Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Иммунофлуоресценции Анализ эндогенные и экзогенные Центромера-кинетохор Белки

Published: March 3, 2016 doi: 10.3791/53732

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

"Центромеры" были классически определены как области подавленной мейоза рекомбинации в области генетики, а затем признается в качестве первичной перетяжки митотических хромосом, который играет существенную роль в точной сегрегации хромосом во время митоза. "Кинетохоры" были описаны как многослойными структурами, которые связываются с микротрубочками на поверхности центромеры, как показали с помощью электронной микроскопии; "Кинетохоры" позже были определены как макромолекулы комплекс, который локализуется на центромеры митотических хромосом. Несмотря на драматическое дивергенции центромерных ДНК-последовательностей среди позвоночных, структура и состав кинетохора высоко консервативны. Динамическое взаимодействие между микротрубочек веретена и кинетохорах необходим для верной сегрегации хромосом во время митоза, а также дефекты в центромерно-кинетохорной функции приводят к анеуплоидии и тем самым рака.

Центромеры в большинстве эукариотне имеет определенной последовательности ДНК, но состоит из больших массивов (0,3-5 Мб) повторяющейся alphoid ДНК, состоящей из 171 пар оснований α-сателлитной ДНК. За исключением почкующихся дрожжей, идентичность центромеры достигается не с помощью ДНК - последовательности , но при наличии специального нуклеосом , который содержит вариант гистона H3 CenH3 (центромерно Белок A [CENP-А] в организме человека). 5 нуклеосом CENP-A локализуются в внутренняя пластина кинетохоров млекопитающих 7 и связываются с 171 п.о. α-сателлитной ДНК. Активные центромеры требуют CENP-А-содержащий нуклеосомы направить набор конститутивного центромерной-ассоциированной сети (CCAN) и кинетохорных белков, которые вместе регулируют прикрепление хромосом к митотического веретена и последующей прогрессии цикла через контрольно-пропускной пункт шпинделя.

В свете приведенного выше доказательства, CENP-А было предложено быть эпигенетическое знак центромеры 8; Тем не менее, процесс, посредством которого CENP-А включена INto центромерная ДНК и факторы, ответственные за это включение еще не были хорошо охарактеризованы. Короткий центромерно таргетирования домен (CATD) находится в гистона раза область CENP-A, и замена соответствующей области H3 с CATD достаточно прямой Н3 к центромеры. 9 Несколько исследований предложили функциональные роли для пост-трансляционной модификация (PTM) из CENP-A 12-16; Однако, молекулярные механизмы этих PTMs из CENP-А в наборе к центромерах до сих пор не выяснены. Ранее мы сообщали , что лигазная активность CUL4A-RBX1-COPS8 E3 требуется для CENP-A K124 убиквитилирования и локализации CENP-А к центромеры. 17

Обнаружение и определение характеристик кинетохорных белков привели к новому пониманию о расхождении хромосом. 18 Более 100 компонентов кинетохор были идентифицированы в клетках позвоночных различными подходами. 19,20 недостаточномустоя , как Кинетохоры сборки и функция также исходит из характеристики клеточных функций каждого центромерной-кинетохора белки и белок-белок сети в клетках. 19 прямой визуализации и передовые визуализации методы флуоресцентной микроскопии обеспечивают замечательную разрешение центромерных-кинетохора компонентов и позволяют непосредственное наблюдение конкретных молекулярных компонентов центромер и кинетохор. Кроме того, методы косвенного иммунофлуоресцентного (ИМФ), окрашивание с использованием специфических антител имеют решающее значение для этих наблюдений. Тем не менее, несмотря на многочисленные сообщения о протоколах IIF, немногие подробно обсуждаются проблемы конкретных центромерных-кинетохора белков. 1-4 Таким образом, разработка и методы IIF окрашивания и количественного анализа IIF отчетности конкретно анализировать каждую центромер-кинетохора белок является чрезвычайно важным. В IIF окрашивания, следует исходить с протоколом окрашивания, чтобы избежать потери белка, представляющего интерес, илиостальная часть клетки. Тем не менее, фиксация разрушает антигенные сайты время от времени, а также различные комбинации антитело-антиген плохо работают с одним фиксирующим средством , но очень хорошо с другим, 21 и выборе закрепителя зависит в значительной степени от белка (белков) , представляющих интерес. Таким образом, различные методы закрепляющие играют решающую роль в IIF окрашивания центромерных-кинетохора белков.

Разработаны Здесь Оптимизированные методы косвенного иммунофлуоресцентного (IIF) окрашивания и анализе для устранения локализации эндогенных центромерных-кинетохора белков, в том числе Флаг-меченых экзогенных белков CENP-A CENP-А и и количественному этих белков в клетках человека. Эти методы могут быть применены к анализу центромерных-кинетохора белков у других видов.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Культура клеток и трансфекция

  1. Поместите покровное стекло (22 мм х 22 мм) в полистирольной пластины 6-луночного. Необязательно пальто защитное стекло с поли-L-лизин, 0,1% вес / объем, в воде (см Перечень материалов / оборудования), чтобы держать делящихся клеток на покровного стекла, выполнив следующие действия:
    Примечание: Оптимальные условия должны быть определены для каждой строки и применения клеток.
    1. Консерванта пальто культуры поверхность с поли-L-лизин, 0,1% вес / об, в воде (0,4 мл / лунку 6-луночного полистирола пластины). Rock осторожно, чтобы обеспечить равномерное покрытие поверхности культуры.
    2. Через 5 мин раствор удалить с помощью аспирации и тщательно промыть поверхность стерильным ткани сорта культуры воды.
    3. Сухой, по меньшей мере 2 ч до введения клеток и среды.
  2. Семенной HeLa клетки или HeLa 17 Tet-Off клетки 17,22 на покровное стекло (22 мм х 22 мм) положить в 6-луночный полистирола пластины. Убедитесь , что плотность клеток составляет 5,4 × 10 5 на лунку. культуры клетокв среде DMEM с высоким содержанием глюкозы с добавлением 10% FBS и 1% пенициллина-стрептомицина.
    Примечание: Для получения оптимальных результатов, эмпирически определить плотность клеток для использования в посеве.
  3. Инкубируйте клетки при 37 ° С в атмосфере 5% CO 2 в течение 18 часов.
    Примечание: В случае HeLa Tet-Off клеток, транскрипции экзогенного гена активен в отсутствие индуктора (т.е. тетрациклин / доксициклин) поэтому культура клетки без тетрациклина / доксициклин и трансфекцию скоротечно с сверхэкспрессией вектором pTRM4 (таблица 2 ), чьи транскрипции регулируется промотором TRE (см ниже).
  4. Восемнадцать часов после посева, трансфекции клеток следующим образом:
    1. Сделать раствор А путем смешивания 1,5 мкл миРНК олиго (20 мкМ отожженной запаса; Таблица 1) и / или 2,0 мкг плазмидной (Таблица 2) в 50 мкл восстановленного сыворотки среды (см Перечень материалов / оборудования), и инкубировать при комнатной температуре в течение 5 мин ,
      Примечание: В этом анализе,СА-UTR миРНК (смесь 5 'и 3' UTR миРНК; Таблица 1) котрансфицируют для использования в протоколах 3 и 4 (см обсуждение).
    2. Сделать раствор B путем смешивания 0,75 мкл реагента для трансфекции I (см Перечень материалов / оборудования) в 50 мкл восстановленных сыворотки среду, и инкубировать при комнатной температуре в течение 5 мин.
      Примечание: Необязательный шаг является добавление 1,0 мкл реагента для трансфекции II (см Перечень материалов / оборудования).
    3. Смешать растворы А и В вместе, и инкубируют при комнатной температуре в течение 15 мин.
    4. Промыть культивируемые клетки один раз PBS, а затем добавляют 500 мкл уменьшенные сыворотки среды в каждую лунку 6-луночного полистирола пластины. Добавьте смесь растворов А и В (т.е. РНК и / или ДНК-липидный комплекс) непосредственно к каждому из отдельной скважины.
      Примечание: Конечная концентрация составляет 3,3 мкг / мл (плазмида); 50 нМ (миРНК).
    5. Инкубируйте клетки при 37 ° С в атмосфере 5% CO 2 в течение 4,5 ч. Изменение среды с высоким содержанием глюкозы DMEM остроумияч 10% FBS и 1% пенициллина-стрептомицина.
    6. Инкубируйте клетки при 37 ° С в атмосфере 5% CO 2 в течение 48-72 ч после трансфекции.
      Примечание: Для получения оптимальных результатов, инкубационный период для роста клеток, прежде чем фиксации должны быть определены эмпирически, и истощение белка и / или выражение должно быть подтверждено с помощью Вестерн-блот-анализа (см Протокол № 6).
    7. Если анализ митотических клеток представляет интерес, добавьте паклитаксел (10 нМ) в культивируемых клетках через 24 часа до того фиксации, или добавить TN16 (0,5 мкМ) в культивируемые клетки 2,5 ч до того фиксации.

2. Cell Фиксирование и Иммунофлуоресцентного Окрашивание для обнаружения эндогенного Центромера-кинетохор Белки (параформальдегид Фиксации)

  1. Приготовление фиксаторов, буферы и реагенты.
    1. Свеже готовят 50 мл 4% -ного раствора параформальдегида в PBS, рН 7,4.
      1. Добавить 40 мл 1 × PBS в стеклянный стакан на мешалке в вытяжном шкафу. Тепло в то время как stirrinг до приблизительно 60 ° С. Добавьте 2 г параформальдегида порошка в нагретом PBS.
      2. Повышение медленно рН путем добавления 1 мл 1 N NaOH в общей сложности, потому что порошок не сразу растворяются.
        Примечание: Решение очищает после добавления NaOH.
      3. После того, как параформальдегид растворится, остудить и профильтровать раствор.
      4. Доводят рН с 1 N HCl до рН 7,4 и объем раствора с 1 × PBS до 50 мл.
        Примечание: Порции раствора могут быть заморожены или хранить при температуре 2-8 ° С в течение до тех пор, как 1 неделя. Раствор должен быть ледяным или хранили при 4 ° С до тех пор, пока не будет использоваться.
    2. Приготовьте 50 мл буфера KB1, который состоит из 10 мМ Трис-HCl, рН 7,5; 150 мМ NaCl, 0,5% БСА; и 0,5% Тритон Х-100.
      Примечание: БСА должен быть свеже добавлен.
      Примечание: Буфер KB серии основаны на буфере KB , описанной в предыдущих докладах 1,2,4.
    3. Приготовьте 50 мл буфера KB2, который состоит из 10 мМ Трис-HCl,рН 7,5; 150 мМ NaCl, и 0,5% БСА.
      Примечание: БСА должен быть свеже добавлен.
    4. Подготовить 1 мл буфера, содержащего KB3 DAPI (50 нг / мл).
    5. Подготовьте 100 мл монтажной среды, которая состоит из 1 мг / мл п-фенилендиамин; 10% PBS и 90% глицерина.
      1. Доводят рН 1 × PBS до 9,8 с помощью 1 N NaOH, растворить п-фенилендиамин в растворе, а затем добавляют глицерин.
      2. Магазин 1 мл аликвоты при -80 ° С. Защита от света.
  2. Удалить культуральную среду путем аспирации через 48-72 ч после трансфекции (см Протокол 1) для фиксации клеток. Промойте клетки один раз PBS. Нанести PBS в сторону лунки с культурой, чтобы не мешать поверхности клеток.
    Примечание: Оптимальная точка времени для фиксации клеток должна быть определена эмпирически.
  3. Зафиксировать клетки, в 4% параформальдегид в PBS в течение 30 мин при температуре 4 ° С. Промойте клетки дважды буфера KB2 в достаточной мере удаления остаточного 4% параформальдегида.
  4. Permeabiатрических образцы в буфере KB1 в течение 30 мин при комнатной температуре. Промыть клетки один раз буфером KB2, и добавить буфер KB2 в течение 5 мин при комнатной температуре, чтобы дополнительный блок участков неспецифического связывания.
    Примечание: Буфер KB1 также в значительной степени способствует блокированию.
  5. Снимите защитное стекло (22 мм х 22 мм) из полистирола пластины 6-а с помощью щипцов. Используя гидрофобный барьер пера (см Перечень материалов / оборудования), нарисуйте бледно-зеленый квадрат или круг, чтобы сформировать гидрофобный барьер вокруг каждого образца покровного стекла. Не трогайте и не слишком близко к клеткам с гидрофобным барьерного пера. Поместите крышку стекла в новом 6-луночного полистирола пластины.
  6. Развести первичного антитела к центромеры или кинетохор белок (коэффициент разбавления 1: 100 до 1: 200, см также перечень материалов / оборудования) и либо анти-CENP-B антитела (коэффициент разбавления 1: 400) или анти- центромеры антител (АСА) (коэффициент разбавления 1: 2000) в качестве центромеры местоположение указателя буфере KB2.
    Примечание: Для получения оптимальных результатов, окончательный Concentraние первичного антитела в этом растворе должно быть определено эмпирически.
  7. Нанесите достаточный объем (приблизительно 30 мкл) разбавленного первичного антитела , чтобы погрузить образец клеток. Выдержите образец клеток в течение 1 ч при 37 ° С. Промойте клетки 3 раза буфером KB2.
  8. Использование буфера KB2, разбавленные флуорофор-конъюгированные вторичные антитела (коэффициент разбавления 1: 100 до 1: 200), направленный против каждого первичного антитела.
    Примечание: Для получения оптимальных результатов, конечная концентрация вторичного антитела в этом растворе должно быть определено эмпирически.
  9. Нанесите достаточный объем (падение примерно 30 мкл на покровного стекла) разбавленного вторичного антитела погрузить образец клеток. Выдержите образец клеток в течение 1 ч при 37 ° С. Прополощите клетки 5 раз буфером KB2 в течение периода 30 мин (пять 6 мин моет).
    Примечание: Для получения оптимальных результатов (т.е. для минимальной потери клеток), оптимальное условие стирки должно быть определено EmpiricaLLY.
  10. Нанесите достаточный объем буферной KB3, содержащей DAPI (50 нг / мл), чтобы погрузить образец клеток. Выдержите клеточного образца в течение 5 мин при комнатной температуре. Прополощите клетки 1-2 раза с буфером KB2.
  11. Установить защитное стекло, которое содержит образец клеток на микро слайд.
    1. Поместите каплю монтажа среды в центре микро слайд.
    2. Удалить жидкость из образца клеток и, с помощью рук или пинцета, поместить образец в центре микро слайд. Избегайте пузырьков воздуха.
    3. Удалите излишки монтажной среды с бумажным полотенцем.

3. Cell Фиксирование и Иммунофлуоресцентного Окрашивание C-концевой Flag-меченый CENP-A Белки (Ацетон Фиксации)

  1. подготовка
    1. Приготовьте ледяной 75% ацетона.
    2. Свеже готовят 50 мл PBS (рН 7,4), содержащем 0,5% обезжиренного молока и 0,5% бычьего сывороточного альбумина.
    3. Свеже готовят 50 мл PBS (рН 7,4), содержащего 0,1% обезжиренного молока и 0,1% бычьего сывороточного альбумина.
    4. Подготовить 1 мл PBS (рН 7,4), содержащий DAPI (50-100 нг / мл).
    5. Подготовьте 100 мл монтажной среды, как описано в 2.1.5.
  2. Удалить культуральную среду путем аспирации через 48-72 ч после трансфекции (см Протокол 1) для фиксации клеток. Промойте клетки один раз PBS. Применить PBS к стороне культуральную лунку, чтобы не мешать поверхности клеток.
    Примечание: Оптимальная точка времени для фиксации клеток должна быть определена эмпирически.
  3. Зафиксировать клетки в охлажденном на льду 75% ацетона, и инкубировать клетки в течение 10 мин при -20 ° С. Сухие клетки на покровного стекла в вытяжном шкафу в течение 30-60 мин при комнатной температуре.
    Примечание: Для получения оптимальных результатов, продолжительность времени, необходимого для фиксации и клеточной сушки должна быть определена эмпирически.
  4. Используя гидрофобный барьер пера (см Перечень материалов / оборудования), нарисуйте бледно-зеленый квадрат или круг, чтобы сформировать гидрофобный барьер вокруг каждого образца покровного стекла. Не трогайте и не слишком близко к клеткам с гидрофобным барьерного пера.
  5. Блок nonspecIFIC сайты связывания на клетках добавлением PBS, содержащего 0,5% обезжиренного молока и 0,5% бычьего сывороточного альбумина в течение 5 мин при комнатной температуре.
  6. С помощью PBS, содержащего 0,1% обезжиренного молока и 0,1% бычьего сывороточного альбумина, разбавленные антитела анти-Flag (1: 1000 коэффициент разбавления) и либо анти-CENP-B-антитела (соотношение при разбавлении 1: 200) или ACA (соотношение 1: 2000 разбавление ) в качестве центромеры местоположения маркера.
    Примечание: Для получения оптимальных результатов, конечная концентрация первичного антитела в этом растворе должно быть определено эмпирически.
  7. Нанесите достаточный объем (приблизительно 30 мкл) разбавленного первичного антитела , чтобы погрузить образец клеток. Выдержите образец клеток в течение 1 ч при 37 ° С. Прополощите клетки 5 раз с блокирующим буфером в течение периода 30 мин.
    Примечание: Клетки могут быть промыты PBS. Для получения оптимальных результатов (то есть, чтобы избежать потери клеток), оптимальные условия промывки должны быть определены эмпирически.
  8. Развести флуорофора-конъюгированные вторичные антитела (коэффициент разбавления 1: 100 до 1: 200), направленный противЕАП первичное антитело в PBS, содержащем 0,1% обезжиренного молока и 0,1% бычьего сывороточного альбумина.
    Примечание: Для получения оптимальных результатов, конечная концентрация вторичного антитела в этом растворе должно быть определено эмпирически.
  9. Нанесите достаточный объем (приблизительно 30 мкл) разбавленного вторичного антитела , чтобы погрузить образец клеток. Выдержите образец клеток в течение 1 ч при 37 ° С. Прополощите клетки в 2 раза ФБР, содержащим 0,1% обезжиренного молока и 0,1% бычьего сывороточного альбумина.
    Примечание: PBS в одиночку, также может быть использован, чтобы промыть клетки.
  10. Нанесите достаточный объем PBS, содержащий DAPI (50-100 нг / мл), чтобы погрузить образец клеток. Выдержите клеточного образца в течение 5 мин при комнатной температуре. Прополощите клетки 1-2 раза с PBS.
  11. Установите крышку стекла, содержащего образец клеток на микро слайд, как описано в 2.11.

4. Cell Фиксирование и Иммунофлуоресцентного Окрашивание N-концевой Flag-меченый CENP-A Белки (Метанол Фиксации)

  1. подготовка
    1. Приготовьте ледяной метанола.
    2. Готовят TBS (рН 7,4), содержащего 4% сыворотки козьего.
    3. Подготовка 1 мл TBS (рН 7,4), содержащий DAPI (50-100 нг / мл).
    4. Подготовьте 100 мл монтажной среды, как описано в 2.1.5.
  2. Удалить культуральную среду путем аспирации через 48-72 ч после трансфекции (см Протокол 1) для фиксации клеток. Промойте клетки один раз с TBS. Применение TBS в сторону лунки с культурой, чтобы не мешать поверхности клеток.
    Примечание: Оптимальная точка времени для фиксации клеток должна быть определена эмпирически.
  3. Зафиксировать клетки, в охлажденном льдом метаноле, и инкубировать клетки в течение 6 мин при -20 ° С. Промойте клетки дважды TBS в достаточной мере удаления остаточного метанола.
  4. Используя гидрофобный барьер пера (см Перечень материалов / оборудования), нарисуйте бледно-зеленый квадрат или круг, чтобы создать гидрофобный барьер вокруг каждого образца покровного стекла. Не трогайте и не слишком близко к клеткам с гидрофобным барьерного пера.
  5. Блок неспецифические сайты связывания на КВЖДLs Добавив TBS, содержащим 4% сыворотки козы. Инкубировать в течение 10 мин при комнатной температуре.
  6. Развести антитело анти-Flag (1: 1000 разведение) и либо анти-CENP-B антитела (коэффициент разбавления 1: 200) или АСА (1: 2000 Коэффициент разбавления) в качестве центромеры местоположения маркера в TBS, содержащем 4% сыворотки козьего ,
    Примечание: Для получения оптимальных результатов, конечная концентрация первичного антитела в этом растворе должно быть определено эмпирически.
  7. Нанесите достаточный объем (приблизительно 30 мкл) разбавленного первичного антитела , чтобы погрузить образец клеток. Выдержите образец клеток в течение 1 ч при 37 ° С. Прополощите клетки 5 раз с блокирующим буфером в течение периода 30 мин. Для достижения оптимальных результатов (т.е. минимальной потерей клеток), оптимальное условие стирки должно быть определено опытным путем.
  8. Развести флуорофора-конъюгированные вторичные антитела (коэффициент разбавления 1: 100 до 1: 200), направленный против каждого первичного антитела в TBS, содержащем 4% сыворотки козьего.
    Примечание: Для получения оптимальных результатов, FINAл концентрация вторичного антитела в этом растворе должно быть определено эмпирически.
  9. Нанесите достаточный объем (приблизительно 30 мкл) разбавленного вторичного антитела , чтобы погрузить образец клеток. Выдержите образец клеток в течение 1 ч при 37 ° С. Промыть клетки 3 раза с блокирующим буфером.
  10. Нанесите достаточный объем TBS, содержащих DAPI (50-100 нг / мл), чтобы погрузить образец клеток. Выдержите клеточного образца в течение 5 мин при комнатной температуре. Прополощите клетки 1-2 раза с TBS.
  11. Установить защитное стекло, которое содержит образец клеток на микро слайд, как описано в 2.11.

5. Иммунофлуоресценции изображение для наблюдения, сбора, Количественный и анализ

  1. Обратите внимание на образец клеток с помощью моторизированного флуоресцентного микроскопа, оснащенного 63X и 100X иммерсионным объективом, внешний компактный источник света, и цифровой ПЗС-камеры.
  2. Выполнять сбор и обработку изображений, включая деконволюции, с помощью программного обеспеченияA, или Softwares В1 и В2 (см Перечень материалов / оборудования). Пожалуйста, смотрите Дополнительный код файлов (5.2.1) для всех команд, используемых в Software A. Для всех команд, используемых в Softwares В1 и В2, см (5.2.2) в дополнительные файлы кода.
  3. С помощью описанного выше метода 23-25 ​​для количественного определения сигналов центромерных-кинетохора белков (например, остальные сигналы CENP-A на центромеры) со следующими незначительными изменениями:
    1. Выберите область центромеры-кинетохора белков и фона следующим образом:
      1. Митотическое клеток: (центромерно-кинетохора область) Выберите область перекрытия с хромосомами окрашивали DAPI; (фоновая область) и область вне хромосом , но внутри идентичной одной клетки (т.е. цитозольного область).
      2. Interphase клеток: (центромерно-кинетохора область) Выберите область перекрытия с хроматином окрашивали DAPI; (Фоновая область) и область за пределами хроматина, но внутри идентичной одной ячейки (<EM> т.е. цитозольная область).
        Примечание: Смотрите также Дополнительный код файлов (5.2.1.4.3) или (5.2.2.6.4) для выбора области с программным обеспечением A или Software В2 соответственно.
    2. Количественно процент оставшихся сигналов на центромерах с помощью программного обеспечения А или В. Для решения этой задачи, используйте следующую формулу:
      Остальные сигналы центромерно-кинетохорной белка в центромерной-кинетохорах
      Equation1
      где s является яркость сигнала выбранной области, что подтверждается ACA или окрашивания CENP-B; б является яркость фонового сигнала; г образца является эталонным ACA или CENP-B сигналы для миРНК (ов) -обработанной клеток; и г Ctrl является опорным ACA или сигналы CENP-B для Luc миРНК-трансфецированных клеток.
      Примечание: В этом анализе, CENP-B сигналы были использованы в качестве опорных сигналов для CUL4A и RBX1, как описано в предыдущих докладах.
    3. Используйте файл Excel для этого вычисления после копирования и вставки необработанных данных из программного обеспечения сигнала количественного описанного выше. Смотрите также дополнительные файлы Код: (5.2.1.4) и (5.2.2.6) для деталей. Одним из примеров расчета представлены в таблице 3.
  4. Анализ по меньшей мере, 20 клеток, чтобы исключить изменение окраски и получения изображений для каждого уровня измерения. Необязательно использовать "усредненное значение" оставшихся центромере-кинетохора сигналов для каждой анализируемой ячейки, чтобы сравнить эти значения между различными центромерных-кинетохора белков.

6. Вестерн-блот-анализ общего белка

  1. Ресуспендируют клеток в денатурирующем буфере А (20 мМ Трис-HCl, рН 7,4; 50 мМ NaCl, 0,5% Нонидет Р-40; 0,5% дезоксихолата, 0,5% ДСН, 1 мМ ЭДТА, и полный ЭДТА-свободный ингибитор протеазы коктейль), 26 при условии подвески к озвучивания и процесса замораживания-оттаивания, и мерыКонцентрации белка в следующем порядке:
    1. Для процесса обработки ультразвуком, добавить 50 мкл буфера А к клеткам, собранных из двух лунок полистирольной пластины 6-луночного через 48-72 ч после трансфекции (см Протокол 1). Эксплуатация на ультразвуковом оборудованного разлагателей рогом и микроострия (см Перечень материалов / оборудования) в течение всего 15 сек продолжительность прерывистого импульса (рабочий цикл 50%) в расчете на одну выборку.
    2. Для процесса замораживания-оттаивания, заморозить клетки с жидким азотом и размораживанию клеток при комнатной температуре.
    3. Измерение концентрации белка с использованием коммерческого анализа белка I реагента или II (см Перечень материалов / оборудования).
      Примечание: лизаты разводили соотношении 1:10 при измерении концентрации белка либо с I или II реагента. При этом разбавлении SDS присутствует в буфере А показывает, мало или вообще без помех в этом измерении.
  2. Смешайте лизата , содержащего 20-30 мкг общего белка с 2 × или 4 × SDS-PAGE буфера загрузки. 27 Закипите образцы для5 мин, а затем загрузить их на 12,0% -15.0% -ном денатурирующем ДСН-полиакриламидном геле для электрофореза.
  3. Перенос белков , разделенных SDS-PAGE на ПВДФ - мембрану с помощью Вестерн - блоттинга метод , описанный ранее. 17,24,27-31
    1. Блок сайты неспецифического связывания на мембране с помощью 5% молока обезжиренного в 1 × PBS, а затем инкубируют мембрану с растворами разбавленных первичными антителами в течение 1 ч при комнатной температуре. См Перечень материалов / оборудования для получения более подробной информации (например, коэффициент разбавления) каждого первичного антитела.
    2. После промывки мембрану 3-4 раза (каждый от 3 до 5 мин инкубации при встряхивании) с PBS-T-буфере (1 × PBS, и 0,1% твина-20), инкубирование мембраны в смеси в ближней инфракрасной области (ИК) флуоресцентный краситель-конъюгированные вторичные антитела (коэффициент разбавления 1: 20000), DyLight-конъюгированные вторичные антитела (коэффициент разбавления 1: 20000), и / или с пероксидазой хрена (HRP) вторичные антитела (разбавленный в PBS-T; dilutiна соотношении 1: 10000) в течение 1 ч при комнатной температуре. См Перечень материалов / оборудования для получения более подробной информации (например, коэффициент разбавления) каждого вторичного антитела.
  4. Вымойте мембраны 3 раза, а затем сканировать мембрану для анализа белков с инфракрасной системой визуализации и / или хемилюминесценции томографа для обнаружения иммуноблот (см Перечень материалов / оборудования).
    1. Для использования инфракрасной системы визуализации, см (6.4.1) в дополнительных файлов кода.
    2. Для использования хемилюминесценции тепловизора см (6.4.2) в дополнительные файлы кода. Используйте ультрачувствительный расширение Хемилюминесцентный (СТЭК) подложки (см Перечень материалов / оборудования) для этой системы.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Иммунофлуоресценции анализ эндогенных CENP-A поддерживает гипотезу о том, что CUL4A-E3 лигаза требуется для локализации CENP-A к центромерах
Наши недавние исследования показали , что лигазная активность CUL4A-RBX1-COPS8 E3 требуется для убиквитилирования лизина 124 (K124) на CENP-А и локализации CENP-A к центромерах. 17 Первоначально интерфаза-центромерно комплекс (ICEN) был выделен анти-CENP-A: родной иммунопреципитация хроматина, 32-34 , и было высказано предположение , что некоторые белки ICEN могут играть определенную роль в локализации CENP-A к центромеры. Таким образом, эксперименты нокдаун миРНК проводили для скрининга белков, отсутствие экспрессии индуцированного делокализа- CENP-A на центромеры 17 (данные не показаны): асинхронно растущие клетки HeLa трансфицировали Cullin 4A (CUL4A) миРНК или RBX1 миРНК в течение времени необходимое для истощения оптимального белка (48 чг для CUL4A и 72 ч для RBX1). Клетки , трансфицированные CUL4A миРНК показал значительное делокализацию CENP-A на центромеры (рис 1A-C). Как показано на рисунке 2 г, уровни протеина CENP-А в лизате клеток CUL4A миРНК-трансфицированных клеток были аналогичны уровням CENP-А в лизатах из люциферазы (Luc) миРНК-трансфецированных клеток при тех же условиях культивирования. Возможность вне целевых эффектов CUL4A миРНК был исключен, потому что эктопическая экспрессия CUL4A-Flag спас сокращение CENP-A на центромеры , когда CUL4A миРНК целевой 3' - UTR (рис 2A-C). Уровни протеина CENP-А в общей сложности лизатов клеток были подтверждены быть похожими на уровни CENP-A в лизатах из Люк миРНК-трансфецированных клеток при тех же самых условиях культивирования , независимо от (1В фигуры, 2G) стадии клеточного цикла; Таким образом, вероятность того, что истощение CUL4A причиной CENP-деградации белка была ликвидирована.

35 и содержит 3 основных элемента: Cullin эшафот, белок безымянного пальца (RBX1 или RBX2) и убиквитин заряженный E2 фермент , который завербован RBX1 или RBX2, 36 безымянного пальца белок также принимает на работу адаптер субстрат , который размещает подложки в непосредственной близости к ферменту Е2 для облегчения передачи убиквитин. 36 RBX1 миРНК вызвало значительное снижение CENP-A на центромеры (рис 1D-F) в условиях , в которых уровни протеина CENP-А в общей сложности лизатов клеток RBX1 миРНК-трансфицированные клетки аналогичны уровням CENP-А в лизатах из Luc миРНК-трансфицированных клеток (рис 2G). Деградация CENP-A белка либо путем разрушения RBX1 или комбинацией CUL4A и истощением RBX1 при тех же самых условиях культивирования не наблюдалось (рис 2G). Возможность вне целевого эффектае годы RBX1 миРНК был исключен, потому что эктопическая экспрессия FLAG-RBX1 спасли сокращение CENP-A на центромеры , когда RBX1 миРНК ориентирована на 3 'UTR (рис 2D-F). Эти результаты свидетельствуют о том, что CUL4A-RBX1-E3 лигаза конкретно требуется для локализации CENP-А к центромеры.

Иммунофлуоресценции анализ экзогенной CENP-A - Флаг указывает , что белки CENP-A K124 убиквитилирование имеет важное значение для локализации CENP-A к центромерах
Ранее наша иммунопреципитации-масс - спектрометрический анализ показал , что лизин 124 (K124) из CENP-A-Flag является убиквитилируются в клетках HeLa. 17 В кристаллической структуре CENP-нуклеосомнои, K124 находится в спирали а3, хотя сайт не в CATD регионе. 17 Кроме того, K124 сохраняется среди млекопитающих, птиц, ящериц, растений и группы грибов (например, Почкадинь дрожжи). 17 CENP-A мутанты лизина (рис 3А) были построены и испытаны на их способность локализовать к центромеры. Существенная упразднение центромерной локализации экзогенного CENP-мутант , K124R диффузной сигналы в обоих митотических и интерфазных клетках HeLa наблюдалось (фигура 3В, С). Локализация Центромера не было существенного влияния ни K9A мутаций (К9 соответствует гистона H3 K9 метилирование) , ни K77R мутации (K77 это уникальный сайт лизина в CATD) (фигура 3В, С).

На основании этих результатов, две гипотезы предложены в отношении функции в естественных условиях CENP-A убиквитилирования на K124. Во-первых, роль K124 убиквитилирования для убиквитин-опосредованного протеолиза для устранения избыточной экспрессии и / или mislocalized CENP-A к эухроматине. Во-вторых, роль CENP-A убиквитилирования на K124 для загрузки CENP-A на центромеры. Чтобы проверить, диафрагменноеIRST возможность, были рассмотрены стабиль- из CENP-A-Flag дикого типа и мутанта K124R, а также эндогенных CENP-А после циклогексимид (СНХ) лечения CUL4A- или RBX1 обедненного клетки. Эти данные свидетельствуют о том, что убиквитилирование из K124, вероятно , не участвует в убиквитин-опосредованного протеолиза для устранения избыточной экспрессии и / или mislocalized CENP-A (данные не показаны). 17. Кроме того, было подтверждено , что мутация K124R аннулирует предположительные monoubiquitylation и diubiquitylation полос, как в в естественных условиях и в пробирке убиквитилированию анализов (данные не показаны). 17 Итак , эти данные свидетельствуют о том, что CUL4A-RBX1 комплекс способствует «сигнальное» убиквитилированию, который необходим для CENP-локализации на центромеры.

Иммунофлуоресценции анализ экзогенной Flag - белков CENP-A указывает на то, что monoubiquitin слитый достаточно для загрузкиCENP-A K124R в центромерах
На основании приведенных выше результатов, было высказано предположение, что ковалентно связанный monoubiquitin служит сигналом для CENP-A погрузка на центромеры. Чтобы проверить эту гипотезу, в N-концевой Flag-меченый и C-концевой убиквитин-слитый дикого типа CENP-А и K124R мутант был построен CENP-A (рис 4а). Monoubiquitin мутант Ub (K48R), в котором отсутствует главный сайт для polyubiquitylation 37-39 был также использован для предотвращения убиквитин-слитый CENP-Белок от потенциального polyubiquitylation. Захватив иммунофлуоресцентного сигналы анти-Flag, был испытан центромерная локализация белков, кодируемых этими конструкциями. Принимая во внимание , Flag-CENP-A (K124) , по существу аннулировано локализации центромеры CENP-A (рис 4В и 4С, столбец [6]), оба флага-CENP-А (WT) , и флаг-CENP-А (WT) -Ub ( WT) , сохраняют свою локализацию центромеры (рисунок 4В и 4С, столбцы [1] и [2]).Флаг-CENP-A (K124R) -Ub (K48R) белок предположительно передразнил monoubiquitylated CENP-А, так как этот белок , по существу восстановлен локализации в центромерах (рис 4C, сравнить столбцы [5] и [6]) более эффективно , чем сделал CENP-A (K124R) -Ub (WT) (фиг.4С, сравнить столбцы [4] - [6]). Эти данные показали, что monoubiquitylation достаточно для вербовки CENP-А к центромеры.

Рисунок 1
Рисунок 1. Иммунофлуоресценции анализ эндогенных CENP-A поддерживает гипотезу о том, что CUL4A-E3 лигаза требуется для локализации CENP-A на центромеры (Рисунки были адаптированы из Niikura и др. 17). (A) CUL4A миРНК индуцированной Делокализация CENP-A на центромеры. Клетки HeLa трансфицировали CUL4A или люциферазы (Luc) миРНК и инкубировали в течение 48 ч (Таблица 1). Шкала бар составляет 10 мкм. (В) Вестерн - блот - анализ лизатов клеток HeLa в целом с использованием тех же условиях культивирования , как в (A). Клетки собирали через 48 часов после трансфекции CUL4A миРНК или Luc миРНК (таблица 1). GAPDH служил в качестве контроля нагрузки. (C) Количественные эндогенные сигналы CENP-A на центромеры , показанных в (А). Нормализация сигналов проводили с использованием Люк миРНК-трансфектированных клеток, а средние процентные доли (± стандартное отклонение) показаны. **** P <0,0001 против Люк миРНК-трансфицированных клеток (Т-критерий Стьюдента). (D) RBX1 миРНК индуцированной делокализации CENP-A от центромеры. HeLa клетки были трансфицированы RBX1 или Luc миРНК (ов) , и инкубировали в течение 72 ч (таблица 1). Шкала бар составляет 10 мкм. (Е) Вестерн - блот - анализ лизатов клеток HeLa в целом с использованием тех же условиях культивирования , как в (D). Клетки собирали 72 ч после трансфекции RBX1 OR Люк миРНК (ы) (таблица 1). GAPDH , в качестве контроля нагрузки. (F) , эндогенные сигналы количественные CENP-A на центромеры , показанных в (D). Нормализация сигналов проводили с использованием Люк миРНК-трансфектированных клеток, а средние процентные доли (± стандартное отклонение) показаны. **** P <0,0001 против Люк миРНК-трансфицированных клеток (Т-критерий Стьюдента). Пожалуйста , нажмите здесь , чтобы посмотреть увеличенную версию этой фигуры.

фигура 2
Рисунок 2. Справочная информация , относящаяся к рисунку 1 центромеры (Рисунки были адаптированы из Niikura и др. 17). (А) Экзогенный CUL4A-Flag спас делокализацию CENP-А когда CUL4A миРНК ориентирована на 3 'UTR. HeLa Tet-Off челLs фиксировали через 48 часов после того, как котрансфекции с миРНК (CUL4A # 2: 3 'UTR мишень или LUC; Таблица 1) плюс плазмидной конструкции (pTRM4-CUL4A-Флаг или вектор, таблица 2). 4-цветный иммунное: окрашивание DAPI (синий цвет); Флаг; эндогенная CENP-B (красный); и эндогенные CENP-А (зеленый), была выполнена и флаг-позитивные клетки были отсортированы, но Flag изображения для простоты опущены. Примечание: CUL4A # 2 является идентичной мишенью , как показано на рисунке 1А-C. Шкала бар составляет 10 мкм. (В) Вестерн - блот - анализ HeLa Tet-Off лизатов целых клеток в том же условиях культивирования , как показано в позиции (А). GAPDH , в качестве контроля нагрузки. Сигналы (С) CENP-А при центромеры , показанных в (А) были определены количественно с помощью микроскопа после сортировки клеток , чтобы изолировать те связываться с антителом анти-Flag. Нормализация сигналов проводили с клетками, трансфицированные Luc миРНК плюс вектором, а средние процентные доли (± стандартное отклонение) показаны.**** P <0,0001 против клеток , трансфицированных Luc миРНК плюс вектора (левая колонка, т-критерий Стьюдента). (D) Экзогенный Flag-RBX1 спас делокализацию CENP-A на центромеры , когда RBX1 миРНК ориентирована на 3 'UTR , HeLa клетки были зафиксированы через 72 ч после совместной трансфекции с миРНК (RBX1 # 2: 3 'UTR - мишени или LUC; Таблица 1) плюс плазмидной конструкции (pcDNA3-Flag-RBX1 или вектором, таблица 2). 4-цветный иммунное: окрашивание DAPI (синий цвет); Флаг; эндогенная CENP-B (красный); и эндогенные CENP-А (зеленый), была выполнена и флаг-позитивные клетки были отсортированы, но Flag изображения для простоты опущены. Шкала бар составляет 10 мкм. (Е) Вестерн - блот - анализ лизатов клеток HeLa в целом в том же условиях культивирования , как в (D). GAPDH , в качестве контроля нагрузки. (F) , сигналы CENP-A на центромеры , показанных в (D) , были определены количественно с помощью микроскопа после сортировки клеток , чтобы изолировать тех , соблюдать : а н анти-Flag антитела. Нормализация сигналов проводили с клетками, трансфицированные Luc миРНК плюс вектором, а средние процентные доли (± стандартное отклонение) показаны. **** P <0,0001 против клетки , трансфицированные Luc миРНК плюс вектор (левая колонка, Стьюдента-тест). (G) Истощение CUL4A и RBX1 не влияет на уровни эндогенных CENP-белка. Уровни эндогенных CENP-A белка измеряли в лизатах клеток HeLa весь урожай 72 ч после трансфекции CUL4A, RBX1, CUL4A плюс RBX1 или Люк миРНК. Через сорок восемь часов после трансфекции клетки были либо необработанными (Asyn) или обрабатывали паклитакселом (+ НДС), чтобы вызвать арест в митоз, и они культивировали в течение 24 часов. GAPDH служил в качестве контроля загрузки. Пожалуйста , нажмите здесь , чтобы посмотреть увеличенную версию этой фигуры.

32 / 53732fig3highres.jpg "ширина =" 700 "/>
Рисунок 3. Иммунофлуоресценции анализ экзогенных белков CENP-A-Flag показал , что CENP-A K124 убиквитилирование требуется для CENP-локализации на центромеры (рис были адаптированы из Niikura и др. 17). (А) Сверхэкспрессия CENP-A- Флаг конструкции (WT и KR-мутанты) была подтверждена с помощью Вестерн-блот-анализа HeLa Tet-Off лизатов целых клеток. Клетки собирали через 48 часов после трансфекции pTRM4-CENP-A-Flag WT, Kr мутантов или pTRM4 вектора (таблица 2). Избыточная экспрессия CENP-A-Flag был обнаружен с помощью антитела анти-Flag. GAPDH служил в качестве контроля нагрузки. Предполагаемые CENP-A-Flag Димер (##) и CENP-A-Flag мономер (#) показаны. Примечание: ДСН-стойкие димеры CENP-A сообщалось ранее 40,41 (В) CENP-А K124R мутант показал рассеянное делокализации от центромеры.. Сигналы от DAPI (синий), флаг (Greeп), а также эндогенными CENP-B (красный, контроль местоположения центромеры) показаны. Примечание: В отличие от эндогенных CENP-A в клетках, трансфицированных CUL4A или RBX1 миРНК, диффузные сигналы появились в клетках, которые суперэкспрессированный экзогенный CENP-A K124R-Flag как фенотипа неспособности быть направлены на центромеры, по-видимому, потому что его уровень экспрессии составляет приблизительно 10 - в 25 раз выше , чем у эндогенных CENP-A (данные не показаны) 17 Шкала бар составляет 10 мкм (с) гистограммы паттернов локализации , показанных в (B)... Более 50 про / прометафазе и метафазных клеток и более 200 интерфазных клеток на эксперименте подсчитывали (N ≥ 3) эксперименты. Средние проценты (± стандартное отклонение) показаны. "Другие (Non-центромеры)" указывает, в основном, поврежденные клетки, мертвые клетки, или клетки с ядрышек локализации (только в интерфазе), предположительно из-за трансфекции или других видов лечения. *** P <0,001 против CENP-A WT-Flag (т-критерий Стьюдента).

Рисунок 4
Рисунок 4. Иммунофлуоресценции анализ экзогенных белков Flag-CENP-A показал , что CENP-A monoubiquitin слитый спас делокализация CENP-A K124R мутанта из центромеры (рис были адаптированы из Niikura и др. 17). (А) Схематическое мультфильмы каждой конструкции , используемой в данном исследовании (см также таблицу 2). Мутация сайт K124R на CENP-A (красный) и мутации сайта K48R на monoubiquitin (синий) показаны. (1) WT: Флаг-CENP-A Номер WT, (2) WT-UB (WT): Флаг-CENP-A Номер WT-UB (WT), (3) WT-UB (K48R): Флаг-CENP-A Номер WT -Ub (K48R), (4) K124R-Ub (WT): Флаг-CENP-A K124R-Ub (WT), (5) K124R-Ub (K48R): Флаг-CENP-A K124R-Ub (K48R), (6) K124R: Флаг-CENP-A K124R (B) Экзогенный CENP-A monoubiquitin слитый спас делокализация CENP-A K124R мутанта от центромеры.. DAPI (синий), флаг (зеленый), а также эндогенными CENP-B (красный, контроль местоположения центромеры) показаны. Шкала бар составляет 10 мкм. (С) Гистограммы паттернов локализации , показанных в (С). Более 50 про / прометафазе и метафазных клеток и более 200 интерфазных клеток на эксперименте подсчитывали (N ≥ 3) эксперименты. Средние проценты (± стандартное отклонение) показаны. **** P <0,0001 и *** р <0,001 против не-плавленого Flag-CENP-A K124R (столбец [6]) (т-критерий Стьюдента). Пожалуйста , нажмите здесь , чтобы посмотреть увеличенную версию этой фигуры.

мишень миРНК Индикация в настоящем исследовании Тип цели номер базы данных миРНК Форвард последовательность (ы) Источник / Ссылка
Люциферазы (GL3) - 1 мишень RKK9 CUUACGCUGAGUACUUCGAdTdT Elbashir и др., (2001)
CENP-A CA-UTR миРНК бассейн (2 целевые смеси) RKK375 / 5 'UTR t1 CGAGCGGCGCGGACUUCUGCCdTdT Niikura и др., (2015)
RKK383 / 3 'UTR t1 UCCUGCACCCAGUGUUUCUGUdGdT Niikura и др., (2015)
CUL4A # 1 1 мишень CRKK178 / RKK309 / t1 AGCGAUCGUAAUCAAUCCUGA Niikura и др., (2015)
# 2 (3'UTR) 1 мишень CRKK181 / RKK331 / t4 AUGCGGGUUUGAAAUAUGACA Niikura и др., (2015)
RBX1 / ROC1 # 1 миРНК бассейн (4 целевые смеси) CRKK198 / RKK411 / t1 GAAGCGCUUUGAAGUGAAA Niikura и др., (2015)
CRKK198 / RKK413 / t2 GCAUAGAAUGUCAAGCUAA Niikura и др., (2015)
CRKK198 / RKK415 / t3 GCAAGAAGCGCUUUGAAGU Niikura и др., (2015)
CRKK198 / RKK417 / t4 CAACAGAGAGUGGGAAUUC Niikura и др., (2015)
# 2 (3 'УТР) 1 мишень CRKK206 / RKK425 / T8 UUCCCUGCUGUUACCUAAUUA Niikura и др., (2015)

Таблица 1. миРНК последовательности , используемые в данном исследовании.

номер B Соответствующая характеристика (ы) Источник / Ссылка
B288 pTRM4 Niikura и др., (2006)
B2067 pTRM4-человек CENP-A-Flag Niikura и др., (2015)
B2281 pTRM4-человек CENP-A K9A-Flag Niikura и др., (2015)
B2387 pTRM4-человек CENP-A K77R-Flag Niikura и др., (2015)
B2388 pTRM4-Хумап CENP-A K124R-Flag Niikura и др., (2015)
B2512 pTRM4-Flag-человек CENP-A Niikura и др., (2015)
B2579 pTRM4-Flag-человек CENP-A K124R Niikura и др., (2015)
B2513 pTRM4-Flag-человек CENP-A-Ub (WT) Niikura и др., (2015)
B2559 pTRM4-Flag-человек CENP-A K124R-Ub (WT) Niikura и др., (2015)
B2515 pTRM4-Flag-человек CENP-A-Ub (K48R) Niikura и др., (2015)
B2560 pTRM4-Flag-человек CENP-A K124R-Ub (K48R) Niikura и др., (2015)
B2759 pTRM4-человек CUL4A-Flag Niikura и др., (2015)
B2624 pcDNA3-Flag-человеческого RBX1 Niikuraи др., (2015)
B1491 pcDNA3-Flag Niikura и др., (2015)

Таблица 2. плазмидные векторы , используемые в данном исследовании.

R (анти-CENP-В) Образец б (анти-CENP-В) R образца (вычитается) Отношение (S образец: R образца) Исправленная соотношение (S образец: R образца)
520 514 6 -4,167 0.000
535 445 90 -1,033 0.000
515 431 84 0,274 0,274
562 483 79 0.506 0.506
902 562 340 0,509 0,509
1203 703 5 часов -0,560 0.000
+1014 589 425 -0,819 0.000
768 510 258 -1,345 0.000
555 458 97 -1,845 0.000
781 576 205 -1,146 0.000
556 436 120 0,758 0,758
534 493 41 -1,634 0.000
702 543 159 0.667 0.667
482 429 53 -1,000 0.000 654 531 123 0.740 0.740
1190 607 583 0,384 0,384
552 454 98 0.969 0.969
489 413 76 0,539 0,539
511 452 59 -3,186 0.000
485 475 10 -2,700 0.000
481 441 40 -1,475 0.000
сумма 5.347
В среднем 0,255
R (анти-CENP-B) , Ctrl б (анти-CENP-В) Отношение (S Ctrl: R Ctrl) Исправленная соотношение (S Ctrl: R Ctrl)
543 483 60 3,017 3,017
526 466 60 2.667 2.667
532 460 72 1,792 1,792
507 457 50 3,520 3,520
491 458 33 4,273 4,273
545 464 81 2.160 2.160
518 484 34 3,559 3,559
461 404 57 2.404 2.404
487 447 40 3.550 3.550
534 477 57 3,965 3,965
528 456 72 3,097 3,097
707 601 106 1,868 1,868
615 528 87 2,828 2,828
660 481 179 1,620 1,620
565 476 89 1,607 1,607
527 455 72 3,583 3,583
560 474 86 2,930 2,930
510 451 59 4,017 4,017
729 586 143 2,678 2,678
634 576 58 3,655 3,655
507 476 31 3,935 3,935
сумма 62,725
В среднем 2,987
Остальные сигналы CENP-A на центромеры (%) 8.5

. Таблица 3. Одним из примеров расчета оставшихся сигналов CENP-A на центромеры (%) Пример Pro / прометафазе на рисунке 2F показан: образец RBX1 # 2 (3'UTR) + Vec (центральная колонка на рисунке 2F ) и контроль Люк + Vec (левый столбец на рисунке 2F). В результате, оставшиеся сигналы CENP-A нацентромеры (%) = (0,255 / 2,987) х получают 100 = 8,5% (или [5,347 / 62,725] х 100 = 8,5% с тем же самым общего числа клеток [т.е. 21 клеток] анализировали между двумя образцами). Обратите внимание , что если значение B больше , чем значение S (то есть, если вычитали значение отрицательное), скорректированное значение отношение устанавливается на 0.00.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

В последние годы многие исследования были разработаны различные анализы количественной микроскопии для фиксированных клеток. 42 Прогресс в центромерно-кинетохорной биологии часто требует понимания центромерно-специфической или кинетохорной конкретной функции белков которых субклеточная пространственно-временное регулирование отражает изменение функции эти белки в течение клеточного цикла. Поэтому здесь мы разработали методы IIF окрашивания и количественного анализа IIF конкретно проанализировать относительные уровни эндогенных и экзогенных белков CENP-A, которые могут быть применимы в по-разному обработанных образцов. В настоящее время мы добились успешного IIF окрашивания эндогенных CENP-I, CENP-H, KNL1, Hec1 и Ska1 с использованием протокола 2 в данном исследовании (см Niikura др 24 и данные не показаны;. Перечень материалов / оборудования для получения информации антител) , В будущем, можно применить тот же метод для количественного определения уровня различных центромерных-кинетохора белков (как endogтиазом и Flag-меченый экзогенные белки) выбирают специфические антитела, однако, наши методы IIF не покрывают обнаружение этих белков в живых клетках или в конкретной одной клетки в течение всего клеточного цикла. Поскольку эти процедуры требуют клетки должны быть фиксированными и обрабатываются на отдельных покровных, мы ввели опорные сигналы (например, ACA или CENP-B) с целью нормализации для того , чтобы достаточно сравнить сигналы среди различных образцов и повысить точность анализа. Так как АСА включать экзогенных и / или экзогенные сигналы CENP-A, CENP-B в качестве опорного сигнала с целью нормализации было бы более подходящим для сравнения, чем бы АСА с точки зрения точности количественного анализа сигналов CENP-A. Амино-концевой области CENP-B связывается с 17 п.н. мотив последовательности CENP-В коробке в alphoid ДНК, и карбокси-концевой области CENP-B образует гомодимеры. 43,44 CENP-Б не локализуются полностью с CENP-а и / или других CENTRomere-кинетохор белки, однако, тесно связана с ними. 45 В то время как иммунофлуоресценции с антителами анти-CENP-C , как правило , дает два дискретных пятна, окрашивание анти-CENP-B часто представляется в виде одной яркой панели , соединяющей обе сестры центромеры. 46 Тем не менее , в нашем макромасштабной микроскопического наблюдения, некоторые CENP-B сигналов, по-видимому перекрываются с сигналами CENP-а, особенно на ранних стадиях митоза (профазы-прометафазных, чем в конце метафазы), также частично в зависимости от наблюдательной угла и типа закрепителя, используемого (данные не показаны). В отличие от этого, в количественном IIF анализе сигналов CENP-A, локализация белка опорных сигналов не должно зависеть от истощения и / или дисфункции CENP-A для справедливого анализа, хотя локализация большинства центромеры-кинетохора белков зависит от CENP-A локализации в центромерах. 47,48 CENP-A-независимая кинетохора сборка устанавливается путем замены ДНК-связывающих областей CENP-С И CENP-T с альтернативными хромосомных таргетирования доменами , которые вербуют эти белки к эктопической локусов. 49,50 Кроме того, недавние работы показали , что внутренние компоненты кинетохор CENP-C и CENP-T действуют параллельно набирать КМН сети к кинетохоры. 51-54 Кроме того, Нисино и др. предположили , что сложные формы CENP-TWSX уникальный нуклеосом-подобную структуру для создания контактов с ДНК, расширяя "гистонов код" вне канонических нуклеосом белков. 55 Поскольку локализация центромеры CENP- с зависит от локализации центромеры CENP-А, 47,48-CENP TWSX или особенно CENP-Т может быть другой кандидат (ы) белка , чтобы обеспечить опорные сигналы в количественном анализе IIF CENP-A. Тем не менее, кандидат в справочной сигнализации должны быть тщательно проверены перед анализом, чтобы определить, является ли локализация в центромерах зависит от истощения и / или дисфункции CENP-A. Аналогичное рассмотрениедолжны быть приняты для количественных анализов IIF других центромерных-кинетохора белков: локализация белка эталонных сигналов не должна зависеть от истощения и / или дисфункции белка-мишени для справедливого анализа. В предыдущем исследовании мы использовали АСА в качестве опорного сигнала для количественного IIF анализа других центральных аута белков кинетохорных. 24 ACA может быть более подходящим вариантом , чем одного CENP-B в качестве контроля положения, а также опорный сигнал, если ACA сигналы не зависят от истощения и / или дисфункции белка-мишени, но колокализации белка-мишени с CENP-B бедна, как упоминалось выше.

Бодор и др. Сообщается , что центромерные уровни CENP-A регулируются массовые акции, то есть количество центромерной CENP-A изменяется в прямой зависимости от клеточного содержания. 56 Они также показали , что переходная индукция-A CENP выражение приводит к Стремительное увеличение в центромерная-A CENP уровень, И наоборот, мы наблюдали большую популяцию клеток с центромеры-локализованы, Флаг-меченый CENP-БТ после совместной трансфекции вектора экспрессии pTRM4 с СА-UTR киРНК (смесь 5 'и 3' UTR миРНК, таблица 1) (данные не показано); это население было больше, чем наблюдаемое после трансфекции только вектором экспрессии pTRM4. Уровень экзогенного флага меченные CENP-A белок, экспрессия которого был обусловлен pTRM4, составляла приблизительно от 1,0 до 1,4 порядков (от 10 до 25 раз) выше, чем у эндогенных CENP-A (данные не показаны). Он предположил, что экспрессия экзогенного CENP-A WT выше определенного порогового значения может отрицательно повлиять на его надлежащее центромерный локализацию.

В современных протоколов, фиксация является важным шагом для поддержания клеточной структуры и окружающей среды, как проксимального ситуации как можно ближе к родному государству. После того, как клетки фиксировали, следует исходить с протоколом окрашивания, чтобы избежать потери белка интеотдыхать или остальная часть клетки. Тем не менее, фиксация разрушает антигенные сайты время от времени, а также различные комбинации антитело-антиген плохо работают с одним фиксирующим средством , но очень хорошо с другой. 21 Из - за этого изменения, выбор фиксаторе во многом зависит от белка (белков) , представляющих интерес. Длина время фиксации может существенно повлиять на обнаружение белка (ов) по иммунным, и короче , крепление , как правило , лучше , чтобы сохранить антигенность. 57 Таким образом, при определении процедуры окрашивания для новой цели других центромерных-кинетохора белков, особенно неопределенной локализация, или при работе с новым антителом, следует проверить несколько способов фиксации и буферов, чтобы найти оптимальное состояние. В современных протоколов, были выбраны два класса популярных фиксаторов: альдегидные фиксаторами (протокол 2) и органические растворители (протоколы 3 и 4). Чистота фиксаторов также чрезвычайно важен. В Протоколе 4, 4% козья сыворотка используется EspeciaLLY блокировать IgG - рецепторы на клеточной поверхности , чтобы уменьшить неспецифический фон. 57 Как правило, сыворотку для блокирования рецепторов IgG должно быть от вида , не связанное с первичным антителом , и предпочтительно от того же вида в качестве второго антитела. 57

В каждом из настоящих протоколов, выбор первичного антитела является наиболее важным шагом в достижении успешной иммунное окрашивание. Антитело с наибольшей специфичностью, чистотой, аффинность и авидность желателен. Хорошая стартовая концентрация для моноклональных антител, как правило, 1-5 мкг / мл. Типичные разведений массоподготовки поликлональных антител лежат в диапазоне от 1:20 до 1:. 500 57 необходимо определить эмпирически соответствующую концентрацию первичного антитела и разбавителя для каждого образца. Образцы должны быть слегка качался, но не высох во время инкубации для однородного окрашивания. Обширные промывка между инкубирования первичного антитела и вторичного Antibody может потребоваться, чтобы избежать перекрестной реакции с иммуноглобулинами от других видов. Тем не менее, оптимальное условие стирки должно быть определено опытным путем , чтобы избежать потери клеток, особенно делящихся клеток, которые округляют и отсоединение при встряхивании (т.е. митотическую вытряхиваемого). 58 Для достижения успеха, вторичное антитело должно быть выбрано для связывания первичное антитело с высоким сродством. Например, чтобы избежать неспецифического связывания части Fc вторичного антитела к рецепторам Fc -области IgG, Рв (аb ') 2 - фрагменты могут быть использованы вместо целого антитела. 57 Для многих вторичных антител, время инкубации может быть сведено к минимуму до 30 мин при комнатной температуре, чтобы уменьшить неспецифический фон.

В дополнение к протоколу 5, лазерной сканирующей конфокальной микроскопии может быть полезным при выявлении и анализе локализации и функции центромерных-кинетохора белков с флуоресцентными свойствами. Как показано в Списке материалов / химическонт, Alexa Fluor 488 и Alexa Fluor 594, вероятно, наиболее часто используемых флуоресцентных красителей в настоящих протоколов. Для обнаружения двух и / или несколько различных центромерно-кинетохора белков в образце, нужно гарантировать , что антитела , используемые для обнаружения одного белка не предотвращают обнаружение второго белка. 57 в настоящем протоколы, две первичные антитела смешивают и наносят в то же время. Тем не менее, следует оптимизировать условия иммуногистохимическое каждого белка по отдельности перед применением первичных или вторичных антител вместе: если два белка находятся в непосредственной близости, как и в случае двух центромеры-кинетохорных компонентов, одно первичное антитело может структурно предотвратить связывание второе первичное антитело. Еще одна проблема обнаружения множественного сигнала является задача спектрального перекрытия: трудности в предотвращении сигнала от одного красителя "негерметичного" в спектральном канале другого. Эта проблема становится все более трудным для конвенцииAl интерференция наборы фильтров , чтобы решить , как количество красителей увеличивается или , если образец содержит overenhanced сигналы (например, ACA или анти-Flag сигналы в настоящем исследовании), в том числе вмешательство автофлюоресценции. Поиск и устранение неисправностей автофлюоресценции было проведено в других исследованиях. 57,59,60 В настоящем исследовании, оптимизируя флуоресцентные наборы фильтров с управлением одной метки в каждом канале достаточно в большинстве случаев , чтобы избежать этих проблем (см . Ниже)

В каждом из настоящих протоколов, необходимых средств контроля имеют важное значение. Каждое новое первичное антитело должно характеризоваться перед началом иммунное. Специфичность антител должно быть подтверждено с помощью Вестерн-блот-анализа, если это применимо. Кроме того, подтверждение того, что окрашивание не вызвано неспецифического связывания с клеточной поверхностью, должна быть получена, и оптимальная рабочая концентрация определенного первичного антитела должно определяться путем использования серийных разведений(Т.е. привязки кривая должна быть разработана). Отрицательный контроль (то есть отсутствие первичного антитела из процесса окрашивания) , должны быть включены. Другой вариант отрицательного контроля является замена нормального IgG из одних и тех же видов, для первичного антитела. Для обнаружения нескольких меток, необходимо подготовить элементы управления без вторичных антител (контроль фона), а также управления одной метки , чтобы избежать спектральных перекрытия артефактов (т.е. просачивание через кроссовер, перекрестные помехи, или краситель "утечка" , как описано выше ). Можно количественно определить долю "утечки" путем сравнения сигналов через "неправильных" фильтров с правильным сигналом, используя эти пропорции , чтобы удалить вычислительно все "протечки" , и вычисления реальное распределение и / или совместной локализации флуоресцентной метки. 60 контроль фон должен быть рассмотрен независимо друг от друга с каждым каналом, чтобы установить пределы усиления сигнала и смещения быть Adapted для окончательной визуализации. Все каналы, которые будут использованы для получения изображения образца нескольких этикеток должны быть подвергнуты независимой коррекции фона, так как уровень флюоресценции в каждом канале значительно изменяется. В "утечкой" контролирует как описано выше, требуется определить величину усиления сигнала возможно в каждом канале без обнаружения "утечки" в соседних каналах. 60

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Авторы заявляют, что у них нет конкурирующих финансовых интересов.

Acknowledgments

Эта работа была поддержана NIH грант GM68418.

Materials

Name Company Catalog Number Comments
Lipofectamin 2000 Life Technologies/Invitrogen 11668 transfection reagent I
Lipofectamin RNAiMAX Life Technologies/Invitrogen 13778 transfection reagent II
Opti-MEM I Life Technologies/Invitrogen 31985 Reduced serum media, warm in 37 °C water bath before use
High-glucose DMEM (Dulbecco’s modified Eagle’s medium) Life Technologies/BioWhittaker 12-604 high-glucose DMEM, warm in 37 °C water bath before use
Fetal Bovine Serum, certified, heat inactivated, US origin Life Technologies/Gibco 10082 FBS (fetal bovine serum)
Poly-L-Lysine SOLUTION SIGMA-SLDRICH P 8920 Poly-L-Lysine, 0.1% w/v, in water
UltraPure Distilled Water Life Technologies/Invitrogen/Gibco 10977 Sterile tissue culture grade water 
Micro Cover glass (22 mm x 22 mm)  Surgipath 105 Cover glass (22 mm x 22 mm) 
6 Well Cell Culture Cluster Fisher/Corning Incorporated 07-200-83 6-well polystyrene plate 
Penicillin, Streptomycin; Liquid Fisher/Gibco 15-140 Penicillin-streptomycin
PAP PEN  Binding Site AD100.1 Hydrophobic barrier pen (for a water repellant barrier in immunofluorescent staining)
Paclitaxel (Taxol) SIGMA-SLDRICH T7402 Taxol for mitotic cell analysis
TN-16, microtubule inhibitor (TN16) Enzo Life Sciences BML-T120 TN16 for mitotic cell analysis
BSA (bovine serum albumin) SIGMA-SLDRICH A7906 Blocking reagent
Triton X-100 SIGMA-SLDRICH T8787 Detergent for permeabilization
Paraformaldehyde SIGMA-SLDRICH P6148 Fixation reagant
DAPI SIGMA-SLDRICH D9542 For nuclear staining
p-phenylenediamine SIGMA-SLDRICH P6001 For mounting medium
VWR Micro Slides, Frosted VWR International 48312-013 Micro slides 
Anti-CENP-A antibody Stressgen/Enzo Life Sciences KAM-CC006 Mouse monoclonal antibody; dilution ratio of 1:100 (IIF), 1:5000 (WB)
Anti-CENP-B antibody Novus Biologicals H00001059-B01P Mouse monoclonal antibody; dilution ratio of 1:200 (IIF, methanol/acetone fixation)-1:400 (IIF, paraformaldehyde fixation)
Anti-CENP-B antibody  abcam ab25734 Rabbit polyclonal antibody; dilution ratio of 1:200 (IIF, methanol/acetone fixation)-1:400 (IIF, paraformaldehyde fixation)
Anti-centromere antibody (ACA) Fitzgerald Industries International, Inc. 90C-CS1058 Human centromere antiserum; dilution ratio of 1:2000 (IIF)
Anti-CENP-H antibody Bethyl Laboratories BL1112 (A400-007A) Rabbit polyclonal antibody; dilution ratio of 1:200 (IIF)
Anti-CENP-H antibody BD 612142 Mouse monoclonal antibody; dilution ratio of 1:200 (IIF)
Anti-CENP-I antibody N/A, Dr. Katusmi Kitagawa N/A, Dr. Katusmi Kitagawa Rabbit polyclonal antibody; dilution ratio of 1:1000 (IIF); Niikura et al., Oncogene, 4133-4146 (2006)
Anti-KNL1 antibody Novus Biologicals NBP1-89223 Rabbit polyclonal antibody; dilution ratio of 1:100 (IIF)
Anti-Hec1 antibody Novus Biologicals / GeneTex NB 100-338 / GTX70268 Mouse monoclonal antibody; dilution ratio of 1:100 (IIF)
Anti-Hec1 antibody GeneTex GTX110735 Rabbit polyclonal antibody; dilution ratio of 1:100 (IIF)
Anti-Ska1 antibody abcam ab46826 Rabbit polyclonal antibody; dilution ratio of 1:100 (IIF)
Anti-Flag antibody SIGMA-ALDRICH F3165 Mouse monoclonal antibody; dilution ratio of 1:1000 (IIF), 1:5000 (WB)
Anti-Flag antibody SIGMA-ALDRICH F7425 Rabbit polyclonal antibody; dilution ratio of 1:1000 (IIF), 1:5000 (WB)
Anti-CUL4A antibody N/A, Dr. Pradip Raychaudhuri N/A, Dr. Pradip Raychaudhuri Rabbit polyclonal antibody; dilution ratio of 1:3000 (WB); Shiyanov et al., The Journal of biological chemistry, 35309-35312 (1999)
Anti-RBX1 antibody Cell Signaling 4397 Rabbit polyclonal antibody; dilution ratio of 1:2000 (WB)
Anti-GAPDH antibody Chemicon MAB374 Mouse monoclonal antibody; dilution ratio of 1:5000 (WB)
Alexa Fluor 488 Goat Anti-Mouse IgG Life Technologies/Invitrogen A11001 fluorophore-conjugated secondary antibody (Affinity-purified secondary antibody)
Alexa Fluor 594 Goat Anti-Mouse IgG Life Technologies/Invitrogen A11005 fluorophore-conjugated secondary antibody (Affinity-purified secondary antibody)
Alexa Fluor 488 Goat Anti-Rabbit IgG Life Technologies/Invitrogen A11008 fluorophore-conjugated secondary antibody (Affinity-purified secondary antibody)
Alexa Fluor 594 Goat Anti-Rabbit IgG Life Technologies/Invitrogen A11012 fluorophore-conjugated secondary antibody (Affinity-purified secondary antibody)
Non fat powdered milk (approved substitution for carnation powdered milk) Fisher Scientific NC9255871 (Reorder No. 190915; Lot# 90629) Skim milk
Leica DM IRE2 motorized fluorescence microscope  Leica motorized fluorescence microscope 
HCX PL APO 63x oil immersion lens Leica LEICA HCX PL APO NA 1.40 OIL PH 3 CS 63X oil immersion lens
HCX PL APO 100x oil immersion lens Leica LEICA HCX PL APO NA 1.40 OIL PHE 100X oil immersion lens
Leica EL6000 compact light source Leica External compact light source for fluorescent excitation
ORCA-R2 Digital CCD camera  Hamamatsu C10600-10B digital CCD camera 
Openlab version 5.5.2 Scientific Imaging Software  Perkin Elmer/Improvision For image observation, acquisition, quantification, and analysis
Velocity version 6.1.1 3D Image Analysis Software  Perkin Elmer/Improvision For image observation, acquisition, quantification, and analysis
Complete EDTA-free protease inhibitor cocktail Roche 11873580001/11836170001 Protease inhibitor cocktail tablets
PlusOne 2-D Quant Kit Amersham Biosciences 80-6483-56 Commercial protein assay reagent I for measurement of protein concentration (compatible with 2% SDS)
Bio-Rad Protein Assay Bio-Rad 500-0006 Commercial protein assay reagent II for measurement of protein concentration (compatible with 0.1% SDS)
Immobilon-FL EMD Millipore IPFL00010 PVDF membrane for transferring
IRDye 800CW Goat Anti-Mouse IgG LI-COR Biosciences 926-32210 IR fluorescent dye-conjugated secondary antibody (Affinity-purified secondary antibody); dilution ratio of 1:20000 (IIF)
IRDye 680 Goat Anti-Rabbit IgG LI-COR Biosciences 926-32221 IR fluorescent dye-conjugated secondary antibody (Affinity-purified secondary antibody); dilution ratio of 1:20000 (IIF)
Goat anti-Mouse IgG DyLight 549 Fisher Scientific PI35507 DyLight-conjugated secondary antibodyIR fluorescent dye-conjugated secondary antibody (Affinity-purified secondary antibody); dilution ratio of 1:20000 (IIF)
Goat anti-Rabbit DyLight 649 Fisher Scientific PI35565 DyLight-conjugated secondary antibodyIR fluorescent dye-conjugated secondary antibody (Affinity-purified secondary antibody); dilution ratio of 1:20000 (IIF)
Goat anti-mouse IgG-HRP Santa Cruz SC-2005 HRP-conjugated secondary antibodyDyLight-conjugated secondary antibodyIR fluorescent dye-conjugated secondary antibody (Affinity-purified secondary antibody); dilution ratio of 1:10000 (IIF)
Goat anti-rabbit IgG-HRP Santa Cruz SC-2004 HRP-conjugated secondary antibodyDyLight-conjugated secondary antibodyIR fluorescent dye-conjugated secondary antibody (Affinity-purified secondary antibody); dilution ratio of 1:10000 (IIF)
Openlab version 5.5.2. Scientific Imaging Software  Improvision/PerkinElmer Software A
Volocity version 6.3 3D Image Analysis Software (Volocity Acquisition) PerkinElmer Software B1
Volocity version 6.3 3D Image Analysis Software (Volocity Quantification) PerkinElmer Software B2
Branson SONIFIER 450 Sonicator
Branson Ultrasonics sonicator Microtip Step, Solid, Threaded 9.5 mm VWR Scientific Products Inc.  33995-325 Disruptor horn for sonication
Branson Ultrasonics sonicator Microtip Tapered 6.5 mm VWR Scientific Products Inc.  33996-185 Microtip for sonication
Odyssey CLx Infrared imaging System  LI-COR Biosciences Infrared imaging system for immunoblot detection
Image Studio Analysis Software Ver 4.0  LI-COR Biosciences Software C
Molecular Imager Versadoc MP4000 System  Bio-Rad Chemiluminescence imager for immunoblot detection
Quantity One 1-D analysis software  Bio-Rad Software D
SuperSignal West Femto Maximum Sensitivity Substrate Thermo 34095 Ultra-sensitive enhanced chemiluminescent (ECL) substrate

DOWNLOAD MATERIALS LIST

References

  1. DeLuca, J. G., et al. Hec1 and nuf2 are core components of the kinetochore outer plate essential for organizing microtubule attachment sites. Molecular biology of the cell. 16, 519-531 (2005).
  2. Earnshaw, W. C., Halligan, N., Cooke, C., Rothfield, N. The kinetochore is part of the metaphase chromosome scaffold. J Cell Biol. 98, 352-357 (1984).
  3. Hoffman, D. B., Pearson, C. G., Yen, T. J., Howell, B. J., Salmon, E. D. Microtubule-dependent changes in assembly of microtubule motor proteins and mitotic spindle checkpoint proteins at PtK1 kinetochores. Molecular biology of the cell. 12, 1995-2009 (2001).
  4. Regnier, V., et al. CENP-A is required for accurate chromosome segregation and sustained kinetochore association of BubR1. Mol Cell Biol. 25, 3967-3981 (2005).
  5. Bernad, R., Sanchez, P., Losada, A. Epigenetic specification of centromeres by CENP-A. Exp Cell Res. 315, 3233-3241 (2009).
  6. Black, B. E., Cleveland, D. W. Epigenetic centromere propagation and the nature of CENP-a nucleosomes. Cell. 144, 471-479 (2011).
  7. Warburton, P. E., et al. Immunolocalization of CENP-A suggests a distinct nucleosome structure at the inner kinetochore plate of active centromeres. Curr Biol. 7, 901-904 (1997).
  8. Karpen, G. H., Allshire, R. C. The case for epigenetic effects on centromere identity and function. Trends Genet. 13, 489-496 (1997).
  9. Black, B. E., et al. Structural determinants for generating centromeric chromatin. Nature. 430, 578-582 (2004).
  10. Black, B. E., et al. Centromere identity maintained by nucleosomes assembled with histone H3 containing the CENP-A targeting domain. Mol Cell. 25, 309-322 (2007).
  11. Fachinetti, D., et al. A two-step mechanism for epigenetic specification of centromere identity and function. Nat Cell Biol. 15, 1056-1066 (2013).
  12. Zeitlin, S. G., Shelby, R. D., Sullivan, K. F. CENP-A is phosphorylated by Aurora B kinase and plays an unexpected role in completion of cytokinesis. The Journal of cell biology. 155, 1147-1157 (2001).
  13. Zhang, X., Li, X., Marshall, J. B., Zhong, C. X., Dawe, R. K. Phosphoserines on maize CENTROMERIC HISTONE H3 and histone H3 demarcate the centromere and pericentromere during chromosome segregation. The Plant cell. 17, 572-583 (2005).
  14. Goutte-Gattat, D., et al. Phosphorylation of the CENP-A amino-terminus in mitotic centromeric chromatin is required for kinetochore function. Proc Natl Acad Sci U S A. 110, 8579-8584 (2013).
  15. Bailey, A. O., et al. Posttranslational modification of CENP-A influences the conformation of centromeric chromatin. Proc Natl Acad Sci U S A. 110, 11827-11832 (2013).
  16. Samel, A., Cuomo, A., Bonaldi, T., Ehrenhofer-Murray, A. E. Methylation of CenH3 arginine 37 regulates kinetochore integrity and chromosome segregation. Proc Natl Acad Sci U S A. 109, 9029-9034 (2012).
  17. Niikura, Y., et al. CENP-A K124 Ubiquitylation Is Required for CENP-A Deposition at the Centromere. Dev Cell. (2015).
  18. Chan, G. K., Liu, S. T., Yen, T. J. Kinetochore structure and function. Trends in cell biology. 15, 589-598 (2005).
  19. Hori, T., Okada, M., Maenaka, K., Fukagawa, T. CENP-O class proteins form a stable complex and are required for proper kinetochore function. Molecular biology of the cell. 19, 843-854 (2008).
  20. Fukagawa, T., Earnshaw, W. C. The centromere: chromatin foundation for the kinetochore machinery. Developmental cell. 30, 496-508 (2014).
  21. Kedersha, N. The Proteintech Blog.Proteintech. Grainger, D. Proteintech Group. (2012).
  22. Clontech Laboratories, Inc. HeLa Tet-Off Advanced Cell Line. Available from: http://www.clontech.com/CR/Products/Inducible_Systems/Tetracycline-Inducible_Expression/ibcGetAttachment.jsp?cItemId=26908&fileId=6712191&sitex=10020:22372:US (2012).
  23. Meraldi, P., Sorger, P. K. A dual role for Bub1 in the spindle checkpoint and chromosome congression. EMBO J. 24, 1621-1633 (2005).
  24. Niikura, Y., et al. 17-AAG, an Hsp90 inhibitor, causes kinetochore defects: a novel mechanism by which 17-AAG inhibits cell proliferation. Oncogene. 25, 4133-4146 (2006).
  25. Yang, Z., et al. Silencing mitosin induces misaligned chromosomes, premature chromosome decondensation before anaphase onset, and mitotic cell death. Mol Cell Biol. 25, 4062-4074 (2005).
  26. Wang, H., et al. Histone H3 and H4 ubiquitylation by the CUL4-DDB-ROC1 ubiquitin ligase facilitates cellular response to DNA damage. Mol Cell. 22, 383-394 (2006).
  27. Lamb, J. R., Tugendreich, S., Hieter, P. Tetratrico peptide repeat interactions: to TPR or not to TPR? Trends Biochem Sci. 20, 257-259 (1995).
  28. Kitagawa, K., Skowyra, D., Elledge, S. J., Harper, J. W., Hieter, P. SGT1 encodes an essential component of the yeast kinetochore assembly pathway and a novel subunit of the SCF ubiquitin ligase complex. Mol Cell. 4, 21-33 (1999).
  29. Niikura, Y., Dixit, A., Scott, R., Perkins, G., Kitagawa, K. BUB1 mediation of caspase-independent mitotic death determines cell fate. J Cell Biol. 178, 283-296 (2007).
  30. Niikura, Y., Kitagawa, K. Identification of a novel splice variant: human SGT1B (SUGT1B). DNA Seq. 14, 436-441 (2003).
  31. Niikura, Y., Ogi, H., Kikuchi, K., Kitagawa, K. BUB3 that dissociates from BUB1 activates caspase-independent mitotic death (CIMD). Cell Death Differ. 17, 1011-1024 (2010).
  32. Ando, S., Yang, H., Nozaki, N., Okazaki, T., Yoda, K. CENP-A, -B, and -C chromatin complex that contains the I-type alpha-satellite array constitutes the prekinetochore in HeLa cells. Mol Cell Biol. 22, 2229-2241 (2002).
  33. Izuta, H., et al. Comprehensive analysis of the ICEN (Interphase Centromere Complex) components enriched in the CENP-A chromatin of human cells. Genes to cells : devoted to molecular & cellular mechanisms. 11, 673-684 (2006).
  34. Obuse, C., et al. Proteomics analysis of the centromere complex from HeLa interphase cells: UV-damaged DNA binding protein 1 (DDB-1) is a component of the CEN-complex, while BMI-1 is transiently co-localized with the centromeric region in interphase. Genes Cells. 9, 105-120 (2004).
  35. Merlet, J., Burger, J., Gomes, J. E., Pintard, L. Regulation of cullin-RING E3 ubiquitin-ligases by neddylation and dimerization. Cell Mol Life Sci. 66, 1924-1938 (2009).
  36. Bennett, E. J., Rush, J., Gygi, S. P., Harper, J. W. Dynamics of cullin-RING ubiquitin ligase network revealed by systematic quantitative proteomics. Cell. 143, 951-965 (2010).
  37. Antonelli, A., et al. Efficient inhibition of macrophage TNF-alpha production upon targeted delivery of K48R ubiquitin. Br J Haematol. 104, 475-481 (1999).
  38. Codomo, C. A., Furuyama, T., Henikoff, S. CENP-A octamers do not confer a reduction in nucleosome height by AFM. Nat Struct Mol Biol. 21, 4-5 (2014).
  39. Thrower, J. S., Hoffman, L., Rechsteiner, M., Pickart, C. M. Recognition of the polyubiquitin proteolytic signal. The EMBO journal. 19, 94-102 (2000).
  40. Yoda, K., et al. Human centromere protein A (CENP-A) can replace histone H3 in nucleosome reconstitution in vitro. Proc Natl Acad Sci U S A. 97, 7266-7271 (2000).
  41. Shelby, R. D., Vafa, O., Sullivan, K. F. Assembly of CENP-A into centromeric chromatin requires a cooperative array of nucleosomal DNA contact sites. J Cell Biol. 136, 501-513 (1997).
  42. Majumder, S., Fisk, H. A. Quantitative immunofluorescence assay to measure the variation in protein levels at centrosomes. J Vis Exp. (2014).
  43. Masumoto, H., Masukata, H., Muro, Y., Nozaki, N., Okazaki, T. A human centromere antigen (CENP-B) interacts with a short specific sequence in alphoid DNA, a human centromeric satellite. J Cell Biol. 109, 1963-1973 (1989).
  44. Yoda, K., Kitagawa, K., Masumoto, H., Muro, Y., Okazaki, T. A human centromere protein, CENP-B, has a DNA binding domain containing four potential alpha helices at the NH2 terminus, which is separable from dimerizing activity. J Cell Biol. 119, 1413-1427 (1992).
  45. Sugata, N., et al. Human CENP-H multimers colocalize with CENP-A and CENP-C at active centromere--kinetochore complexes. Hum Mol Genet. 9, 2919-2926 (2000).
  46. Earnshaw, W. C., Ratrie, H. 3rd, Stetten, G. Visualization of centromere proteins CENP-B and CENP-C on a stable dicentric chromosome in cytological spreads. Chromosoma. 98, 1-12 (1989).
  47. Goshima, G., Kiyomitsu, T., Yoda, K., Yanagida, M. Human centromere chromatin protein hMis12, essential for equal segregation, is independent of CENP-A loading pathway. J Cell Biol. 160, 25-39 (2003).
  48. Liu, S. T., Rattner, J. B., Jablonski, S. A., Yen, T. J. Mapping the assembly pathways that specify formation of the trilaminar kinetochore plates in human cells. J Cell Biol. 175, 41-53 (2006).
  49. Gascoigne, K. E., Cheeseman, I. M. T time for point centromeres. Nat Cell Biol. 14, 559-561 (2012).
  50. Gascoigne, K. E., et al. Induced ectopic kinetochore assembly bypasses the requirement for CENP-A nucleosomes. Cell. 145, 410-422 (2011).
  51. Nishino, T., et al. CENP-T provides a structural platform for outer kinetochore assembly. EMBO J. 32, 424-436 (2013).
  52. Malvezzi, F., et al. A structural basis for kinetochore recruitment of the Ndc80 complex via two distinct centromere receptors. EMBO J. 32, 409-423 (2013).
  53. Schleiffer, A., et al. CENP-T proteins are conserved centromere receptors of the Ndc80 complex. Nat Cell Biol. 14, 604-613 (2012).
  54. Rago, F., Gascoigne, K. E., Cheeseman, I. M. Distinct organization and regulation of the outer kinetochore KMN network downstream of CENP-C and CENP-T. Curr Biol. 25, 671-677 (2015).
  55. Nishino, T., et al. CENP-T-W-S-X forms a unique centromeric chromatin structure with a histone-like fold. Cell. 148, 487-501 (2012).
  56. Bodor, D. L., et al. The quantitative architecture of centromeric chromatin. Elife. 3, e02137 (2014).
  57. Oliver, C. Ch 58. Molecular Biomethods Handbook. Rapely, R., Walker, J. M. Humana Press. 1063-1079 (2008).
  58. Terasima, T., Tolmach, L. J. Changes in x-ray sensitivity of HeLa cells during the division cycle. Nature. 190, 1210-1211 (1961).
  59. Levenson, G. B. R. Ch 8. Biomedical Photonics Handbook. Vo-Dinh, T. uan CRC Press LLC. 8-19 (2003).
  60. Sanderson, J. Fluorescence bleed-though. Available from: http://www.gum2012.fionastoreydesign.co.uk/Downloads/Bleed through text.pdf (2011).
Иммунофлуоресценции Анализ эндогенные и экзогенные Центромера-кинетохор Белки
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Niikura, Y., Kitagawa, K. Immunofluorescence Analysis of Endogenous and Exogenous Centromere-kinetochore Proteins. J. Vis. Exp. (109), e53732, doi:10.3791/53732 (2016).More

Niikura, Y., Kitagawa, K. Immunofluorescence Analysis of Endogenous and Exogenous Centromere-kinetochore Proteins. J. Vis. Exp. (109), e53732, doi:10.3791/53732 (2016).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter