylated בתאים הלה. 17 בשנת המבנה הגבישי של CENP-A הנוקלאוזום, K124 מתגורר הסליל α3, אם כי האתר הוא לא בתוך האזור CATD. 17 בנוסף, K124 נשמרת בקרב יונקים, ציפורים, לטאות, צמחים, וקבוצה של פטריות (למשל, ניצןשמרים דינג). 17 CENP-A מוטנטים ליזין (איור 3 א) נבנו ונבדקו יכולתם למקם את centromere. ביטול משמעותי של לוקליזציה centromeric של אקסוגניים CENP-A מוטצית K124R עם אותות מפוזרים בשני תאי הלה mitotic ו שלבים נצפה (האיור 3B, C). לוקליזציה centromere לא הושפעה באופן משמעותי לא על ידי מוטציות K9A (K9 מתאים היסטון מתילציה H3 K9) ולא מוטציות K77R (K77 הוא אתר ליזין ייחודי CATD) (איור 3 ב, ג).

בהתבסס על תוצאות אלו, שתי השערות מוצעות בנוגע לפונקציית in vivo של CENP-A ubiquitylation ב K124. ראשית, תפקידו של ubiquitylation K124 מיועדת proteolysis בתיווך היוביקוויטין לחסל ביטוי יתר ו / או mislocalized CENP-א 'עד euchromatin. שנית, את התפקיד של CENP-A ubiquitylation על K124 הוא לטעינת CENP-A על צנטרומר. כדי לבדוק את fאפשרות irst, את היציבות של סוג בר CENP-A-הדגל מוטציה K124R וכן CENP-A אנדוגני לאחר cycloheximide (chx) לטיפול CUL4A- או תאים מדולדל RBX1 טופלו. נתונים אלה הציעו ubiquitylation של K124 הוא כנראה לא מעורב proteolysis בתיווך היוביקוויטין לחסל ביטוי יתר ו / או mislocalized CENP-A (מידע לא מוצג). 17. יתר על כן, הוא אישר כי המוטציה K124R מבטלת להקות monoubiquitylation ו diubiquitylation המשוערת, הן in vivo ו מבחני ubiquitylation במבחנה (מידע לא מוצג). 17 ביחד, נתונים אלה מראים כי המתחם CUL4A-RBX1 תורמת "איתות" ubiquitylation, אשר נדרש CENP-A לוקליזציה ב צנטרומר.

ניתוח Immunofluorescence של דגל אקסוגניים - חלבונים-A CENP עולה כי היתוך monoubiquitin מספיק כדי לטעוןCENP-A K124R ב צנטרומר
על סמך התוצאות לעיל, זה היה שיערו כי monoubiquitin מקושר קוולנטית משמש אות עבור CENP-A להעמיס צנטרומר. על מנת לבחון השערה זו, N-terminal דגל-מתויג בטרמינל C-היוביקוויטין התמזגו wild-type CENP-A ו- מוטציה K124R CENP-A נבנה (איור 4 א). מוטצית monoubiquitin UB (K48R), אשר חסר אתר מרכזי polyubiquitylation 37-39 שמשה גם כדי למנוע התמזג היוביקוויטין CENP-A חלבון מן polyubiquitylation הפוטנציאלי. על ידי לכידת אותות immunofluorescent אנטי-דגל, לוקליזציה centromeric של חלבונים המקודדים על ידי שני המושגים הללו נבדקה. בעוד דגל-CENP-A (K124) לוקליזציה centromere ביטל משמעותית של-A CENP (איור 4 ב ו 4C, עמודה [6]), הן דגל-CENP-A (WT) ודגל-CENP-A (WT) -Ub ( WT) מתוחזק לוקליזציה centromere שלהם (איור 4 ב ו 4C, עמודים [1] ו [2]). הדגל-CENP-A (K124R) -Ub (K48R) חלבון מן הסתם התנדנדה monoubiquitylated CENP-A, כמו חלבון זה שוחזר באופן משמעותי לוקליזציה צנטרומר (4C איור, להשוות עמודות [5] [6]) בצורה יעילה יותר מאשר CENP-A (K124R) -Ub (WT) (איור 4C, להשוות עמודות [4] - [6]). נתונים אלה הוכיחו כי monoubiquitylation מספיקה לגיוס CENP-א 'עד צנטרומר.

איור 1
איור 1. ניתוח Immunofluorescence של CENP-A אנדוגני תומך בהשערה כי CUL4A-E3 האנזים הדרוש לוקליזציה של CENP-א 'עד צנטרומר (דמויות הותאמו מ Niikura et al. 17). (א) delocalization CUL4A siRNA המושרה של CENP-A ב צנטרומר. תאים הלה היו transfected עם CUL4A או בלוציפראז (לוק) siRNA וטופחו במשך 48 שעות (טבלה 1). סרגל קנה מידה מייצג 10 מיקרומטר. (ב) ניתוח כתם המערבי של lysates התא כולו הלה תוך שימוש באותו מצב התרבות כמו ב (א). התאים נקצרו 48 שעות לאחר transfection עם CUL4A siRNA או לוק siRNA (טבלה 1). GAPDH שימש כביקורת הטעינה. (C) לכמת אנדוגני CENP-A אותות ב צנטרומר שמוצג (א). נורמליזציה של אותות בוצעה באמצעות לוק תאי siRNA-טרנספקציה, ואת אחוזי הממוצע (± סטיית תקן) מוצגים. **** P <0.0001 לעומת לוק תאים siRNA-טרנספקציה (מבחן t). (ד) RBX1 delocalization המושרה siRNA של CENP-A מ צנטרומר. תאים הלה היו transfected עם RBX1 או לוק siRNA (ים) וטופחו במשך 72 שעות (טבלה 1). סרגל קנה מידה מייצג 10 מיקרומטר. (ה) ניתוח כתם המערבי של lysates התא כולו הלה תוך שימוש באותו מצב התרבות כמו (D). התאים נקצרו 72 שעות לאחר transfection עם RBX1 or לוק siRNA (ים) (טבלה 1). GAPDH שימש כביקורת הטעינה. (F) לכמת אותות אנדוגני CENP-A ב צנטרומר שמוצג (ד '). נורמליזציה של אותות בוצעה באמצעות לוק תאי siRNA-טרנספקציה, ואת אחוזי הממוצע (± סטיית תקן) מוצגים. **** P <0.0001 לעומת לוק תאים siRNA-טרנספקציה (מבחן t). נא ללחוץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

איור 2
איור 2. מידע נוסף הקשור איור 1 צנטרומר (דמויות הותאמו מ Niikura et al. 17). (א) אקסוגניים CUL4A-דגל הצילה את delocalization של-A CENP כאשר CUL4A siRNA ממוקד 3 'UTR. cel הלה ט-Offls תוקנו ב 48 שעות לאחר cotransfection עם siRNA (CUL4A # 2: 3 'UTR היעד או לוק; טבלה 1) בתוספת לבנות פלסמיד (pTRM4-CUL4A-דגל או וקטור; טבלה 2). immunostaining 4 צבעים: מכתים עבור DAPI (כחול); דֶגֶל; CENP-B אנדוגני (אדום); ו CENP-A אנדוגני (ירוק), בוצע ותאי דגל חיובי מוינו, אבל תמונות דגל מושמטים לפשטות. הערה: CUL4A # 2 הוא היעד זהה לזה שמוצג באיור 1 א-ג. סרגל קנה מידה מייצג 10 מיקרומטר. (ב) ניתוח כתם המערבי של הלה ט-Off lysates התא כולו הבאה באותו מצב התרבות כפי שמוצג (א). GAPDH שימש כביקורת הטעינה. (C) CENP-A אותות ב צנטרומר שמוצג (א) היו לכמת ידי מיקרוסקופ לאחר מיון של תאי לבודד אותם מחויב נוגדן אנטי הדגל. נורמליזציה של אותות בוצעה עם תאים transfected עם לוק siRNA בתוספת וקטור, ואת אחוזי ממוצע (± סטיית תקן) מוצגים.**** P <0.0001 לעומת תאים transfected עם לוק siRNA בתוספת וקטור (שמאל טור מבחן t). (ד) אקסוגניים דגל-RBX1 הצילה את delocalization של CENP-A על centromere כאשר RBX1 siRNA ממוקד 3 'UTR . תאים הלה תוקנו ב 72 שעות לאחר cotransfection עם siRNA (RBX1 # 2: 3 'היעד UTR או לוק; טבלה 1) בתוספת לבנות פלסמיד (pcDNA3-דגל-RBX1 או וקטור; טבלה 2). immunostaining 4 צבעים: מכתים עבור DAPI (כחול); דֶגֶל; CENP-B אנדוגני (אדום); ו CENP-A אנדוגני (ירוק), בוצע ותאי דגל חיובי מוינו, אבל תמונות דגל מושמטים לפשטות. סרגל קנה מידה מייצג 10 מיקרומטר. (ה) ניתוח כתם המערבי של lysates התא כולו הלה בא באותו מצב התרבות כמו (D). GAPDH שימש כביקורת הטעינה. (F) אותות-A CENP ב צנטרומר שמוצג (ד) היו לכמת ידי מיקרוסקופ לאחר מיון של תאי לבודד אלה הקשורות ביניהן n נוגדן אנטי הדגל. נורמליזציה של אותות בוצעה עם תאים transfected עם לוק siRNA בתוספת וקטור, ואת אחוזי ממוצע (± סטיית תקן) מוצגים. **** P <0.0001 לעומת תאים transfected עם לוק siRNA בתוספת וקטור (בעמודה השמאלית, מבחן t). (ז) דלדול של CUL4A ו RBX1 לא השפיע על רמות של אנדוגני CENP-חלבון. רמות אנדוגני CENP-A חלבון נמדדו lysates התא כולו הלה שנקטפו 72 שעות לאחר transfection עם CUL4A, RBX1, CUL4A בתוספת RBX1, או לוק siRNA. ארבעים ושמונה שעות לאחר transfection, התאים היו או לא מטופלים (Asyn) או מטופלים עם פקליטקסל (+ מס) כדי לגרום ומעצרים מיטוזה, והם היו בתרבית למשך 24 שעות. GAPDH שימש כביקורת הטעינה. אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

32 / 53732fig3highres.jpg "width =" 700 "/>
איור 3. Immunofluorescence ניתוח של חלבונים אקסוגני CENP-A-דגל ציינו כי CENP-A ubiquitylation K124 נדרש CENP-A לוקליזציה ב צנטרומר (דמויות הותאמו מ Niikura et al. 17). (א) התבטאות יתר של CENP-A- בונה דגל (WT ו KR מוטציות) אושרה על ידי ניתוח כתם המערבי של הלה ט-Off lysates התא כולו. התאים נקצרו 48 שעות לאחר transfection עם pTRM4-CENP-A-דגל WT, מוטציות KR, או וקטור pTRM4 (טבלה 2). התבטאות יתר של CENP-A-דגל זוהה על ידי נוגדן אנטי הדגל. GAPDH שימש כביקורת הטעינה. CENP-A-דגל דימר המשוערת (##) ו CENP-A-דגל מונומר (#) מוצגים. הערה: SDS-עמיד הדימרים CENP-A דווחו בעבר 40,41 (ב) delocalization CENP-A מוטציה K124R הראה מתפזרת מ צנטרומר.. אותות DAPI (כחול), דגל (Green), ואת אנדוגני CENP-B (אדום; פקד מיקום centromere) מוצגים. הערה: בניגוד אנדוגני CENP-A בתאי transfected עם CUL4A או siRNA RBX1, אותות מפוזרים הופיעו בתאי overexpressed אקסוגניים CENP-A K124R-סמן כלא פנוטיפ של חוסר היכולת להיות ממוקדים צנטרומר, ככל הנראה בגלל רמת הביטוי שלה היא כ 10 - 25-לקפל גבוה יותר מזה של-A CENP אנדוגני (מידע לא מוצג) 17 בר סולם מייצג 10 מיקרומטר (C) היסטוגרמות של דפוסי לוקליזציה שמוצג (ב ')... יותר מ -50 תאים פרו / prometaphase ו metaphase ויותר מ -200 תאים שלבי הביניים לכל ניסוי נספרו (n ≥ 3 ניסויים). האחוזים הממוצעים (± סטיית תקן) מוצגים. "אחרים (Non-centromere)" מציין תאים פגומים בעיקר, תאים מתים, או תאים עם לוקליזציה nucleolar (רק הביניים), כנראה בשל transfection או טיפולים אחרים. *** P <0.001 לעומת CENP-A WT-דגל (מבחן t).

איור 4
איור 4. Immunofluorescence ניתוח של חלבונים דגל-CENP-A אקסוגניים ציינו כי CENP-A delocalization הצילה היתוך monoubiquitin של מוטציה CENP-A K124R מ צנטרומר (דמויות הותאמו מ Niikura et al. 17). (א) קריקטורות סכמטי של כל מבנה ששימשו במחקר זה (ראו גם טבלה 2). אתר המוטציה K124R על CENP-A (אדום) ואת אתר מוטצית K48R על monoubiquitin (כחול) מוצג. (1) WT: Flag-CENP-A WT, (2) WT-UB (WT): Flag-CENP-A WT-UB (WT), (3) WT-UB (K48R): Flag-CENP-A WT -Ub (K48R), (4) K124R-UB (WT): Flag-CENP-A K124R-UB (WT), (5) K124R-UB (K48R): Flag-CENP-A K124R-UB (K48R), (6) K124R: Flag-CENP-A K124R (B) אקסוגניים CENP-A delocalization הצילה היתוך monoubiquitin של מוטציה CENP-A K124R מ צנטרומר.. DAPI (כחול), דגל (ירוק), ו אנדוגני CENP-B (אדום; פקד מיקום centromere) מוצגים. סרגל קנה מידה מייצג 10 מיקרומטר. (C) היסטוגרמות של דפוסי לוקליזציה שמוצג (C). יותר מ -50 תאים פרו / prometaphase ו metaphase ויותר מ -200 תאים שלבי הביניים לכל ניסוי נספרו (n ≥ 3 ניסויים). האחוזים הממוצעים (± סטיית תקן) מוצגים. **** P <0.0001 ו *** P <0.001 לעומת הלא-התמזגו דגל-CENP-A K124R (עמודה [6]) (מבחן t). נא ללחוץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

יעד siRNA חיווי במחקר הנוכחי סוג יעד מספר נכסים באתר siRNA רצף קדמי (ים) מקור / הפניה
בלוציפראז (GL3) - 1 יעד RKK9 CUUACGCUGAGUACUUCGAdTdT Elbashir et al., (2001)
CENP-A CA-UTR בריכת siRNA (2 מטרות תערובת) RKK375 / 5 'UTR T1 CGAGCGGCGCGGACUUCUGCCdTdT Niikura et al., (2015)
RKK383 / 3 'UTR T1 UCCUGCACCCAGUGUUUCUGUdGdT Niikura et al., (2015)
CUL4A # 1 1 יעד CRKK178 / RKK309 / T1 AGCGAUCGUAAUCAAUCCUGA Niikura et al., (2015)
# 2 (3'UTR) 1 יעד CRKK181 / RKK331 / T4 AUGCGGGUUUGAAAUAUGACA Niikura et al., (2015)
RBX1 / ROC1 # 1 בריכת siRNA (4 מטרות תערובת) CRKK198 / RKK411 / T1 GAAGCGCUUUGAAGUGAAA Niikura et al., (2015)
CRKK198 / RKK413 / T2 GCAUAGAAUGUCAAGCUAA Niikura et al., (2015)
CRKK198 / RKK415 / T3 GCAAGAAGCGCUUUGAAGU Niikura et al., (2015)
CRKK198 / RKK417 / T4 CAACAGAGAGUGGGAAUUC Niikura et al., (2015)
# 2 (3 'UTR) 1 יעד CRKK206 / RKK425 / T8 UUCCCUGCUGUUACCUAAUUA Niikura et al., (2015)

רצפי siRNA בטבלה 1. השתמשו במחקר זה.

מספר B המאפיינים הרלבנטיים (ים) מקור / הפניה
B288 pTRM4 Niikura et al., (2006)
B2067 pTRM4-אדם CENP-A-Flag Niikura et al., (2015)
B2281 pTRM4-אדם CENP-A K9A-Flag Niikura et al., (2015)
B2387 pTRM4-אדם CENP-דגל K77R- Niikura et al., (2015)
B2388 pTRM4-הומאn CENP-A K124R-Flag Niikura et al., (2015)
B2512 pTRM4-דגל-אדם CENP-A Niikura et al., (2015)
B2579 pTRM4-דגל-אדם CENP-A K124R Niikura et al., (2015)
B2513 pTRM4-דגל-אדם CENP-A-UB (WT) Niikura et al., (2015)
B2559 pTRM4-דגל-אדם CENP-A K124R-UB (WT) Niikura et al., (2015)
B2515 pTRM4-דגל-אדם CENP-A-UB (K48R) Niikura et al., (2015)
B2560 pTRM4-דגל-אדם CENP-A K124R-UB (K48R) Niikura et al., (2015)
B2759 pTRM4-אדם CUL4A-Flag Niikura et al., (2015)
B2624 pcDNA3-דגל-אדם RBX1 Niikuraet al., (2015)
B1491 pcDNA3-Flag Niikura et al., (2015)

טבלה 2. וקטורים פלסמיד השתמשו במחקר זה.

R (אנטי-CENP-B) מדגם ב (אנטי-CENP-B) מדגם R (מופחת) יחס (מדגם S: מדגם R) יחס מתוקן (מדגם S: מדגם R)
520 514 6 -4.167 0.000
535 445 90 -1.033 0.000
515 431 84 .274 .274
562 483 79 .506 .506
902 562 340 .509 .509
1203 703 500 -0.560 0.000
1014 589 425 -0.819 0.000
768 510 258 -1.345 0.000
555 458 97 -1.845 0.000
781 576 205 -1.146 0.000
556 436 120 0.758 0.758
534 493 41 -1.634 0.000
702 543 159 .667 .667
482 429 53 -1.000 0.000 654 531 123 .740 .740
1190 607 583 .384 .384
552 454 98 .969 .969
489 413 76 .539 .539
511 452 59 -3.186 0.000
485 475 10 -2.700 0.000
481 441 40 -1.475 0.000
סְכוּם 5.347
מְמוּצָע .255
R (אנטי-CENP-B) ctrl ב (אנטי-CENP-B) יחס (S ctrl: R ctrl) יחס מתוקן (S ctrl: R ctrl)
543 483 60 3.017 3.017
526 466 60 2.667 2.667
532 460 72 1.792 1.792
507 457 50 3.520 3.520
491 458 33 4.273 4.273
545 464 81 2.160 2.160
518 484 34 3.559 3.559
461 404 57 2.404 2.404
487 447 40 3.550 3.550
534 477 57 3.965 3.965
528 456 72 3.097 3.097
707 601 106 1.868 1.868
615 528 87 2.828 2.828
660 481 179 1.620 1.620
565 476 89 1.607 1.607
527 455 72 3.583 3.583
560 474 86 2.930 2.930
510 451 59 4.017 4.017
729 586 143 2.678 2.678
634 576 58 3.655 3.655
507 476 31 3.935 3.935
סְכוּם 62.725
מְמוּצָע 2.987
הנותרים אותות-A CENP ב centromere (%) 8.5

. לוח 3. דוגמה אחת חישוב אותות CENP-A הנותרים centromere (%) דוגמה Pro / prometaphase באיור 2F מוצג: המדגם הוא RBX1 # 2 (3'UTR) + Vec (העמודה המרכזית באיור 2F ו) השליטה היא לוק + Vec (שמאל טור באיור 2F). כתוצאה מכך, הנותרים אותות CENP-A בcentromere (%) = (0,255 / 2,987) x 100 = 8.5% מתקבלים (או [5.347 / 62.725] x 100 = 8.5% עם אותו מספר התא הכולל [כלומר, 21 תאים], נתחו בין שתי דגימות). שים לב שאם ערך b הוא יותר מערך S (כלומר, אם הערך מופחת הוא שלילי), ערך יחס תיקן מוגדר 0.00.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

בשנים האחרונות מחקרים רבים פתחו מבחני מיקרוסקופיה כמותיים שונים עבור תאים קבועים. 42 התקדמות בביולוגיה-קינטוכור centromere לעתים קרובות דורש הבנה של קינטוכור ספציפי הספציפי centromere או תפקודם של חלבונים אשר מרחבית-טמפורלית subcellular תקנה משקפת את הפונקציות המשתנות של חלבונים אלה במהלך מחזור התא. לכן, כאן פתחנו שיטות מכתימות IIF וכן assay IIF כמותית לנתח את הרמות היחסיות במיוחד של אנדוגני וחלבוני CENP-A אקסוגניים, אשר יכול להיות רלוונטית בדגימות יחס שונה. נכון לעכשיו השגנו IIF מכתים מוצלח של אנדוגני CENP-I, CENP-H, KNL1, Hec1, ו Ska1 באמצעות פרוטוקול 2 במחקר זה (ראה Niikura ואח 24 ו מידע לא מוצג;. רשימה של חומרים / ציוד עבור מידע של נוגדנים) . בעתיד, אפשר להחיל באותה שיטה לכמת את רמת חלבוני centromere-קינטוכור שונים (הן endogenous ו מתויג דגל חלבונים אקסוגניים) בבחירת הנוגדנים הספציפיים, לעומת זאת, שיטות IIF שלנו אינן מכסות את זיהוי של חלבונים אלה בתאים חיים או בתא מסוים יחיד במהלך מחזור התא כולו. בגלל נהלים אלה מחייבים התאים להיות קבועים ומעובדים על coverslips נפרד, הצגנו אותות הייחוס (למשל, ACA או CENP-B) לצורך נורמליזציה כדי להשוות אותות למדי בקרב מדגמים שונים ולהגדיל את הדיוק של assay. בגלל ACA לערב אנדוגני ו / או אותות CENP-A אקסוגניים, CENP-B כאיתות התייחסות לצורך הנורמליזציה תהיה מתאימה יותר להשוואה מאשר היה ACA מבחינת הדיוק של assay כמוני של אותות CENP-A. האזור מסוף אמינו של CENP-B נקשר מוטיב 17 נ"ב של רצף CENP-B תיבת בדנ"א alphoid, והאזור carboxy הטרמינל של CENP-B מהווה homodimers. 43,44 CENP-B אינו colocalize לחלוטין עם-A CENP ו / או centr אחריםחלבוני omere-קינטוכור, לעומת זאת, קשור קשר הדוק איתם. 45 בעוד immunofluorescence עם נוגדנים נגד CENP-C בדרך כלל נותן שתי נקודות בדידות, מכתים עם אנטי CENP-B לעתים קרובות מופיע כעמודה בהירה אחד שמחבר השני צנטרומר אחותו. 46 עם זאת , תצפית מיקרוסקופית מאקרו בקנה מידה שלנו, כמה אותות CENP-B כנראה חפיפה עם אותות CENP-A, במיוחד בשלבים mitotic קודם לכן (-prometaphase prophase מ metaphase מאוחר), גם בחלק בהתאם לזווית תצפיתי וסוג מקבע בשימוש (מידע לא מוצג). לעומת זאת, ב assay IIF כמותי של אותות CENP-A, לוקליזציה חלבון של אותות הייחוס לא אמור להיות מושפע על ידי דלדול ו / או תפקוד לקוי של CENP-A לניתוח הוגן, אם כי לוקליזציה של רוב החלבונים-קינטוכור centromere תלויה CENP-A לוקליזציה ב צנטרומר. 47,48 הרכבת קינטוכור CENP-A-עצמאית היא הוקמה על ידי החלפת אזורי מחייב DNA של CENP-C ו CENP-T עם תחומים חלופי מיקוד כרומוזום העוסקות בגיוס החלבונים האלה כדי לוקוסים מחוץ לרחם. 49,50 בנוסף, העבודה האחרונה הצביעו על כך CENP-C ו- CENP-T מעשה במקביל לגייס לרשת קמן לרכיבי קינטוכור הפנימי קינטוכור. 51-54 יתר על כן, ואח Nishino. הציע כי הצורות המורכבות CENP-TWSX מבנה הנוקלאוזום דמוית ייחודי ליצור קשר עם DNA, הארכת 'קוד היסטון' מעבר חלבוני הנוקלאוזום הקנונית. 55 בגלל לוקליזציה centromere של CENP- C תלויה לוקליזציה centromere של-A CENP, 47,48 CENP-TWSX או במיוחד CENP-T יכול להיות מועמד אחר חלבון (ים) שלהם לספק אותות הייחוס ב assay IIF כמותי של-A CENP. עם זאת, מועמד איתות הפניה צריך להיבדק בקפידה לפני assay כדי לקבוע אם לוקליזציה ב צנטרומר מושפעת דלדול ו / או תפקוד לקוי של-A CENP. שיקול מקביליש לנקוט עבור מבחני כמותי IIF של חלבונים centromere-קינטוכור אחרים: לוקליזציה חלבון של אותות הייחוס לא אמור להיות מושפע על ידי דלדול ו / או תפקוד לקוי של חלבון המטרה לניתוח הוגן. במחקר הקודם, השתמשנו ACA כאיתות התייחסות assay IIF כמותית של חלבונים קינטוכור מרכזיים-חיצוניים אחרים. 24 ACA יכול להיות אפשרות מתאימה יותר יחיד CENP-B כביקורת עמדה וכן אות ייחוס, אם ACA אותות אינם מושפעים דלדול ו / או תפקוד לקוי של חלבון המטרה אבל colocalization של חלבון המטרה עם CENP-B הוא עני כאמור לעיל.

בודור et al. דווח כי רמות CENP-A centromeric מוסדרות המסות, כלומר, כמות CENP-A centromeric משתנית ביחס ישיר לתוכן הסלולר. 56 גם הם הראו כי אינדוקציה חולפת ביטוי CENP-A מובילה לעלייה מהירה של רמת CENP-A centromeric. לעומת זאת, צפינו אוכלוסיית תאים גדולים עם centromere-מקומי, דגל-tagged CENP-A WT לאחר cotransfection של וקטור ביטוי pTRM4 עם CA-UTR siRNAs (תערובת של 5 'ו 3' UTR siRNA; טבלה 1) (נתונים לא מוצג); אוכלוסייה זו הייתה גדולה יותר מזה שנראה לאחר transfection עם וקטור ביטוי pTRM4 בלבד. רמת-CENP דגל-tagged אקסוגניים חלבון שביטויים הונע על ידי pTRM4, היה כ -1.0 עד 1.4 סדרי גודל (10 עד פי 25) גבוה יותר מזה של אנדוגני CENP-A (מידע לא מוצג). ישנה סברה כי הביטוי של אקסוגניים CENP-A WT מעל סף מסוים עלולה להשפיע לרעה על לוקליזציה centromeric הראוי לו.

בפרוטוקולים הנוכחיים, קיבעון הוא שלב קריטי כדי לשמור על מבנה תאי וסביבה כמו מצב הפרוקסימלי ככל האפשר למצב הטבעי. לאחר תאים הם קבועים, אחד צריך להמשיך עם הפרוטוקול המכתים כדי למנוע אובדן של החלבון של inteלנוח או שאר התא. עם זאת, קיבעון הורס אתרים אנטיגני מדי פעם, ושילובי נוגדן-אנטיגן שונים לעבוד היטב עם מקבע אחד, אבל טוב מאוד עם אחר. 21 בגלל וריאציה זו, הבחירה של מקבע תלוי במידה רבה על החלבון (ים) של עניין. אורך הזמן של קיבעון יכול להשפיע באופן משמעותי על זיהוי של החלבון (ים) על ידי immunostaining, קיבעון קצר הוא בדרך כלל טוב יותר כדי לשמור על antigenicity. 57 לכן, בעת קביעת נהלים מכתימים עבור יעד חדש של חלבוני centromere-קינטוכור אחרים, במיוחד של ודאית לוקליזציה, או בעת עבודה עם נוגדן חדש, אחד צריכה לבדוק מספר שיטות של קיבעון מאגרים כדי למצוא את המצב האופטימלי. בפרוטוקולים הנוכחיים, שתי מעמדות של fixatives הפופולרי נבחרו: fixatives אלדהיד (פרוטוקול 2) וממסים אורגניים (פרוטוקולים 3 ו -4). הטוהר של fixatives הוא גם מאוד חשוב. ב 4 לפרוטוקול, 4% נסיוב עז משמש especially לחסום קולטני IgG על פני התא כדי להפחית את הרקע ספציפי. 57 באופן כללי, סרום לחסימת קולטני IgG אמור להיות מזן שאינו קשור נוגדן ראשוני ועדיף מאותו המין כמו נוגדנים משני. 57

בכל אחד מהפרוטוקולים הנוכחי, הבחירה של הנוגדן העיקרי הוא השלב הקריטי ביותר בהשגת immunostaining מוצלח. הנוגדן עם סגוליות גדולות, טוהרת, זיקה, ואת הלהיטות הוא רצוי. ריכוז פתיחה טוב נוגדנים חד שבטיים הוא בדרך כלל 1-5 מיקרוגרם / מיליליטר. דילולים אופייניים של ההכנה מלאי של נוגדני polyclonal נעים בין 01:20 ל -1:. 500 57 אחד צריכים לקבוע את הריכוז המתאים באופן אמפירי של הנוגדן הראשוני ואת diluent עבור כל דגימה. דוגמאות יש התנדנדה קלות אבל לא יובשו במהלך הדגירה של מכתים הומוגנית. כביסה נרחבת בין הדגירה של נוגדנים ראשיים ומשניntibody שיידרש כדי למנוע תגובה צולבת עם אימונוגלובולינים ממינים אחרים. עם זאת, תנאי הכביסה האופטימלי צריך להיקבע באופן אמפירי כדי למנוע אובדן תאים, במיוחד תאי mitotic, אשר לעגל ולנתק כאשר מטלטלים אותם (כלומר, לנער את mitotic). 58 עבור הצלחה, נוגדנים משני חייבים להיבחר להיקשר הנוגדן הראשוני עם זיקה גבוהה. למשל, כדי למנוע ספציפי מחייב של חלק Fc של נוגדנים משני לקולטנים Fc IgG, Fb (ab ') 2 שברים ניתן להשתמש במקום הנוגדן כולו. 57 עבור נוגדנים משני רבים, זמן דגירה ניתן למזער עד 30 דק' ב RT כדי להפחית את הרקע הספציפי.

בנוסף לפרוטוקול 5, מיקרוסקופיה confocal לייזר סריקה יכול להיות יתרון באיתור וניתוח לוקליזציה את תפקודם של חלבונים-קינטוכור centromere עם התכונות ניאון. כפי שניתן לראות רשימה של חומרים / EquipmeNT, Alexa פלואוריד 488 ו אלקסה פלואוריד 594 הם כנראה צבעי ניאון הנפוצים ביותר בשימוש בפרוטוקולים הנוכחיים. כדי לזהות שני ו / או חלבוני centromere-קינטוכור שונים מרובים במדגם, יש להבטיח כי הנוגדנים המשמשים לאיתור חלבון אחד לא למנוע זיהוי של החלבון השני. 57 בפרוטוקולים הנוכחיים, שני נוגדנים ראשוניים מעורבבים ויישומים באותו הזמן. עם זאת, אחד צריך לייעל את תנאי immunostaining עבור כל חלבון בנפרד לפני החלת הנוגדנים הראשוניים או משניים יחד: אם שני החלבונים נמצאים בסמיכות כמו במקרה של שני מרכיבים centromere-קינטוכור, נוגדן ראשוני ניתן מבני למנוע את הכריכה של נוגדן ראשוני שני. חשש נוסף של גילוי אותות מרובה הוא בעיית חפיפה ספקטרלית: הקושי במניעת אות מ צבע אחד "דולף" לתוך התעלה ספקטרלי של אחר. בעיה זו הופכת קשה יותר עבור כנסהמסנן הפרעה אל קובע לפתור כפי שמספר צבעים או אם המדגם מכיל אותות overenhanced (למשל, ACA או אותות-דגל אנטי במחקר הנוכחי), כולל התערבות של autofluorescence. פתרון בעיות של autofluorescence נערך במחקרים אחרים. 57,59,60 במחקר הנוכחי, אופטימיזציה של סינוני ניאון עם פקדים-תווית אחת בכל ערוץ מספיק ברוב המקרים, כדי למנוע בעיות אלה (ראה להלן).

בכל אחד מהפרוטוקולים הנוכחיים, בקרות נאותות חיוניות. כל נוגדן ראשוני חדש צריך להיות מאופיין לפני immunostaining מתחיל. הספציפי של הנוגדן צריך להיות מאושר על ידי ניתוח כתם מערבי, אם זה אפשרי. בנוסף, אישור כי המכתים אינו נגרם על ידי ספציפי מחייב את פני התא יש לקבל, ואת ריכוז העבודה האופטימלי של נוגדן ראשוני מסוים צריך להיקבע באמצעות דילולים סדרו(כלומר, עקום מחייב יש לפתח). כביקורת שלילית (כלומר, ההיעדר של הנוגדן הראשוני מהתהליך המכתים) צריך להיכלל. אפשרות נוספת של בקרה שלילית היא ההחלפה של IgG הנורמלי מאותו המין עבור הנוגדן הראשוני. לגילוי של תוויות מרובות, אחד חייב להכין שולט ללא נוגדנים משני (בקרת הרקע) וכן בקרות-תווית אחת להימנע חפצי חפיפה ספקטרלית (כלומר, לדמם דרך, מוצלב, crosstalk, או לצבוע "דולף", כפי שתואר לעיל ). אפשר לכמת את החלק היחסי של "דולף" על ידי השוואת אותות דרך המסננים "לא בסדר" עם האות הנכונה, באמצעות הפרופורציות הבאות להסרת מחשוב כל "דולף," ומחשוב החלוקה ו / או שיתוף הלוקליזציה האמיתית של תווית ניאון. 60 השלט ברקע יש לבחון באופן עצמאי עם כל ערוץ כדי להגדיר את גבולות רווח אות לקזז להיות עדהpted עבור ההדמיה הסופית. כל הערוצים אשר ישמש כדי להשיג תמונה של מדגם מרובה תווית חייבים להיות חשופים תיקון רקע עצמאי, כי רמת autofluorescence בכל ערוץ משתנית באופן משמעותי. את "דולף" שולטת כמתואר לעיל נדרשים כדי לקבוע את הסכום של רווח האות אפשרי בכל אחד מהערוצים ללא גילוי "דולף" לתוך ערוצים סמוכים. 60

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

החוקרים מצהירים כי אין להם אינטרסים כלכליים מתחרים.

Acknowledgments

עבודה זו נתמכה על ידי GM68418 מענק NIH.

Materials

Name Company Catalog Number Comments
Lipofectamin 2000 Life Technologies/Invitrogen 11668 transfection reagent I
Lipofectamin RNAiMAX Life Technologies/Invitrogen 13778 transfection reagent II
Opti-MEM I Life Technologies/Invitrogen 31985 Reduced serum media, warm in 37 °C water bath before use
High-glucose DMEM (Dulbecco’s modified Eagle’s medium) Life Technologies/BioWhittaker 12-604 high-glucose DMEM, warm in 37 °C water bath before use
Fetal Bovine Serum, certified, heat inactivated, US origin Life Technologies/Gibco 10082 FBS (fetal bovine serum)
Poly-L-Lysine SOLUTION SIGMA-SLDRICH P 8920 Poly-L-Lysine, 0.1% w/v, in water
UltraPure Distilled Water Life Technologies/Invitrogen/Gibco 10977 Sterile tissue culture grade water 
Micro Cover glass (22 mm x 22 mm)  Surgipath 105 Cover glass (22 mm x 22 mm) 
6 Well Cell Culture Cluster Fisher/Corning Incorporated 07-200-83 6-well polystyrene plate 
Penicillin, Streptomycin; Liquid Fisher/Gibco 15-140 Penicillin-streptomycin
PAP PEN  Binding Site AD100.1 Hydrophobic barrier pen (for a water repellant barrier in immunofluorescent staining)
Paclitaxel (Taxol) SIGMA-SLDRICH T7402 Taxol for mitotic cell analysis
TN-16, microtubule inhibitor (TN16) Enzo Life Sciences BML-T120 TN16 for mitotic cell analysis
BSA (bovine serum albumin) SIGMA-SLDRICH A7906 Blocking reagent
Triton X-100 SIGMA-SLDRICH T8787 Detergent for permeabilization
Paraformaldehyde SIGMA-SLDRICH P6148 Fixation reagant
DAPI SIGMA-SLDRICH D9542 For nuclear staining
p-phenylenediamine SIGMA-SLDRICH P6001 For mounting medium
VWR Micro Slides, Frosted VWR International 48312-013 Micro slides 
Anti-CENP-A antibody Stressgen/Enzo Life Sciences KAM-CC006 Mouse monoclonal antibody; dilution ratio of 1:100 (IIF), 1:5000 (WB)
Anti-CENP-B antibody Novus Biologicals H00001059-B01P Mouse monoclonal antibody; dilution ratio of 1:200 (IIF, methanol/acetone fixation)-1:400 (IIF, paraformaldehyde fixation)
Anti-CENP-B antibody  abcam ab25734 Rabbit polyclonal antibody; dilution ratio of 1:200 (IIF, methanol/acetone fixation)-1:400 (IIF, paraformaldehyde fixation)
Anti-centromere antibody (ACA) Fitzgerald Industries International, Inc. 90C-CS1058 Human centromere antiserum; dilution ratio of 1:2000 (IIF)
Anti-CENP-H antibody Bethyl Laboratories BL1112 (A400-007A) Rabbit polyclonal antibody; dilution ratio of 1:200 (IIF)
Anti-CENP-H antibody BD 612142 Mouse monoclonal antibody; dilution ratio of 1:200 (IIF)
Anti-CENP-I antibody N/A, Dr. Katusmi Kitagawa N/A, Dr. Katusmi Kitagawa Rabbit polyclonal antibody; dilution ratio of 1:1000 (IIF); Niikura et al., Oncogene, 4133-4146 (2006)
Anti-KNL1 antibody Novus Biologicals NBP1-89223 Rabbit polyclonal antibody; dilution ratio of 1:100 (IIF)
Anti-Hec1 antibody Novus Biologicals / GeneTex NB 100-338 / GTX70268 Mouse monoclonal antibody; dilution ratio of 1:100 (IIF)
Anti-Hec1 antibody GeneTex GTX110735 Rabbit polyclonal antibody; dilution ratio of 1:100 (IIF)
Anti-Ska1 antibody abcam ab46826 Rabbit polyclonal antibody; dilution ratio of 1:100 (IIF)
Anti-Flag antibody SIGMA-ALDRICH F3165 Mouse monoclonal antibody; dilution ratio of 1:1000 (IIF), 1:5000 (WB)
Anti-Flag antibody SIGMA-ALDRICH F7425 Rabbit polyclonal antibody; dilution ratio of 1:1000 (IIF), 1:5000 (WB)
Anti-CUL4A antibody N/A, Dr. Pradip Raychaudhuri N/A, Dr. Pradip Raychaudhuri Rabbit polyclonal antibody; dilution ratio of 1:3000 (WB); Shiyanov et al., The Journal of biological chemistry, 35309-35312 (1999)
Anti-RBX1 antibody Cell Signaling 4397 Rabbit polyclonal antibody; dilution ratio of 1:2000 (WB)
Anti-GAPDH antibody Chemicon MAB374 Mouse monoclonal antibody; dilution ratio of 1:5000 (WB)
Alexa Fluor 488 Goat Anti-Mouse IgG Life Technologies/Invitrogen A11001 fluorophore-conjugated secondary antibody (Affinity-purified secondary antibody)
Alexa Fluor 594 Goat Anti-Mouse IgG Life Technologies/Invitrogen A11005 fluorophore-conjugated secondary antibody (Affinity-purified secondary antibody)
Alexa Fluor 488 Goat Anti-Rabbit IgG Life Technologies/Invitrogen A11008 fluorophore-conjugated secondary antibody (Affinity-purified secondary antibody)
Alexa Fluor 594 Goat Anti-Rabbit IgG Life Technologies/Invitrogen A11012 fluorophore-conjugated secondary antibody (Affinity-purified secondary antibody)
Non fat powdered milk (approved substitution for carnation powdered milk) Fisher Scientific NC9255871 (Reorder No. 190915; Lot# 90629) Skim milk
Leica DM IRE2 motorized fluorescence microscope  Leica motorized fluorescence microscope 
HCX PL APO 63x oil immersion lens Leica LEICA HCX PL APO NA 1.40 OIL PH 3 CS 63X oil immersion lens
HCX PL APO 100x oil immersion lens Leica LEICA HCX PL APO NA 1.40 OIL PHE 100X oil immersion lens
Leica EL6000 compact light source Leica External compact light source for fluorescent excitation
ORCA-R2 Digital CCD camera  Hamamatsu C10600-10B digital CCD camera 
Openlab version 5.5.2 Scientific Imaging Software  Perkin Elmer/Improvision For image observation, acquisition, quantification, and analysis
Velocity version 6.1.1 3D Image Analysis Software  Perkin Elmer/Improvision For image observation, acquisition, quantification, and analysis
Complete EDTA-free protease inhibitor cocktail Roche 11873580001/11836170001 Protease inhibitor cocktail tablets
PlusOne 2-D Quant Kit Amersham Biosciences 80-6483-56 Commercial protein assay reagent I for measurement of protein concentration (compatible with 2% SDS)
Bio-Rad Protein Assay Bio-Rad 500-0006 Commercial protein assay reagent II for measurement of protein concentration (compatible with 0.1% SDS)
Immobilon-FL EMD Millipore IPFL00010 PVDF membrane for transferring
IRDye 800CW Goat Anti-Mouse IgG LI-COR Biosciences 926-32210 IR fluorescent dye-conjugated secondary antibody (Affinity-purified secondary antibody); dilution ratio of 1:20000 (IIF)
IRDye 680 Goat Anti-Rabbit IgG LI-COR Biosciences 926-32221 IR fluorescent dye-conjugated secondary antibody (Affinity-purified secondary antibody); dilution ratio of 1:20000 (IIF)
Goat anti-Mouse IgG DyLight 549 Fisher Scientific PI35507 DyLight-conjugated secondary antibodyIR fluorescent dye-conjugated secondary antibody (Affinity-purified secondary antibody); dilution ratio of 1:20000 (IIF)
Goat anti-Rabbit DyLight 649 Fisher Scientific PI35565 DyLight-conjugated secondary antibodyIR fluorescent dye-conjugated secondary antibody (Affinity-purified secondary antibody); dilution ratio of 1:20000 (IIF)
Goat anti-mouse IgG-HRP Santa Cruz SC-2005 HRP-conjugated secondary antibodyDyLight-conjugated secondary antibodyIR fluorescent dye-conjugated secondary antibody (Affinity-purified secondary antibody); dilution ratio of 1:10000 (IIF)
Goat anti-rabbit IgG-HRP Santa Cruz SC-2004 HRP-conjugated secondary antibodyDyLight-conjugated secondary antibodyIR fluorescent dye-conjugated secondary antibody (Affinity-purified secondary antibody); dilution ratio of 1:10000 (IIF)
Openlab version 5.5.2. Scientific Imaging Software  Improvision/PerkinElmer Software A
Volocity version 6.3 3D Image Analysis Software (Volocity Acquisition) PerkinElmer Software B1
Volocity version 6.3 3D Image Analysis Software (Volocity Quantification) PerkinElmer Software B2
Branson SONIFIER 450 Sonicator
Branson Ultrasonics sonicator Microtip Step, Solid, Threaded 9.5 mm VWR Scientific Products Inc.  33995-325 Disruptor horn for sonication
Branson Ultrasonics sonicator Microtip Tapered 6.5 mm VWR Scientific Products Inc.  33996-185 Microtip for sonication
Odyssey CLx Infrared imaging System  LI-COR Biosciences Infrared imaging system for immunoblot detection
Image Studio Analysis Software Ver 4.0  LI-COR Biosciences Software C
Molecular Imager Versadoc MP4000 System  Bio-Rad Chemiluminescence imager for immunoblot detection
Quantity One 1-D analysis software  Bio-Rad Software D
SuperSignal West Femto Maximum Sensitivity Substrate Thermo 34095 Ultra-sensitive enhanced chemiluminescent (ECL) substrate

DOWNLOAD MATERIALS LIST

References

  1. DeLuca, J. G., et al. Hec1 and nuf2 are core components of the kinetochore outer plate essential for organizing microtubule attachment sites. Molecular biology of the cell. 16, 519-531 (2005).
  2. Earnshaw, W. C., Halligan, N., Cooke, C., Rothfield, N. The kinetochore is part of the metaphase chromosome scaffold. J Cell Biol. 98, 352-357 (1984).
  3. Hoffman, D. B., Pearson, C. G., Yen, T. J., Howell, B. J., Salmon, E. D. Microtubule-dependent changes in assembly of microtubule motor proteins and mitotic spindle checkpoint proteins at PtK1 kinetochores. Molecular biology of the cell. 12, 1995-2009 (2001).
  4. Regnier, V., et al. CENP-A is required for accurate chromosome segregation and sustained kinetochore association of BubR1. Mol Cell Biol. 25, 3967-3981 (2005).
  5. Bernad, R., Sanchez, P., Losada, A. Epigenetic specification of centromeres by CENP-A. Exp Cell Res. 315, 3233-3241 (2009).
  6. Black, B. E., Cleveland, D. W. Epigenetic centromere propagation and the nature of CENP-a nucleosomes. Cell. 144, 471-479 (2011).
  7. Warburton, P. E., et al. Immunolocalization of CENP-A suggests a distinct nucleosome structure at the inner kinetochore plate of active centromeres. Curr Biol. 7, 901-904 (1997).
  8. Karpen, G. H., Allshire, R. C. The case for epigenetic effects on centromere identity and function. Trends Genet. 13, 489-496 (1997).
  9. Black, B. E., et al. Structural determinants for generating centromeric chromatin. Nature. 430, 578-582 (2004).
  10. Black, B. E., et al. Centromere identity maintained by nucleosomes assembled with histone H3 containing the CENP-A targeting domain. Mol Cell. 25, 309-322 (2007).
  11. Fachinetti, D., et al. A two-step mechanism for epigenetic specification of centromere identity and function. Nat Cell Biol. 15, 1056-1066 (2013).
  12. Zeitlin, S. G., Shelby, R. D., Sullivan, K. F. CENP-A is phosphorylated by Aurora B kinase and plays an unexpected role in completion of cytokinesis. The Journal of cell biology. 155, 1147-1157 (2001).
  13. Zhang, X., Li, X., Marshall, J. B., Zhong, C. X., Dawe, R. K. Phosphoserines on maize CENTROMERIC HISTONE H3 and histone H3 demarcate the centromere and pericentromere during chromosome segregation. The Plant cell. 17, 572-583 (2005).
  14. Goutte-Gattat, D., et al. Phosphorylation of the CENP-A amino-terminus in mitotic centromeric chromatin is required for kinetochore function. Proc Natl Acad Sci U S A. 110, 8579-8584 (2013).
  15. Bailey, A. O., et al. Posttranslational modification of CENP-A influences the conformation of centromeric chromatin. Proc Natl Acad Sci U S A. 110, 11827-11832 (2013).
  16. Samel, A., Cuomo, A., Bonaldi, T., Ehrenhofer-Murray, A. E. Methylation of CenH3 arginine 37 regulates kinetochore integrity and chromosome segregation. Proc Natl Acad Sci U S A. 109, 9029-9034 (2012).
  17. Niikura, Y., et al. CENP-A K124 Ubiquitylation Is Required for CENP-A Deposition at the Centromere. Dev Cell. (2015).
  18. Chan, G. K., Liu, S. T., Yen, T. J. Kinetochore structure and function. Trends in cell biology. 15, 589-598 (2005).
  19. Hori, T., Okada, M., Maenaka, K., Fukagawa, T. CENP-O class proteins form a stable complex and are required for proper kinetochore function. Molecular biology of the cell. 19, 843-854 (2008).
  20. Fukagawa, T., Earnshaw, W. C. The centromere: chromatin foundation for the kinetochore machinery. Developmental cell. 30, 496-508 (2014).
  21. Kedersha, N. The Proteintech Blog.Proteintech. Grainger, D. Proteintech Group. (2012).
  22. Clontech Laboratories, Inc. HeLa Tet-Off Advanced Cell Line. Available from: http://www.clontech.com/CR/Products/Inducible_Systems/Tetracycline-Inducible_Expression/ibcGetAttachment.jsp?cItemId=26908&fileId=6712191&sitex=10020:22372:US (2012).
  23. Meraldi, P., Sorger, P. K. A dual role for Bub1 in the spindle checkpoint and chromosome congression. EMBO J. 24, 1621-1633 (2005).
  24. Niikura, Y., et al. 17-AAG, an Hsp90 inhibitor, causes kinetochore defects: a novel mechanism by which 17-AAG inhibits cell proliferation. Oncogene. 25, 4133-4146 (2006).
  25. Yang, Z., et al. Silencing mitosin induces misaligned chromosomes, premature chromosome decondensation before anaphase onset, and mitotic cell death. Mol Cell Biol. 25, 4062-4074 (2005).
  26. Wang, H., et al. Histone H3 and H4 ubiquitylation by the CUL4-DDB-ROC1 ubiquitin ligase facilitates cellular response to DNA damage. Mol Cell. 22, 383-394 (2006).
  27. Lamb, J. R., Tugendreich, S., Hieter, P. Tetratrico peptide repeat interactions: to TPR or not to TPR? Trends Biochem Sci. 20, 257-259 (1995).
  28. Kitagawa, K., Skowyra, D., Elledge, S. J., Harper, J. W., Hieter, P. SGT1 encodes an essential component of the yeast kinetochore assembly pathway and a novel subunit of the SCF ubiquitin ligase complex. Mol Cell. 4, 21-33 (1999).
  29. Niikura, Y., Dixit, A., Scott, R., Perkins, G., Kitagawa, K. BUB1 mediation of caspase-independent mitotic death determines cell fate. J Cell Biol. 178, 283-296 (2007).
  30. Niikura, Y., Kitagawa, K. Identification of a novel splice variant: human SGT1B (SUGT1B). DNA Seq. 14, 436-441 (2003).
  31. Niikura, Y., Ogi, H., Kikuchi, K., Kitagawa, K. BUB3 that dissociates from BUB1 activates caspase-independent mitotic death (CIMD). Cell Death Differ. 17, 1011-1024 (2010).
  32. Ando, S., Yang, H., Nozaki, N., Okazaki, T., Yoda, K. CENP-A, -B, and -C chromatin complex that contains the I-type alpha-satellite array constitutes the prekinetochore in HeLa cells. Mol Cell Biol. 22, 2229-2241 (2002).
  33. Izuta, H., et al. Comprehensive analysis of the ICEN (Interphase Centromere Complex) components enriched in the CENP-A chromatin of human cells. Genes to cells : devoted to molecular & cellular mechanisms. 11, 673-684 (2006).
  34. Obuse, C., et al. Proteomics analysis of the centromere complex from HeLa interphase cells: UV-damaged DNA binding protein 1 (DDB-1) is a component of the CEN-complex, while BMI-1 is transiently co-localized with the centromeric region in interphase. Genes Cells. 9, 105-120 (2004).
  35. Merlet, J., Burger, J., Gomes, J. E., Pintard, L. Regulation of cullin-RING E3 ubiquitin-ligases by neddylation and dimerization. Cell Mol Life Sci. 66, 1924-1938 (2009).
  36. Bennett, E. J., Rush, J., Gygi, S. P., Harper, J. W. Dynamics of cullin-RING ubiquitin ligase network revealed by systematic quantitative proteomics. Cell. 143, 951-965 (2010).
  37. Antonelli, A., et al. Efficient inhibition of macrophage TNF-alpha production upon targeted delivery of K48R ubiquitin. Br J Haematol. 104, 475-481 (1999).
  38. Codomo, C. A., Furuyama, T., Henikoff, S. CENP-A octamers do not confer a reduction in nucleosome height by AFM. Nat Struct Mol Biol. 21, 4-5 (2014).
  39. Thrower, J. S., Hoffman, L., Rechsteiner, M., Pickart, C. M. Recognition of the polyubiquitin proteolytic signal. The EMBO journal. 19, 94-102 (2000).
  40. Yoda, K., et al. Human centromere protein A (CENP-A) can replace histone H3 in nucleosome reconstitution in vitro. Proc Natl Acad Sci U S A. 97, 7266-7271 (2000).
  41. Shelby, R. D., Vafa, O., Sullivan, K. F. Assembly of CENP-A into centromeric chromatin requires a cooperative array of nucleosomal DNA contact sites. J Cell Biol. 136, 501-513 (1997).
  42. Majumder, S., Fisk, H. A. Quantitative immunofluorescence assay to measure the variation in protein levels at centrosomes. J Vis Exp. (2014).
  43. Masumoto, H., Masukata, H., Muro, Y., Nozaki, N., Okazaki, T. A human centromere antigen (CENP-B) interacts with a short specific sequence in alphoid DNA, a human centromeric satellite. J Cell Biol. 109, 1963-1973 (1989).
  44. Yoda, K., Kitagawa, K., Masumoto, H., Muro, Y., Okazaki, T. A human centromere protein, CENP-B, has a DNA binding domain containing four potential alpha helices at the NH2 terminus, which is separable from dimerizing activity. J Cell Biol. 119, 1413-1427 (1992).
  45. Sugata, N., et al. Human CENP-H multimers colocalize with CENP-A and CENP-C at active centromere--kinetochore complexes. Hum Mol Genet. 9, 2919-2926 (2000).
  46. Earnshaw, W. C., Ratrie, H. 3rd, Stetten, G. Visualization of centromere proteins CENP-B and CENP-C on a stable dicentric chromosome in cytological spreads. Chromosoma. 98, 1-12 (1989).
  47. Goshima, G., Kiyomitsu, T., Yoda, K., Yanagida, M. Human centromere chromatin protein hMis12, essential for equal segregation, is independent of CENP-A loading pathway. J Cell Biol. 160, 25-39 (2003).
  48. Liu, S. T., Rattner, J. B., Jablonski, S. A., Yen, T. J. Mapping the assembly pathways that specify formation of the trilaminar kinetochore plates in human cells. J Cell Biol. 175, 41-53 (2006).
  49. Gascoigne, K. E., Cheeseman, I. M. T time for point centromeres. Nat Cell Biol. 14, 559-561 (2012).
  50. Gascoigne, K. E., et al. Induced ectopic kinetochore assembly bypasses the requirement for CENP-A nucleosomes. Cell. 145, 410-422 (2011).
  51. Nishino, T., et al. CENP-T provides a structural platform for outer kinetochore assembly. EMBO J. 32, 424-436 (2013).
  52. Malvezzi, F., et al. A structural basis for kinetochore recruitment of the Ndc80 complex via two distinct centromere receptors. EMBO J. 32, 409-423 (2013).
  53. Schleiffer, A., et al. CENP-T proteins are conserved centromere receptors of the Ndc80 complex. Nat Cell Biol. 14, 604-613 (2012).
  54. Rago, F., Gascoigne, K. E., Cheeseman, I. M. Distinct organization and regulation of the outer kinetochore KMN network downstream of CENP-C and CENP-T. Curr Biol. 25, 671-677 (2015).
  55. Nishino, T., et al. CENP-T-W-S-X forms a unique centromeric chromatin structure with a histone-like fold. Cell. 148, 487-501 (2012).
  56. Bodor, D. L., et al. The quantitative architecture of centromeric chromatin. Elife. 3, e02137 (2014).
  57. Oliver, C. Ch 58. Molecular Biomethods Handbook. Rapely, R., Walker, J. M. Humana Press. 1063-1079 (2008).
  58. Terasima, T., Tolmach, L. J. Changes in x-ray sensitivity of HeLa cells during the division cycle. Nature. 190, 1210-1211 (1961).
  59. Levenson, G. B. R. Ch 8. Biomedical Photonics Handbook. Vo-Dinh, T. uan CRC Press LLC. 8-19 (2003).
  60. Sanderson, J. Fluorescence bleed-though. Available from: http://www.gum2012.fionastoreydesign.co.uk/Downloads/Bleed through text.pdf (2011).
חלבונים Immunofluorescence ניתוח של אנדוגני אקסוגניים centromere-קינטוכור
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Niikura, Y., Kitagawa, K. Immunofluorescence Analysis of Endogenous and Exogenous Centromere-kinetochore Proteins. J. Vis. Exp. (109), e53732, doi:10.3791/53732 (2016).More

Niikura, Y., Kitagawa, K. Immunofluorescence Analysis of Endogenous and Exogenous Centromere-kinetochore Proteins. J. Vis. Exp. (109), e53732, doi:10.3791/53732 (2016).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter