Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Immunofluorescens Analys av endogena och exogena centromer-kinetochore proteiner

Published: March 3, 2016 doi: 10.3791/53732

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

"centromerer" var klassiskt definieras som områden av undertryckt meiotiska rekombination i genetik och senare erkänd som den primära sammandragning av mitotiska kromosomer, som spelar en viktig roll i exakt kromosomsegregation under mitos. "kinetokorer" beskrevs som de flerskiktade strukturer som binder till mikrotubuli vid ytan av centromerer, såsom avslöjas genom elektronmikroskopi; "kinetokorer" senare definieras som makromolekylära komplex som lokaliserar vid centromeren mitotiska kromosomer. Trots en dramatisk avvikelse av centro DNA-sekvenser bland ryggradsdjur, kinetochor struktur och sammansättning är mycket konserverad. En dynamisk interaktion mellan spindel mikrotubuli och kinetochor krävs för trogen segregering av kromosomer under mitos och defekter i centromer-kinetochor funktion leder till aneuploidi och därmed cancer.

Centromeren i de flesta eukaryoterhar ingen definierad DNA-sekvens, men består av stora matriser (0,3-5 MB) repetitiva alphoid DNA bestående av 171 bp α-satellit-DNA. Utom i knoppande jäst, är centromeridentitet uppnås inte av DNA-sekvensen men genom närvaro av en speciell nukleosomen som innehåller histon H3 varianten CenH3 (centromer Protein A [CENP-A] hos människa). 5 CENP-A nukleosomer lokalisera till inre platta av däggdjurs kinetokorer 7 och binder till 171 bp α-satellit-DNA. Aktiva centromerer kräva CENP-A-innehållande nukleosomer för att rikta rekryteringen av en konstitutiv centromer-associerat nätverk (Ccan) och kinetochor proteiner, som tillsammans reglera vidhäftningen av kromosomer till den mitotiska spolen och efterföljande cykelprogression genom spindeln checkpoint.

Mot bakgrund av ovanstående bevis har CENP-A har föreslagits vara den epigenetiska märke centromeren 8; emellertid den process genom vilken CENP-A är inkorporerad into centro DNA och de faktorer som ligger bakom denna integration har ännu inte väl karakteriserade. En kort centromer-targeting domain (CATD) befinner sig i histon faldig regionen av CENP-A, och ersättning av motsvarande region i H3 med CATD är tillräcklig för att direkt H3 till centromeren. 9 Flera studier föreslog funktionella roller för posttranslationell modifiering (PTM) av CENP-A 16/12; Men, de molekylära mekanismerna bakom dessa PTMs av CENP-A i rekryteringen till centromerer har ännu inte klarlagts. Vi rapporterade tidigare att CUL4A-RBX1-COPS8 E3-ligas-aktivitet krävs för CENP-A K124 ubiquitylation och lokalisering av CENP-A till centromerer. 17

Upptäckten och karakteriseringen av kinetokoren proteiner har lett till nya insikter om kromosomsegregation. 18 Mer än 100 kinetokoren komponenter har identifierats i celler från ryggradsdjur av olika metoder. 19,20 En understående av hur kinetokorer monterar och funktion kommer också från karakterisering av de cellulära funktionerna hos varje centromer-kinetochore proteiner och protein-protein nätverk inom celler. 19 Direkt visualisering och avancerad avbildningsmetoder i fluorescensmikroskopi ger anmärkningsvärd upplösning av centromer-kinetochore komponenter och tillåta direkt observation av specifika molekylära komponenter i centromerer och kinetokorer. Dessutom, metoder för indirekt immunofluorescerande (IIF) färgning med användning av specifika antikroppar är avgörande för dessa observationer. Men trots många rapporter om IIF protokoll, få diskuteras i detalj problem med specifika centromer-kinetochore proteiner. 1-4 är således mycket viktigt att utveckla och rapportering metoder för IIF-färgning och en kvantitativ IIF analys för att specifikt analysera varje centromer-kinetochore protein. I IIF-färgning, bör man fortsätta med färgningsprotokollet för att undvika förlust av proteinet av intresse ellerresten av cellen. Emellertid förstör fixering antigena ställen ibland, och olika antikropp-antigen kombinationer fungerar dåligt med ett fixativ, men mycket väl med en annan, 21 och val av fixativ beror till stor del på protein (er) av intresse. Därför olika fästmetoder är avgörande för IIF-färgning av centromer-kinetochore proteiner.

Här optimerade metoder för indirekt immunofluorescerande (IIF) färgning och en analys för att ta itu med lokalisering av endogena centromer-kinetochore proteiner, innefattande CENP-A och Flag-märkta exogena CENP-A-proteiner, och kvantifiering av dessa proteiner i humana celler har utvecklats. Dessa metoder kan tillämpas på analysen av centromer-kinetochore proteiner i andra arter.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Cellodling och transfektion

  1. Sätta ett täckglas (22 mm x 22 mm) i en 6-brunnars polystyrenplatta. Eventuellt belägga en täckglaset med Poly-L-lysin, 0,1% vikt / volym, i vatten (se lista över material / utrustning) för att hålla mitotiska celler på täckglaset att följa stegen nedan:
    Notera: Optimala förhållanden måste bestämmas för varje cellinje och tillämpning.
    1. Aseptiskt coat odlingsytan med Poly-L-lysin, 0,1% vikt / volym, i vatten (0,4 ml / brunn i en 6-brunnars polystyrenplatta). Gunga försiktigt för att säkerställa jämn beläggning av odlingsytan.
    2. Efter 5 minuter, avlägsna lösningen genom aspiration och grundligt skölja ytan med steril vävnadsodlingsgrad vatten.
    3. Torka minst 2 timmar innan man inför celler och medium.
  2. Seed HeLa-celler 17 eller HeLa Tet-Off celler 17,22 på ett täckglas (22 mm x 22 mm) placerades i en 6-brunns polystyrenplatta. Kontrollera att celltätheten är 5,4 x 10 5 per brunn. kulturcelleri hög-glukos DMEM med 10% FBS och 1% penicillin-streptomycin.
    Obs: För bästa resultat, empiriskt bestämma celltätheten att använda i sådd.
  3. Inkubera cellerna vid 37 ° C i en atmosfär av 5% CO2 under 18 timmar.
    Obs: När det gäller HeLa Tet-Off-celler, är aktiv i frånvaro av induceraren (dvs tetracyklin / doxycyklin) därför kulturceller utan tetracyklin / doxycyklin transkription av den exogena genen och transfektera transient med pTRM4 uttryck vektorn (tabell 2 ), vars transkription regleras av TRE-promotorn (se nedan).
  4. Arton timmar efter sådd, transfektera celler enligt följande:
    1. Gör lösning A genom att blanda 1,5 l siRNA oligo (20 iM glödgad lager, Tabell 1) och / eller 2,0 mikrogram plasmid (tabell 2) i 50 pl reducerad serummedium (se lista över material / utrustning) och inkubera vid rumstemperatur under 5 min .
      Obs: I denna analys,CA-UTR siRNA (en blandning av 5 'och 3' UTR siRNA; Tabell 1) samtransfekterades för användning i protokollen 3 och 4 (se diskussion).
    2. Gör lösning B genom att blanda 0,75 l transfektion reagens I (se lista över material / utrustning) i 50 pl minskade serummedium och inkubera vid RT under 5 min.
      Obs: Ett valfritt steg är tillsats av 1,0 pl transfektionsreagens II (se lista över material / utrustning).
    3. Blanda lösningarna A och B tillsammans, och inkubera vid RT i 15 min.
    4. Tvätta de odlade cellerna en gång med PBS, och sedan lägga till 500 l minskade serummedium till varje brunn på 6-brunns polystyrenplatta. Tillsätt blandningen av lösningarna A och B (dvs, RNA och / eller DNA-lipidkomplex) direkt till var och en av de individuella brunn.
      Notera: Slutlig koncentration är 3,3 | ig / ml (plasmid); 50 nM (siRNA).
    5. Inkubera cellerna vid 37 ° C i en atmosfär av 5% CO2 under 4,5 h. Ändra medelhög till hög-glukos DMEM with 10% FBS och 1% penicillin-streptomycin.
    6. Inkubera cellerna vid 37 ° C i en atmosfär av 5% CO2 under 48-72 h efter transfektion.
      Obs! För bästa resultat måste inkubationstiden för celltillväxt före fixering bestämmas empiriskt, och proteinbrist och / eller uttryck måste bekräftas genom Western blot-analys (se protokoll 6).
    7. Om mitotisk cellanalys är av intresse, till paklitaxel (10 nM) till odlade celler 24 h före fixering, eller lägga TN16 (0,5 M) till de odlade cellerna 2,5 h före fixering.

2. Cell Fixering och immunofluorescerande färgning att upptäcka Endogenous centromer-kinetochore proteiner (Paraformaldehyd Fixering)

  1. Framställning av fixativ, buffertar och reagens.
    1. Färskt framställa 50 ml av 4% paraformaldehydlösning i PBS, pH 7,4.
      1. Tillsätt 40 ml 1 x PBS till en glasbägare på en omrörningsplatta i en ventilerad huv. Värme medan stirring till ca 60 ° C. Tillsätt 2 g paraformaldehyd pulver till den uppvärmda PBS.
      2. Höj långsamt pH genom att tillsätta 1 ml av en N NaOH i totala, eftersom pulvret kommer inte att omedelbart lösas upp.
        Anmärkning: Lösningen klarnar efter tillsatsen av NaOH.
      3. När paraformaldehyd har lösts, sval och filtrera lösningen.
      4. Justera pH med 1 N HCl till pH 7,4 och volymen av lösningen med ett × PBS till 50 ml.
        Notera: Alikvoter av lösningen kan frysas eller lagras vid 2-8 ° C under så länge som en vecka. Lösningen bör vara iskall eller förvaras vid 4 ° C tills den skall användas.
    2. Förbered 50 ml av buffert KB1, som består av 10 mM Tris-HCl, pH 7,5; 150 mM NaCl; 0,5% BSA; och 0,5% Triton X-100.
      Obs: BSA bör färskt tillsatt.
      Obs: Bufferten KB-serien bygger på buffert KB beskrivits i tidigare rapporter 1,2,4.
    3. Förbered 50 ml av buffert KB2, som består av 10 mM Tris-HCl,pH 7,5; 150 mM NaCl; och 0,5% BSA.
      Obs: BSA bör färskt tillsatt.
    4. Förbereda 1 ml buffert KB3 innehållande DAPI (50 ng / ml).
    5. Bereda 100 ml av monteringsmedium, som består av 1 mg / ml p-fenylendiamin; 10% PBS, och 90% glycerol.
      1. Justera pH för en × PBS till 9,8 med 1 N NaOH, lös upp p-fenylendiamin i lösningen, och sedan lägga till glycerol.
      2. Store 1 ml alikvoter vid -80 ° C. Skyddas från ljus.
  2. Avlägsna odlingsmediet genom avsugning vid 48-72 h efter transfektion (se Protokoll 1) för cellfixering. Skölj cellerna en gång med PBS. Tillsätt PBS till sidan av odlingsbrunnarna att undvika att störa ytan av cellerna.
    Obs: Den optimala tidpunkten för cell fixering måste bestämmas empiriskt.
  3. Fixera cellerna i 4% paraformaldehyd i PBS under 30 min vid 4 ° C. Skölj cellerna två gånger med buffert KB2 att tillräckligt avlägsna kvarvarande 4% paraformaldehyd.
  4. PermeabiLize proverna i buffert KB1 under 30 min vid RT. Skölj cellerna en gång med buffert KB2, och tillsätt buffert KB2 under 5 minuter vid RT för att ytterligare blockera ställen för ospecifik bindning.
    Obs: Buffert KB1 bidrar också i hög grad till blockering.
  5. Ta bort ett täckglas (22 mm x 22 mm) från en 6-brunns polystyren plattan med pincett. Med hjälp av en hydrofob barriär penna (se lista över material / utrustning), rita en ljusgrön kvadrat eller cirkel för att bilda en hydrofob barriär runt varje prov täckglaset. Rör inte eller kommer för nära till cellerna med den hydrofoba barriär pennan. Sätta täckglaset i nytt sex-brunnars polystyrenplatta.
  6. Späd en primär antikropp mot centromeren eller kinetochor protein (utspädningsförhållande av 1: 100 till 1: 200, se även lista över material / utrustning) och antingen en anti-CENP-B-antikroppar (utspädningsförhållande av 1: 400) eller en anti- centromer antikropp (ACA) (utspädningsförhållande av 1: 2000) som en centromer platsmarkör i buffert KB2.
    Obs: För bästa resultat, slut Concentration av den primära antikroppen i denna lösning måste bestämmas empiriskt.
  7. Tillämpa en tillräcklig volym (ca 30 | j, l) av den utspädda primära antikroppen för att doppa provcellen. Inkubera cellprovet under 1 h vid 37 ° C. Skölj cellerna 3 gånger med buffert KB2.
  8. Med användning av buffert KB2, späd en fluorofor-konjugerad sekundär antikropp (spädning förhållande av 1: 100 till 1: 200) riktade mot varje primär antikropp.
    Notera: För optimala resultat måste den slutliga koncentrationen av den sekundära antikroppen i denna lösning bestämmas empiriskt.
  9. Applicera en tillräcklig volym (en droppe ca 30 pl på täckglaset) av den utspädda sekundär antikropp att fördjupa cellprovet. Inkubera cellprovet under 1 h vid 37 ° C. Skölj cellerna 5 gånger med buffert KB2 under en period av 30 min (fem 6 minuterstvättar).
    Obs! För bästa resultat (det vill säga för minimal förlust av celler), måste den optimala tvätt tillstånd bestämmas Empirically.
  10. Applicera en tillräcklig volym buffert KB3 innehållande DAPI (50 ng / ml) för att fördjupa cellprovet. Inkubera cellprovet under 5 min vid RT. Skölj cellerna 1-2 gånger med buffert KB2.
  11. Montera täckglaset som innehåller provcellen på mikro bilden.
    1. Placera en droppe monteringsmedium i centrum av mikroobjektglas.
    2. Avlägsna vätska från provcellen och, med hjälp av händer eller pincett, placera provet i centrum av mikroobjektglas. Undvika luftbubblor.
    3. Ta bort överflödigt monteringsmedium med en pappershandduk.

3. Cell Fixering och immunofluorescerande färgning av C-terminal Flag-märkt CENP-A Proteins (Aceton Fixering)

  1. Förberedelse
    1. Förbered iskall 75% aceton.
    2. Färskt förbereda 50 ml PBS (pH 7,4) innehållande 0,5% skummjölk och 0,5% BSA.
    3. Färskt förbereda 50 ml PBS (pH 7,4) innehållande 0,1% skummjölk och 0,1% BSA.
    4. Förbereda 1 ml PBS (pH 7,4) innehållande DAPI (50-100 ng / ml).
    5. Bered 100 ml monteringsmedium som beskrivs i 2.1.5.
  2. Avlägsna odlingsmediet genom avsugning vid 48-72 h efter transfektion (se Protokoll 1) för cellfixering. Skölj cellerna en gång med PBS. Tillsätt PBS till sidan av den odlingsbrunn för att undvika att störa ytan av cellerna.
    Obs: Den optimala tidpunkten för cell fixering måste bestämmas empiriskt.
  3. Fixera cellerna i iskall 75% aceton, och inkubera cellerna under 10 min vid -20 ° C. Torra celler på täckglaset i ett dragskåp under 30-60 min vid RT.
    Obs! För bästa resultat måste den tid som behövs för fixering och cell torkning bestämmas empiriskt.
  4. Använda den hydrofoba barriär pennan (se lista över material / utrustning), rita en ljusgrön kvadrat eller cirkel för att bilda en hydrofob barriär runt varje prov täckglaset. Rör inte eller kommer för nära till cellerna med den hydrofoba barriär pennan.
  5. blocket nonspecific bindningsställen på cellerna genom att tillsätta PBS innehållande 0,5% skummjölk och 0,5% BSA under 5 min vid RT.
  6. Med användning av PBS innehållande 0,1% skummjölk och 0,1% BSA, späd en anti-Flag-antikropp (1: 1000 spädningsförhållande) och antingen en anti-CENP-B-antikroppar (utspädningsförhållande av 1: 200) eller ACA (1: 2000 spädningsförhållande ) som en centromer platsmarkör.
    Notera: För optimala resultat måste den slutliga koncentrationen av den primära antikroppen i denna lösning bestämmas empiriskt.
  7. Tillämpa en tillräcklig volym (ca 30 | j, l) av den utspädda primära antikroppen för att doppa provcellen. Inkubera cellprovet under 1 h vid 37 ° C. Skölj cellerna 5 gånger med den blockerande bufferten under en period av 30 min.
    Obs: Celler kan sköljas med PBS. För bästa resultat (dvs för att undvika förlust av celler), måste de optimala tvättbetingelser bestämmas empiriskt.
  8. Späd en fluorofor-konjugerad sekundär antikropp (spädning förhållande av 1: 100 till 1: 200) riktad motden varje primär antikropp i PBS innehållande 0,1% skummjölk och 0,1% BSA.
    Notera: För optimala resultat måste den slutliga koncentrationen av den sekundära antikroppen i denna lösning bestämmas empiriskt.
  9. Tillämpa en tillräcklig volym (ca 30 | j, l) av den utspädda sekundära antikroppen att doppa provcellen. Inkubera cellprovet under 1 h vid 37 ° C. Skölj cellerna 2 gånger med PBS innehållande 0,1% skummjölk och 0,1% BSA.
    Notera: PBS enbart kan också användas för att tvätta cellerna.
  10. Applicera en tillräcklig volym av PBS innehållande DAPI (50-100 ng / ml) för att fördjupa cellprovet. Inkubera cellprovet under 5 min vid RT. Skölj cellerna 1-2 gånger med PBS.
  11. Montera täckglaset innehåller provcellen på mikro bilden som beskrivs i 2.11.

4. Cell Fixering och immunofluorescerande färgning av N-terminal Flag-märkt CENP-A Proteins (Metanol Fixering)

  1. Förberedelse
    1. Förbered iskall metanol.
    2. Förbereda TBS (pH 7,4) innehållande 4% getserum.
    3. Förbereda 1 ml TBS (pH 7,4) innehållande DAPI (50-100 ng / ml).
    4. Bered 100 ml monteringsmedium som beskrivs i 2.1.5.
  2. Avlägsna odlingsmediet genom avsugning vid 48-72 h efter transfektion (se Protokoll 1) för cellfixering. Skölj cellerna en gång med TBS. Applicera TBS till sidan av odlingsbrunnarna att undvika att störa ytan av celler.
    Obs: Den optimala tidpunkten för cell fixering måste bestämmas empiriskt.
  3. Fixera cellerna i iskall metanol, och inkubera cellerna under 6 minuter vid -20 ° C. Skölj cellerna två gånger med TBS för att tillräckligt avlägsnande av kvarvarande metanol.
  4. Med hjälp av en hydrofob barriär penna (se lista över material / utrustning), rita en ljusgrön kvadrat eller cirkel för att skapa en hydrofob barriär runt varje prov täckglaset. Rör inte eller kommer för nära till cellerna med den hydrofoba barriär pennan.
  5. Blockera icke-specifika bindningsställen på cells genom att lägga till TBS innehållande 4% getserum. Inkubera under 10 min vid RT.
  6. Späd en anti-Flag-antikropp (1: 1000 spädning) och antingen en anti-CENP-B-antikroppar (utspädningsförhållande av 1: 200) eller ACA (1: 2000 spädningsförhållande) som en centromer platsmarkör i TBS innehållande 4% getserum .
    Notera: För optimala resultat måste den slutliga koncentrationen av den primära antikroppen i denna lösning bestämmas empiriskt.
  7. Tillämpa en tillräcklig volym (ca 30 | j, l) av den utspädda primära antikroppen för att doppa provcellen. Inkubera cellprovet under 1 h vid 37 ° C. Skölj cellerna 5 gånger med den blockerande bufferten under en period av 30 min. För bästa resultat (dvs den minimala förlusten av celler), måste den optimala tvätt tillstånd bestämmas empiriskt.
  8. Späd en fluorofor-konjugerad sekundär antikropp (spädning förhållande av 1: 100 till 1: 200) riktade mot varje primär antikropp i TBS innehållande 4% getserum.
    Obs: För bästa resultat, FINAl koncentrationen av den sekundära antikroppen i denna lösning måste bestämmas empiriskt.
  9. Tillämpa en tillräcklig volym (ca 30 | j, l) av den utspädda sekundära antikroppen att doppa provcellen. Inkubera cellprovet under 1 h vid 37 ° C. Skölj cellerna 3 gånger med blockerande buffert.
  10. Applicera en tillräcklig volym TBS innehållande DAPI (50-100 ng / ml) för att fördjupa cellprovet. Inkubera cellprovet under 5 min vid RT. Skölj cellerna 1-2 gånger med TBS.
  11. Montera täckglaset som innehåller provcellen på mikro bilden som beskrivs i 2.11.

5. Immunofluorescens Bild Observation, Förvärv, kvantifiering och analys

  1. Provet observeras cellen genom en motoriserad fluorescensmikroskop utrustat med en 63X och 100X oljeimmersion lins, en yttre kompakt ljuskälla, och en digital CCD-kamera.
  2. Utför bildtagning och behandling, inklusive avfaltning, med hjälp av programvaraA, eller Softwares B1 och B2 (se lista över material / utrustning). Se Kompletterande kodfiler (5.2.1) för alla kommandon som används i programvara A. För alla kommandon som används i Softwares B1 och B2, se (5.2.2) i Supplemental Code filer.
  3. Använder en tidigare beskriven metod 23-25 ​​att kvantifiera signaler av centromer-kinetochore proteiner (t.ex., kvarvarande signaler av CENP-A vid centromeren) med följande smärre modifikationer:
    1. Välj område av de centromer-kinetochore proteiner och den för bakgrunden enligt följande:
      1. Mitotiska cellens: (centromer-kinetochor region) Välj område överlappar med kromosomer färgade med DAPI; (bakgrundsområdet) och området utanför kromosomerna men inuti identisk enda cell (dvs cytosoliska regionen).
      2. Interphase cell: (centromer-kinetochor region) Välj område överlappar med kromatin färgas med DAPI; (Bakgrundsområdet) och området utanför kromatin men inuti identisk enda cell (<em> dvs cytosoliska regionen).
        Obs: Se även Kompletterande kodfiler (5.2.1.4.3) eller (5.2.2.6.4) för val med Software A eller programvara B2, respektive.
    2. Kvantifiera andelen kvarvarande signalerna vid centromerer med Software A eller B. För denna uppgift, använd följande formel:
      Återstående signaler från centromer-kinetochor protein vid centromer-kinetochore
      Equation1
      där s är signalen ljusstyrka markerade området, vilket bekräftas av ACA eller CENP-B-färgning, b är bakgrundssignalen ljusstyrka, r provet är referens ACA eller CENP-B-signaler för siRNA (s) -behandlade celler; och r ctrl är referens ACA eller CENP-B-signaler för Luc siRNA-transfekterade celler.
      Obs: I denna analys CENP-B-signaler som används som referenssignaler för CUL4A och RBX1 som beskrivits i tidigare rapporter.
    3. Använd en Excel-fil för denna beräkning efter kopiera och klistra in rådata från signal kvantifiering programvara som beskrivs ovan. Se även Kompletterande kodfiler: (5.2.1.4) och (5.2.2.6) för mer information. Ett exempel på beräkning visas i tabell 3.
  4. Analysera minst 20 celler för att eliminera variation i färgning och bild förvärv för varje nivåmätning. Valfritt använda "genomsnittliga värde" återstående centromer-kinetochore signaler för varje analyserat cell att jämföra dessa värden mellan olika centromer-kinetochore proteiner.

6. Western blot-analys av totalt protein

  1. Resuspendera cellerna i denaturer buffert A (20 mM Tris-HCl, pH 7,4; 50 mM NaCl; 0,5% Nonidet P-40; 0,5% deoxicholat; 0,5% SDS; 1 mM EDTA; och fullständig EDTA-fri proteasinhibitorcocktail), 26 ämne suspensionen till en sonikering och frys-upptiningsprocessen, och måttproteinkoncentrationer enligt följande:
    1. För sonication processen, tillsätt 50 | il av buffert A till cellerna som samlats in från två brunnar i en 6-brunnars polystyrenplatta vid 48-72 h efter transfektion (se protokoll 1). Driva en ultraljud utrustad med disruptor horn och mikro (se lista över material / utrustning) för totalt 15 sekunder intermittent pulslängd (duty cycle 50%) per ett prov.
    2. För frysning-tining process, fryst celler med flytande kväve och tina cellerna vid RT.
    3. Mät proteinkoncentrationer med hjälp av en kommersiell proteinanalysreagens I eller II (se lista över material / utrustning).
      Note: Lysat utspädes med förhållande av 01:10 i mätningen av proteinkoncentrationer med antingen reagens I eller II. Vid denna spädning, SDS närvarande i buffert A visar liten eller ingen interferens i denna mätning.
  2. Blanda lysatet innehållande 20-30 | ig av totalt protein med 2 x eller 4 × SDS-PAGE-laddningsbuffert. 27 Koka proverna för5 min och sedan ladda dem på en 12,0% -15,0% denaturering SDS-polyakrylamidgelelektrofores för elektrofores.
  3. Överföra proteinerna separerade genom SDS-PAGE på ett PVDF-membran genom användning av en Western blotting-metoden som beskrivits tidigare. 17,24,27-31
    1. Blockera icke-specifika bindningsställen på membranet med 5% fettfri mjölk i en × PBS, och sedan inkubera membranet med lösningar av utspädda primära antikroppar under 1 h vid RT. Se lista över material / utrustning för detaljerad information (t.ex. utspädningsförhållande) för varje primär antikropp.
    2. Efter tvättning av membranet 3-4 gånger (vardera 3- till 5-min inkubation med skakning) med PBS-T-buffert (1 x PBS och 0,1% Tween-20), inkubera membranet i en blandning av nära-infraröda (IR) fluorescerande färgämnes-konjugerad sekundära antikroppar (utspädningsförhållande av 1: 20.000), DyLight-konjugerade sekundära antikroppar (utspädningsförhållande av 1: 20.000), och / eller pepparrotsperoxidas (HRP) -konjugerad sekundära antikroppar (utspädda i PBS-T; dilutipå förhållande av 1: 10000) under 1 h vid RT. Se lista över material / utrustning för detaljerad information (t.ex. utspädningsförhållande) för varje sekundär antikropp.
  4. Tvätta membranet 3 gånger, och sedan scanna membranet att analysera proteiner med den infraröda bildsystem och / eller kemiluminescensen kameran för immunoblot påvisande (se lista över material / utrustning).
    1. För att kunna använda den infraröda bildsystem, se (6.4.1) i Supplemental Code filer.
    2. För att kunna använda den kemiluminiscens kameran, se (6.4.2) i Supplemental Code filer. Använd en ultrakänsliga substrat förstärkt kemiluminiscerande (ECL) (se lista över material / utrustning) för detta system.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Immunofluorescensanalys av endogen CENP-A stöder hypotesen att CUL4A-E3-ligas krävs för lokalisering av CENP-A till centromerer
Våra nyligen gjorda studier visade att CUL4A-RBX1-COPS8 E3-ligas-aktivitet krävs för ubiquitylation av lysin 124 (K124) på CENP-A och lokalisering av CENP-A till centromerer. 17 Inledningsvis var interfas-centromer-komplex (ICEN) isoleras genom anti-CENP-A: nativ kromatin immunoprecipitation, 32-34 och det har antagits att vissa av de ICEN proteiner kan spela en roll i att lokalisera CENP-A till centromerer. Därför var siRNA knockdown experiment utfördes för att screena för proteiner vars frånvaro av uttryck inducerade delokalisering av CENP-A vid centromerer 17 (data ej visade): asynkront växande HeLa-celler transfekterades med Cullin 4A (CUL4A) siRNA eller RBX1 siRNA för tiderna krävs för optimal proteinbrist (48 timmarr för CUL4A och 72 h under RBX1). Celler transfekterade med CUL4A siRNA visade en signifikant delokalise av CENP-A vid centromererna (Figur 1A-C). Såsom ses i fig 2G, proteinnivåer av CENP-A i totalt cellysat av CUL4A siRNA-transfekterade celler liknade CENP-A nivåer i lysat från luciferas (Luc) siRNA-transfekterade celler under samma odlingsbetingelser. Möjligheten att off-mål effekterna av CUL4A siRNA uteslöts, eftersom ektopisk expression av CUL4A-Flag räddade minskning av CENP-A vid centromerer när CUL4A siRNA riktade 3 'UTR (Figur 2A-C). Proteinnivåer CENP-A i totalt cellysat bekräftades att likna CENP-A nivåer i lysat från Luc siRNA-transfekterade celler under samma odlingsbetingelser oberoende av cellcykeln skede (figur 1B, 2G); alltså möjligheten att CUL4A utarmning orsakade CENP-A proteinnedbrytning eliminerades.

35 och innehåller 3 viktiga delar: en Cullin byggnadsställning, en RING fingerprotein (RBX1 eller RBX2), och en ubikitin-charged E2 enzym som rekryteras av RBX1 eller RBX2, 36 A RING-fingerprotein rekryterar även ett substrat adapter som placerar substraten i närheten av den E2-enzymet för att underlätta ubiquitin överföring. 36 RBX1 siRNA inducerade en signifikant reduktion av CENP-A vid centromerer (Figur 1D-F) under de förhållanden under vilka proteinnivåer CENP-A i totalt cellysat av RBX1 siRNA-transfekterade celler liknade CENP-A nivåer i lysat från Luc siRNA-transfekterade celler (Figur 2G). Nedbrytning av CENP-A-protein, antingen genom RBX1 förbrukning eller genom kombinationen av CUL4A och RBX1 utarmning under samma odlingsbetingelser observerades inte (figur 2G). Möjligheten av off-target effekts of RBX1 siRNA uteslöts, eftersom ektopiskt uttryck av flagga-RBX1 räddade reduktionen av CENP-A vid centromerer när RBX1 siRNA riktade 3 'UTR (figur 2D-F). Dessa fynd tyder på att CUL4A-RBX1-E3-ligas är nödvändig för lokalisering av CENP-A centromerer.

Immunofluorescensanalys av exogen CENP-A - sjunker proteiner indikerar att CENP-A K124 ubiquitylation är nödvändig för lokalisering av CENP-A centromerer
Tidigare visade vår immunoutfällning-masspektrometri analys att lysin 124 (K124) av CENP-A-Flag är ubiquitylated i HeLa-celler. 17 kristallstrukturen av CENP-A nukleosomen, K124 är bosatt i α3 helix, även om platsen är inte ligger inom CATD regionen. 17 Dessutom är K124 konserverad bland däggdjur, fåglar, ödlor, växter och en grupp av svampar (t.ex., knoppding jäst). 17 CENP-A lysin mutanter (figur 3A) konstruerades och testades deras förmåga att lokalisera till centromeren. Väsentlig upphävandet av centro lokalisering av exogent CENP-A K124R mutant med diffusa signaler i både mitos som i interfas HeLa-celler observerades (figur 3B, C). Centromeren lokaliseringen påverkades inte signifikant varken av K9A mutationer (K9 motsvarar histon H3 K9 metylering) eller K77R mutationer (K77 är en unik lysin-stället i CATD) (Figur 3B, C).

Baserat på dessa resultat, är två hypoteser föreslagits avseende funktion in vivo av CENP-A ubiquitylation på K124. För det första är den roll som K124 ubiquitylation för ubiquitinmedierad proteolys för att eliminera överuttryckt och / eller mislocalized CENP-A eukromatin. För det andra är den roll som CENP-A ubiquitylation på K124 för lastning CENP-A på centromerer. För att testa fFÖRSTA möjlighet stabilitet av CENP-A-Flag vildtypen och K124R mutanten liksom endogen CENP-A efter cykloheximid (CHX) behandling av CUL4A- eller RBX1 utarmade celler togs upp. Dessa data tyder på att ubiquitylation av K124 förmodligen inte är involverad i ubiquitinmedierad proteolys för att eliminera överuttryckt och / eller mislocalized CENP-A (data visas ej). 17. Vidare bekräftades det att K124R mutationen upphäver förmodade monoubiquitylation och diubiquitylation band, både in vivo och in vitro ubiquitylation analyser (data ej visade). 17 Tillsammans antyder dessa data att den CUL4A-RBX1 komplex bidrar till "signalering" ubiquitylation, vilket krävs för CENP-A lokalisering vid centromererna.

Immunofluorescensanalys av exogen flagga - CENP-A-proteiner indikerar att monoubiquitin fusion är tillräcklig för att fyllaCENP-A K124R vid centromererna
Baserat på resultaten ovan, var det en hypotes att kovalent kopplade monoubiquitin fungerar som en signal för CENP-A lastning på centromerer. För att testa denna hypotes, en N-terminal Flag-märkt och C-terminal ubiquitin-smält vildtyp CENP-A och en K124R mutant CENP-A konstruerades (Figur 4A). Den monoubiquitin mutanten Ub (K48R), som saknar en viktig plats för polyubiquitylation 37-39 användes även för att förhindra ubikitin-fuserad CENP-A-protein från potentiell polyubiquitylation. Genom att fånga anti-Flag immunofluorescenta signaler, var den centromer lokalisering av proteiner som kodas av dessa konstruktioner testades. Medan Flag-CENP-A (K124) väsentligen upphävs centromere lokalisering av CENP-A (figur 4B och 4C, kolumn [6]), både Flag-CENP-A (WT) och Flag-CENP-A (WT) -Ub ( WT) bibehållit sin centromer lokalisering (figur 4B och 4C, kolumner [1] och [2]). DeFlag-CENP-A (K124R) -Ub (K48R) protein förmodligen härmade monoubiquitylated CENP-A, eftersom detta protein väsentligen återställts lokalisering till centromerer (Figur 4C, jämför kolumner [5] och [6]) mer effektivt än gjorde CENP-A (K124R) -Ub (WT) (Figur 4C, jämför kolumner [4] - [6]). Dessa data visade att monoubiquitylation är tillräcklig för rekrytering av CENP-A centromerer.

Figur 1
Figur 1. Immunofluorescensanalys av endogen CENP-A stöder hypotesen att CUL4A-E3-ligas krävs för lokalisering av CENP-A till centromerer (figurerna anpassades från et al. Niikura 17). (A) CUL4A siRNA inducerade utlokalisering av CENP-A vid centromerer. HeLa-celler transfekterades med CUL4A eller luciferas (Luc) siRNA och inkuberades under 48 h (Tabell 1). Skalstrecket representerar 10 | j, m. (B) Western blot-analys av HeLa hela cellysat med användning av samma odlingsbetingelser som i (A). Cellerna skördades 48 h efter transfektion med CUL4A siRNA eller Luc siRNA (tabell 1). GAPDH fungerade som en laddningskontroll. (C) Kvantifierad endogena CENP-A-signaler vid centromerer som visas i (A). Normalisering av signaler utfördes med hjälp av Luc siRNA-transfekterade celler, och de genomsnittliga procenttal (± SD) visas. **** P <0,0001 jämfört med Luc siRNA-transfekterade celler (t-test). (D) RBX1 siRNA inducerade utlokalisering av CENP-A från centromerer. HeLa-celler transfekterades med RBX1 eller Luc siRNA (er) och inkuberades under 72 h (tabell 1). Skalstrecket representerar 10 | j, m. (E) Western blot-analys av HeLa hela cellysat med användning av samma odlingsbetingelser som i (D). Cellerna skördades 72 h efter transfektion med RBX1 or Luc siRNA (s) (tabell 1). GAPDH fungerade som en laddningskontroll. (F) Den kvantifierade endogena CENP-A-signaler vid centromererna som visas i (D). Normalisering av signaler utfördes med hjälp av Luc siRNA-transfekterade celler, och de genomsnittliga procenttal (± SD) visas. **** P <0,0001 jämfört med Luc siRNA-transfekterade celler (t-test). Klicka här för att se en större version av denna siffra.

figur 2
Figur 2. Kompletterande information om Figur 1 centromerer (figurerna anpassades från al. Niikura et 17). (A) Exogena CUL4A-Flag räddade omlokalisering av CENP-A när CUL4A siRNA riktade 3 'UTR. HeLa Tet-Off cells fixerades vid 48 h efter samtransfektion med siRNA (CUL4A # 2: 3 'UTR mål eller Luc; tabell 1) plus plasmidkonstruktionen (pTRM4-CUL4A-flagga eller vektor; Tabell 2). 4-färg immunfärgning: färgning för DAPI (blå); Flagga; endogen CENP-B (röd); och endogen CENP-A (grön), utfördes och Flag-positiva celler sorterades, men sjunker bilder utelämnas för enkelhets skull. Notera: CUL4A # 2 är den identiska mål som den som visas i figur 1A-C. Skalstrecket representerar 10 | j, m. (B) Western blot-analys av HeLa Tet-Off hela cellysat enligt samma odlingsbetingelser som visas i (A). GAPDH fungerade som en laddningskontroll. (C) CENP-A-signaler vid centromerer som visas i (A) kvantifierades genom mikroskopi efter sorteringen av cellerna för att isolera dem som är bundna av en anti-Flag-antikropp. Normalisering av signaler utfördes med celler transfekterade med Luc siRNA plus vektor och medel procent (± SD) visas.**** P <0,0001 vs celler transfekterade med Luc siRNA plus vektor (vänstra kolumnen, Students t-test). (D) Exogent Flag-RBX1 räddade delokalisering av CENP-A vid centromeren när RBX1 siRNA riktade 3 'UTR . HeLa-celler fixerades vid 72 timmar efter samtransfektion med siRNA (RBX1 # 2: 3 'UTR mål eller Luc; tabell 1) plus plasmidkonstruktionen (pcDNA3-Flag-RBX1 eller vektor; Tabell 2). 4-färg immunfärgning: färgning för DAPI (blå); Flagga; endogen CENP-B (röd); och endogen CENP-A (grön), utfördes och Flag-positiva celler sorterades, men sjunker bilder utelämnas för enkelhets skull. Skalstrecket representerar 10 | j, m. (E) Western blot-analys av HeLa hela cellysat enligt samma odlingsbetingelser som i (D). GAPDH fungerade som en laddningskontroll. (F) CENP-A-signaler vid centromerer som visas i (D) kvantifierades genom mikroskopi efter sortering av celler för att isolera dem som är bundna av en n anti-Flag antikropp. Normalisering av signaler utfördes med celler transfekterade med Luc siRNA plus vektor och medel procent (± SD) visas. **** P <0,0001 vs celler transfekterade med Luc siRNA plus vektor (vänstra kolumnen, Students t-test). (G) Utarmning av CUL4A och RBX1 påverkade inte nivåerna av endogent CENP-A-protein. Nivåer av endogent CENP-A-protein mättes i HeLa hela cellysat skördades 72 timmar efter transfektion med CUL4A, RBX1, CUL4A plus RBX1 eller Luc siRNA. Fyrtioåtta timmar efter transfektion, cellerna var antingen obehandlade (asyn) eller behandlade med paklitaxel (+ moms) för att inducera gripande i mitos, och de odlades under 24 timmar. GAPDH fungerade som en laddningskontroll. Klicka här för att se en större version av denna siffra.

32 / 53732fig3highres.jpg "width =" 700 "/>
Figur 3. Immunofluorescensanalys av exogena CENP-A-Flag proteiner indikerade att CENP-A K124 ubiquitylation krävs för CENP-A lokalisering vid centromerer (figurerna anpassades från Niikura et al. 17). (A) Överuttryck av CENP-A- Flag-konstrukt (WT och KR mutanter) bekräftades genom Western blot-analys av heLa Tet-Off hela cellysat. Cellerna skördades 48 h efter transfektion med pTRM4-CENP-A-Flag WT, KR-mutanter, eller pTRM4 vektorn (tabell 2). Överexpression av CENP-A-Flag detekterades genom en anti-Flag-antikropp. GAPDH fungerade som en laddningskontroll. Förmodade CENP-A-Flag-dimer (##) och CENP-A-Flag monomer (#) visas. Obs: SDS-resistenta CENP-A-dimerer har tidigare rapporterats 40,41 (B) CENP-A K124R mutant visade diffust omlokalisering från centromerer.. Signaler från DAPI (blå), Flag (Green), och endogena CENP-B (röd, en centromer styrplats) visas. Obs: Till skillnad från endogent CENP-A i celler transfekterade med CUL4A eller RBX1 siRNA, verkade diffusa signaler i celler som överuttrycks exogen CENP-A K124R-Flag som en fenotyp av oförmågan att styras till centromerer, förmodligen eftersom dess expressionsnivå är ungefär 10 - till 25-faldigt högre än den för endogent CENP-A (data visas ej) 17 Skala stapel representerar 10 | j, m (C) Histogram av lokaliseringsmönster som visas i (B)... Mer än 50 pro / prometafas och metafas celler och mer än 200 interfasceller per experiment räknades (n ≥ 3 experiment). De genomsnittliga procentandelar (± SD) visas. "Andra (icke-centromer)" indikerar mestadels skadade celler, döda celler, eller celler med nukleolär lokalisering (endast i inter), förmodligen på grund av transfektion eller andra behandlingar. *** P <0,001 vs CENP-A WT-Flag (Students t-test).

figur 4
Figur 4. Immunofluorescens analys av exogena Flag-CENP-A-proteiner indikerade att CENP-A monoubiquitin fusion räddade omlokalisering av CENP-A K124R mutant från centromerer (figurerna anpassades från Niikura et al. 17). (A) Schematisk karikatyrerna av varje konstrukt användes i denna studie (se även tabell 2). Den K124R mutationsstället på CENP-A (röd) och K48R mutationsstället på monoubiquitin (blå) visas. (1) WT: Flag-CENP-A WT, (2) WT-Ub (WT): Flag-CENP-A WT-Ub (WT), (3) WT-Ub (K48R): Flag-CENP-A WT -Ub (K48R), (4) K124R-Ub (WT): Flag-CENP-A K124R-Ub (WT), (5) K124R-Ub (K48R): Flag-CENP-A K124R-Ub (K48R), (6) K124R: Flag-CENP-A K124R (B) Exogenous CENP-A monoubiquitin fusion räddade delokalisering av CENP-A K124R mutant från centromerer.. DAPI (blå), sjunker (grön), och endogena CENP-B (röd, en centromer styrplats) visas. Skalstrecket representerar 10 | j, m. (C) Histogram av lokaliseringsmönster som visas i (C). Mer än 50 pro / prometafas och metafas celler och mer än 200 interfasceller per experiment räknades (n ≥ 3 experiment). De genomsnittliga procentandelar (± SD) visas. **** P <0,0001 och *** P <0,001 vs icke-smält Flag-CENP-A K124R (kolumn [6]) (t-test). Klicka här för att se en större version av denna siffra.

siRNA mål Indikationen aktuella studien måltyp siRNA databasnummer Framåt sekvens (er) Källa / Referens
Luciferas (GL3) - ett mål RKK9 CUUACGCUGAGUACUUCGAdTdT Elbashir et al., (2001)
CENP-A CA-UTR siRNA pool (2 mål blandning) RKK375 / 5 'UTR t1 CGAGCGGCGCGGACUUCUGCCdTdT Niikura et al., (2015)
RKK383 / 3 'UTR t1 UCCUGCACCCAGUGUUUCUGUdGdT Niikura et al., (2015)
CUL4A # 1 ett mål CRKK178 / RKK309 / t1 AGCGAUCGUAAUCAAUCCUGA Niikura et al., (2015)
# 2 (3'UTR) ett mål CRKK181 / RKK331 / t4 AUGCGGGUUUGAAAUAUGACA Niikura et al., (2015)
RBX1 / ROC1 # 1 siRNA pool (4 mål blandning) CRKK198 / RKK411 / t1 GAAGCGCUUUGAAGUGAAA Niikura et al., (2015)
CRKK198 / RKK413 / t2 GCAUAGAAUGUCAAGCUAA Niikura et al., (2015)
CRKK198 / RKK415 / t3 GCAAGAAGCGCUUUGAAGU Niikura et al., (2015)
CRKK198 / RKK417 / t4 CAACAGAGAGUGGGAAUUC Niikura et al., (2015)
# 2 (3 'UTR) ett mål CRKK206 / RKK425 / t8 UUCCCUGCUGUUACCUAAUUA Niikura et al., (2015)

Tabell 1. siRNA-sekvenser som används i denna studie.

B-nummer Relevant egenskap (er) Källa / Referens
B288 pTRM4 Niikura et al., (2006)
B2067 pTRM4-human CENP-A-Flag Niikura et al., (2015)
B2281 pTRM4-human CENP-A K9A-Flag Niikura et al., (2015)
B2387 pTRM4-human CENP-A K77R-Flag Niikura et al., (2015)
B2388 pTRM4-human CENP-A K124R-Flag Niikura et al., (2015)
B2512 pTRM4-Flag-human CENP-A Niikura et al., (2015)
B2579 pTRM4-Flag-human CENP-A K124R Niikura et al., (2015)
B2513 pTRM4-Flag-human CENP-A-Ub (WT) Niikura et al., (2015)
B2559 pTRM4-Flag-human CENP-A K124R-Ub (WT) Niikura et al., (2015)
B2515 pTRM4-Flag-human CENP-A-Ub (K48R) Niikura et al., (2015)
B2560 pTRM4-Flag-human CENP-A K124R-Ub (K48R) Niikura et al., (2015)
B2759 pTRM4-human CUL4A-Flag Niikura et al., (2015)
B2624 pcDNA3-Flag-human RBX1 Niikuraet al., (2015)
B1491 pcDNA3-Flag Niikura et al., (2015)

Tabell 2. Plasmidvektorer används i denna studie.

R (anti-CENP-B) prov b (anti-CENP-B) R prov (subtraheras) Ratio (S prov: R prov) Korrigerad Ratio (S prov: R prov)
520 514 6 -4,167 0,000
535 445 90 -1,033 0,000
515 431 84 0,274 0,274
562 483 79 0,506 0,506
902 562 340 0,509 0,509
1203 703 500 -0,560 0,000
1014 589 425 -0,819 0,000
768 510 258 -1,345 0,000
555 458 97 -1,845 0,000
781 576 205 -1,146 0,000
556 436 120 0,758 0,758
534 493 41 -1,634 0,000
702 543 159 0,667 0,667
482 429 53 -1,000 0,000 654 531 123 0,740 0,740
1190 607 583 0,384 0,384
552 454 98 0,969 0,969
489 413 76 0,539 0,539
511 452 59 -3,186 0,000
485 475 10 -2,700 0,000
481 441 40 -1,475 0,000
Belopp 5,347
Genomsnitt 0,255
R (anti-CENP-B) ctrl b (anti-CENP-B) Ratio (S ctrl: R ctrl) Korrigerad Ratio (S ctrl: R ctrl)
543 483 60 3,017 3,017
526 466 60 2,667 2,667
532 460 72 1,792 1,792
507 457 50 3,520 3,520
491 458 33 4,273 4,273
545 464 81 2,160 2,160
518 484 34 3,559 3,559
461 404 57 2,404 2,404
487 447 40 3,550 3,550
534 477 57 3,965 3,965
528 456 72 3,097 3,097
707 601 106 1,868 1,868
615 528 87 2,828 2,828
660 481 179 1,620 1,620
565 476 89 1,607 1,607
527 455 72 3,583 3,583
560 474 86 2,930 2,930
510 451 59 4,017 4,017
729 586 143 2,678 2,678
634 576 58 3,655 3,655
507 476 31 3,935 3,935
Belopp 62,725
Genomsnitt 2,987
Återstående CENP-A-signaler vid centromer (%) 8,5

. Tabell 3. Ett exempel på beräkning av kvarvarande CENP-A-signaler vid centromeren (%) Ett exempel på Pro / prometafas i figur 2F visas: provet är RBX1 # 2 (3'UTR) + Vec (mittenkolumnen i figur 2F ) och kontroll är Luc + Vec (vänstra kolumnen i figur 2F). Som ett resultat, kvarvarande CENP-A-signaler påcentromer (%) = (0,255 / 2,987) x 100 = 8,5% erhålls (eller [5,347 / 62,725] x 100 = 8,5% med samma totala antalet celler [dvs 21 celler] analyserade mellan två prover). Observera att om B-värdet är mer än S-värde (dvs om subtraheras värdet är negativt), korrigerat kvotvärde sätts till 0,00.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Under senare år har många studier har utvecklat olika kvantitativ mikroskopi analyser för fixerade celler. 42 Framsteg i centromer-kinetochor biologi ofta kräver en förståelse av centromer specifika eller kinetokoren-specifik funktion av proteiner som subcellulär spatial-temporal reglering återspeglar de förändrade funktioner dessa proteiner under cellcykeln. Därför, här har vi utvecklat metoder för IIF-färgning och en kvantitativ IIF analys för att särskilt analysera de relativa nivåerna av endogena och exogena CENP-A-proteiner, som kan vara tillämpliga i olika behandlade prover. För närvarande har vi uppnått framgångsrik IIF-färgning av endogen CENP-I, CENP-H, KNL1, Hec1 och Ska1 använder protokoll 2 i denna studie (se al Niikura et 24 och ej visade data,. Förteckning över Material / Utrustning för informations av antikroppar) . I framtiden, kan en tillämpa samma metod för att kvantifiera nivån av olika centromer-kinetochore proteiner (både endogenous och Flag-märkta exogena proteiner) välja specifika antikroppar, men våra IIF metoder inte täcker detektering av dessa proteiner i levande celler eller i ett visst enda cell under hela cellcykeln. Eftersom dessa förfaranden kräver celler som skall fastställas och behandlas på separata täck introducerade vi referenssignaler (t.ex. ACA eller CENP-B) i syfte att normalisera för att rättvist jämföra signaler mellan olika prover och öka noggrannheten av analysen. Eftersom ACA involverar endogena och / eller exogena CENP-A-signaler, CENP-B som en referenssignal för att normaliseringen skulle vara lämpligare för jämförelse än skulle ACA när det gäller riktigheten i den kvantitativa analysen av CENP-A-signaler. Den aminoterminala regionen av CENP-B binder till den 17-bp-motivet av CENP-B-box-sekvensen i alphoid DNA och den karboxi-terminala regionen av CENP-B bildar homodimerer. 43,44 CENP-B inte colocalize helt med CENP-A och / eller annan centromere-kinetochore proteiner, dock är nära förknippad med dem. 45 Medan immunofluorescens med anti-CENP-C-antikroppar ger typiskt två diskreta fläckar, färgning med anti-CENP-B visas ofta som en enda ljus bar förbinder de båda syster centromerer. 46 emellertid i vår makroskala mikroskopisk observation, vissa CENP-B-signaler överlappar tydligen med CENP-A-signaler, särskilt vid tidigare mitotiska steg (profas-prometafas än sen meta), även delvis beroende på observationsvinkel och vilken typ av fixativ som används (data ej visade). Däremot i en kvantitativ IIF analys av CENP-A-signaler, protein lokalisering av referenssignaler bör inte påverkas genom utarmning och / eller dysfunktion av CENP-A för rättvis analys, även om lokaliseringen av de flesta av de centromer-kinetochore proteiner är beroende av CENP-A lokalisering vid centromererna. 47,48 CENP-A-oberoende kinetochor aggregatet är etablerad genom att ersätta de DNA-bindande regionerna av CENP-C Och CENP-T med alternativa kromosom inriktning domäner som rekryterar dessa proteiner till ektopisk loci. 49,50 Dessutom senaste arbete indikerade att de inre kinetokoren komponenterna CENP-C och CENP-T agera parallellt rekrytera KMN nätet till kinetokorer. 51-54 Dessutom Nishino et al. föreslog att CENP-TWSX komplexa former en unik nukleosomen liknande struktur för att generera kontakter med DNA, förlängning av "histon koden" bortom kanoniska nukleosomen proteiner. 55 Eftersom centromer lokalisering av CENP- C är beroende av centromeren lokalisering av CENP-A, kunde 47,48 CENP-TWSX eller speciellt CENP-T vara ett annat protein kandidat (er) för att tillhandahålla referenssignaler i ett kvantitativt IIF analys av CENP-A. Dock bör kandidat för referenssignal testas noggrant innan analys för att bestämma huruvida lokalisering vid centromerer påverkas av utarmning och / eller dysfunktion av CENP-A. analogt övervägandebör tas för kvantitativa IIF-analyser av andra centromer-kinetochore proteiner: protein lokalisering av referenssignaler bör inte påverkas av utarmning och / eller dysfunktion av målproteinet för opartisk analys. I den tidigare studien använde vi ACA som en referenssignal för kvantitativ IIF-analys av andra central-yttre kinetokoren proteiner. 24 ACA skulle kunna vara en mer lämplig alternativ än enstaka CENP-B som en positionsstyrning samt en referenssignal, om ACA signaler inte påverkas av utarmning och / eller dysfunktion av målproteinet men colocalization av målproteinet med CENP-B är dålig som nämnts ovan.

Bodor et al. rapporterade att centro CENP-A nivåer regleras genom massaktioner, dvs mängden centro CENP-A varierar i direkt proportion till den cellulära innehåll. 56 De visade också att övergående induktion av CENP-A uttryck leder till en snabb ökning av centro CENP-A nivå. Omvänt, observerade vi en stor cellpopulation med centromer-lokaliserad, Flag-märkt CENP-A WT efter samtransfektion av pTRM4 expressionsvek med CA-UTR siRNA (en blandning av 5 'och 3' UTR siRNA, Tabell 1) (data visad); denna population var större än den som sågs efter transfektion med enbart den pTRM4 expressionsvektom. Nivån av exogena Flag-märkt CENP-A-protein vars uttryck drevs av pTRM4, var ca 1,0 till 1,4 storleksordningar (10- till 25-faldigt) högre än den för endogent CENP-A (data visas ej). Det spekuleras att uttryck av exogen CENP-A WT ovanför en viss tröskel skulle kunna påverka dess korrekta centro lokalisering.

I förevarande protokoll, är fixering ett kritiskt steg för att upprätthålla cellstruktur och miljö proximal situation som möjligt det nativa tillståndet. När celler är fasta, bör en fortsätta med färgningsprotokollet för att undvika förlust av proteinet av integrevila eller resten av cellen. Emellertid förstör fixering antigena ställen ibland, och olika antikropp-antigen kombinationer fungerar dåligt med ett fixativ, men mycket väl med en annan. 21 På grund av denna variation, valet av fixativ beror till stor del på protein (er) av intresse. Den tidslängd fixering kan väsentligt påverka detektion av protein (er) genom immunfärgning och kortare fixering är i allmänhet bättre att behålla antigenicitet. 57 Därför, vid fastställandet färgningsprocedurer för ett nytt mål på andra centromer-kinetochore proteiner, särskilt osäker lokalisering, eller när man arbetar med en ny antikropp, bör man testa flera metoder för fixering och buffertar för att hitta den optimala tillståndet. I förevarande protokoll, har två klasser av populära fixativ valt: aldehyd fixativ (protokoll 2) och organiska lösningsmedel (Protokoll 3 och 4). Renheten av de fixativ är också oerhört viktigt. I protokoll 4, är 4% getserum användes especially att blockera IgG-receptorer på cellytan för att minska icke-specifik bakgrund. 57 I allmänhet serum för blockering IgG-receptorer bör vara från en art utan samband med den primära antikroppen och företrädesvis från samma art som den sekundära antikroppen. 57

I var och en av de föreliggande protokoll, är valet av primär antikropp det mest kritiska steget för att uppnå framgångsrik immunfärgning. Antikroppen har störst specificitet, renhet, affinitet och aviditet önskas. En bra utgångskoncentrationen för monoklonala antikroppar är vanligtvis 1-5 | j, g / ml. Typiska spädningar av mäldberedningen av polyklonala antikroppar varierar från 1:20 till 1:. 500 57 Man måste bestämma empiriskt lämplig koncentration av den primära antikroppen och utspädningsmedlet för varje prov. Prover ska försiktigt rockade men inte torkad under inkubation för homogen färgning. Omfattande tvättning mellan inkubation av primär antikropp och sekundär enntibody kan krävas för att undvika korsreaktion med immunoglobuliner från andra arter. Dock måste det optimala tvätt tillstånd bestämmas empiriskt för att undvika förlust av celler, speciellt mitotiska celler, som avrunda och lossa när skakas (dvs mitotisk skaka-off). 58 För framgång måste en sekundär antikropp väljas för att binda till den primära antikroppen med hög affinitet. Till exempel, för att undvika icke-specifik bindning av Fc-delen av den sekundära antikroppen till IgG Fc-receptorer, Fb (ab ') 2-fragment kan användas i stället för hela antikroppen. 57 För många sekundära antikroppar, kan inkubationstiden minimeras till 30 min vid RT för att minska den icke-specifika bakgrunden.

Förutom protokoll 5, kan laserskanning konfokalmikroskopi vara fördelaktigt för att upptäcka och analysera lokalisering och funktion av centromer-kinetochore proteiner med fluorescerande egenskaper. Som framgår av förteckningen över material / Equipment, Alexa Fluor 488 och Alexa Fluor 594 är förmodligen den mest använda fluorescerande färgämnen i föreliggande protokoll. För att upptäcka två och / eller flera olika centromer-kinetochore proteiner i provet, måste man se till att de antikroppar som används för att detektera ett protein inte hindrar detektion av det andra proteinet. 57 I förevarande protokoll, två primära antikroppar blandas och tillämpas på samma gång. Emellertid bör en optimera immunfärgning villkoren för varje protein separat före tillämpning av de primära eller sekundära antikroppar tillsammans: om de två proteinerna är i omedelbar närhet som i fallet med två centromer-kinetochore komponenter, kan en primär antikropp strukturellt förhindra bindning av den andra primära antikroppen. En annan angelägenhet för multipel detekteringssignalen är problemet med spektral överlappning: svårigheten att förhindra signal från ett färgämne "läckande" i den spektrala kanal i ett annat. Detta problem blir svårare för conventional interferensfilter sätter att lösa eftersom antalet färgämnen ökar eller om provet innehåller overenhanced signaler (t.ex. ACA eller anti-Flag-signaler i den aktuella studien), inklusive störningar av autofluorescens. Felsökning av autofluorescens har utförts i andra studier. 57,59,60 I den aktuella studien, optimera fluorescerande filteruppsättningar med en enda etikett kontroller i varje kanal är tillräcklig i de flesta fall för att undvika dessa problem (se nedan).

I var och en av de föreliggande protokoll, lämpliga kontroller är nödvändiga. Varje ny primär antikropp ska präglas före immunfärgning börjar. Specificiteten hos antikroppen bör bekräftas genom Western blot-analys, om tillämpligt. Dessutom bör bekräftelse på att färgningen inte orsakas av icke-specifik bindning till cellytan erhållas, och den optimala arbetskoncentration av en speciell primär antikropp bör bestämmas genom användning av seriespädningar(Dvs. en bindningskurva bör utvecklas). En negativ kontroll (dvs frånvaro av den primära antikroppen från färgningsprocessen) bör inkluderas. Ett annat alternativ för negativ kontroll är ersättning av normalt IgG från samma art för den primära antikroppen. För detektion av flera etiketter, måste man förbereda kontroller utan sekundära antikroppar (bakgrundskontroll) samt en enda etikett kontroller för att undvika spektral överlappning artefakter (dvs genomblödning, crossover, överhörning, eller färgämne "läcker", som beskrivits ovan ). Man kan kvantifiera den del av "läckande" genom att jämföra signaler genom "fel" filter med rätt signal, med hjälp av dessa proportioner för att ta bort beräknings alla "läcker", och beräkna den verkliga fördelningen och / eller samlokalisering av fluorescerande markör. 60 den bakgrundskontroll bör undersökas oberoende med varje kanal för att ställa in gränserna för signalförstärkning och offset vara adapted Slut avbildning. Alla kanaler som kommer att användas för att få en bild av ett fler etikett prov måste genomgå oberoende bakgrundskorrektion, eftersom graden av autofluorescens i varje kanal varierar kraftigt. De "läcker" kontroller som beskrivs ovan krävs för att bestämma mängden signalförstärkning möjligt i varje kanal utan att upptäcka "läcka" i angränsande kanaler. 60

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Författarna förklarar att de inte har några konkurrerande ekonomiska intressen.

Acknowledgments

Detta arbete stöddes av NIH bidrag GM68418.

Materials

Name Company Catalog Number Comments
Lipofectamin 2000 Life Technologies/Invitrogen 11668 transfection reagent I
Lipofectamin RNAiMAX Life Technologies/Invitrogen 13778 transfection reagent II
Opti-MEM I Life Technologies/Invitrogen 31985 Reduced serum media, warm in 37 °C water bath before use
High-glucose DMEM (Dulbecco’s modified Eagle’s medium) Life Technologies/BioWhittaker 12-604 high-glucose DMEM, warm in 37 °C water bath before use
Fetal Bovine Serum, certified, heat inactivated, US origin Life Technologies/Gibco 10082 FBS (fetal bovine serum)
Poly-L-Lysine SOLUTION SIGMA-SLDRICH P 8920 Poly-L-Lysine, 0.1% w/v, in water
UltraPure Distilled Water Life Technologies/Invitrogen/Gibco 10977 Sterile tissue culture grade water 
Micro Cover glass (22 mm x 22 mm)  Surgipath 105 Cover glass (22 mm x 22 mm) 
6 Well Cell Culture Cluster Fisher/Corning Incorporated 07-200-83 6-well polystyrene plate 
Penicillin, Streptomycin; Liquid Fisher/Gibco 15-140 Penicillin-streptomycin
PAP PEN  Binding Site AD100.1 Hydrophobic barrier pen (for a water repellant barrier in immunofluorescent staining)
Paclitaxel (Taxol) SIGMA-SLDRICH T7402 Taxol for mitotic cell analysis
TN-16, microtubule inhibitor (TN16) Enzo Life Sciences BML-T120 TN16 for mitotic cell analysis
BSA (bovine serum albumin) SIGMA-SLDRICH A7906 Blocking reagent
Triton X-100 SIGMA-SLDRICH T8787 Detergent for permeabilization
Paraformaldehyde SIGMA-SLDRICH P6148 Fixation reagant
DAPI SIGMA-SLDRICH D9542 For nuclear staining
p-phenylenediamine SIGMA-SLDRICH P6001 For mounting medium
VWR Micro Slides, Frosted VWR International 48312-013 Micro slides 
Anti-CENP-A antibody Stressgen/Enzo Life Sciences KAM-CC006 Mouse monoclonal antibody; dilution ratio of 1:100 (IIF), 1:5000 (WB)
Anti-CENP-B antibody Novus Biologicals H00001059-B01P Mouse monoclonal antibody; dilution ratio of 1:200 (IIF, methanol/acetone fixation)-1:400 (IIF, paraformaldehyde fixation)
Anti-CENP-B antibody  abcam ab25734 Rabbit polyclonal antibody; dilution ratio of 1:200 (IIF, methanol/acetone fixation)-1:400 (IIF, paraformaldehyde fixation)
Anti-centromere antibody (ACA) Fitzgerald Industries International, Inc. 90C-CS1058 Human centromere antiserum; dilution ratio of 1:2000 (IIF)
Anti-CENP-H antibody Bethyl Laboratories BL1112 (A400-007A) Rabbit polyclonal antibody; dilution ratio of 1:200 (IIF)
Anti-CENP-H antibody BD 612142 Mouse monoclonal antibody; dilution ratio of 1:200 (IIF)
Anti-CENP-I antibody N/A, Dr. Katusmi Kitagawa N/A, Dr. Katusmi Kitagawa Rabbit polyclonal antibody; dilution ratio of 1:1000 (IIF); Niikura et al., Oncogene, 4133-4146 (2006)
Anti-KNL1 antibody Novus Biologicals NBP1-89223 Rabbit polyclonal antibody; dilution ratio of 1:100 (IIF)
Anti-Hec1 antibody Novus Biologicals / GeneTex NB 100-338 / GTX70268 Mouse monoclonal antibody; dilution ratio of 1:100 (IIF)
Anti-Hec1 antibody GeneTex GTX110735 Rabbit polyclonal antibody; dilution ratio of 1:100 (IIF)
Anti-Ska1 antibody abcam ab46826 Rabbit polyclonal antibody; dilution ratio of 1:100 (IIF)
Anti-Flag antibody SIGMA-ALDRICH F3165 Mouse monoclonal antibody; dilution ratio of 1:1000 (IIF), 1:5000 (WB)
Anti-Flag antibody SIGMA-ALDRICH F7425 Rabbit polyclonal antibody; dilution ratio of 1:1000 (IIF), 1:5000 (WB)
Anti-CUL4A antibody N/A, Dr. Pradip Raychaudhuri N/A, Dr. Pradip Raychaudhuri Rabbit polyclonal antibody; dilution ratio of 1:3000 (WB); Shiyanov et al., The Journal of biological chemistry, 35309-35312 (1999)
Anti-RBX1 antibody Cell Signaling 4397 Rabbit polyclonal antibody; dilution ratio of 1:2000 (WB)
Anti-GAPDH antibody Chemicon MAB374 Mouse monoclonal antibody; dilution ratio of 1:5000 (WB)
Alexa Fluor 488 Goat Anti-Mouse IgG Life Technologies/Invitrogen A11001 fluorophore-conjugated secondary antibody (Affinity-purified secondary antibody)
Alexa Fluor 594 Goat Anti-Mouse IgG Life Technologies/Invitrogen A11005 fluorophore-conjugated secondary antibody (Affinity-purified secondary antibody)
Alexa Fluor 488 Goat Anti-Rabbit IgG Life Technologies/Invitrogen A11008 fluorophore-conjugated secondary antibody (Affinity-purified secondary antibody)
Alexa Fluor 594 Goat Anti-Rabbit IgG Life Technologies/Invitrogen A11012 fluorophore-conjugated secondary antibody (Affinity-purified secondary antibody)
Non fat powdered milk (approved substitution for carnation powdered milk) Fisher Scientific NC9255871 (Reorder No. 190915; Lot# 90629) Skim milk
Leica DM IRE2 motorized fluorescence microscope  Leica motorized fluorescence microscope 
HCX PL APO 63x oil immersion lens Leica LEICA HCX PL APO NA 1.40 OIL PH 3 CS 63X oil immersion lens
HCX PL APO 100x oil immersion lens Leica LEICA HCX PL APO NA 1.40 OIL PHE 100X oil immersion lens
Leica EL6000 compact light source Leica External compact light source for fluorescent excitation
ORCA-R2 Digital CCD camera  Hamamatsu C10600-10B digital CCD camera 
Openlab version 5.5.2 Scientific Imaging Software  Perkin Elmer/Improvision For image observation, acquisition, quantification, and analysis
Velocity version 6.1.1 3D Image Analysis Software  Perkin Elmer/Improvision For image observation, acquisition, quantification, and analysis
Complete EDTA-free protease inhibitor cocktail Roche 11873580001/11836170001 Protease inhibitor cocktail tablets
PlusOne 2-D Quant Kit Amersham Biosciences 80-6483-56 Commercial protein assay reagent I for measurement of protein concentration (compatible with 2% SDS)
Bio-Rad Protein Assay Bio-Rad 500-0006 Commercial protein assay reagent II for measurement of protein concentration (compatible with 0.1% SDS)
Immobilon-FL EMD Millipore IPFL00010 PVDF membrane for transferring
IRDye 800CW Goat Anti-Mouse IgG LI-COR Biosciences 926-32210 IR fluorescent dye-conjugated secondary antibody (Affinity-purified secondary antibody); dilution ratio of 1:20000 (IIF)
IRDye 680 Goat Anti-Rabbit IgG LI-COR Biosciences 926-32221 IR fluorescent dye-conjugated secondary antibody (Affinity-purified secondary antibody); dilution ratio of 1:20000 (IIF)
Goat anti-Mouse IgG DyLight 549 Fisher Scientific PI35507 DyLight-conjugated secondary antibodyIR fluorescent dye-conjugated secondary antibody (Affinity-purified secondary antibody); dilution ratio of 1:20000 (IIF)
Goat anti-Rabbit DyLight 649 Fisher Scientific PI35565 DyLight-conjugated secondary antibodyIR fluorescent dye-conjugated secondary antibody (Affinity-purified secondary antibody); dilution ratio of 1:20000 (IIF)
Goat anti-mouse IgG-HRP Santa Cruz SC-2005 HRP-conjugated secondary antibodyDyLight-conjugated secondary antibodyIR fluorescent dye-conjugated secondary antibody (Affinity-purified secondary antibody); dilution ratio of 1:10000 (IIF)
Goat anti-rabbit IgG-HRP Santa Cruz SC-2004 HRP-conjugated secondary antibodyDyLight-conjugated secondary antibodyIR fluorescent dye-conjugated secondary antibody (Affinity-purified secondary antibody); dilution ratio of 1:10000 (IIF)
Openlab version 5.5.2. Scientific Imaging Software  Improvision/PerkinElmer Software A
Volocity version 6.3 3D Image Analysis Software (Volocity Acquisition) PerkinElmer Software B1
Volocity version 6.3 3D Image Analysis Software (Volocity Quantification) PerkinElmer Software B2
Branson SONIFIER 450 Sonicator
Branson Ultrasonics sonicator Microtip Step, Solid, Threaded 9.5 mm VWR Scientific Products Inc.  33995-325 Disruptor horn for sonication
Branson Ultrasonics sonicator Microtip Tapered 6.5 mm VWR Scientific Products Inc.  33996-185 Microtip for sonication
Odyssey CLx Infrared imaging System  LI-COR Biosciences Infrared imaging system for immunoblot detection
Image Studio Analysis Software Ver 4.0  LI-COR Biosciences Software C
Molecular Imager Versadoc MP4000 System  Bio-Rad Chemiluminescence imager for immunoblot detection
Quantity One 1-D analysis software  Bio-Rad Software D
SuperSignal West Femto Maximum Sensitivity Substrate Thermo 34095 Ultra-sensitive enhanced chemiluminescent (ECL) substrate

DOWNLOAD MATERIALS LIST

References

  1. DeLuca, J. G., et al. Hec1 and nuf2 are core components of the kinetochore outer plate essential for organizing microtubule attachment sites. Molecular biology of the cell. 16, 519-531 (2005).
  2. Earnshaw, W. C., Halligan, N., Cooke, C., Rothfield, N. The kinetochore is part of the metaphase chromosome scaffold. J Cell Biol. 98, 352-357 (1984).
  3. Hoffman, D. B., Pearson, C. G., Yen, T. J., Howell, B. J., Salmon, E. D. Microtubule-dependent changes in assembly of microtubule motor proteins and mitotic spindle checkpoint proteins at PtK1 kinetochores. Molecular biology of the cell. 12, 1995-2009 (2001).
  4. Regnier, V., et al. CENP-A is required for accurate chromosome segregation and sustained kinetochore association of BubR1. Mol Cell Biol. 25, 3967-3981 (2005).
  5. Bernad, R., Sanchez, P., Losada, A. Epigenetic specification of centromeres by CENP-A. Exp Cell Res. 315, 3233-3241 (2009).
  6. Black, B. E., Cleveland, D. W. Epigenetic centromere propagation and the nature of CENP-a nucleosomes. Cell. 144, 471-479 (2011).
  7. Warburton, P. E., et al. Immunolocalization of CENP-A suggests a distinct nucleosome structure at the inner kinetochore plate of active centromeres. Curr Biol. 7, 901-904 (1997).
  8. Karpen, G. H., Allshire, R. C. The case for epigenetic effects on centromere identity and function. Trends Genet. 13, 489-496 (1997).
  9. Black, B. E., et al. Structural determinants for generating centromeric chromatin. Nature. 430, 578-582 (2004).
  10. Black, B. E., et al. Centromere identity maintained by nucleosomes assembled with histone H3 containing the CENP-A targeting domain. Mol Cell. 25, 309-322 (2007).
  11. Fachinetti, D., et al. A two-step mechanism for epigenetic specification of centromere identity and function. Nat Cell Biol. 15, 1056-1066 (2013).
  12. Zeitlin, S. G., Shelby, R. D., Sullivan, K. F. CENP-A is phosphorylated by Aurora B kinase and plays an unexpected role in completion of cytokinesis. The Journal of cell biology. 155, 1147-1157 (2001).
  13. Zhang, X., Li, X., Marshall, J. B., Zhong, C. X., Dawe, R. K. Phosphoserines on maize CENTROMERIC HISTONE H3 and histone H3 demarcate the centromere and pericentromere during chromosome segregation. The Plant cell. 17, 572-583 (2005).
  14. Goutte-Gattat, D., et al. Phosphorylation of the CENP-A amino-terminus in mitotic centromeric chromatin is required for kinetochore function. Proc Natl Acad Sci U S A. 110, 8579-8584 (2013).
  15. Bailey, A. O., et al. Posttranslational modification of CENP-A influences the conformation of centromeric chromatin. Proc Natl Acad Sci U S A. 110, 11827-11832 (2013).
  16. Samel, A., Cuomo, A., Bonaldi, T., Ehrenhofer-Murray, A. E. Methylation of CenH3 arginine 37 regulates kinetochore integrity and chromosome segregation. Proc Natl Acad Sci U S A. 109, 9029-9034 (2012).
  17. Niikura, Y., et al. CENP-A K124 Ubiquitylation Is Required for CENP-A Deposition at the Centromere. Dev Cell. (2015).
  18. Chan, G. K., Liu, S. T., Yen, T. J. Kinetochore structure and function. Trends in cell biology. 15, 589-598 (2005).
  19. Hori, T., Okada, M., Maenaka, K., Fukagawa, T. CENP-O class proteins form a stable complex and are required for proper kinetochore function. Molecular biology of the cell. 19, 843-854 (2008).
  20. Fukagawa, T., Earnshaw, W. C. The centromere: chromatin foundation for the kinetochore machinery. Developmental cell. 30, 496-508 (2014).
  21. Kedersha, N. The Proteintech Blog.Proteintech. Grainger, D. Proteintech Group. (2012).
  22. Clontech Laboratories, Inc. HeLa Tet-Off Advanced Cell Line. Available from: http://www.clontech.com/CR/Products/Inducible_Systems/Tetracycline-Inducible_Expression/ibcGetAttachment.jsp?cItemId=26908&fileId=6712191&sitex=10020:22372:US (2012).
  23. Meraldi, P., Sorger, P. K. A dual role for Bub1 in the spindle checkpoint and chromosome congression. EMBO J. 24, 1621-1633 (2005).
  24. Niikura, Y., et al. 17-AAG, an Hsp90 inhibitor, causes kinetochore defects: a novel mechanism by which 17-AAG inhibits cell proliferation. Oncogene. 25, 4133-4146 (2006).
  25. Yang, Z., et al. Silencing mitosin induces misaligned chromosomes, premature chromosome decondensation before anaphase onset, and mitotic cell death. Mol Cell Biol. 25, 4062-4074 (2005).
  26. Wang, H., et al. Histone H3 and H4 ubiquitylation by the CUL4-DDB-ROC1 ubiquitin ligase facilitates cellular response to DNA damage. Mol Cell. 22, 383-394 (2006).
  27. Lamb, J. R., Tugendreich, S., Hieter, P. Tetratrico peptide repeat interactions: to TPR or not to TPR? Trends Biochem Sci. 20, 257-259 (1995).
  28. Kitagawa, K., Skowyra, D., Elledge, S. J., Harper, J. W., Hieter, P. SGT1 encodes an essential component of the yeast kinetochore assembly pathway and a novel subunit of the SCF ubiquitin ligase complex. Mol Cell. 4, 21-33 (1999).
  29. Niikura, Y., Dixit, A., Scott, R., Perkins, G., Kitagawa, K. BUB1 mediation of caspase-independent mitotic death determines cell fate. J Cell Biol. 178, 283-296 (2007).
  30. Niikura, Y., Kitagawa, K. Identification of a novel splice variant: human SGT1B (SUGT1B). DNA Seq. 14, 436-441 (2003).
  31. Niikura, Y., Ogi, H., Kikuchi, K., Kitagawa, K. BUB3 that dissociates from BUB1 activates caspase-independent mitotic death (CIMD). Cell Death Differ. 17, 1011-1024 (2010).
  32. Ando, S., Yang, H., Nozaki, N., Okazaki, T., Yoda, K. CENP-A, -B, and -C chromatin complex that contains the I-type alpha-satellite array constitutes the prekinetochore in HeLa cells. Mol Cell Biol. 22, 2229-2241 (2002).
  33. Izuta, H., et al. Comprehensive analysis of the ICEN (Interphase Centromere Complex) components enriched in the CENP-A chromatin of human cells. Genes to cells : devoted to molecular & cellular mechanisms. 11, 673-684 (2006).
  34. Obuse, C., et al. Proteomics analysis of the centromere complex from HeLa interphase cells: UV-damaged DNA binding protein 1 (DDB-1) is a component of the CEN-complex, while BMI-1 is transiently co-localized with the centromeric region in interphase. Genes Cells. 9, 105-120 (2004).
  35. Merlet, J., Burger, J., Gomes, J. E., Pintard, L. Regulation of cullin-RING E3 ubiquitin-ligases by neddylation and dimerization. Cell Mol Life Sci. 66, 1924-1938 (2009).
  36. Bennett, E. J., Rush, J., Gygi, S. P., Harper, J. W. Dynamics of cullin-RING ubiquitin ligase network revealed by systematic quantitative proteomics. Cell. 143, 951-965 (2010).
  37. Antonelli, A., et al. Efficient inhibition of macrophage TNF-alpha production upon targeted delivery of K48R ubiquitin. Br J Haematol. 104, 475-481 (1999).
  38. Codomo, C. A., Furuyama, T., Henikoff, S. CENP-A octamers do not confer a reduction in nucleosome height by AFM. Nat Struct Mol Biol. 21, 4-5 (2014).
  39. Thrower, J. S., Hoffman, L., Rechsteiner, M., Pickart, C. M. Recognition of the polyubiquitin proteolytic signal. The EMBO journal. 19, 94-102 (2000).
  40. Yoda, K., et al. Human centromere protein A (CENP-A) can replace histone H3 in nucleosome reconstitution in vitro. Proc Natl Acad Sci U S A. 97, 7266-7271 (2000).
  41. Shelby, R. D., Vafa, O., Sullivan, K. F. Assembly of CENP-A into centromeric chromatin requires a cooperative array of nucleosomal DNA contact sites. J Cell Biol. 136, 501-513 (1997).
  42. Majumder, S., Fisk, H. A. Quantitative immunofluorescence assay to measure the variation in protein levels at centrosomes. J Vis Exp. (2014).
  43. Masumoto, H., Masukata, H., Muro, Y., Nozaki, N., Okazaki, T. A human centromere antigen (CENP-B) interacts with a short specific sequence in alphoid DNA, a human centromeric satellite. J Cell Biol. 109, 1963-1973 (1989).
  44. Yoda, K., Kitagawa, K., Masumoto, H., Muro, Y., Okazaki, T. A human centromere protein, CENP-B, has a DNA binding domain containing four potential alpha helices at the NH2 terminus, which is separable from dimerizing activity. J Cell Biol. 119, 1413-1427 (1992).
  45. Sugata, N., et al. Human CENP-H multimers colocalize with CENP-A and CENP-C at active centromere--kinetochore complexes. Hum Mol Genet. 9, 2919-2926 (2000).
  46. Earnshaw, W. C., Ratrie, H. 3rd, Stetten, G. Visualization of centromere proteins CENP-B and CENP-C on a stable dicentric chromosome in cytological spreads. Chromosoma. 98, 1-12 (1989).
  47. Goshima, G., Kiyomitsu, T., Yoda, K., Yanagida, M. Human centromere chromatin protein hMis12, essential for equal segregation, is independent of CENP-A loading pathway. J Cell Biol. 160, 25-39 (2003).
  48. Liu, S. T., Rattner, J. B., Jablonski, S. A., Yen, T. J. Mapping the assembly pathways that specify formation of the trilaminar kinetochore plates in human cells. J Cell Biol. 175, 41-53 (2006).
  49. Gascoigne, K. E., Cheeseman, I. M. T time for point centromeres. Nat Cell Biol. 14, 559-561 (2012).
  50. Gascoigne, K. E., et al. Induced ectopic kinetochore assembly bypasses the requirement for CENP-A nucleosomes. Cell. 145, 410-422 (2011).
  51. Nishino, T., et al. CENP-T provides a structural platform for outer kinetochore assembly. EMBO J. 32, 424-436 (2013).
  52. Malvezzi, F., et al. A structural basis for kinetochore recruitment of the Ndc80 complex via two distinct centromere receptors. EMBO J. 32, 409-423 (2013).
  53. Schleiffer, A., et al. CENP-T proteins are conserved centromere receptors of the Ndc80 complex. Nat Cell Biol. 14, 604-613 (2012).
  54. Rago, F., Gascoigne, K. E., Cheeseman, I. M. Distinct organization and regulation of the outer kinetochore KMN network downstream of CENP-C and CENP-T. Curr Biol. 25, 671-677 (2015).
  55. Nishino, T., et al. CENP-T-W-S-X forms a unique centromeric chromatin structure with a histone-like fold. Cell. 148, 487-501 (2012).
  56. Bodor, D. L., et al. The quantitative architecture of centromeric chromatin. Elife. 3, e02137 (2014).
  57. Oliver, C. Ch 58. Molecular Biomethods Handbook. Rapely, R., Walker, J. M. Humana Press. 1063-1079 (2008).
  58. Terasima, T., Tolmach, L. J. Changes in x-ray sensitivity of HeLa cells during the division cycle. Nature. 190, 1210-1211 (1961).
  59. Levenson, G. B. R. Ch 8. Biomedical Photonics Handbook. Vo-Dinh, T. uan CRC Press LLC. 8-19 (2003).
  60. Sanderson, J. Fluorescence bleed-though. Available from: http://www.gum2012.fionastoreydesign.co.uk/Downloads/Bleed through text.pdf (2011).
Immunofluorescens Analys av endogena och exogena centromer-kinetochore proteiner
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Niikura, Y., Kitagawa, K. Immunofluorescence Analysis of Endogenous and Exogenous Centromere-kinetochore Proteins. J. Vis. Exp. (109), e53732, doi:10.3791/53732 (2016).More

Niikura, Y., Kitagawa, K. Immunofluorescence Analysis of Endogenous and Exogenous Centromere-kinetochore Proteins. J. Vis. Exp. (109), e53732, doi:10.3791/53732 (2016).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter