Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Las proteínas Análisis de inmunofluorescencia de endógenos y exógenos Centrómero-cinetocoro

Published: March 3, 2016 doi: 10.3791/53732

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

"Los centrómeros" se define clásicamente como regiones de recombinación meiótica suprimida en genética y más tarde reconocidos como la constricción principal de cromosomas mitóticos, que desempeña un papel esencial en la segregación cromosómica precisa durante la mitosis. "Kinetochores" se describieron como las estructuras de capas múltiples que se unen a los microtúbulos en la superficie de centrómeros, como se revela por microscopía electrónica; "cinetocoros" se definen como más tarde el complejo macromolecular que se localiza en el centrómero de los cromosomas mitóticos. A pesar de una divergencia dramática de secuencias de ADN centroméricas entre los vertebrados, la estructura y composición kinetochore están muy conservadas. Se requiere una interacción dinámica entre los microtúbulos del huso y el cinetocoro fieles a la segregación de los cromosomas durante la mitosis, y defectos en la función del centrómero-cinetocoro plomo a aneuploidía y por lo tanto el cáncer.

El centrómero en la mayoría de los eucariotasno tiene ninguna secuencia de ADN definida, pero se compone de grandes matrices (0,3-5 Mb) de ADN repetitivo alfoide consiste en ADN α-satélite de 171 pb. Excepto en la levadura en ciernes, la identidad centrómero se logra no por la secuencia de ADN, pero por la presencia de un nucleosoma especial que contiene la variante de la histona H3 CenH3 (centrómero Proteína A [CENP-A] en los seres humanos). 5 nucleosomas CENP-A localizar a la placa interior de los cinetocoros de mamíferos y 7 se unen al ADN α-satélite de 171 pb. centrómeros activos requieren que contiene CENP-A-nucleosomas para dirigir el reclutamiento de una red constitutiva centrómero-asociado (CCAN) y las proteínas del cinetocoro, que junto a regular la unión de los cromosomas al huso mitótico y la progresión del ciclo posterior a través del eje de control.

A la luz de la evidencia anterior, se ha propuesto CENP-A sea de la marca epigenética del centrómero 8; sin embargo, el proceso por el cual CENP-A se incorporó into ADN centromérica y los factores responsables de esta incorporación aún no han sido bien caracterizados. Un dominio corto centrómero de segmentación (CATD) reside en la histona región de CENP-A veces, y la sustitución de la región correspondiente de H3 con la CATD es suficiente para H3 directa al centrómero. 9 Varios estudios sugieren papeles funcionales para después de la traducción modificación (PTM) de CENP-A 12-16; sin embargo, aún no se han elucidado los mecanismos moleculares de estos PTMs de CENP-A en la contratación a centrómeros. Hemos informado anteriormente de que se requiere la actividad ligasa Cul4A-RBX1-COPS8 E3 de CENP-A K124 ubiquitinación y localización de CENP-A a los centrómeros. 17

El descubrimiento y caracterización de proteínas kinetochore han dado lugar a una nueva comprensión en cuanto a la segregación cromosómica. 18 Más de 100 componentes del cinetocoro se han identificado en células de vertebrados por varios enfoques. 19,20 Un bajoDe pie de cómo cinetocoros ensamblan y función también viene de la caracterización de las funciones celulares de cada red centrómero-kinetochore proteínas y proteína-proteína dentro de las células. 19 visualización directa y formación de imágenes avanzado métodos en microscopía de fluorescencia proporcionan notable resolución de los componentes centrómero-cinetocoro y permiten la observación directa de los componentes moleculares específicos de los centrómeros y cinetocoros. Además, los métodos de inmunofluorescencia indirecta (IIF) tinción utilizando anticuerpos específicos son cruciales para estas observaciones. Sin embargo, a pesar de numerosos informes acerca de los protocolos IIF, pocos problemas discutidos en detalle de proteínas específicas centrómero-cinetocoro. 1-4 Por lo tanto, el desarrollo y la presentación de informes métodos de tinción IIF y un ensayo cuantitativo IIF un análisis específico de cada proteína centrómero-cinetocoro es extremadamente importante. En la tinción de IIF, se debe proceder con el protocolo de tinción para evitar la pérdida de la proteína de interés oel resto de la célula. Sin embargo, la fijación destruye sitios antigénicos de vez en cuando, y diferentes combinaciones de anticuerpo-antígeno funciona mal con un solo fijador, pero muy bien con otra, 21 y la elección de fijador depende en gran medida de la proteína (s) de interés. Por lo tanto, los diferentes métodos de fijadores son cruciales en la tinción de las proteínas del centrómero IIF-cinetocoro.

Se han desarrollado métodos Aquí optimizadas de inmunofluorescencia indirecta (IIF) tinción y un ensayo para abordar localización de las proteínas del centrómero-kinetochore endógenos, incluyendo CENP-A y las proteínas de CENP-A exógenos bandera de etiquetado, y la cuantificación de estas proteínas en las células humanas. Estos métodos se pueden aplicar al análisis de proteínas centrómero-kinetochore en otras especies.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Cultivo de células y transfección

  1. Ponga una tapa de vidrio (22 mm x 22 mm) en una placa de poliestireno de 6 pocillos. escudo opcionalmente una cubierta de vidrio con poli-L-lisina, 0,1% w / v, en agua (ver Lista de Materiales / Equipo) para mantener las células mitóticas en la cubierta de vidrio siguiendo los siguientes pasos:
    Nota: Las condiciones óptimas deben determinarse para cada línea celular y aplicación.
    1. superficie de cultivo capa asépticamente con poli-L-lisina, 0,1% w / v, en agua (0,4 ml / pocillo de una placa de 6 pocillos de poliestireno). Agite suavemente para asegurar un recubrimiento de la superficie de cultivo.
    2. Después de 5 minutos, retirar la solución por aspiración y enjuague a fondo la superficie con el tejido estéril agua de calidad para cultivo.
    3. Seca al menos 2 horas antes de la introducción de células y medio.
  2. Las células HeLa o células de semillas 17 17,22 en una cubierta de vidrio (22 mm x 22 mm) poner en una placa de poliestireno de 6 pocillos HeLa Tet-Off. Compruebe que la densidad celular es de 5,4 x 10 5 por pocillo. células de cultivoen DMEM de alta glucosa con 10% de FBS y 1% de penicilina-estreptomicina.
    Nota: Para obtener resultados óptimos, empíricamente determinar la densidad de las células para utilizar en la siembra.
  3. Se incuban las células a 37 ° C en una atmósfera de CO2 al 5% durante 18 horas.
    Nota: En el caso de las células HeLa Tet-Off, la transcripción del gen exógeno es activo en ausencia del inductor (es decir, tetraciclina / doxiciclina), por tanto, las células de cultivo sin tetraciclina / doxiciclina y transfectar de forma transitoria con el vector de sobreexpresión pTRM4 (Tabla 2 ), cuya transcripción está regulada por el promotor TRE (ver abajo).
  4. Dieciocho horas después de la siembra de células, transfectar como sigue:
    1. Hacer la solución A mediante la mezcla de 1,5 l de siRNA oligo (20 mM de valores recocido, Tabla 1) y / o 2,0 g de plásmido (Tabla 2) en 50 l medio con suero reducido (véase la lista de materiales / Equipo), e incubar a temperatura ambiente durante 5 min .
      Nota: En este análisis,CA-UTR siRNAs (una mezcla de 5 'y 3' UTR siRNA; Tabla 1) fueron co-transfectadas para uso en los Protocolos 3 y 4 (véase la discusión).
    2. Hacer la solución B mezclando 0,75 reactivo de transfección l I (véase la Lista de Materiales / Equipos) en 50 l reducidos medio con suero, y se incuba a temperatura ambiente durante 5 min.
      Nota: Un paso opcional es la adición de 1,0 l de reactivo de transfección II (véase la lista de Materiales / Equipos).
    3. Mezclar las soluciones A y B juntos, y se incuba a TA durante 15 min.
    4. Se lavan las células cultivadas una vez con PBS, y luego añadir 500 l reducidos medio de suero a cada pocillo de la placa de poliestireno de 6 pocillos. Añadir la mezcla de soluciones A y B (es decir, ARN y / o complejo de ADN-lípido) directamente a cada una de la persona así.
      Nota: La concentración final es de 3,3 mg / ml (plásmido); 50 nM (siRNA).
    5. Se incuban las células a 37 ° C en una atmósfera de CO2 al 5% durante 4,5 horas. Cambiar el medio de alta glucosa DMEM ingenioh 10% de FBS y 1% de penicilina-estreptomicina.
    6. Se incuban las células a 37 ° C en una atmósfera de CO2 al 5% durante 48-72 horas después de la transfección.
      Nota: Para obtener resultados óptimos, el período de incubación para el crecimiento celular antes de la fijación debe determinarse empíricamente, y el agotamiento de la proteína y / o expresión debe ser confirmada por análisis de Western blot (véase el Protocolo 6).
    7. Si el análisis celular mitótico es de interés, añadir paclitaxel (10 nM) a las células cultivadas 24 horas antes de la fijación, o añadir TN16 (0,5 M) a las células cultivadas 2,5 hr antes de la fijación.

2. Fijación de la célula y tinción de inmunofluorescencia para detectar las proteínas endógenas Centrómero-cinetocoro (paraformaldehído fijación)

  1. Preparación de fijador, tampones y reactivos.
    1. Recién preparar 50 ml de solución de paraformaldehído al 4% en PBS, pH 7,4.
      1. Añadir 40 ml de PBS 1X a un vaso de precipitados de vidrio sobre una placa de agitación en una campana ventilada. Calor mientras stirring a aproximadamente 60 ° C. Añadir 2 g de polvo de paraformaldehído a la climatizada PBS.
      2. Levante lentamente el pH mediante la adición de 1 ml de NaOH 1 N en total, debido a que el polvo no se disuelve inmediatamente.
        Nota: La solución borra después de la adición de NaOH.
      3. Una vez que se haya disuelto paraformaldehído, enfriar y filtrar la solución.
      4. Ajustar el pH con HCl 1 N a pH 7,4 y el volumen de la solución con 1 × PBS a 50 ml.
        Nota: Las alícuotas de la solución se pueden congelar o almacenar a 2-8 ° C durante el tiempo que de 1 semana. La solución debe ser o se almacena a 4 ° C enfriado en hielo hasta que se va a utilizar.
    2. Preparar 50 ml de tampón de KB1, que consiste en 10 mM Tris-HCl, pH 7,5; NaCl 150 mM; 0,5% de BSA; y 0,5% de Triton X-100.
      Nota: BSA debe estar recién añadido.
      Nota: La serie KB memoria intermedia se basan en KB tampón descrito en informes anteriores 1,2,4.
    3. Preparar 50 ml de tampón de KB2, que consiste en 10 mM Tris-HCl,pH 7,5; NaCl 150 mM; y 0,5% de BSA.
      Nota: BSA debe estar recién añadido.
    4. Preparar 1 ml de tampón que contiene KB3 DAPI (50 ng / ml).
    5. Preparar 100 ml de medio de montaje, que consiste en 1 mg / ml de p-fenilendiamina; 10% PBS, y 90% de glicerol.
      1. Ajustar el pH de 1 × PBS a 9,8 con NaOH 1 N, se disuelven p-fenilendiamina en la solución, y luego añadir glicerol.
      2. Tienda alícuotas de 1 ml a -80 ° C. Proteger de la luz.
  2. Retire el medio de cultivo por aspiración al 48-72 h después de la transfección (véase el Protocolo 1) para la fijación celular. Las células se lava una vez con PBS. Aplicar PBS a un lado de los pocillos de cultivo para evitar molestar a la superficie de las células.
    Nota: El punto de tiempo óptimo para la fijación de células se debe determinar empíricamente.
  3. Fijar las células en 4% de paraformaldehído en PBS durante 30 min a 4 ° C. Enjuagar las células dos veces con tampón para eliminar KB2 suficientemente residual 4% de paraformaldehído.
  4. permeabiLizé las muestras en KB1 tampón durante 30 min a RT. Enjuagar las células una vez con tampón de KB2, y añadir KB2 tampón durante 5 min a RT para bloquear los sitios adicionales de unión no específica.
    Nota: Buffer KB1 también contribuye significativamente a la de bloqueo.
  5. Quitar una cubierta de vidrio (22 mm x 22 mm) de una placa de poliestireno de 6 pocillos con unas pinzas. Con un marcador de barrera hidrofóbica (ver Lista de Materiales / Equipos), dibujar un cuadrado o un círculo de color verde pálido para formar una barrera hidrofóbica alrededor de cada muestra de vidrio cubierta. No toque ni se acerque demasiado a las células con la pluma barrera hidrofóbica. Ponga la cubierta de vidrio en una nueva placa de poliestireno de 6 pocillos.
  6. Diluir un anticuerpo primario a centrómero o proteína kinetochore (relación de dilución de 1: 100 a 1: 200; véase también la Lista de Materiales / Equipment) y, o bien un anticuerpo anti-CENP-B (relación de dilución de 1: 400) o un anti- anticuerpo centrómero (ACA) (relación de dilución de 1: 2000) como un marcador de ubicación centrómero en KB2 buffer.
    Nota: Para obtener resultados óptimos, la concentración final dela del anticuerpo primario en esta solución debe ser determinada empíricamente.
  7. Aplicar un volumen suficiente (aproximadamente 30 l) del anticuerpo primario diluido para sumergir la muestra de células. Incubar la muestra de células durante 1 hora a 37 ° C. Enjuagar las células 3 veces con tampón KB 2.
  8. Usando KB2 tampón, se diluye un anticuerpo secundario conjugado con fluoróforo (relación de dilución de 1: 100 a 1: 200) dirigido contra cada anticuerpo primario.
    Nota: Para obtener resultados óptimos, la concentración final del anticuerpo secundario en esta solución debe ser determinada empíricamente.
  9. Aplicar un volumen suficiente (una gota de ca. 30 l en el cristal de cubierta) del anticuerpo secundario diluido para sumergir la muestra de células. Incubar la muestra de células durante 1 hora a 37 ° C. Enjuagar las células 5 veces con tampón de KB2 durante un período de 30 min (cinco 6 min lavados).
    Nota: Para obtener resultados óptimos (es decir, para una mínima pérdida de células), la condición de lavado óptimo debe determinarse EmpiricaLLY.
  10. Aplicar un volumen suficiente de KB3 tampón que contiene DAPI (50 ng / ml) para sumergir la muestra de células. Incubar la muestra de células durante 5 min a RT. Enjuagar las células 1-2 veces con tampón KB2.
  11. Montar la cubierta de vidrio que contiene la muestra de células en el portaobjetos de micro.
    1. Colocar una gota de medio de montaje en el centro de la corredera micro.
    2. Retire el líquido de la muestra de células y, utilizando las manos o los fórceps, la posición de la muestra en el centro de la diapositiva micro. Evitar las burbujas de aire.
    3. Eliminar el exceso de medio de montaje con una toalla de papel.

3. Fijación de la célula y Inmunofluorescencia La tinción de C-terminal Bandera de etiquetado CENP-A Proteínas (Acetona fijación)

  1. Preparación
    1. Preparar helado de acetona al 75%.
    2. Recién preparar 50 ml de PBS (pH 7,4) que contiene 0,5% de leche desnatada y 0,5% de BSA.
    3. Recién preparar 50 ml de PBS (pH 7,4) que contiene 0,1% de leche desnatada y 0,1% de BSA.
    4. Preparar 1 ml de PBS (pH 7,4) que contiene DAPI (50-100 ng / ml).
    5. Preparar 100 ml de medio de montaje como se describe en 2.1.5.
  2. Retire el medio de cultivo por aspiración al 48-72 h después de la transfección (véase el Protocolo 1) para la fijación celular. Las células se lava una vez con PBS. Aplicar PBS al lado del pocillo de cultivo para evitar molestar a la superficie de las células.
    Nota: El punto de tiempo óptimo para la fijación de células se debe determinar empíricamente.
  3. Fijar las células en helado de 75% de acetona, y se incuban las células durante 10 min a -20 ° C. Las pilas secas en la cubierta de vidrio en una campana de humos durante 30-60 minutos a temperatura ambiente.
    Nota: Para obtener resultados óptimos, la longitud de tiempo necesario para la fijación y la célula de secado debe ser determinada empíricamente.
  4. Uso del lápiz barrera hidrofóbica (ver Lista de Materiales / Equipos), dibujar un cuadrado o un círculo de color verde pálido para formar una barrera hidrofóbica alrededor de cada muestra de vidrio cubierta. No toque ni se acerque demasiado a las células con la pluma barrera hidrofóbica.
  5. bloque nonspecific sitios en las células de unión mediante la adición de PBS que contenía 0,5% de leche desnatada y 0,5% de BSA durante 5 min a TA.
  6. El uso de PBS que contenía 0,1% de leche desnatada y 0,1% de BSA, se diluye un anticuerpo anti-Flag (1: 1.000 relación de dilución) y, o bien un anticuerpo anti-CENP-B (relación de dilución de 1: 200) o ACA (1: relación de dilución 2000 ) como un marcador de ubicación centrómero.
    Nota: Para obtener resultados óptimos, la concentración final del anticuerpo primario en esta solución debe ser determinada empíricamente.
  7. Aplicar un volumen suficiente (aproximadamente 30 l) del anticuerpo primario diluido para sumergir la muestra de células. Incubar la muestra de células durante 1 hora a 37 ° C. Enjuagar las células 5 veces con el tampón de bloqueo durante un período de 30 min.
    Nota: Las células pueden ser enjuagados con PBS. Para obtener resultados óptimos (es decir, para evitar la pérdida de las células), las condiciones de lavado óptimos deben determinarse empíricamente.
  8. Diluir un anticuerpo secundario conjugado con fluoróforo (relación de dilución de 1: 100 a 1: 200) dirigido contrala cada anticuerpo primario en PBS que contenía 0,1% de leche desnatada y 0,1% de BSA.
    Nota: Para obtener resultados óptimos, la concentración final del anticuerpo secundario en esta solución debe ser determinada empíricamente.
  9. Aplicar un volumen suficiente (aproximadamente 30 l) del anticuerpo secundario diluido para sumergir la muestra de células. Incubar la muestra de células durante 1 hora a 37 ° C. Enjuagar las células 2 veces con PBS que contenía 0,1% de leche desnatada y 0,1% de BSA.
    Nota: PBS solo también puede ser utilizado para lavar las células.
  10. Aplicar un volumen suficiente de PBS que contenía DAPI (50-100 ng / ml) para sumergir la muestra de células. Incubar la muestra de células durante 5 min a RT. Enjuagar las células 1-2 veces con PBS.
  11. Montar la cubierta de vidrio que contiene la muestra de células en el portaobjetos de micro como se describe en 2.11.

4. Fijación de la célula y Inmunofluorescencia La tinción de N-terminal Bandera de etiquetado CENP-A Proteínas (metanol fijación)

  1. Preparación
    1. Preparar metanol enfriado con hielo.
    2. Preparar TBS (pH 7,4) que contiene 4% de suero de cabra.
    3. Preparar 1 ml de TBS (pH 7,4) que contiene DAPI (50-100 ng / ml).
    4. Preparar 100 ml de medio de montaje como se describe en 2.1.5.
  2. Retire el medio de cultivo por aspiración al 48-72 h después de la transfección (véase el Protocolo 1) para la fijación celular. Las células se lava una vez con TBS. Aplicar TBS a un lado de los pocillos de cultivo para evitar molestar a la superficie de las células.
    Nota: El punto de tiempo óptimo para la fijación de células se debe determinar empíricamente.
  3. Fijar las células en metanol enfriado con hielo, y se incuban las células durante 6 min a -20 ° C. Enjuagar las células dos veces con TBS para eliminar suficientemente metanol residual.
  4. Con un marcador de barrera hidrofóbica (ver Lista de Materiales / Equipos), dibujar un cuadrado o un círculo de color verde pálido para crear una barrera hidrofóbica alrededor de cada muestra de vidrio cubierta. No toque ni se acerque demasiado a las células con la pluma barrera hidrofóbica.
  5. Bloquear los sitios de unión no específicos en el cells por TBS añadiendo que contienen 4% de suero de cabra. Incubar durante 10 min a TA.
  6. Diluir un anticuerpo anti-Flag (dilución 1: 1000) y, o bien un anticuerpo anti-CENP-B (relación de dilución de 1: 200) o ACA (1: 2.000 relación de dilución) como un marcador de ubicación centrómero en TBS que contenía 4% de suero de cabra .
    Nota: Para obtener resultados óptimos, la concentración final del anticuerpo primario en esta solución debe ser determinada empíricamente.
  7. Aplicar un volumen suficiente (aproximadamente 30 l) del anticuerpo primario diluido para sumergir la muestra de células. Incubar la muestra de células durante 1 hora a 37 ° C. Enjuagar las células 5 veces con el tampón de bloqueo durante un período de 30 min. Para obtener resultados óptimos (es decir, la pérdida mínima de células), la condición de lavado óptimo debe determinarse empíricamente.
  8. Diluir un anticuerpo secundario conjugado con fluoróforo (relación de dilución de 1: 100 a 1: 200) dirigido contra cada anticuerpo primario en TBS que contenía 4% de suero de cabra.
    Nota: Para obtener resultados óptimos, la FINAl concentración del anticuerpo secundario en esta solución debe ser determinada empíricamente.
  9. Aplicar un volumen suficiente (aproximadamente 30 l) del anticuerpo secundario diluido para sumergir la muestra de células. Incubar la muestra de células durante 1 hora a 37 ° C. Enjuagar las células 3 veces con el tampón de bloqueo.
  10. Aplicar un volumen suficiente de TBS que contenía DAPI (50-100 ng / ml) para sumergir la muestra de células. Incubar la muestra de células durante 5 min a RT. Enjuagar las células 1-2 veces con TBS.
  11. Montar la cubierta de vidrio que contiene la muestra de células en el portaobjetos de micro como se describe en 2.11.

5. La inmunofluorescencia Observación de imágenes, adquisición, cuantificación y análisis

  1. Observar la muestra de células a través de un microscopio de fluorescencia motorizado equipado con una lente de 63X y 100X de inmersión en aceite, una fuente de luz compacta externa, y una cámara digital CCD.
  2. Realizar la adquisición de imágenes y procesamiento, incluyendo deconvolución, mediante el uso de softwareUna o Softwares B1 y B2 (ver Lista de Materiales / Equipos). Por favor, vea el Código Suplementario de Archivos (5.2.1) para todos los comandos utilizados en Software A. Para todos los comandos utilizados en Softwares B1 y B2, véase (5.2.2) en los archivos de código suplementario.
  3. Use un método descrito previamente 23-25 ​​para cuantificar las señales de las proteínas del centrómero-cinetocoro (por ejemplo, señales de CENP-A en el centrómero restante) con las siguientes modificaciones de menor importancia:
    1. Seleccionar zona de las proteínas de centrómero-cinetocoro y la del fondo de la siguiente manera:
      1. celular mitótico: (región centrómero-cinetocoro) Seleccionar área de superposición con los cromosomas teñidos con DAPI; (región de fondo) y la zona exterior cromosomas pero dentro de la única célula idéntica (es decir, región, citosólica).
      2. interfase celular: (región centrómero-cinetocoro) Seleccionar área de superposición con la cromatina se tiñeron con DAPI; (Región de fondo) y la zona exterior de la cromatina, pero dentro de la única célula idéntica (<em> es decir, la región citosólica).
        Nota: Consulte los archivos de código también Suplementario (5.2.1.4.3) o (5.2.2.6.4) para la selección de software Una zona con software o B2, respectivamente.
    2. Cuantificar el porcentaje de señales restantes en los centrómeros mediante el uso de software de A o B. Para esta tarea, utilice la siguiente fórmula:
      Restante señales de proteína-centrómero cinetocoro en el centrómero-cinetocoro
      ecuación1
      donde s es el brillo de la señal de la zona seleccionada, que se confirma por ACA o tinción CENP-B; b es el brillo de la señal de fondo; muestra de r es las señales de ACA de referencia o CENP-B para siRNA (s) células tratadas; y r es el ctrl señales CENP-B ACA referencia o de las células transfectadas con siRNA Luc.
      Nota: En este análisis, se utilizaron señales CENP-B como señales de referencia para Cul4A y RBX1 como se describe en los informes anteriores.
    3. Utilice un archivo de Excel para este cálculo después de copiar y pegar los datos en bruto de la señal de software de cuantificación se ha descrito anteriormente. Ver también los archivos de código suplementario: (5.2.1.4) y (5.2.2.6) para obtener más información. Un ejemplo de cálculo se muestra en la Tabla 3.
  4. Analizar al menos 20 células para eliminar la variación en la tinción y adquisición de imágenes para cada nivel de medición. utilizar opcionalmente "valor medio" de permanecer señales del centrómero-cinetocoro para cada analizaron las células para comparar estos valores entre diferentes proteínas del centrómero-cinetocoro.

6. Análisis de transferencia Western de las proteínas totales

  1. Resuspender las células en tampón desnaturalizante A (20 mM Tris-HCl, pH 7,4; NaCl 50 mM; 0,5% de Nonidet P-40; 0,5% desoxicolato; 0,5% de SDS; EDTA 1 mM; y completa de la proteasa cóctel inhibidor libre de EDTA), 26 sujeta la suspensión a un tratamiento con ultrasonidos y el proceso de congelación-descongelación, y medidalas concentraciones de proteína como sigue:
    1. Para el proceso de sonicación, se añaden 50 l de tampón A a las células recogidas a partir de dos pocillos de una placa de poliestireno de 6 pocillos a 48 a 72 h después de la transfección (véase el Protocolo 1). Operar un aparato de ultrasonidos equipada con el cuerno disruptor y micropunta (ver Lista de Materiales / Equipo) para una duración total de 15 seg-pulso intermitente (ciclo de trabajo del 50%) por cada muestra.
    2. Para el proceso de congelación-descongelación, congelación de células con nitrógeno líquido y descongelar las células a TA.
    3. Medir las concentraciones de proteína usando un ensayo de proteína reactivo I o II comercial (ver Lista de Materiales / Equipos).
      Nota: Los lisados ​​se diluyen con relación de 1:10 en la medición de las concentraciones de proteína, ya sea con el reactivo I o II. A esta dilución, el SDS presente en tampón A muestra poca o ninguna interferencia en esta medición.
  2. Mezclar el lisado que contiene 20 a 30 g de proteína total con tampón de carga 2 × o 4 × SDS-PAGE. 27 hervir las muestras para5 min y luego cargarlos en un 12.0% -15.0% de desnaturalización en gel de poliacrilamida-SDS para electroforesis.
  3. La transferencia de las proteínas separadas por SDS-PAGE a una membrana de PVDF usando un método de inmunotransferencia de tipo Western descrito anteriormente. 17,24,27-31
    1. Bloquear los sitios de unión no específicos en la membrana con leche no grasa al 5% en 1 x PBS, y luego se incuba la membrana con soluciones de anticuerpos primarios diluidos durante 1 hora a RT. Ver Lista de Materiales / Equipos para obtener información detallada (por ejemplo, relación de dilución) de cada anticuerpo primario.
    2. Después de lavar la membrana 3-4 veces (cada uno de 3 a 5 minutos de incubación con agitación) con tampón de PBS-T (1 x PBS y 0,1% Tween-20), incubar la membrana en una mezcla de infrarrojo cercano (IR) anticuerpos secundarios de tinte conjugado fluorescentes (relación de dilución de 1: 20000), anticuerpos secundarios conjugados DyLight (relación de dilución de 1: 20.000), y / o peroxidasa de rábano picante (HRP) conjugado con anticuerpos secundarios (diluido en PBS-T; dilutien proporción de 1: 10000) durante 1 hora a RT. Ver Lista de Materiales / Equipos para obtener información detallada (por ejemplo, relación de dilución) de cada anticuerpo secundario.
  4. Lavar la membrana 3 veces, y luego escanear la membrana para analizar las proteínas con el sistema de imágenes de infrarrojos y / o el generador de imágenes de quimioluminiscencia para la detección de inmunotransferencia (véase la lista de materiales / equipo).
    1. Para poder utilizar el sistema de imágenes por infrarrojos, véase (6.4.1) en los archivos de código suplementario.
    2. Para poder utilizar el reproductor de imágenes de quimioluminiscencia, véase (6.4.2) en los archivos de código suplementario. Utilizar un sustrato ultrasensible mejorado de quimioluminiscencia (ECL) (véase la lista de materiales / Equipo) para este sistema.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

El análisis de inmunofluorescencia de endógena CENP-A es compatible con la hipótesis de que se requiere Cul4A-E3 ligasa para la localización de CENP-A a centrómeros
Nuestros estudios recientes demostraron que se requiere la actividad ligasa Cul4A-RBX1-COPS8 E3 para la ubiquitinación de la lisina 124 (K124) en el CENP-A y localización de CENP-A a los centrómeros. 17 Inicialmente, el complejo de interfase-centrómero (ICEN) fue aislado por anti-CENP-a: inmunoprecipitación de la cromatina nativa, 32-34 y se ha planteado la hipótesis de que algunas de las proteínas ICEN pueden desempeñar un papel en la localización de CENP-a a los centrómeros. Por lo tanto, se realizaron experimentos desmontables de siRNA para la detección de proteínas cuya ausencia de la expresión inducida por la deslocalización de CENP-A en centromeres 17 (datos no mostrados): asincrónicamente creciente células HeLa fueron transfectadas con Cullin 4A (Cul4A) siRNA o siRNA RBX1 para los tiempos requerido para el agotamiento de la proteína óptima (48 hr para Cul4A y 72 h para RBX1). Las células transfectadas con siRNA Cul4A mostraron una deslocalización significativa de CENP-A en centromeres (Figura 1A-C). Como se ve en la Figura 2G, los niveles de proteína de CENP-A en el total de lisados ​​celulares de células transfectadas con siRNA Cul4A fueron similares a los niveles de CENP-A en lisados ​​de luciferasa (LUC) células siRNA-transfectadas en las mismas condiciones de cultivo. Se excluyó la posibilidad de efectos fuera de la meta de Cul4A siRNA, porque la expresión ectópica de Cul4A-Flag rescató a la reducción de la CENP-A en centromeres cuando Cul4A siRNA dirigidos los 3 'UTR (Figura 2A-C). Los niveles de proteína de CENP-A en lisados ​​de células totales se confirmó que eran similares a los niveles CENP-A en lisados ​​de células transfectadas con siRNA Luc en las mismas condiciones de cultivo, independientemente de la (1B figuras, 2G) de la etapa del ciclo celular; Por lo tanto, la posibilidad de que Cul4A agotamiento causado CENP-A degradación de la proteína fue eliminada.

35 y contienen 3 elementos principales: un andamio Cullin, una proteína de tipo dedo RING (o RBX1 RBX2), y una enzima E2 ubiquitina-cargado que es reclutado por RBX1 o RBX2, 36 proteína de dedo de un anillo también recluta a un adaptador de sustrato que coloca a los sustratos en la proximidad de la enzima E2 para facilitar la transferencia de ubiquitina. 36 siRNAs Rbx1 indujo una reducción significativa de CENP-a en centromeres (Figura 1D-F) en las condiciones en las que los niveles de proteína de CENP-a en el total de lisados ​​celulares de células siRNA-transfectadas RBX1 eran similares a los niveles de CENP-a en lisados ​​de células transfectadas con siRNA Luc (figura 2G). La degradación de CENP-A de proteínas, ya sea por agotamiento RBX1 o por la combinación de Cul4A y el agotamiento RBX1 en las mismas condiciones de cultivo no se observó (Figura 2G). La posibilidad de efecto fuera del objetivose excluyó s de RBX1 siRNA, porque la expresión ectópica de Flag-RBX1 rescató la reducción de CENP-A en centromeres cuando RBX1 siRNA dirigido el 3 'UTR (Figura 2D-F). Estos resultados sugirieron que Cul4A-RBX1-E3 ligasa se requiere específicamente para la localización de CENP-A a los centrómeros.

El análisis de inmunofluorescencia de exógena CENP-A - proteínas de la bandera indica que el CENP-A K124 ubiquitylation es esencial para la localización de CENP-A a centrómeros
Anteriormente, nuestro análisis de espectrometría de inmunoprecipitación de masas mostró que la lisina 124 (K124) de CENP-A-Flag se ubiquitylated en células HeLa. 17 En la estructura cristalina de la CENP-A nucleosoma, K124 reside en la hélice α3, aunque el sitio es no dentro de la región CATD. 17 Además, K124 se conserva entre mamíferos, aves, lagartos, plantas, y un grupo de hongos (por ejemplo, broteding levadura). 17 CENP-A mutantes de lisina (Figura 3A) se construyó y se probó su capacidad de localizar al centrómero. Se observó supresión sustancial de la localización centromérica de exógena CENP-A mutante K124R con señales difusas en tanto mitóticos y de interfase células HeLa (Figura 3B, C). Centrómero localización no fue significativamente afectada ni por mutaciones K9A (K9 corresponde a la histona H3 K9 metilación) ni mutaciones K77R (K77 es un sitio único en lisina CATD) (Figura 3B, C).

Basándose en estos resultados, se proponen dos hipótesis con respecto a la función in vivo de CENP-A ubiquitylation en K124. En primer lugar, el papel de K124 ubiquitylation es para la proteolisis mediada por ubiquitina de eliminar sobreexpresado y / o mislocalized CENP-A a la eucromatina. En segundo lugar, el papel de CENP-A ubiquitylation en K124 es para la carga de CENP-A en centrómeros. Para probar la fposibilidad rimero, se abordaron las estabilidades de tipo CENP-A-Bandera salvaje y el mutante K124R, así como endógenas CENP-A después de cicloheximida (CHX) tratamiento de CUL4A- o células RBX1-agotado. Estos datos sugirieron que ubiquitylation de K124 es, probablemente, que no participan en la proteolisis mediada por ubiquitina de eliminar sobreexpresado y / o mislocalized CENP-A (datos no mostrados). 17. Además, se confirmó que la mutación K124R abroga bandas monoubiquitylation y diubiquitylation putativo, tanto en in vivo y en ensayos de ubiquitylation in vitro (datos no presentados). 17 En conjunto, estos datos sugieren que el complejo Cul4A-RBX1 contribuye a ubiquitylation "señalización", la cual es necesaria para la localización de CENP-a en centromeres.

El análisis de inmunofluorescencia de la bandera exógena - proteínas CENP-A indica que la fusión monoubiquitin es suficiente para cargarCENP-A en centromeres K124R
Sobre la base de los resultados anteriores, se planteó la hipótesis de que monoubiquitin unido covalentemente sirve como una señal para CENP-A carga en centrómeros. Para probar esta hipótesis, un N-terminal Bandera de etiquetado y C-terminal de ubiquitina-condensado de tipo salvaje CENP-A y un mutante K124R se construyó CENP-A (Figura 4A). El mutante monoubiquitin Ub (K48R), que carece de un sitio importante para polyubiquitylation 37-39 también se utiliza para prevenir la ubiquitina-fusionado CENP-Una proteína de polyubiquitylation potencial. Al capturar las señales de inmunofluorescencia anti-Flag, se probó la localización centromérica de las proteínas codificadas por estos constructos. Mientras que la bandera-CENP-A (K124) sustancialmente abrogada la localización del centrómero CENP-A (Figura 4B y 4C, la columna [6]), ambos Bandera-CENP-A (WT) y Bandera-CENP-A (WT) -UB ( WT) mantiene su localización centrómero (Figura 4B y 4C, las columnas [1] y [2]). los-A CENP-Flag (K124R) -UB (K48R) proteína presumiblemente imitaba monoubiquitylated CENP-A, ya que esta proteína restaurado sustancialmente la localización de los centrómeros (Figura 4C, comparar columnas [5] y [6]) más eficientemente que hizo CENP-A (K124R) -UB (WT) (Figura 4C, comparar columnas [4] - [6]). Estos datos demostraron que monoubiquitylation es suficiente para la contratación de CENP-A a los centrómeros.

Figura 1
Figura 1. El análisis de inmunofluorescencia de endógena CENP-A es compatible con la hipótesis de que se requiere Cul4A-E3 ligasa para la localización de CENP-A a centrómeros (figuras han sido adaptados de Niikura et al. 17). Deslocalización inducida (A) Cul4A siRNA de CENP-A en centromeres. células HeLa fueron transfectadas con Cul4A o luciferasa siRNA (Luc) y se incubaron durante 48 hr (Tabla 1). La barra de escala representa 10 m. (B) Análisis de transferencia Western de lisados ​​de células HeLa conjunto utilizando la misma condición de cultivo como en (A). Las células se recogieron 48 horas después de la transfección con Cul4A siRNA o Luc siRNA (Tabla 1). GAPDH sirvió como control de carga. (C) Las señales de CENP-A cuantificado endógenos en centrómeros se muestran en (A). La normalización de las señales se llevó a cabo mediante el uso de células transfectadas con siRNA Luc, y se muestran los porcentajes medios (± DE). **** P <0,0001 vs células transfectadas con siRNA Luc (prueba t de Student). Deslocalización inducida (D) RBX1 siRNA de CENP-A partir de los centrómeros. Células HeLa fueron transfectadas con RBX1 o Luc siRNA (s) y se incubaron durante 72 hr (Tabla 1). La barra de escala representa 10 m. (E) Análisis de transferencia Western de lisados ​​de células HeLa conjunto utilizando la misma condición de cultivo como en (D). Las células se recogieron 72 horas después de la transfección con RBX1 or Luc siRNA (s) (Tabla 1). GAPDH sirvió como control de carga. (F) cuantificado de señales endógenas CENP-A en centromeres se muestran en (D). La normalización de las señales se llevó a cabo mediante el uso de células transfectadas con siRNA Luc, y se muestran los porcentajes medios (± DE). **** P <0,0001 vs células transfectadas con siRNA Luc (prueba t de Student). Haga clic aquí para ver una versión más grande de esta figura.

Figura 2
Figura 2. Información de consulta relacionada con la Figura 1 centrómeros (figuras fueron adaptadas de Niikura et al. 17). (A) exógena Cul4A-Flag rescató a la deslocalización de CENP-A cuando Cul4A siRNA dirigidos los 3 'UTR. HeLa Tet-Off cells se fijaron en 48 horas después de la co-transfección con siRNA (Cul4A # 2: 3 'UTR objetivo o Luc; Tabla 1), además de la construcción de plásmido (pTRM4-Cul4A-Flag o vector; Tabla 2). inmunotinción de 4 colores: tinción de DAPI (azul); Bandera; endógena CENP-B (rojo); y endógenos CENP-A (verde), se realizó y se clasificaron las células Bandera-positivas, pero las imágenes de la bandera se omiten por razones de simplicidad. Nota: Cul4A # 2 es el objetivo idéntico al que se muestra en la Figura 1A-C. La barra de escala representa 10 m. (B) Análisis de transferencia Western de HeLa Tet-Off lisados ​​de células enteras después de la misma condición de cultivo como se muestra en (A). GAPDH sirvió como control de carga. Señales (C) CENP-A en centrómeros se muestra en (A) se cuantificaron por microscopía después de la clasificación de las células para aislar a los que se une un anticuerpo anti-Flag. La normalización de las señales se realizó con células transfectadas con siRNA Luc además vector, y se muestran los porcentajes medios (± DE).**** P <0,0001 vs células transfectadas con siRNA Luc además vector (columna izquierda, la prueba t de Student). (D) exógena Bandera-RBX1 rescató a la deslocalización de CENP-A en el centrómero cuando RBX1 siRNA dirigidos los 3 'UTR . Células HeLa se fijaron en 72 horas después de la co-transfección con siRNA (RBX1 # 2: 3 'UTR objetivo o Luc; Tabla 1), además de la construcción de plásmido (pcDNA3-Flag-RBX1 o vector; Tabla 2). inmunotinción de 4 colores: tinción de DAPI (azul); Bandera; endógena CENP-B (rojo); y endógenos CENP-A (verde), se realizó y se clasificaron las células Bandera-positivas, pero las imágenes de la bandera se omiten por razones de simplicidad. La barra de escala representa 10 m. (E) Análisis de transferencia Western de lisados ​​de células HeLa conjunto siguiendo la misma condición de cultivo como en (D). GAPDH sirvió como control de carga. (F) señales de CENP-A en centrómeros se muestran en (D) se cuantificaron por microscopía después de la clasificación de las células para aislar los unidos por una n anticuerpo anti-Flag. La normalización de las señales se realizó con células transfectadas con siRNA Luc además vector, y se muestran los porcentajes medios (± DE). **** P <0,0001 vs células transfectadas con siRNA Luc además vector (columna, la prueba t de Student izquierda). (G) El agotamiento de Cul4A y RBX1 no afectaron a los niveles endógenos de proteína CENP-A. Los niveles endógenos de proteína CENP-A fueron medidos en HeLa lisados ​​de células enteras cosecharon 72 horas después de la transfección con Cul4A, RBX1, Cul4A más RBX1, o Luc siRNA. Cuarenta y ocho horas después de la transfección, las células se dejaron sin tratar (Asyn) o tratados con paclitaxel (+ Tax) para inducir la detención en la mitosis, y se cultivaron durante 24 hr. GAPDH sirvió como control de carga. Por favor, haga clic aquí para ver una versión más grande de esta figura.

32 / 53732fig3highres.jpg "width =" 700 "/>
Figura 3. Análisis de inmunofluorescencia de proteínas exógenas CENP-A-Flag indicó que se requiere CENP-A K124 ubiquitinación para la localización de CENP-A en centromeres (figuras han sido adaptados de Niikura et al. 17). (A) La sobreexpresión de CENP-A- construcciones Flag (WT y mutantes KR) se confirmó mediante análisis de transferencia de Western de células HeLa Tet-Off lisados ​​de células enteras. Las células se recogieron 48 horas después de la transfección con pTRM4-CENP-A-Flag WT, los mutantes Kr, o vector pTRM4 (Tabla 2). La sobreexpresión de CENP-A-Flag se detectó mediante un anticuerpo anti-Flag. GAPDH sirvió como control de carga. se muestran putativo CENP-A-Flag dímero (##) y el monómero CENP-A-Flag (#). Nota: dímeros SDS-resistentes CENP-A se ha informado anteriormente 40,41 (B) El CENP-A mutante K124R mostró deslocalización difundido desde centrómeros.. Las señales de DAPI (azul), Bandera (gradon) y endógena CENP-B (rojo, un control de localización centrómero) se muestran. Nota: A diferencia de endógeno CENP-A en células transfectadas con Cul4A o siRNA RBX1, señales difusas aparecieron en las células que sobreexpresan exógeno CENP-A K124R-Flag como un fenotipo de la incapacidad para ser dirigidos a los centrómeros, presumiblemente debido a su nivel de expresión es aproximadamente 10 - a 25 veces mayor que la de endógeno CENP-a (datos no mostrados) 17 barra de escala representa 10 micras (C) Histogramas de los patrones de localización que se muestran en (B)... Más de 50 células / prometaphase y metafase a favor y en más de 200 células en interfase por experimento fueron contados (n ≥ 3 experimentos). Se muestran los porcentajes medios (± DE). "Otros (Non-centrómero)" indica que las células dañadas en su mayoría, las células muertas o células con la localización nucleolar (sólo en interfase), presumiblemente a causa de transfección u otros tratamientos. *** P <0,001 frente a CENP-A WT-Flag (prueba t de Student).

Figura 4
Figura 4. Análisis de inmunofluorescencia de las proteínas exógenas Bandera-CENP-A indicó que CENP-A de fusión monoubiquitin deslocalización rescatado de la CENP-A mutante K124R de centrómeros (figuras fueron adaptadas de Niikura et al. 17). (A) los dibujos animados esquemáticos de cada construcción utilizada en este estudio (ver también la Tabla 2). El sitio de la mutación K124R en CENP-A (rojo) y el sitio de la mutación K48R en monoubiquitin (azul) se muestran. (1) WT: Bandera-CENP-A WT, (2) WT-Ub (WT): Bandera-CENP-A WT-Ub (WT), (3) WT-Ub (K48R): Bandera-CENP-A WT -UB (K48R), (4) K124R-Ub (WT): Bandera-CENP-A-K124R Ub (WT), (5) K124R-Ub (K48R): Bandera-CENP-A-K124R Ub (K48R), (6) K124R: Bandera-CENP-A K124R (B) exógena CENP-A de fusión monoubiquitin deslocalización rescatado de la CENP-A mutante K124R de centrómeros.. se muestran; DAPI (azul), la bandera (verde) y endógena CENP-B (un control de ubicación centrómero rojo). La barra de escala representa 10 m. (C) Histogramas de los patrones de localización mostrados en (C). Más de 50 células / prometaphase y metafase a favor y en más de 200 células en interfase por experimento fueron contados (n ≥ 3 experimentos). Se muestran los porcentajes medios (± DE). **** P <0,0001 y *** P <0,001 frente a no fusionada Bandera-CENP-A K124R (columna [6]) (prueba t de Student). Por favor, haga clic aquí para ver una versión más grande de esta figura.

siRNA objetivo Indicación en el presente estudio tipo de destino número de bases de datos de siRNA Secuencia de desvío (s) Fuente / Referencia
Luciferase (GL3) - 1 destino RKK9 CUUACGCUGAGUACUUCGAdTdT Elbashir et al., (2001)
CENP-A CA-UTR piscina siRNA (2 objetivos mezcla) RKK375 / 5 'UTR t1 CGAGCGGCGCGGACUUCUGCCdTdT Niikura et al., (2015)
RKK383 / 3 'UTR t1 UCCUGCACCCAGUGUUUCUGUdGdT Niikura et al., (2015)
Cul4A # 1 1 destino CRKK178 / RKK309 / t1 AGCGAUCGUAAUCAAUCCUGA Niikura et al., (2015)
# 2 (3'UTR) 1 destino CRKK181 / RKK331 / t4 AUGCGGGUUUGAAAUAUGACA Niikura et al., (2015)
RBX1 / ROC1 # 1 piscina siRNA (4 objetivos mezcla) CRKK198 / RKK411 / t1 GAAGCGCUUUGAAGUGAAA Niikura et al., (2015)
CRKK198 / RKK413 / t2 GCAUAGAAUGUCAAGCUAA Niikura et al., (2015)
CRKK198 / RKK415 / t3 GCAAGAAGCGCUUUGAAGU Niikura et al., (2015)
CRKK198 / RKK417 / t4 CAACAGAGAGUGGGAAUUC Niikura et al., (2015)
# 2 (3 'UTR) 1 destino CRKK206 / RKK425 / T8 UUCCCUGCUGUUACCUAAUUA Niikura et al., (2015)

Tabla 1. secuencias de siRNA usadas en este estudio.

número B Característica relevante (s) Fuente / Referencia
B288 pTRM4 Niikura et al., (2006)
B2067 pTRM4-humana CENP-A-Flag Niikura et al., (2015)
B2281 pTRM4-humana CENP-A-K9A Bandera Niikura et al., (2015)
B2387 pTRM4-humana CENP-A K77R-Flag Niikura et al., (2015)
B2388 pTRM4-human CENP-A-K124R Bandera Niikura et al., (2015)
B2512 pTRM4-Flag-humana CENP-A Niikura et al., (2015)
B2579 CENP-A-Bandera-pTRM4 humana K124R Niikura et al., (2015)
B2513 pTRM4-Flag-humana CENP-A-Ub (WT) Niikura et al., (2015)
B2559 pTRM4-Flag-humana CENP-A-K124R Ub (WT) Niikura et al., (2015)
B2515 pTRM4-Flag-humana CENP-A-Ub (K48R) Niikura et al., (2015)
B2560 pTRM4-Flag-humana CENP-A-K124R Ub (K48R) Niikura et al., (2015)
B2759 pTRM4-humana Cul4A-Flag Niikura et al., (2015)
B2624 RBX1 pcDNA3-Flag-humana Niikuraet al., (2015)
B1491 pcDNA3-Flag Niikura et al., (2015)

Tabla 2. Los vectores de plásmidos utilizados en este estudio.

R (anti-CENP-B) de la muestra B (anti-CENP-B) R muestra (restado) Relación (S muestra: R muestra) Relación corregida (S muestra: R muestra)
520 514 6 -4,167 0.000
535 445 90 -1,033 0.000
515 431 84 0,274 0,274
562 483 79 0,506 0,506
902 562 340 0,509 0,509
1203 703 500 -0,560 0.000
1014 589 425 -0,819 0.000
768 510 258 -1,345 0.000
555 458 97 -1,845 0.000
781 576 205 -1,146 0.000
556 436 120 0,758 0,758
534 493 41 -1,634 0.000
702 543 159 0,667 0,667
482 429 53 -1.000 0.000 654 531 123 0.740 0.740
1190 607 583 0,384 0,384
552 454 98 0,969 0,969
489 413 76 0,539 0,539
511 452 59 -3,186 0.000
485 475 10 -2,700 0.000
481 441 40 -1,475 0.000
Suma 5.347
Promedio 0,255
R (anti-CENP-B) ctrl B (anti-CENP-B) Relación (S ctrl: R ctrl) Relación corregida (S ctrl: R ctrl)
543 483 60 3.017 3.017
526 466 60 2.667 2.667
532 460 72 1.792 1.792
507 457 50 3.520 3.520
491 458 33 4.273 4.273
545 464 81 2.160 2.160
518 484 34 3.559 3.559
461 404 57 2.404 2.404
487 447 40 3.550 3.550
534 477 57 3.965 3.965
528 456 72 3.097 3.097
707 601 106 1.868 1.868
615 528 87 2.828 2.828
660 481 179 1.620 1.620
565 476 89 1.607 1.607
527 455 72 3.583 3.583
560 474 86 2.930 2.930
510 451 59 4.017 4.017
729 586 143 2.678 2.678
634 576 58 3.655 3.655
507 476 31 3.935 3.935
Suma 62.725
Promedio 2.987
Restante señales CENP-A en el centrómero (%) 8.5

. Tabla 3. Un ejemplo de cálculo de las señales restantes CENP-A en el centrómero (%) se muestra un ejemplo de Pro / Prometafase en la Figura 2F: muestra es RBX1 # 2 (3'UTR) + Vec (columna central en la Figura 2F ) y el control es Luc + Vec (columna izquierda en la Figura 2F). Como resultado, las señales restante CENP-A encentrómero (%) = (0.255 / 2.987) se obtiene x 100 = 8,5% (O [5.347 / 62.725] x 100 = 8,5% con el mismo número total de células [es decir, las células 21] analizaron entre dos muestras). Tenga en cuenta que si el valor de b es mayor que el valor S (es decir, si el valor se resta es negativo), el valor corregido relación se establece en 0,00.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

En los últimos años muchos estudios han desarrollado diferentes ensayos de microscopía cuantitativa de células fijadas. 42 El progreso en la biología centrómero-kinetochore a menudo requiere una comprensión de la función específica del centrómero o-kinetochore específico de proteínas de las cuales subcelular regulación espacial-temporal refleja las cambiantes funciones de estas proteínas durante el ciclo celular. Por lo tanto, aquí hemos desarrollado métodos de tinción de IIF y un ensayo cuantitativo IIF para analizar específicamente los niveles relativos de endógeno y proteínas exógenas CENP-A, que puede ser aplicable en las muestras tratadas de manera diferente. Actualmente hemos logrado con éxito tinción IIF endógena de CENP-I, CENP-H, KNL1, Hec1, y Ska1 usando el Protocolo nº 2 en este estudio (ver Niikura et al 24, y los datos no presentados;. Lista de Materiales / Equipo para la información de los anticuerpos) . En el futuro, se puede aplicar el mismo método para cuantificar el nivel de las diferentes proteínas del centrómero-cinetocoro (tanto endogendógeno y la bandera de etiquetado proteínas exógenas) la elección de los anticuerpos específicos, sin embargo, nuestros métodos IIF no cubren la detección de estas proteínas en las células vivas o en una célula simple específico durante el ciclo celular completo. Debido a que estos procedimientos requieren células para ser fijados y procesados ​​en cubreobjetos separadas, introdujimos señales de referencia (por ejemplo, ACA o CENP-B) para el propósito de la normalización con el fin de comparar bastante señales entre diferentes muestras y aumentar la precisión del ensayo. Debido ACA implican señales endógenos y / o exógenos CENP-A, CENP-B como señal de referencia para el propósito de la normalización sería más apropiado para la comparación que lo haría ACA en términos de la exactitud del ensayo cuantitativo de las señales de CENP-A. La región amino-terminal de CENP-B se une al motivo de 17 pb de la secuencia de cuadro de CENP-B en el ADN alfoide, y la región carboxi-terminal de CENP-B forma homodímeros. 43,44 CENP-B no colocalize completamente con CENP-A y / o de otro centrproteínas Omere-cinetocoro, sin embargo, se asocia estrechamente con ellos. 45 Mientras inmunofluorescencia con anticuerpos anti-CENP-C por lo general da dos puntos discretos, la tinción con anti-CENP-B aparece a menudo como una sola barra luminosa que conecta ambos hermana centromeres. 46 Sin embargo , en nuestra observación microscópica macro-escala, algunas señales de CENP-B aparentemente se superponen con las señales de CENP-a, sobre todo en las fases de la mitosis anteriores (profase-prometaphase que tarde metafase), también en parte, en función del ángulo de observación y el tipo de fijador utilizado (datos no mostrados). Por el contrario, en un ensayo de IIF cuantitativa de las señales de CENP-A, la localización de proteínas de señales de referencia no debería verse afectada por el agotamiento y / o disfunción de CENP-A para el análisis justo, aunque la localización de la mayoría de las proteínas de centrómero-kinetochore depende de CENP-a localización en centromeres. montaje kinetochore 47,48 CENP-a-independiente se establece mediante la sustitución de las regiones de unión al ADN de CENP-C Y CENP-T con dominios alternativos de cromosomas de metas que reclutan a estas proteínas para loci ectópico. 49,50 Además, trabajos recientes indican que los componentes internos del cinetocoro CENP-C y CENP-T actúan en paralelo para reclutar a la red de KMN cinetocoros. 51-54 Además, Nishino et al. sugirieron que las formas complejas CENP-TWSX una estructura similar a nucleosoma única para generar contactos con ADN, se extiende el "código de histonas" más allá de las proteínas de nucleosomas canónicas. 55 Debido a la localización del centrómero CENP- C depende de la localización de centrómero CENP-a, 47,48 CENP-TWSX o especialmente CENP-T podría ser otro candidato (s) proteína para proporcionar señales de referencia en un ensayo de IIF cuantitativa de CENP-a. Sin embargo, el candidato para la señalización de referencia debe ser probado cuidadosamente antes del ensayo para determinar si la localización en centromeres se ve afectada por el agotamiento y / o disfunción del CENP-A. consideración análogase debe tomar para ensayos cuantitativos IIF de otras proteínas del centrómero-cinetocoro: localización de la proteína de señales de referencia no debe verse afectada por el agotamiento y / o disfunción de la proteína diana para el análisis objetivo. En el estudio anterior, hemos utilizado ACA como señal de referencia para el ensayo IIF cuantitativa de otras proteínas centrales-externa del cinetocoro. 24 ACA podría ser una opción más apropiada que la única CENP-B como un control de posición, así como una señal de referencia, si ACA señales no se ven afectados por el agotamiento y / o la disfunción de la proteína diana pero colocalización de la proteína diana con CENP-B es pobre como se mencionó anteriormente.

Bodor et al. informaron que los niveles centroméricas CENP-A están regulados por la acción de masas, es decir, la cantidad de centromérica CENP-A varía en proporción directa con el contenido celular. 56 También mostraron que la inducción transitoria de CENP-A expresión conduce a un aumento rápido en la centromérica CENP-A nivel. Por el contrario, se observó una población de células grandes con centrómero-localizada, Bandera de etiquetado CENP-A WT después de la co-transfección del vector de expresión pTRM4 con CA-UTR siRNAs (una mezcla de 5 'y 3' UTR siRNA, Tabla 1) (no de datos mostrado); esta población era mayor que la observada después de la transfección con sólo el vector de expresión pTRM4. El nivel de exógena Bandera de etiquetado CENP-A de proteínas cuya expresión fue impulsado por pTRM4, fue de aproximadamente 1,0 a 1,4 órdenes de magnitud (de 10 a 25 veces) mayor que la de endógeno CENP-A (datos no mostrados). Se especula que la expresión exógena de CENP-A WT encima de un umbral particular, podría afectar negativamente a su localización centromérica adecuada.

En los protocolos actuales, la fijación es un paso crítico para mantener la estructura celular y el medio ambiente como la situación proximal como sea posible al estado nativo. Una vez que se fijan las células, se debe proceder con el protocolo de tinción para evitar la pérdida de la proteína de intedescansar o el resto de la célula. Sin embargo, la fijación destruye sitios antigénicos de vez en cuando, y diferentes combinaciones de anticuerpo-antígeno funciona mal con un solo fijador, pero muy bien con otra. 21 Debido a esta variación, la elección del fijador depende en gran medida de la proteína (s) de interés. La longitud de tiempo de fijación puede afectar de manera significativa la detección de la proteína (s) por inmunotinción, y fijación más corto es generalmente mejor para conservar la antigenicidad. 57 Por lo tanto, cuando la determinación de los procedimientos de tinción para un nuevo objetivo de otras proteínas centrómero-cinetocoro, especialmente de incierto localización, o cuando se trabaja con un nuevo anticuerpo, uno debe probar varios métodos de fijación y tampones para encontrar las condiciones óptimas. En los protocolos actuales, se seleccionaron dos tipos de fijadores populares: fijadores de aldehído (Protocolo 2) y disolventes orgánicos (Protocolos 3 y 4). La pureza de los fijadores también es extremadamente importante. En el Protocolo 4, 4% de suero de cabra se utiliza especiaLLY para bloquear los receptores de IgG en la superficie celular para reducir el fondo no específica. 57 En general, el suero para bloquear los receptores de IgG debería ser de una especie no relacionada con el anticuerpo primario y preferiblemente de la misma especie que el anticuerpo secundario. 57

En cada uno de los protocolos actuales, la elección de anticuerpo primario es el paso más crítico en la consecución de la inmunotinción con éxito. Se desea que el anticuerpo con la mayor especificidad, la pureza, afinidad y avidez. Una buena concentración de partida para los anticuerpos monoclonales es generalmente de 1 a 5 mg / ml. Diluciones típicas de la preparación de la pasta de anticuerpos policlonales van de 1:20 a 1:. 500 57 Uno tiene que determinar empíricamente la concentración apropiada de anticuerpo primario y el diluyente para cada muestra. Las muestras deben ser sacudieron suavemente sin secar durante la incubación para la tinción homogénea. Lavado extensivo entre la incubación de anticuerpo primario y un secundariontibody puede ser necesaria para evitar la reacción cruzada con las inmunoglobulinas de otras especies. Sin embargo, la condición de lavado óptimo debe ser determinado empíricamente para evitar la pérdida de células, especialmente células mitóticas, que completan y se desprenden cuando se agitan (es decir, mitótico sacudida-off). 58 Para el éxito, un anticuerpo secundario debe ser elegido para unirse a el anticuerpo primario con alta afinidad. Por ejemplo, para evitar la unión no específica de la porción Fc del anticuerpo secundario a los receptores de Fc de IgG, Fb (ab ') 2 se pueden usar en lugar de todo el anticuerpo. 57 Para muchos anticuerpos secundarios, tiempo de incubación se puede minimizar a 30 min a TA para reducir el fondo no específica.

Además de Protocolo 5, de escaneo láser confocal de microscopía podría ser ventajoso en la detección y el análisis de la localización y la función de las proteínas del centrómero-kinetochore con las propiedades fluorescentes. Como se muestra en la Lista de Materiales / Equipment, Alexa Fluor 488 y Alexa Fluor 594 son probablemente los tintes fluorescentes utilizados más frecuentemente en los protocolos actuales. Para detectar dos o varias proteínas diferentes y / centrómero-cinetocoro en la muestra, uno debe asegurarse de que los anticuerpos utilizados para detectar una proteína no impiden la detección de la segunda proteína. 57 En los protocolos actuales, dos anticuerpos primarios se mezclan y se aplican al mismo tiempo. Sin embargo, hay que optimizar las condiciones de la inmunotinción para cada proteína por separado antes de la aplicación de los anticuerpos primarios o secundarios juntos: si las dos proteínas están en estrecha proximidad como en el caso de dos componentes centrómero-cinetocoro, un anticuerpo primario puede prevenir estructuralmente la unión de la segundo anticuerpo primario. Otra preocupación de detección de la señal múltiple es el problema de la superposición espectral: la dificultad en la prevención de la señal de un colorante "fugas" en el canal espectral de otro. Este problema se hace más difícil para la convenciónfiltro de interferencia al establece para resolver como el número de colorantes aumenta o si la muestra contiene señales overenhanced (por ejemplo, ACA o anti-Flag señales en el presente estudio), incluyendo la interferencia de la autofluorescencia. Solución de problemas de autofluorescencia se ha realizado en otros estudios. 57,59,60 En el presente estudio, la optimización de los conjuntos de filtros fluorescentes con los controles de etiqueta única en cada canal es suficiente en la mayoría de los casos para evitar estos problemas (véase más adelante).

En cada uno de los protocolos actuales, los controles adecuados son esenciales. Cada nuevo anticuerpo primario debe caracterizarse antes de que comience la inmunotinción. La especificidad del anticuerpo debe ser confirmado por análisis de transferencia Western, en su caso. Además, la confirmación de que la tinción no es causado por la unión no específica a la superficie celular se debe obtener, y la concentración de trabajo óptima de un anticuerpo primario se deberán determinar mediante el uso de diluciones en serie(Es decir, una curva de unión debe desarrollarse). Un control negativo (es decir, la ausencia del anticuerpo primario en el proceso de tinción) debe ser incluido. Otra opción de control negativo es la sustitución de IgG normal de la misma especie para el anticuerpo primario. Para la detección de múltiples etiquetas, hay que preparar controles sin anticuerpos secundarios (el control de fondo), así como controles de etiqueta única para evitar artefactos de solapamiento espectral (es decir, derrame, de cruce, la diafonía, o el tinte "filtrar", como se describió anteriormente ). Se puede cuantificar la fracción de "filtrar" mediante la comparación de las señales a través de los filtros "malo" con la señal correcta, el uso de estas proporciones para eliminar computacionalmente todos "fugas", y el cálculo de la distribución de bienes y / o co-localización de marcador fluorescente. 60 el control de fondo debe ser examinado de forma independiente con cada canal para establecer los límites de la ganancia de la señal y compensa ser adapted para la formación de imágenes final. Todos los canales que se utilizan para obtener una imagen de una muestra de etiqueta múltiple deben ser sometidos a la corrección de fondo independiente, debido a que el nivel de autofluorescencia en cada canal varía sustancialmente. Las "fugas" controles como se describió anteriormente son necesarios para determinar la cantidad de ganancia de señal posible en cada canal sin detectar "fugas" en los canales adyacentes. 60

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Los autores declaran que no tienen intereses financieros en competencia.

Acknowledgments

Este trabajo fue apoyado por el NIH GM68418 subvención.

Materials

Name Company Catalog Number Comments
Lipofectamin 2000 Life Technologies/Invitrogen 11668 transfection reagent I
Lipofectamin RNAiMAX Life Technologies/Invitrogen 13778 transfection reagent II
Opti-MEM I Life Technologies/Invitrogen 31985 Reduced serum media, warm in 37 °C water bath before use
High-glucose DMEM (Dulbecco’s modified Eagle’s medium) Life Technologies/BioWhittaker 12-604 high-glucose DMEM, warm in 37 °C water bath before use
Fetal Bovine Serum, certified, heat inactivated, US origin Life Technologies/Gibco 10082 FBS (fetal bovine serum)
Poly-L-Lysine SOLUTION SIGMA-SLDRICH P 8920 Poly-L-Lysine, 0.1% w/v, in water
UltraPure Distilled Water Life Technologies/Invitrogen/Gibco 10977 Sterile tissue culture grade water 
Micro Cover glass (22 mm x 22 mm)  Surgipath 105 Cover glass (22 mm x 22 mm) 
6 Well Cell Culture Cluster Fisher/Corning Incorporated 07-200-83 6-well polystyrene plate 
Penicillin, Streptomycin; Liquid Fisher/Gibco 15-140 Penicillin-streptomycin
PAP PEN  Binding Site AD100.1 Hydrophobic barrier pen (for a water repellant barrier in immunofluorescent staining)
Paclitaxel (Taxol) SIGMA-SLDRICH T7402 Taxol for mitotic cell analysis
TN-16, microtubule inhibitor (TN16) Enzo Life Sciences BML-T120 TN16 for mitotic cell analysis
BSA (bovine serum albumin) SIGMA-SLDRICH A7906 Blocking reagent
Triton X-100 SIGMA-SLDRICH T8787 Detergent for permeabilization
Paraformaldehyde SIGMA-SLDRICH P6148 Fixation reagant
DAPI SIGMA-SLDRICH D9542 For nuclear staining
p-phenylenediamine SIGMA-SLDRICH P6001 For mounting medium
VWR Micro Slides, Frosted VWR International 48312-013 Micro slides 
Anti-CENP-A antibody Stressgen/Enzo Life Sciences KAM-CC006 Mouse monoclonal antibody; dilution ratio of 1:100 (IIF), 1:5000 (WB)
Anti-CENP-B antibody Novus Biologicals H00001059-B01P Mouse monoclonal antibody; dilution ratio of 1:200 (IIF, methanol/acetone fixation)-1:400 (IIF, paraformaldehyde fixation)
Anti-CENP-B antibody  abcam ab25734 Rabbit polyclonal antibody; dilution ratio of 1:200 (IIF, methanol/acetone fixation)-1:400 (IIF, paraformaldehyde fixation)
Anti-centromere antibody (ACA) Fitzgerald Industries International, Inc. 90C-CS1058 Human centromere antiserum; dilution ratio of 1:2000 (IIF)
Anti-CENP-H antibody Bethyl Laboratories BL1112 (A400-007A) Rabbit polyclonal antibody; dilution ratio of 1:200 (IIF)
Anti-CENP-H antibody BD 612142 Mouse monoclonal antibody; dilution ratio of 1:200 (IIF)
Anti-CENP-I antibody N/A, Dr. Katusmi Kitagawa N/A, Dr. Katusmi Kitagawa Rabbit polyclonal antibody; dilution ratio of 1:1000 (IIF); Niikura et al., Oncogene, 4133-4146 (2006)
Anti-KNL1 antibody Novus Biologicals NBP1-89223 Rabbit polyclonal antibody; dilution ratio of 1:100 (IIF)
Anti-Hec1 antibody Novus Biologicals / GeneTex NB 100-338 / GTX70268 Mouse monoclonal antibody; dilution ratio of 1:100 (IIF)
Anti-Hec1 antibody GeneTex GTX110735 Rabbit polyclonal antibody; dilution ratio of 1:100 (IIF)
Anti-Ska1 antibody abcam ab46826 Rabbit polyclonal antibody; dilution ratio of 1:100 (IIF)
Anti-Flag antibody SIGMA-ALDRICH F3165 Mouse monoclonal antibody; dilution ratio of 1:1000 (IIF), 1:5000 (WB)
Anti-Flag antibody SIGMA-ALDRICH F7425 Rabbit polyclonal antibody; dilution ratio of 1:1000 (IIF), 1:5000 (WB)
Anti-CUL4A antibody N/A, Dr. Pradip Raychaudhuri N/A, Dr. Pradip Raychaudhuri Rabbit polyclonal antibody; dilution ratio of 1:3000 (WB); Shiyanov et al., The Journal of biological chemistry, 35309-35312 (1999)
Anti-RBX1 antibody Cell Signaling 4397 Rabbit polyclonal antibody; dilution ratio of 1:2000 (WB)
Anti-GAPDH antibody Chemicon MAB374 Mouse monoclonal antibody; dilution ratio of 1:5000 (WB)
Alexa Fluor 488 Goat Anti-Mouse IgG Life Technologies/Invitrogen A11001 fluorophore-conjugated secondary antibody (Affinity-purified secondary antibody)
Alexa Fluor 594 Goat Anti-Mouse IgG Life Technologies/Invitrogen A11005 fluorophore-conjugated secondary antibody (Affinity-purified secondary antibody)
Alexa Fluor 488 Goat Anti-Rabbit IgG Life Technologies/Invitrogen A11008 fluorophore-conjugated secondary antibody (Affinity-purified secondary antibody)
Alexa Fluor 594 Goat Anti-Rabbit IgG Life Technologies/Invitrogen A11012 fluorophore-conjugated secondary antibody (Affinity-purified secondary antibody)
Non fat powdered milk (approved substitution for carnation powdered milk) Fisher Scientific NC9255871 (Reorder No. 190915; Lot# 90629) Skim milk
Leica DM IRE2 motorized fluorescence microscope  Leica motorized fluorescence microscope 
HCX PL APO 63x oil immersion lens Leica LEICA HCX PL APO NA 1.40 OIL PH 3 CS 63X oil immersion lens
HCX PL APO 100x oil immersion lens Leica LEICA HCX PL APO NA 1.40 OIL PHE 100X oil immersion lens
Leica EL6000 compact light source Leica External compact light source for fluorescent excitation
ORCA-R2 Digital CCD camera  Hamamatsu C10600-10B digital CCD camera 
Openlab version 5.5.2 Scientific Imaging Software  Perkin Elmer/Improvision For image observation, acquisition, quantification, and analysis
Velocity version 6.1.1 3D Image Analysis Software  Perkin Elmer/Improvision For image observation, acquisition, quantification, and analysis
Complete EDTA-free protease inhibitor cocktail Roche 11873580001/11836170001 Protease inhibitor cocktail tablets
PlusOne 2-D Quant Kit Amersham Biosciences 80-6483-56 Commercial protein assay reagent I for measurement of protein concentration (compatible with 2% SDS)
Bio-Rad Protein Assay Bio-Rad 500-0006 Commercial protein assay reagent II for measurement of protein concentration (compatible with 0.1% SDS)
Immobilon-FL EMD Millipore IPFL00010 PVDF membrane for transferring
IRDye 800CW Goat Anti-Mouse IgG LI-COR Biosciences 926-32210 IR fluorescent dye-conjugated secondary antibody (Affinity-purified secondary antibody); dilution ratio of 1:20000 (IIF)
IRDye 680 Goat Anti-Rabbit IgG LI-COR Biosciences 926-32221 IR fluorescent dye-conjugated secondary antibody (Affinity-purified secondary antibody); dilution ratio of 1:20000 (IIF)
Goat anti-Mouse IgG DyLight 549 Fisher Scientific PI35507 DyLight-conjugated secondary antibodyIR fluorescent dye-conjugated secondary antibody (Affinity-purified secondary antibody); dilution ratio of 1:20000 (IIF)
Goat anti-Rabbit DyLight 649 Fisher Scientific PI35565 DyLight-conjugated secondary antibodyIR fluorescent dye-conjugated secondary antibody (Affinity-purified secondary antibody); dilution ratio of 1:20000 (IIF)
Goat anti-mouse IgG-HRP Santa Cruz SC-2005 HRP-conjugated secondary antibodyDyLight-conjugated secondary antibodyIR fluorescent dye-conjugated secondary antibody (Affinity-purified secondary antibody); dilution ratio of 1:10000 (IIF)
Goat anti-rabbit IgG-HRP Santa Cruz SC-2004 HRP-conjugated secondary antibodyDyLight-conjugated secondary antibodyIR fluorescent dye-conjugated secondary antibody (Affinity-purified secondary antibody); dilution ratio of 1:10000 (IIF)
Openlab version 5.5.2. Scientific Imaging Software  Improvision/PerkinElmer Software A
Volocity version 6.3 3D Image Analysis Software (Volocity Acquisition) PerkinElmer Software B1
Volocity version 6.3 3D Image Analysis Software (Volocity Quantification) PerkinElmer Software B2
Branson SONIFIER 450 Sonicator
Branson Ultrasonics sonicator Microtip Step, Solid, Threaded 9.5 mm VWR Scientific Products Inc.  33995-325 Disruptor horn for sonication
Branson Ultrasonics sonicator Microtip Tapered 6.5 mm VWR Scientific Products Inc.  33996-185 Microtip for sonication
Odyssey CLx Infrared imaging System  LI-COR Biosciences Infrared imaging system for immunoblot detection
Image Studio Analysis Software Ver 4.0  LI-COR Biosciences Software C
Molecular Imager Versadoc MP4000 System  Bio-Rad Chemiluminescence imager for immunoblot detection
Quantity One 1-D analysis software  Bio-Rad Software D
SuperSignal West Femto Maximum Sensitivity Substrate Thermo 34095 Ultra-sensitive enhanced chemiluminescent (ECL) substrate

DOWNLOAD MATERIALS LIST

References

  1. DeLuca, J. G., et al. Hec1 and nuf2 are core components of the kinetochore outer plate essential for organizing microtubule attachment sites. Molecular biology of the cell. 16, 519-531 (2005).
  2. Earnshaw, W. C., Halligan, N., Cooke, C., Rothfield, N. The kinetochore is part of the metaphase chromosome scaffold. J Cell Biol. 98, 352-357 (1984).
  3. Hoffman, D. B., Pearson, C. G., Yen, T. J., Howell, B. J., Salmon, E. D. Microtubule-dependent changes in assembly of microtubule motor proteins and mitotic spindle checkpoint proteins at PtK1 kinetochores. Molecular biology of the cell. 12, 1995-2009 (2001).
  4. Regnier, V., et al. CENP-A is required for accurate chromosome segregation and sustained kinetochore association of BubR1. Mol Cell Biol. 25, 3967-3981 (2005).
  5. Bernad, R., Sanchez, P., Losada, A. Epigenetic specification of centromeres by CENP-A. Exp Cell Res. 315, 3233-3241 (2009).
  6. Black, B. E., Cleveland, D. W. Epigenetic centromere propagation and the nature of CENP-a nucleosomes. Cell. 144, 471-479 (2011).
  7. Warburton, P. E., et al. Immunolocalization of CENP-A suggests a distinct nucleosome structure at the inner kinetochore plate of active centromeres. Curr Biol. 7, 901-904 (1997).
  8. Karpen, G. H., Allshire, R. C. The case for epigenetic effects on centromere identity and function. Trends Genet. 13, 489-496 (1997).
  9. Black, B. E., et al. Structural determinants for generating centromeric chromatin. Nature. 430, 578-582 (2004).
  10. Black, B. E., et al. Centromere identity maintained by nucleosomes assembled with histone H3 containing the CENP-A targeting domain. Mol Cell. 25, 309-322 (2007).
  11. Fachinetti, D., et al. A two-step mechanism for epigenetic specification of centromere identity and function. Nat Cell Biol. 15, 1056-1066 (2013).
  12. Zeitlin, S. G., Shelby, R. D., Sullivan, K. F. CENP-A is phosphorylated by Aurora B kinase and plays an unexpected role in completion of cytokinesis. The Journal of cell biology. 155, 1147-1157 (2001).
  13. Zhang, X., Li, X., Marshall, J. B., Zhong, C. X., Dawe, R. K. Phosphoserines on maize CENTROMERIC HISTONE H3 and histone H3 demarcate the centromere and pericentromere during chromosome segregation. The Plant cell. 17, 572-583 (2005).
  14. Goutte-Gattat, D., et al. Phosphorylation of the CENP-A amino-terminus in mitotic centromeric chromatin is required for kinetochore function. Proc Natl Acad Sci U S A. 110, 8579-8584 (2013).
  15. Bailey, A. O., et al. Posttranslational modification of CENP-A influences the conformation of centromeric chromatin. Proc Natl Acad Sci U S A. 110, 11827-11832 (2013).
  16. Samel, A., Cuomo, A., Bonaldi, T., Ehrenhofer-Murray, A. E. Methylation of CenH3 arginine 37 regulates kinetochore integrity and chromosome segregation. Proc Natl Acad Sci U S A. 109, 9029-9034 (2012).
  17. Niikura, Y., et al. CENP-A K124 Ubiquitylation Is Required for CENP-A Deposition at the Centromere. Dev Cell. (2015).
  18. Chan, G. K., Liu, S. T., Yen, T. J. Kinetochore structure and function. Trends in cell biology. 15, 589-598 (2005).
  19. Hori, T., Okada, M., Maenaka, K., Fukagawa, T. CENP-O class proteins form a stable complex and are required for proper kinetochore function. Molecular biology of the cell. 19, 843-854 (2008).
  20. Fukagawa, T., Earnshaw, W. C. The centromere: chromatin foundation for the kinetochore machinery. Developmental cell. 30, 496-508 (2014).
  21. Kedersha, N. The Proteintech Blog.Proteintech. Grainger, D. Proteintech Group. (2012).
  22. Clontech Laboratories, Inc. HeLa Tet-Off Advanced Cell Line. Available from: http://www.clontech.com/CR/Products/Inducible_Systems/Tetracycline-Inducible_Expression/ibcGetAttachment.jsp?cItemId=26908&fileId=6712191&sitex=10020:22372:US (2012).
  23. Meraldi, P., Sorger, P. K. A dual role for Bub1 in the spindle checkpoint and chromosome congression. EMBO J. 24, 1621-1633 (2005).
  24. Niikura, Y., et al. 17-AAG, an Hsp90 inhibitor, causes kinetochore defects: a novel mechanism by which 17-AAG inhibits cell proliferation. Oncogene. 25, 4133-4146 (2006).
  25. Yang, Z., et al. Silencing mitosin induces misaligned chromosomes, premature chromosome decondensation before anaphase onset, and mitotic cell death. Mol Cell Biol. 25, 4062-4074 (2005).
  26. Wang, H., et al. Histone H3 and H4 ubiquitylation by the CUL4-DDB-ROC1 ubiquitin ligase facilitates cellular response to DNA damage. Mol Cell. 22, 383-394 (2006).
  27. Lamb, J. R., Tugendreich, S., Hieter, P. Tetratrico peptide repeat interactions: to TPR or not to TPR? Trends Biochem Sci. 20, 257-259 (1995).
  28. Kitagawa, K., Skowyra, D., Elledge, S. J., Harper, J. W., Hieter, P. SGT1 encodes an essential component of the yeast kinetochore assembly pathway and a novel subunit of the SCF ubiquitin ligase complex. Mol Cell. 4, 21-33 (1999).
  29. Niikura, Y., Dixit, A., Scott, R., Perkins, G., Kitagawa, K. BUB1 mediation of caspase-independent mitotic death determines cell fate. J Cell Biol. 178, 283-296 (2007).
  30. Niikura, Y., Kitagawa, K. Identification of a novel splice variant: human SGT1B (SUGT1B). DNA Seq. 14, 436-441 (2003).
  31. Niikura, Y., Ogi, H., Kikuchi, K., Kitagawa, K. BUB3 that dissociates from BUB1 activates caspase-independent mitotic death (CIMD). Cell Death Differ. 17, 1011-1024 (2010).
  32. Ando, S., Yang, H., Nozaki, N., Okazaki, T., Yoda, K. CENP-A, -B, and -C chromatin complex that contains the I-type alpha-satellite array constitutes the prekinetochore in HeLa cells. Mol Cell Biol. 22, 2229-2241 (2002).
  33. Izuta, H., et al. Comprehensive analysis of the ICEN (Interphase Centromere Complex) components enriched in the CENP-A chromatin of human cells. Genes to cells : devoted to molecular & cellular mechanisms. 11, 673-684 (2006).
  34. Obuse, C., et al. Proteomics analysis of the centromere complex from HeLa interphase cells: UV-damaged DNA binding protein 1 (DDB-1) is a component of the CEN-complex, while BMI-1 is transiently co-localized with the centromeric region in interphase. Genes Cells. 9, 105-120 (2004).
  35. Merlet, J., Burger, J., Gomes, J. E., Pintard, L. Regulation of cullin-RING E3 ubiquitin-ligases by neddylation and dimerization. Cell Mol Life Sci. 66, 1924-1938 (2009).
  36. Bennett, E. J., Rush, J., Gygi, S. P., Harper, J. W. Dynamics of cullin-RING ubiquitin ligase network revealed by systematic quantitative proteomics. Cell. 143, 951-965 (2010).
  37. Antonelli, A., et al. Efficient inhibition of macrophage TNF-alpha production upon targeted delivery of K48R ubiquitin. Br J Haematol. 104, 475-481 (1999).
  38. Codomo, C. A., Furuyama, T., Henikoff, S. CENP-A octamers do not confer a reduction in nucleosome height by AFM. Nat Struct Mol Biol. 21, 4-5 (2014).
  39. Thrower, J. S., Hoffman, L., Rechsteiner, M., Pickart, C. M. Recognition of the polyubiquitin proteolytic signal. The EMBO journal. 19, 94-102 (2000).
  40. Yoda, K., et al. Human centromere protein A (CENP-A) can replace histone H3 in nucleosome reconstitution in vitro. Proc Natl Acad Sci U S A. 97, 7266-7271 (2000).
  41. Shelby, R. D., Vafa, O., Sullivan, K. F. Assembly of CENP-A into centromeric chromatin requires a cooperative array of nucleosomal DNA contact sites. J Cell Biol. 136, 501-513 (1997).
  42. Majumder, S., Fisk, H. A. Quantitative immunofluorescence assay to measure the variation in protein levels at centrosomes. J Vis Exp. (2014).
  43. Masumoto, H., Masukata, H., Muro, Y., Nozaki, N., Okazaki, T. A human centromere antigen (CENP-B) interacts with a short specific sequence in alphoid DNA, a human centromeric satellite. J Cell Biol. 109, 1963-1973 (1989).
  44. Yoda, K., Kitagawa, K., Masumoto, H., Muro, Y., Okazaki, T. A human centromere protein, CENP-B, has a DNA binding domain containing four potential alpha helices at the NH2 terminus, which is separable from dimerizing activity. J Cell Biol. 119, 1413-1427 (1992).
  45. Sugata, N., et al. Human CENP-H multimers colocalize with CENP-A and CENP-C at active centromere--kinetochore complexes. Hum Mol Genet. 9, 2919-2926 (2000).
  46. Earnshaw, W. C., Ratrie, H. 3rd, Stetten, G. Visualization of centromere proteins CENP-B and CENP-C on a stable dicentric chromosome in cytological spreads. Chromosoma. 98, 1-12 (1989).
  47. Goshima, G., Kiyomitsu, T., Yoda, K., Yanagida, M. Human centromere chromatin protein hMis12, essential for equal segregation, is independent of CENP-A loading pathway. J Cell Biol. 160, 25-39 (2003).
  48. Liu, S. T., Rattner, J. B., Jablonski, S. A., Yen, T. J. Mapping the assembly pathways that specify formation of the trilaminar kinetochore plates in human cells. J Cell Biol. 175, 41-53 (2006).
  49. Gascoigne, K. E., Cheeseman, I. M. T time for point centromeres. Nat Cell Biol. 14, 559-561 (2012).
  50. Gascoigne, K. E., et al. Induced ectopic kinetochore assembly bypasses the requirement for CENP-A nucleosomes. Cell. 145, 410-422 (2011).
  51. Nishino, T., et al. CENP-T provides a structural platform for outer kinetochore assembly. EMBO J. 32, 424-436 (2013).
  52. Malvezzi, F., et al. A structural basis for kinetochore recruitment of the Ndc80 complex via two distinct centromere receptors. EMBO J. 32, 409-423 (2013).
  53. Schleiffer, A., et al. CENP-T proteins are conserved centromere receptors of the Ndc80 complex. Nat Cell Biol. 14, 604-613 (2012).
  54. Rago, F., Gascoigne, K. E., Cheeseman, I. M. Distinct organization and regulation of the outer kinetochore KMN network downstream of CENP-C and CENP-T. Curr Biol. 25, 671-677 (2015).
  55. Nishino, T., et al. CENP-T-W-S-X forms a unique centromeric chromatin structure with a histone-like fold. Cell. 148, 487-501 (2012).
  56. Bodor, D. L., et al. The quantitative architecture of centromeric chromatin. Elife. 3, e02137 (2014).
  57. Oliver, C. Ch 58. Molecular Biomethods Handbook. Rapely, R., Walker, J. M. Humana Press. 1063-1079 (2008).
  58. Terasima, T., Tolmach, L. J. Changes in x-ray sensitivity of HeLa cells during the division cycle. Nature. 190, 1210-1211 (1961).
  59. Levenson, G. B. R. Ch 8. Biomedical Photonics Handbook. Vo-Dinh, T. uan CRC Press LLC. 8-19 (2003).
  60. Sanderson, J. Fluorescence bleed-though. Available from: http://www.gum2012.fionastoreydesign.co.uk/Downloads/Bleed through text.pdf (2011).
Las proteínas Análisis de inmunofluorescencia de endógenos y exógenos Centrómero-cinetocoro
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Niikura, Y., Kitagawa, K. Immunofluorescence Analysis of Endogenous and Exogenous Centromere-kinetochore Proteins. J. Vis. Exp. (109), e53732, doi:10.3791/53732 (2016).More

Niikura, Y., Kitagawa, K. Immunofluorescence Analysis of Endogenous and Exogenous Centromere-kinetochore Proteins. J. Vis. Exp. (109), e53732, doi:10.3791/53732 (2016).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter