Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Endojen ve İmmünofloresan Analizi ve Eksojen Sentromer-kinetochore Proteinler

Published: March 3, 2016 doi: 10.3791/53732

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

"Sentromerler" Klasik genetikte bastırılmış mayoz rekombinasyon bölgeleri olarak tanımlanan ve daha sonra mitoz sırasında doğru kromozom ayrımı önemli bir rol oynar mitotik kromozom birincil daralma olarak kabul edildi. "Kinetokorlar" elektron mikroskobu ile ortaya koyduğu gibi, sentromerlerinin yüzeyinde mikrotübül bağlanan katmanlı yapılar olarak tarif edildi; "Kinetokorlar" sonra mitotik kromozom sentromer de lokalize makromoleküler kompleksi olarak tanımlandı. omurgalılar arasında sentromerik DNA dizilerinin dramatik farklılığa rağmen, kinetochore yapısı ve bileşimi yüksek oranda korumalıdır. iğ mikrotübüller ve kinetokor oluşumunu uyarır arasındaki dinamik etkileşim mitoz sırasında kromozomların sadık ayrımı için gerekli olan ve sentromer-kinetochore fonksiyonu kurşun kusurları anöploidi ve böylece kanser olduğunu.

En ökaryotlarda sentromerResim tanımlanan DNA sekansına sahiptir, ancak 171-bp α-uydu DNA'dan oluşan tekrarlanan alphoid DNA'nın büyük diziler (0,3-5 Mb) oluşmaktadır. Maya tomurcuklanma dışında, sentromer kimliği olmayan DNA dizisi tarafından değil histon H3 varyantı CenH3 içeren özel bir nükleozom varlığı ile elde edilir (sentromer protein A [CENP-A] insanlarda). 5 CENP-A nükleozom lokalize 171-bp α-uydu DNA memeli kinetokorlar 7 ve bağlama iç plakası. Aktif sentromerler gerektiren CENP-A içeren bir araya mili kontrol noktasından mitotik iğ ve sonraki devir ilerlemesine kromozomların eki düzenleyen, bir kurucu sentromer ilişkili ağ (KİAN) ve kinetochore proteinlerin işe yönlendirmek için nükleozom.

Yukarıdaki deliller ışığında, CENP-A sentromer 8 epigenetik işareti olduğu ileri sürülmüştür; Bununla beraber, işlem hangi CENP-A i zikredilennBu sentromerik DNA, ve dahil edilmek için sorumlu olan faktörler henüz iyi karakterize edilmemiştir. Kısa bir sentromer hedefleme alanı (CATD) CENP-A bölgesini kat histon bulunur ve CATD ile H3 karşılık gelen bölgenin yerine sentromer doğrudan H3 için yeterlidir. 9 Çeşitli çalışmalarda post-translasyonel fonksiyonel rolleri önerilen modifikasyonu CENP-A 12-16 (PTM); Ancak, sentromer için istihdamında CENP-A bu PTMS moleküler mekanizmalar henüz ortaya konamamıştır. Daha önce CUL4A-RBX1-COPS8 E3 ligaz aktivitesi sentromer için CENP-A CENP-A K124 ubiquitylation ve lokalizasyonu için gerekli olduğu bildirilmektedir. 17

Kinetochore proteinlerin keşfi ve karakterize kromozom segregasyonu ile ilgili yeni bir bakış açısı yol açmıştır. 18 en fazla 100 kinetochore bileşenleri çeşitli yaklaşımlarla omurgalı hücreler tespit edilmiştir. 19,20 Altındafloresan mikroskopi kinetokorlar montaj ve işlevi de hücrelerin içinde her sentromer kinetochore proteinler ve protein-protein ağının hücresel fonksiyonları karakterizasyonu geliyor nasıl ayakta. 19 Doğrudan görselleştirme ve gelişmiş görüntüleme yöntemleri sentromer kinetochore bileşenlerin olağanüstü çözünürlük sağlar ve izin sentromerler ve kinetokorlar spesifik moleküler bileşenleri doğrudan gözlem. Buna ek olarak, özel antikorlar kullanılarak dolaylı immünofluoresan Yöntemi (IIF) boyama Bu gözlemler için çok önemlidir. Bununla birlikte, belirli bir sentromer kinetochore proteinlerin ayrıntılı problemlerinde tartışıldığı IIF protokolleri, birkaç ilgili olarak çok çeşitli raporlara rağmen. 1-4 Böylece geliştirilmesi ve spesifik olarak her bir sentromer kinetochore protein analiz IIF boyama ve kantitatif IIF tahlili yöntemleri rapor son derece önemlidir. IIF boyama, tek ilgilenilen proteinin kaybını önlemek için boyama protokolü ile devam etmelidir veyaHücrenin geri kalanı. Bununla birlikte, sabitleme zaman antigenik mahalleri yok eder ve farklı bir antikor-antijen kombinasyonları, bir fiksatif, yeterli çalışır, ancak çok iyi başka, 21 ve sabitleyici seçimi büyük ölçüde ilgi protein (ler) bağlıdır. Bu nedenle, farklı sabitleyici yöntemleri sentromer kinetochore proteinlerin IIF boyama önem taşımaktadır.

Dolaylı immunofloresans (IIF) boyama ve CENP-A ve Flag-künyeli eksojen CENP-A proteinleri ve insan hücrelerinde bu proteinlerin kantitatif dahil endojen sentromer kinetochore proteinlerin lokalizasyonunu gidermek için bir tahlilin Burada optimize yöntemler geliştirilmiştir. Bu yöntemler, diğer türlerde sentromer kinetochore proteinlerin analizi uygulanabilir.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Hücre Kültürü ve transfeksiyonu

  1. 6 oyuklu polistiren plaka bir cam kapak (22 mm x 22 mm) koyun. İsteğe bağlı olarak kat Aşağıdaki adımları uygulayarak kapak camına mitotik hücrelerin tutmak için (Malzeme / Ekipman Listesi bakınız) suda Poli-L-Lizin ile cam kapak, w / v% 0.1,:
    Not: Optimal koşullar her bir hücre hattı ve bir uygulama için belirlenmelidir.
    1. su içinde Poli-L-lisin, ağ / hac% 0.1 ile aseptik kat kultur yüzeyi (0.4 mi / oyuk, 6 oyuklu polistiren plaka) eritin. Kültür yüzey da kaplama sağlamak için hafifçe sallayın.
    2. 5 dakika sonra, aspirasyon ile çözüm kaldırmak ve iyice steril doku kültürü dereceli su ile yüzeyin durulanması.
    3. hücreleri ve orta tanıtan önce kuru en az 2 saat.
  2. Tohum HeLa hücreleri 17 veya 6 oyuklu polistiren plaka konan bir kapak camı (22 mm x 22 mm) üzerinde 17,22 HeLa Tet-hücrelerini. Bu hücre yoğunluğu oyuk başına 5.4 x 10 5 olup olmadığını kontrol edin. Kültür hücreleri% 10 FBS ve% 1 penisilin-streptomisin ile yüksek glukoz DMEM.
    Not: En iyi sonuçlar için, ampirik tohumlama kullanmak için hücre yoğunluğu belirlemek.
  3. 18 saat% 5 CO2 atmosferinde 37 ° C'de inkübe hücreleri.
    Not: HeLa Tet-hücrelerini söz konusu olduğunda, dışsal genin transkripsiyon indükleyici (örneğin, tetrasiklin / doksisiklin) tetrasiklin / doksisiklin olmayan bu nedenle kültür hücreleri yokluğunda aktif ve pTRM4 aşın vektörü (Tablo 2 ile geçici olarak transfekte ) olan transkripsiyon TRE promotör tarafından regüle edilir (aşağıya bakın).
  4. tohumlama, transfect hücre sonra onsekiz saat şöyle:
    1. (20 uM tavlı stok, Tablo 1) 1.5 ul siRNA oligo karıştırarak çözüm A yapın ve / veya 2.0 ug plazmid (Tablo 2) 50 ul azaltılmış serum ortamında (Malzeme / Ekipman Listesi bakınız), ve 5 dakika boyunca oda sıcaklığında inkübe .
      Not: Bu analizde,CA-UTR siRNA'lar (a 5 kanşımı 've 3' UTR, siRNA, Tablo 1) ko-transfekte Protocols 3 ve 4 (tartışma) kullanılmak üzere idi.
    2. Ben serum orta azaltılmış 50 ul (Malzeme / Ekipman Listesi bakınız), ve 5 dakika boyunca oda sıcaklığında inkübe 0.75 ul transfeksiyon reaktifi karıştırarak çözüm B olun.
      Not: İsteğe bağlı bir adım transfeksiyon reaktif II ul 1.0 eklenmesidir (Malzeme / Ekipman Listesi bakınız).
    3. birlikte çözüm A ve B karıştırın ve 15 dakika boyunca oda sıcaklığında inkübe edilir.
    4. Bir kez PBS ile kültürlenmiş hücreler yıkanır, ve daha sonra 6-çukurlu polistiren plakanın her bir serum ortamı, indirgenmiş 500 ul ekle. Şirketinden de bireyin her çözeltiler A ve B (örneğin, RNA ve / veya DNA-lipit kompleksi) karışımı ekleyin.
      Not: Nihai konsantrasyon 3.3 ug / ml (plazma) olduğu; 50 nM (siRNA).
    5. 4.5 saat boyunca% 5 CO2 atmosferinde 37 ° C'de inkübe hücreleri. yüksek glikoz DMEM zekâ orta değiştirmekH,% 10 FBS ve% 1 penisilin-streptomisin.
    6. Transfeksiyondan sonra 48-72 saat boyunca% 5 CO2 atmosferinde 37 ° C'de inkübe hücreleri.
      Not: En iyi sonuçlar için, tespitten önce, hücre büyümesi için kuluçka süresi deneysel olarak tespit edilmelidir, ve protein azalması ve / veya ekspresyon Western blot analizi ile teyit edilmesi gereklidir (Protokol 6).
    7. mitotik hücre analizi ilgi konusu ise, tespitten önce kültürlenmiş hücreler 24 saat paklitaksel (10 nM) ilave, ya tespitten önce kültürlenmiş hücreler 2.5 saat için TN16 (0.5 uM) ekleyin.

2. Hücre Sabitleme ve Immunofluorescent Boyama Endojen Sentromer-kinetochore Proteinler Algılama için (Paraformaldehyde Fixation)

  1. sabitleyici, tampon, ve reaktiflerin hazırlanması.
    1. Taze PBS, pH 7.4 içinde% 4 paraformaldehit çözeltisi 50 ml hazırlar.
      1. Havalandırılan kaputu bir karıştırma plakası üzerinde cam bir behere 1 x PBS, 40 ml ilave edilir. Isıtma sırasında stirrinyaklaşık olarak 60 ° C'ye kadar örn. ısıtılmış PBS paraformaldehid toz 2 g ekleyin.
      2. Toz hemen çözülür çünkü, toplam 1 N NaOH, 1 ml ilave edilerek yavaş yavaş pH değerini yükseltmek.
        Not: Çözelti NaOH ilave edildikten sonra temizler.
      3. paraformaldehit, serin çözülür ve çözüm filtre edildikten sonra.
      4. pH 7,4-1 N HCI ile pH ve 50 ml 1 x PBS ile çözeltinin hacmini ayarlar.
        Not: çözelti Alikolar dondurulmuş veya en fazla 1 ile bir hafta 2-8 ° C'de muhafaza edilebilir. Bu kullanılacak kadar çözelti, buzla soğutulmuş ve 4 ° C de muhafaza edilmelidir.
    2. 10 mM Tris-HCI, pH 7.5 içerir tampon KB1, 50 ml hazırlamak; 150 mM NaCI; % 0.5 BSA; ve% 0.5 Triton X-100.
      Not: BSA, taze ilave edilmelidir.
      Not: tampon KB serisi daha önceki raporlarda açıklanan tampon KB dayanmaktadır 1,2,4.
    3. 10 mM Tris-HCl tampon maddesi oluşur KB2, 50 ml hazırlamakpH 7.5; 150 mM NaCI; ve% 0.5 BSA.
      Not: BSA, taze ilave edilmelidir.
    4. DAPI (50 ng / ml) ihtiva eden tampon maddesi KB3 1 ml hazırlayın.
    5. 1 mg / ml p-fenilendiamin oluşan montaj orta, 100 ml hazırlamak; % 10 PBS ve% 90 gliserol.
      1. 1 N NaOH ile 9.8 1 x PBS, pH ayarlama çözeltisi içinde p-fenilendiamin çözülür, sonra gliserol ekleyin.
      2. Mağaza -80 ° C'de 1 ml'lik eş payları,. Işıktan koruyunuz.
  2. Hücre fiksasyonu için 48-72 saat sonrası transfeksiyon (Protokol 1 bakınız) aspirasyonu ile kültür ortamı çıkarın. bir kez PBS ile durulayın hücreleri. hücre yüzeyi rahatsız etmemek için kültür kuyularının tarafına PBS uygulanır.
    Not: Hücre tespit için en uygun zaman noktası deneysel olarak tespit edilmelidir.
  3. 4 ° C'de 30 dakika boyunca PBS içinde% 4 paraformaldehid içinde hücreleri saptamak. yeterince kalan% 4 paraformaldehid kaldırmak için tampon KB2 ile iki kez hücreleri durulayın.
  4. permeabiOda sıcaklığında 30 dakika süre ile tampon KB1 örnekleri lize. Tampon KB2 bir kez hücreler durulanır, ve belirli olmayan bağlanma ek blok sitelerine oda sıcaklığında 5 dakika boyunca bir tampon KB2 ekleyin.
    Not: Tampon KB1 da engelleme önemli katkılarda bulunur.
  5. forseps kullanılarak 6 oyuklu polistiren plaka bir cam kapak (22 mm x 22 mm) çıkarın. hidrofobik bir bariyer kalem kullanarak her cam kapak numune etrafında hidrofobik bir bariyer oluşturmak üzere bir soluk yeşil kare ya da daire çizin, (Malzeme / Ekipman Listesi bakınız). dokunmayın ya da etmeyin hidrofobik bariyer kalem ile hücrelere çok yakın olsun. Yeni 6-iyi polistiren plaka kapak cam koyun.
  6. (; Ayrıca Malzemeleri / Ekipman Listesi bkz 200: 100 1 1 seyreltme oranı) ve bir anti-CENP-B antikoru (1 seyreltme oranını: 400) ya da bir anti- birincil sentromer için antikor veya kinetochore proteini seyreltin sentromer antikor (AKA) (1 seyreltme oranı: 2.000) tamponu KB2 bir sentromer konum işaretleyici olarak.
    Not: En iyi sonuçlar için, nihai konsantrasyonBu çözelti içinde birincil antikor tion deneysel olarak tespit edilmelidir.
  7. Hücre örneği sokmak için seyreltilmiş primer antikor yeterli hacmi (yaklaşık 30 ul) uygulayın. 37 ° C 'de 1 saat süre ile hücre örneği inkübe edin. hücreleri tampon KB2 ile 3 kez durulayın.
  8. Her primer antikor karşı tamponu KB2 kullanarak, bir flüorofor-konjuge sekonder antikor (200: 100: 1 ile 1 seyreltme oranı) seyreltin.
    Not: En iyi sonuçlar için, bu çözelti içinde sekonder antikor nihai konsantrasyon ampirik olarak tespit edilmelidir.
  9. Yeterli bir hacim hücre örneği sokmak için seyreltilmiş ikincil antikor (kapak camına yaklaşık 30 ul bir damla) uygulayın. 37 ° C 'de 1 saat süre ile hücre örneği inkübe edin. 30 dakika (beş 6 dakika yıkama) bir süre boyunca hücreleri ara KB2 ile 5 kez yıkayın.
    Not: (hücrelerin minimum kayıp için yani) En iyi sonuçlar için, optimum yıkama koşulu Empirica tespit edilmelidirLly.
  10. hücre örneği sokmak için DAPI (50 ng / ml) ihtiva eden tampon maddesi KB3 yeterli bir hacmi uygulanır. Oda sıcaklığında 5 dakika boyunca hücre örneği inkübe edin. hücreleri tampon KB2 ile 1-2 kez durulayın.
  11. Mikro slayt üzerine hücre örneği içeren cam kapak monte edin.
    1. Mikro slayt merkezinde montaj orta bir damla yerleştirin.
    2. hücre örneği sıvıyı çıkarın ve ellerini veya forseps kullanarak, mikro slayt merkezinde örnek yerleştirin. hava kabarcıkları kaçının.
    3. Bir kağıt havlu ile fazla montaj orta çıkarın.

3. Hücre C-terminali Fiksasyon ve Immunofluorescent Boyama Bayrak-etiketli CENP-A Proteinler (Aseton Fixation)

  1. Hazırlık
    1. buz soğukluğunda% 75 aseton hazırlayın.
    2. Taze% 0.5 kaymağı alınmış süt ve% 0.5 BSA içeren PBS (pH 7.4), 50 ml hazırlar.
    3. Taze% 0.1 kaymağı alınmış süt ve% 0.1 BSA içeren PBS (pH 7.4), 50 ml hazırlar.
    4. (PBS 1 ml hazırlayınpH 7,4) DAPI (50-100 ng / ml) ihtiva etmektedir.
    5. 2.1.5 tarif edildiği gibi montaj orta 100 ml hazırlayın.
  2. Hücre fiksasyonu için 48-72 saat sonrası transfeksiyon (Protokol 1 bakınız) aspirasyonu ile kültür ortamı çıkarın. bir kez PBS ile durulayın hücreleri. hücre yüzeyi rahatsız etmemek için kültür oyuğundaki tarafına PBS uygulanır.
    Not: Hücre tespit için en uygun zaman noktası deneysel olarak tespit edilmelidir.
  3. buz soğukluğunda% 75 aseton hücreleri saptamak, ve -20 ° C'de 10 dakika boyunca hücreler inkübe edin. Oda sıcaklığında, 30-60 dakika boyunca, bir çeker ocak içinde cam kapak üzerinde kurutuldu hücreleri.
    Not: En iyi sonuçlar için, sabitleme ve hücre kurutma için gereken süre deneysel olarak tespit edilmelidir.
  4. hidrofobik bariyer kalem kullanarak her cam kapak numune etrafında hidrofobik bir bariyer oluşturmak üzere bir soluk yeşil kare ya da daire çizin, (Malzeme / Ekipman Listesi bakınız). dokunmayın ya da etmeyin hidrofobik bariyer kalem ile hücrelere çok yakın olsun.
  5. blok nonspecIFIC PBS oda sıcaklığında 5 dakika için% 0.5 kaymağı alınmış süt ve% 0.5 BSA ihtiva eden eklenerek hücreler üzerindeki bağlanma sahaları.
  6. (: 1000 seyreltme oranı 1) ve bir anti-CENP-B antikoru (1 seyreltme oranı: 200) ya da ACA (1: 2000 seyreltme oranı PBS% 0.1 kaymağı alınmış süt ve% 0.1 BSA ihtiva eden kullanılarak, bir anti-Bayrak antikor seyreltik ) bir sentromer konum işaretleyici olarak.
    Not: En iyi sonuçlar için, bu çözelti içinde birincil antikor nihai konsantrasyon ampirik olarak tespit edilmelidir.
  7. Hücre örneği sokmak için seyreltilmiş primer antikor yeterli hacmi (yaklaşık 30 ul) uygulayın. 37 ° C 'de 1 saat süre ile hücre örneği inkübe edin. 30 dakikalık bir süre içinde hücreler bloke edici tampon ile 5 kez yıkayın.
    Not: Hücreler PBS ile durulanır. En iyi sonuçlar (yani, hücre kaybını önlemek için) için, en iyi yıkama koşulları deneysel olarak tespit edilmelidir.
  8. yönelik bir florofor-konjuge sekonder antikor (200: 100: 1 ile 1 seyreltme oranı) seyreltinPBS,% 0.1 kaymağı alınmış süt ve% 0.1 BSA ihtiva eden ki her birincil antikor.
    Not: En iyi sonuçlar için, bu çözelti içinde sekonder antikor nihai konsantrasyon ampirik olarak tespit edilmelidir.
  9. Hücre örneği sokmak için seyreltilmiş ikincil antikor yeterli hacmi (yaklaşık 30 ul) uygulayın. 37 ° C 'de 1 saat süre ile hücre örneği inkübe edin. PBS,% 0.1 kaymağı alınmış süt ve% 0.1 BSA içeren hücreler 2 defa yıkayın.
    Tek başına PBS ayrıca hücreleri yıkamak için kullanılabilir: edin.
  10. hücre örneği sokmak için DAPI (50-100 ng / ml) içeren PBS yeterli bir hacmi uygulanır. Oda sıcaklığında 5 dakika boyunca hücre örneği inkübe edin. PBS ile hücreleri 1-2 kez durulayın.
  11. 2.11 açıklandığı gibi mikro slayt üzerine hücre örneği içeren cam kapak monte edin.

4. Hücre N-terminal Fiksasyon ve immünofloresan boyama Flag-işaretli CENP-protein (Methanol eşdeğer)

  1. Hazırlık
    1. buz soğukluğunda metanol hazırlayın.
    2. TBS% 4 keçi serumu ihtiva eden (pH 7.4) hazırlayın.
    3. TBS DAPI (50-100 ng / ml) ihtiva eden (pH 7.4) 1 ml hazırlayın.
    4. 2.1.5 tarif edildiği gibi montaj orta 100 ml hazırlayın.
  2. Hücre fiksasyonu için 48-72 saat sonrası transfeksiyon (Protokol 1 bakınız) aspirasyonu ile kültür ortamı çıkarın. bir zamanlar TBS ile durulayın hücreleri. hücrelerin yüzeyine rahatsız etmemek için kültür kuyu tarafına TBS uygulayın.
    Not: Hücre tespit için en uygun zaman noktası deneysel olarak tespit edilmelidir.
  3. buz soğukluğunda metanol hücreleri saptamak, ve -20 ° C'de 6 dakika inkübe hücreleri. yeterli artık metanolün çıkması için TBS ile iki kez hücreleri durulayın.
  4. hidrofobik bir bariyer kalem kullanarak her cam kapak numune etrafında hidrofobik bir bariyer oluşturmak için bir soluk yeşil kare ya da daire çizin, (Malzeme / Ekipman Listesi bakınız). dokunmayın ya da etmeyin hidrofobik bariyer kalem ile hücrelere çok yakın olsun.
  5. cel üzerinde spesifik olmayan bağlanma siteleri engellemek% 4 keçi serumu içeren ekleyerek TBS tarafından ls. Oda sıcaklığında 10 dakika boyunca inkübe edin.
  6. (: 1000 sulandırma 1) ve bir anti-CENP-B antikoru (seyreltme oranı 1: 200) ya da:% 4 keçi serumu ihtiva eden TBS içinde bir sentromer Yer belirleyici olarak (2.000 seyreltme oranı 1) veya ACA, bir anti-Bayrak antikor seyreltilir .
    Not: En iyi sonuçlar için, bu çözelti içinde birincil antikor nihai konsantrasyon ampirik olarak tespit edilmelidir.
  7. Hücre örneği sokmak için seyreltilmiş primer antikor yeterli hacmi (yaklaşık 30 ul) uygulayın. 37 ° C 'de 1 saat süre ile hücre örneği inkübe edin. 30 dakikalık bir süre içinde hücreler bloke edici tampon ile 5 kez yıkayın. En iyi sonuçlar (hücrelerin, yani çok az zarar), en iyi yıkama durumu deneysel olarak tespit edilmelidir.
  8. % 4 keçi serumu ihtiva eden TBS içinde her bir birincil antikor karşı bir flüorofor-konjuge sekonder antikor (200: 100: 1 ile 1 seyreltme oranı) seyreltin.
    Not: En iyi sonuçlar için, finaBu çözelti içinde, ikincil antikorun L konsantrasyon ampirik olarak belirlenmelidir.
  9. Hücre örneği sokmak için seyreltilmiş ikincil antikor yeterli hacmi (yaklaşık 30 ul) uygulayın. 37 ° C 'de 1 saat süre ile hücre örneği inkübe edin. engelleme tampon ile hücreleri 3 kez durulayın.
  10. hücre örneği batırmak için DAPI (50-100 ng / ml) içeren TBS yeterli hacim uygulayın. Oda sıcaklığında 5 dakika boyunca hücre örneği inkübe edin. TBS ile hücreleri 1-2 kez durulayın.
  11. 2.11 açıklandığı gibi mikro slayt üzerine hücre örneği içeren cam kapak monte edin.

5. İmmünofloresan Görüntü Gözlem, Acquisition, miktar tayini ve Analiz

  1. Bir 63X ve 100X yağ daldırma objektif, harici kompakt ışık kaynağı ve bir dijital CCD kamera ile donatılmış bir motorlu floresan mikroskop aracılığıyla hücre örneği gözlemleyin.
  2. Yazılımı kullanarak, deconvolution dahil görüntü elde etme ve işleme, gerçekleştirmeA veya Yazılımları B1 ve B2 (Malzeme / Ekipman Listesi bakınız). Program B1 ve B2 kullanılan tüm komutlar için Yazılım A'da kullanılan tüm komutlar için ek kod dosyaları (5.2.1) bakın, Yan Kodu Files (5.2.2) bakın.
  3. Sentromer kinetochore proteinlerin sinyal ölçmek için daha önce tarif edilen yöntem, 23-25 ​​kullanarak (örneğin, sentromer de CENP-A sinyallerini geri kalan) Aşağıdaki küçük değişikliklerle:
    1. Seç sentromer-kinetochore proteinlerin alanı ve arka plan olduğunu şöyle:
      1. Mitotik hücre: (sentromer kinetochore bölge) DAPI ile boyanmış kromozom ile örtüşen seç alanı; (yani, sitozolik bölge) kromozom dışında ancak aynı tek hücrenin içinde (arka plan bölge) ve alan.
      2. Interfaz hücre: (sentromer kinetochore bölge) DAPI ile boyanmış kromatinli örtüşen seç alanı; (Kromatin dışında ancak aynı tek hücrenin içinde (arka plan bölge) ve alan <em> yani sitozolik bölge).
        Not: Sırasıyla, Yazılım A veya Yazılım B2 alan seçimi için de yazmak Kod Files (5.2.1.4.3) ya da (5.2.2.6.4) Bkz.
    2. aşağıdaki formülü kullanın, bu görev için Yazılım A veya B kullanarak sentromer kalan sinyallerin yüzdesini ölçmek:
      sentromer kinetokor oluşumunu uyarır de sentromer-kinetochore protein sinyalleri Kalan
      Equation1
      b Arka sinyal parlaklık olduğu; s ACA veya CENP-B boyama ile teyit edilir seçilen alanın, sinyal parlaklığı nerede r örnek siRNA (ler) enjekte hücreler için referans ACA veya CENP-B sinyalleri; ve r ctrl Luc siRNA transfekte hücreler için referans ACA veya CENP-B sinyalleri.
      Not: daha önceki raporlarda açıklandığı gibi, bu analizde, CENP-B sinyalleri CUL4A referans sinyalleri kullanılır ve RBX1 edildi.
    3. kopyaladıktan sonra bu hesaplama için bir Excel dosyası kullanın ve yukarıda açıklanan sinyal kantitatif yazılımı ham veri yapıştırarak. Ayrıca Yan Kod Dosyaları görün: Ayrıntılar için (5.2.1.4) ve (5.2.2.6). Hesaplama bir örneği, Tablo 3 'de gösterilmiştir.
  4. Her bir ölçüm düzeyi için boyama ve görüntü alımı varyasyonu ortadan kaldırmak için en az 20 hücreleri analiz edin. Her hücre analiz için isteğe bağlı olarak farklı sentromer-kinetochore proteinler arasında bu değerleri karşılaştırmak için sentromer kinetochore sinyalleri kalan "ortalama değeri" kullanın.

Toplam proteinin 6 Western Blot Analizi

  1. Tampon A denatüre hücrelerin tekrar (20 mM Tris-HCl, pH 7.4, 50 mM NaCI,% 0.5 Nonidet P-40,% 0.5 deoksikolat,% 0.5 SDS, 1 mM EDTA, ve tam EDTA'sız proteaz inhibitör kokteyli), 26 denek bir sonikasyon ve donma-çözülme süreci ve tedbire süspansiyonProtein konsantrasyonları şunlardır:
    1. sonikasyon işlemi için, 48-72 saat sonra, transfeksiyon ucunda bir 6-yuvalı polistiren plakanın iki kuyu toplanan hücreler tampon A 50 ul (Protokol 1 e bakınız). Topu boynuzu ve mikro uç ile donatılmış bir sonikatör İşlet bir örnek başına toplam 15 saniye aralıklı darbe süresi (görev döngüsü% 50) için (Malzeme / Ekipman Listesi bakınız).
    2. dondurma-çözme işlemi için sıvı nitrojen ile dondurularak hücreleri ve oda sıcaklığında hücreleri eritin.
    3. ticari bir protein tahlil belirteci I veya II kullanarak protein konsantrasyonları ölçün (Malzeme / Ekipman Listesi bakınız).
      Not: Lizatlar reaktif I ya da II ya da protein konsantrasyonları ölçümünde 1:10 oranında seyreltilir. Bu seyreltmede, tampon A içinde SDS bulunan bu ölçüm çok az veya hiç etkileşim gösterir.
  2. 2 x ya da 4 x SDS-PAGE yükleme tamponu ile toplam proteinin 20-30 ug ihtiva lizat karıştırın. 27 kaynatın numuneleri5 dakika ve daha sonra elektroforez için SDS-poliakrilamid jel denatüre edici bir% 12.0 -15.0% üzerine yerleştirin.
  3. Daha önce tarif edilen bir Western lekeleme yöntemi kullanılarak bir PVDF zarı üzerine, SDS-PAGE ile ayrılmış proteinler aktarın. 17,24,27-31
    1. 1 x PBS içinde% 5 yağsız süt ile zar üzerinde spesifik olmayan bağlanma yerlerini bloke ve daha sonra oda sıcaklığında 1 saat süre ile seyreltilmiş birincil antikor çözeltileri ile membran inkübe edin. Her birincil antikor ayrıntılı bilgiler (örneğin, seyreltme oranı) malzemeler / Ekipman Listesi bölümüne bakınız.
    2. PBS-T tampon maddesi ile (çalkalama, her 3 ila 5 dakika inkübasyon) membran 3-4 kez yıkandıktan sonra (1 x PBS ve% 0.1 Tween-20), yakın kızıl ötesi (IR) bir karışımı içinde membran inkübe fluoresan boya-konjüge edilmiş ikincil antikor (1 seyreltme oranı: 20,000), DyLight-konjuge sekonder antikor (1 seyreltme oranı: 20,000), ve / veya yaban turpu peroksidaz (HRP) PBS-T içinde seyreltilmiş sekonder antikor (konjüge edilmiş; dilutiOda sıcaklığında 1 saat için 10,000): 1 oranı. Her ikincil antikor ayrıntılı bilgiler (örneğin, seyreltme oranı) malzemeler / Ekipman Listesi bölümüne bakınız.
  4. membranı 3 kez yıkayın ve sonra kızılötesi görüntüleme sistemi ve / veya immunoblot tespiti için kemilüminesans görüntüleme cihazı ile proteinlerin analiz etmek membran tarama (Malzeme / Ekipman Listesi bakınız).
    1. kızılötesi görüntüleme sistemi kullanmak için, Ek Kod Files (6.4.1) bkz.
    2. Kemiluminesan görüntüleyici kullanmak için, Ek Kod Files (6.4.2) bkz. ultra-hassas geliştirilmiş kemiluminesans (ECL) substratı kullanın bu sistem için (Malzeme / Ekipman Listesi bakınız).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Endojen CENP-A immünofloresans analizi CUL4A-E3 ligaz sentromer için CENP-A lokalizasyonu için gerekli olduğu hipotezini desteklemektedir
Son çalışmalar, CUL4A-RBX1-COPS8 E3 ligaz aktivitesi CENP-A ve sentromer için CENP-A lokalizasyonuna lisin 124 (K124) arasında ubiquitylation için gerekli olduğunu gösterdi. 17 Başlangıçta, interfaz-sentromer kompleksi (içen) ile izole edilmiştir Anti-CENP-a: kromatin immünopresipitasyon, 32-34 ve içen proteinlerin bazıları sentromer için CENP-A lokalize bir rol oynayabileceği ileri sürülmüştür. Bu nedenle, siRNA demonte deneyleri yokluğu, ifade sentromer 17'de CENP-A delokalizasyonu kaynaklı proteinlerin taranması için yapıldı (veriler gösterilmemiştir) zaman uyumsuz büyüyen HeLa hücreleri kez Cullin 4a (CUL4A) siRNA veya RBX1 siRNA ile transfekte edildi (en iyi protein kısıtlamasının 48 saat gereklidirCUL4A için R ve RBX1 72 saat). CUL4A siRNA ile transfekte edilmiş hücreler sentromer de CENP-A önemli bir delokalizasyonu (Şekil 1A-C) göstermiştir. Şekil 2G'de görüleceği üzere, CUL4A siRNA transfekte edilmiş hücrelerin toplam hücre lizatlan içinde CENP-A protein seviyeleri, aynı kültür koşulları altında (Luc) siRNA transfekte edilmiş hücreler lusiferaz gelen lizatlarda CENP-A seviyelere benzerdir. CUL4A siRNA 3 'UTR (Şekil 2A-C) hedef alan CUL4A-Bayrağın ektopik ifade sentromer de CENP-A azalma kurtarıldı çünkü CUL4A siRNA off-hedef etkilerin ortaya çıkma olasılığı, dışlandı. Toplam hücre lizatlan içinde CENP-A protein seviyesi ne olursa olsun, hücre döngüsü aşaması (Şekil 1B, 2 g), aynı kültür koşulları altında Luc siRNA transfekte edilmiş hücrelerin lizatları içinde CENP-A seviyelerine benzer olduğu teyit edilmiştir; böylece, CUL4A tükenmesi neden olasılığı olduğu CENP-A protein yıkımı ortadan kaldırılmıştır.

35 ligaz ve 3 ana unsurları içerir: bir cullin iskele, bir HALKA parmak proteini (RBX1 veya RBX2) ve RBX1 veya RBX2 tarafından işe bir ubikuitin-ücret E2 enzim, 36 A HALKA parmak proteini de ubikuitin transferini kolaylaştırmak için E2 enzime yakınlığı substratları yerleştiren bir substrat adaptörü acemi. 36 RBX1 siRNA'lar önemli bir azalmaya neden RBX1 siRNA transfekte edilmiş hücrelerin toplam hücre lizatlan içinde CENP-A protein seviyesi Luc siRNA transfekte edilmiş hücrelerin lizatları içinde CENP-A seviyelere benzer koşullar altında sentromer (Şekil 1D-F) CENP-A (Şekil 2G). RBX1 azalması ile ya da aynı kültür koşulları altında CUL4A kombinasyonunun RBX1 azalması yoluyla CENP-bir proteinin bozulması (Şekil 2G) gözlenmemiştir. hedef dışı etki olasılığıRBX1 siRNA 3 'UTR (Şekil 2B-F) hedef alan Bayrak-RBX1 ektopik ifade sentromer de CENP-A azalma kurtarıldı çünkü RBX1 siRNA s çıkarılmıştır. Bu bulgular CUL4A-RBX1-E3 ligaz özellikle sentromer için CENP-A lokalizasyonu için gerekli olduğunu göstermiştir.

Eksojen CENP-A immünofloresans analizi - Bayrak proteinleri CENP-A K124 ubiquitylation sentromer için CENP-A lokalizasyonu için gerekli olduğunu göstermektedir
Daha önce, immüno-kütle spektrometrisi analizi, lisin 124 CENP-A-Bayrak (K124) HeLa hücrelerinde ubiquitylated olduğunu göstermiştir. 17 CENP-nükleozom kristal yapıda edilir olsa da, K124, α3 sarmal bulunur olup CATD bölge içinde. 17 ek olarak, K124, memelilere, kuşlara, kertenkele, bitkiler ve fungus bir grup (örneğin, tomurcuk arasında muhafaza edilirDing maya). 17 CENP-A lisin mutantlar (Şekil 3A) inşa edilmiş ve sentromer lokalize kabiliyetlerini test edildi. Mitotik ve interfaz hem HeLa hücrelerinde yaygın sinyaller ile eksojen CENP-A K124R mutant sentromer lokalizasyonu önemli iptal (Şekil 3B, C) ​​gözlenmiştir. Sentromer yerelleştirme anlamlı ne K9A mutasyonlarla (K77 CATD benzersiz bir lizin site) (Şekil 3B, C) ​​ne K77R mutasyonu (K9 H3 K9 metilasyonu sübstrat olarak histon karşılık gelir) etkilenmedi.

Bu sonuçlara göre, iki hipotez K124 de CENP-A ubiquitylation in vivo tesiri ile ilgili teklif edilmiştir. İlk olarak, K124 ubiquitylation rolü ökromatin için ifade edilmiş ve / veya mislocalized CENP-A ortadan kaldırmak için ubikuitin-aracılı proteolizi içindir. İkinci olarak, K124 ile CENP-A ubiquitylation rolü sentromer üzerine CENP-yükleme içindir. f sınamak içinIRST olasılık, CENP-A-Bayrak vahşi tip ve sikloheksimid (CHX) sonra K124R mutant yanı sıra endojen CENP-A tedavisi CUL4A- veya RBX1 tükenmiş hücreleri kararlılıkları ele alındı. Bu veriler (veriler gösterilmemiştir). 17 K124 ve ubiquitylation muhtemelen ifade edilmiş ve / veya mislocalized CENP-A ortadan kaldırmak için ubikuitin-aracılı proteolizi yer tutulmaması. Ayrıca, K124R mutasyonu in vivo ve in vitro deneylerde ubiquitylation hem de olası monoubiquitylation ve diubiquitylation bantları ortadan kaldırır teyit edilmiştir (veriler gösterilmemiştir). 17, bu veriler CUL4A-RBX1 karmaşık "sinyal" ubiquitylation katkıda bulunduğunu göstermektedir, hangi sentromer de CENP-A lokalizasyonu için gereklidir.

Eksojen Bayrak immünofloresan analizi - CENP-A proteinleri monoubiquitin füzyon yüklemek için yeterli olduğunu göstermektedirsentromer de CENP-A K124R
Yukarıdaki sonuçlara dayanarak, bu şekilde bağlanmış olan monoubiquitin sentromer üzerine CENP-A yükleme için bir sinyal olarak hizmet ettiği varsayılmıştır. Bu hipotezi, bir N-terminali Flag-künyeli C-terminali ubikuitin-kaynaşık vahşi tip CENP-A ve CENP-A inşa edilmiş bir K124R mutant (Şekil 4A) test etmek için. Polyubiquitylation 37-39 için önemli bir bölgesini gerektiren monoubiquitin mutantı Ub (K48R), aynı zamanda, potansiyel polyubiquitylation gelen ubikitin kaynaşık CENP-A proteini önlemek için kullanılmıştır. anti-Flag immünofloresan sinyalleri ele olarak, bu yapılar tarafından kodlanan proteinlerin sentromerik yeri test edilmiştir. Flag-CENP-A (K124) CENP-A büyük ölçüde iptal sentromer lokalizasyonu ise (Şekil 4B ve 4C, kolon [6]), Flag-CENP-A (WT) ve Flag-CENP-A hem de (WT) -Ub ( WT) kendi sentromer lokalizasyonu (Şekil 4B ve 4C muhafaza sütun [1] ve [2]).Bu protein, esas sentromer lokalizasyon geri şekilde Flag-CENP-A (K124R) -Ub (K48R) proteini muhtemelen, CENP-A monoubiquitylated taklit (Şekil 4C, karşılaştırın sütun [5] ve [6]) yaptığı daha etkin şekilde CENP-A (K124R) -Ub (WT) (Şekil 4C, sütunları karşılaştırmak [4] - [6]). Bu veriler monoubiquitylation sentromer için CENP-A alımı için yeterli olduğunu göstermiştir.

Şekil 1
Şekil 1. endojen CENP-A immünofloresan analizi CUL4A-E3 ligaz (Şekiller Niikura ve ark., 17 den uyarlanmıştır) sentromer için CENP-A lokalizasyonu için gerekli olduğu hipotezini desteklemektedir. Sentromer de CENP-A (A) CUL4A siRNA neden delokalizasyon. HeLa hücreleri CUL4A ya lusiferazı (LUC) siRNA ile transfekte edilmiş ve (48 saat süre ile inkübe edildiTablo 1). Ölçek çubuğu temsil eden 10 um. (B) (A) ile aynı kültür koşulundaki ile HeLa bütün hücre lizatlarının Western blot analizi. Hücreler CUL4A siRNA veya Luc siRNA (Tablo 1) ile transfeksiyondan sonra 48 saat hasat edilmiştir. GAPDH bir yükleme kontrolü olarak görev yaptı. (C), (A) 'da gösterilen sentromer ve ölçülen endojen CENP-A sinyaller. sinyallerin Normalleştirme Luc siRNA transfekte hücreler kullanılarak yapıldı ve (± SD) ortalama yüzdeleri gösterilmiştir. **** P <Luc siRNA transfekte edilmiş hücrelerin (Student t-testi) sentromer gelen CENP-A. (D) RBX1 siRNA bağlı yerel olmaktan vs 0.0001. HeLa hücreleri RBX1 ya Luc siRNA (ler) ile birlikte transfekte edildi ve 72 saat (Tablo 1) için kuluçkalanmıştır. Ölçek çubuğu 10 um temsil eder. (E), (D) ile aynı kültür koşulundaki ile HeLa bütün hücre lizatlarının Western blot analizi. Hücreler RBX1 O ile transfeksiyondan sonra 72 saat ürünR Luc siRNA (ler) (Tablo 1). GAPDH bir yükleme kontrolü olarak görev yaptı. (F) (D) 'de gösterilen sentromer endojen CENP-A sinyallerini nicel. sinyallerin Normalleştirme Luc siRNA transfekte hücreler kullanılarak yapıldı ve (± SD) ortalama yüzdeleri gösterilmiştir. **** P <Luc siRNA transfekte hücreler (Student t-testi) vs 0.0001. Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

şekil 2
Şekil 1 sentromerlere Şekil ilişkin 2. İletişim bilgileri CUL4A siRNA 3 'UTR hedef zaman. (A) Eksojen CUL4A-Bayrak CENP-A delokalizasyonu kurtarıldı (Şekil Niikura ve ark., 17 uyarlandı). HeLa Tet-Off celLS siRNA ile kotransfeksiyonu sonra 48 saat sonra tespit edildi (CUL4A 2: 3 'UTR, hedef ya da Luc, Tablo 1) artı plazmid yapı (pTRM4-CUL4A-Flag veya vektör, Tablo 2). 4-renk immün: DAPI (mavi) için boyama; Bayrak; endojen CENP-B (kırmızı); ve endojen CENP-A (yeşil), yapılmış ve Flag-pozitif hücreler kriteri, ancak bayrak resim basitlik amacıyla atlanmıştır. Not: CUL4A 2. Şekil 1A-C'de gösterilen edilene benzer bir hedeftir. Ölçek çubuğu temsil eden 10 um. (B) (A) 'da gösterildiği gibi, aynı kültür durumda, aşağıdaki HeLa Tet-Off bütün hücre lizatlarının Western blot analizi. GAPDH bir yükleme kontrolü olarak görev yaptı. (A) 'da gösterilen sentromer (C) CENP-A sinyallerini, bir anti-Flag antikor tarafından bağlanan bu izole etmek için hücre sıralama sonra mikroskop ile sayıldı. sinyallerin Normalizasyon Luc siRNA Ayrıca vektör ile transfekte edilmiş hücreler ile yapıldı ve (± SD) ortalama yüzdeleri gösterilmiştir.RBX1 siRNA 3 'UTR hedef alan **** p <Luc siRNA artı vektör (sol sütun, Student t-testi) ile transfekte edilmiş hücrelerin vs 0.0001. (D) Ekzojen Flag-RBX1 sentromer de CENP-A delokalizasyonu kurtarıldı . Ayrıca plazmid yapısı (pcDNA3-Flag-RBX1 veya vektör, Tablo 2);: HeLa hücreleri 72 siRNA ile kotransfeksiyonu saat sonra, (Tablo 1 ila 3 'UTR, hedef ya da Luc RBX1 # 2) sabitlenmiştir. 4-renk immün: DAPI (mavi) için boyama; Bayrak; endojen CENP-B (kırmızı); ve endojen CENP-A (yeşil), yapılmış ve Flag-pozitif hücreler kriteri, ancak bayrak resim basitlik amacıyla atlanmıştır. Ölçek çubuğu 10 um temsil eder. (E), (D) ile aynı kültür koşulundaki aşağıdaki HeLa bütün hücre lizatlarının Western blot analizi. GAPDH bir yükleme kontrolü olarak görev yaptı. (F) (D) 'de gösterilen sentromer de CENP-A sinyallerini bağlı olan izole etmek için hücre sıralama sonra mikroskop ile nicelleştirilmiştir N, anti bayrak antikorlarını. sinyallerin Normalizasyon Luc siRNA Ayrıca vektör ile transfekte edilmiş hücreler ile yapıldı ve (± SD) ortalama yüzdeleri gösterilmiştir. **** P <0.0001 Luc siRNA artı vektör (sol sütun, Student t-testi) ile birlikte transfekte edilen hücreler. CUL4A ve RBX1 arasında (G) azalması endojen CENP-A proteini düzeylerini etkilemedi vs. endojen CENP-A protein seviyesi HeLa bütün hücre lizatları ölçüldü CUL4A, RBX1, CUL4A artı RBX1 veya Luc siRNA ile transfeksiyondan sonra 72 saat ürün. Kırk sekiz saat sonra transfeksiyon, hücreler, ya (ASYN) tedavi edilmemiş veya paklitaksel (+ vergi), hücre bölünmesini durdurmasına sebep, ve 24 saat süre ile kültüre edildi ile muamele edilmektedir. GAPDH bir yükleme kontrolü olarak görev yaptı. Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

32 / 53732fig3highres.jpg "width =" 700 "/>
Eksojen CENP-A-Flag proteinlerinin Şekil 3. immünofloresans analizi CENP-A K124 ubiquitylation (Şekiller Niikura ark adapte edilmiştir. 17) sentromer de CENP-lokalizasyon için gerekli olduğunu göstermiştir. CENP-A-(A) aşırı ekspresyonu Bayrak konstruktları (VT ve KR mutantlar) HeLa Tet-Off bütün hücre lizatlarının Batı benek analizi ile teyit edilmiştir. Hücreler pTRM4-CENP-A-Flag WT KR mutantlan veya pTRM4 vektörü (Tablo 2) ile transfeksiyondan sonra 48 saat hasat edilmiştir. CENP-A-Flag aşırı ekspresyonu, bir anti-Flag antikor ile tespit edilmiştir. GAPDH bir yükleme kontrolü olarak görev yaptı. Varsayılan CENP-A-Bayrak dimer (##) ve CENP-A-Bayrak monomer (#) gösterilmektedir. Not: SDS-dirençli CENP-A dimerler daha önce rapor edilmiştir 40,41 (B), CENP-A K124R mutant sentromer dağılan delokalizasyonu göstermiştir.. DAPI (mavi), Bayrak (gelen sinyaller green) ve endojen CENP-B (kırmızı, bir sentromer Yer kontrol) gösterilmiştir. Not: CUL4A ya RBX1 siRNA ile transfekte edilmiş hücrelerin, endojen CENP-A farklı olarak, dağınık sinyaller ekspresyonu seviyesi, yaklaşık 10, muhtemelen nedeni, sentromer hedeflenmesini yetersizlik fenotipi olarak eksojen CENP-A K124R-Flag aşırı eksprese hücrelerde ortaya - endojen CENP-A daha yüksek 25 misli (veriler gösterilmemiştir) 17 Ölçek çubuğu (B) 'de gösterilen lokalizasyon desen 10 um (C) Histogramlar temsil eder... 50'den fazla pro / prometafaz ve metafaz hücreleri ve deney başına 200'den fazla interfaz hücreleri (n ≥ 3 deneyler) sayıldı. (± SD) ortalama yüzdeleri gösterilmiştir. "Diğer (Sigara sentromer)" büyük ihtimalle, çünkü transfeksiyon veya diğer tedavilerin çoğu hasarlı hücreleri, ölü hücreleri ya da (sadece interfaz) nükleolar lokalizasyonu hücreleri belirtir. *** P <CENP-WT-Flag (Student t-testi) v 0.001.

Şekil 4,
Eksojen Flag-CENP-A proteinlerinin Şekil 4. immünofloresans analizi CENP-A sentromer gelen CENP-A K124R mutantının monoubiquitin füzyon kurtarıldı delokalizasyon (Şekiller Niikura ve ark., 17 den uyarlanmıştır) olduğunu göstermiştir. (A), bu çalışmada kullanılan her yapının şematik çizgi film (ayrıca tablo 2'yi görünüz). CENP-A (kırmızı) ve monoubiquitin (mavi) K48R mutasyonu sahada K124R mutasyon yeri gösterilmektedir. (1) WT: Bayrak-CENP-A WT, (2) WT-Ub (WT): Bayrak-CENP-A WT-Ub (WT), (3) WT-Ub (K48R): Bayrak-CENP-A WT -Ub (K48R), (4) K124R-Ub (WT): Bayrak-CENP-A K124R-Ub (WT), (5) K124R-Ub (K48R): Bayrak-CENP-A K124R-Ub (K48R), (6) K124R: Flag-CENP-A K124R (B) Ekzojen CENP-A sentromer gelen CENP-A K124R mutantının monoubiquitin füzyon kurtarıldı delokalizasyon.. DAPI (mavi), Bayrak (yeşil) ve endojen CENP-B (kırmızı, bir sentromer konum kontrolü) gösterilmektedir. Ölçek çubuğu (C) 'de gösterilen lokalizasyon desen 10 um. (C) Histogramlar temsil eder. 50'den fazla pro / prometafaz ve metafaz hücreleri ve deney başına 200'den fazla interfaz hücreleri (n ≥ 3 deneyler) sayıldı. (± SD) ortalama yüzdeleri gösterilmiştir. **** P <0.0001 ve *** p <0.001 kaynaşmamış Bayrak-CENP-A K124R vs (sütun [6]) (Student t-testi). Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

siRNA hedef Bu çalışmada Endikasyon hedef türü siRNA veritabanı sayısı İleri dizisi (ler) Kaynak / Başvuru
Lusiferaz (GL3) - 1 hedef RKK9 CUUACGCUGAGUACUUCGAdTdT Elbashir ve ark., (2001),
CENP-A CA-UTR siRNA havuzu (2 hedefler karışımı) RKK375 / 5 'UTR T1 CGAGCGGCGCGGACUUCUGCCdTdT Niikura ve diğ., (2015)
RKK383 / 3 'UTR t1 UCCUGCACCCAGUGUUUCUGUdGdT Niikura ve diğ., (2015)
CUL4A 1. 1 hedef CRKK178 / RKK309 / t1 AGCGAUCGUAAUCAAUCCUGA Niikura ve diğ., (2015)
2. (3'UTR) 1 hedef CRKK181 / RKK331 / T4 AUGCGGGUUUGAAAUAUGACA Niikura ve diğ., (2015)
RBX1 / ROC1 1. siRNA havuzu (4 hedefler karışımı) CRKK198 / RKK411 / t1 GAAGCGCUUUGAAGUGAAA Niikura ve diğ., (2015)
CRKK198 / RKK413 / T2 GCAUAGAAUGUCAAGCUAA Niikura ve diğ., (2015)
CRKK198 / RKK415 / T3 GCAAGAAGCGCUUUGAAGU Niikura ve diğ., (2015)
CRKK198 / RKK417 / T4 CAACAGAGAGUGGGAAUUC Niikura ve diğ., (2015)
2. (3 'UTR) 1 hedef CRKK206 / RKK425 / t8 UUCCCUGCUGUUACCUAAUUA Niikura ve diğ., (2015)

Bu çalışmada kullanılan Tablo 1. siRNA dizileri.

B numarası İlgili özellik (ler) Kaynak / Başvuru
B288 pTRM4 Niikura ve diğ., (2006)
B2067 pTRM4-insan CENP-A-Flag Niikura ve diğ., (2015)
B2281 pTRM4-insan CENP-A K9A-Flag Niikura ve diğ., (2015)
B2387 pTRM4-insan CENP-A K77R-Flag Niikura ve diğ., (2015)
B2388 pTRM4-humaN CENP-A K124R-Flag Niikura ve diğ., (2015)
B2512 pTRM4-Flag-insan CENP-A Niikura ve diğ., (2015)
B2579 pTRM4-Flag-insan CENP-A K124R Niikura ve diğ., (2015)
B2513 pTRM4-Flag-insan CENP-A-UB (WT) Niikura ve diğ., (2015)
B2559 pTRM4-Flag-insan CENP-A K124R-UB (WT) Niikura ve diğ., (2015)
B2515 pTRM4-Flag-insan CENP-A-UB (K48R) Niikura ve diğ., (2015)
B2560 pTRM4-Flag-insan CENP-A K124R-UB (K48R) Niikura ve diğ., (2015)
B2759 pTRM4-insan CUL4A-Flag Niikura ve diğ., (2015)
B2624 pcDNA3-Flag-insan RBX1 Niikurave diğ., (2015)
B1491 pcDNA3-Flag Niikura ve diğ., (2015)

Bu çalışmada kullanılan Tablo 2. Plasmid vektörleri.

R (anti-CENP-b) numune B (anti-CENP-B) R örneği (çıkarılır) Oran (S örnek: R örnek) Düzeltilmiş Oran (S örnek: R örnek)
520 514 6 -4,167 0.000
535 445 90 -1,033 0.000
515 431 84 0.274 0.274
562 483 79 0.506 0.506
902 562 340 0.509 0.509
1203 703 500 -0,560 0.000
1014 589 425 -0,819 0.000
768 510 258 -1,345 0.000
555 458 97 -1,845 0.000
781 576 205 -1,146 0.000
556 436 120 0.758 0.758
534 493 41 -1,634 0.000
702 543 159 0.667 0.667
482 429 53 -1,000 0.000 654 531 123 0.740 0.740
1190 607 583 0.384 0.384
552 454 98 0.969 0.969
489 413 76 0.539 0.539
511 452 59 -3,186 0.000
485 475 10 -2,700 0.000
481 441 40 -1,475 0.000
toplam 5.347
Ortalama 0.255
R (anti-CENP-B) ctrl B (anti-CENP-B) Oran (S ctrl: R ctrl) Düzeltilmiş Oran (S ctrl: R ctrl)
543 483 60 3,017 3,017
526 466 60 2,667 2,667
532 460 72 1,792 1,792
507 457 50 3,520 3,520
491 458 33 4,273 4,273
545 464 81 2.160 2.160
518 484 34 3,559 3,559
461 404 57 2,404 2,404
487 447 40 3.550 3.550
534 477 57 3,965 3,965
528 456 72 3.097 3.097
707 601 106 1,868 1,868
615 528 87 2,828 2,828
660 481 179 1.620 1.620
565 476 89 1,607 1,607
527 455 72 3,583 3,583
560 474 86 2.930 2.930
510 451 59 4,017 4,017
729 586 143 2,678 2,678
634 576 58 3,655 3,655
507 476 31 3.935 3.935
toplam 62,725
Ortalama 2,987
Sentromere de CENP-A sinyallerini Kalan (%) 8.5

. Tablo 3. sentromer (%) kalan CENP-A sinyallerinin hesaplanması bir örneği Şekil 2F Pro / prometafaz bir örnek gösterilmektedir: Örnek Şekil 2F içinde RBX1 # 2 (3'UTR) + Vec (merkez sütun ) ve kontrol Luc + Vec Şekil 2F de (sol sütun) 'dir. Bunun bir sonucu olarak, en CENP-A sinyallerini geri kalansentromer (%) = (0.255 / 2.987) 100 =% 8.5 elde edilir, X (veya [5.347 / 62,725] [yani, 21 hücreleri] iki örnek arasındaki analizinin toplam hücre sayısı 100 = 8.5 x%). B değeri S değerinden daha fazla ise (çıkarılan değeri negatif ise yani), düzeltilmiş oran değeri 0.00 olarak ayarlanır unutmayın.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Son yıllarda pek çok çalışma, sabit hücreler için farklı nicel mikroskopi deneyleri geliştirdik. 42 Progress sentromer kinetochore biyoloji genellikle hücre içi mekânsal-zamansal düzenleme değişen işlevlerini yansıtan hangi proteinlerin sentromer özgü veya kinetochore özel fonksiyon anlaşılmasını gerektirir hücre döngüsü sırasında bu proteinler. Bu nedenle, burada IIF boyama ve özellikle farklı tedavi örneklerde geçerli olabilir endojen ve eksojen CENP-A proteinlerinin nispi seviyeleri, analiz için niceliksel IIF deneyin yöntemlerini geliştirmiştir. Şu anda bu çalışmada Protokolü 2 kullanarak endojen CENP-I, CENP-H, KNL1, Hec1 ve Ska1 başarılı IIF boyama elde (. Niikura ark 24 ve veriler gösterilmemiştir bkz Malzemeleri / Ekipman Listesi antikorların bilgi için) . Gelecekte, tek bir (başka bir sentromer kinetochore protein seviyesini ölçmek için, her iki endog aynı yöntemi uygulayabilirspesifik antikorları seçmek) enous ve ekzojen proteinler Flag-işaretli Ancak bizim IIF yöntemler, canlı hücreler ya da bütün hücre döngüsü sırasında belirli tek bir hücrede, bu proteinlerin tespiti kapsamaz. Bu işlemler, sabit ve ayrı lamelleri işlenecek hücreleri gerektirdiğinden, biz oldukça farklı örnekleri arasında sinyalleri karşılaştırmak ve testin doğruluğunu artırmak için normalleştirme amacıyla referans sinyallerini (örn ACA veya CENP-B) tanıttı. ACA endojen ve / veya eksojen CENP-A sinyalleri, CENP-B içeren çünkü CENP-A sinyallerinin sayısal testin doğruluk açısından AKA olduğundan daha normalleşmesi amacıyla bir referans sinyal karşılaştırma için daha uygun olurdu. CENP-B'nin amino-terminal bölgesi alphoid DNA CENP-B kutusu dizisinin 17 bp motifi bağlanır ve CENP-B karboksi ucu bölgesi homodimerler oluşturur. 43,44 CENP-B tam colocalize etmez CENP-A ve / veya diğer centr ileomere-kinetochore proteinler, ancak onlarla yakın ilişkilidir. 45, anti-CENP-Cı antikorları ile immünofloresan tipik haliyle de anti-CENP-B, genellikle her iki kız kardeş sentromerlere bağlayan tek bir parlak bir çubuk olarak görüntülenir. 46 ile boyanarak, iki ayn noktalar verirken bizim makro ölçekli mikroskopik gözlem bazı CENP-B sinyalleri görünüşte gözlem açısı ve kullanılan sabitleyiciye tipine bağlı olarak da kısmen, özellikle de daha önce mitotik aşamaları (geç metafaz daha profaz-prometafaz) de, CENP-A sinyalleri ile üst üste (veri gösterilemiyor). sentromer kinetochore proteinlerin çoğu lokalizasyonu bağlıdır, ancak aksine, CENP-A sinyallerinin sayısal IIF deneyinde referans sinyallerinin protein lokalizasyonu, incelmesi ve / veya gerçeğe uygun analiz için CENP-A disfonksiyon ile etkilenmemelidir sentromer de CENP-A lokalizasyonu. 47,48 CENP-A bağımsız kinetochore düzeneği CENP DNA bağlayıcı bölge değiştirilmesiyle kurulmuşturEktopik loci bu proteinleri işe alternatif kromozom hedefleme etki ile -C ve CENP-T. Buna ek olarak 49,50, son çalışma iç kinetochore bileşenleri CENP-C ve paralel CENP-T hareket için KMN ağı işe belirtti Ayrıca kinetokorlar. 51-54, Nishino ve ark. kanonik nucleosome proteinleri ötesinde 'histon kodu' uzanan DNA ile temas oluşturmak için CENP-TWSX karmaşık formlar bu eşsiz nucleosome benzeri bir yapı önerdi. 55 Çünkü CENP- ve sentromer lokalizasyonu Cı CENP-a sentromer lokalizasyonu bağlıdır, 47,48 CENP-TWSX veya bilhassa CENP-T diğer protein adayı (ler) CENP-a kantitatif IIF deneyinde referans sinyallerini sağlamak için olabilir. Ancak, referans sinyali için aday dikkatle sentromer de yerelleştirme CENP-A tükenmesi ve / veya disfonksiyon etkilenen olup olmadığını belirlemek için tahlil önce test edilmelidir. benzer düşünceDiğer sentromer kinetochore proteinlerin kantitatif IIF tahlilleri için alınmalıdır: referans sinyallerinin protein lokalizasyonu bol analizi için hedef proteinin azalması ve / veya fonksiyon bozukluğundan etkilenmemelidir. Bir önceki çalışmada, diğer merkez-dış kinetochore proteinlerin kantitatif IIF tahlili için bir referans sinyali olarak ACA kullanılır. 24 ACA bir pozisyon kontrolü olarak tek CENP-B daha uygun bir seçenek gibi bir referans sinyali, eğer olabilir ACA yukarıda da belirtildiği gibi sinyal CENP-B ile hedef proteinin azalması ve / veya hedef proteinin fonksiyon bozukluğu, ancak ko etkilenmez kötüdür.

Bodor ve diğ. sentromerik CENP-derece, sentromerik CENP-A miktarı, hücre içeriğine doğru orantılı olarak değişir, yani kitle eylem düzenlenir bildirmiştir. 56 ayrıca CENP-A ifade geçici indüksiyonu bir istem artışa neden olduğunu göstermiştir sentromer CENP-A düzeyi. Aksine, CA-UTR siRNA'lar (UTR siRNA 5 've 3' içeren bir karışım, Tablo 1) pTRM4 sentezleme vektörünün kotransfeksiyonu sonra sentromer lokalize Flag-işaretli CENP-WT ile büyük hücre popülasyonu gözlenmiştir (veriler ) gösterilmiştir; Bu nüfusun sadece pTRM4 sentezleme vektörü ile transfeksiyondan sonra görülenden daha büyük. Ekspresyonu pTRM4 kaynaklanmıştır eksojen Flag-işaretli CENP-A protein seviyesi, endojen CENP-A daha yüksek büyüklükte (10, 25 katına kadar) yaklaşık olarak 1,0 ilâ 1,4 siparişleri (veriler gösterilmemiştir). Ayrıca, belirli bir eşik değerinin üzerinde dışsal CENP-WT sentezlenmesi olumsuz kendi doğru sentromerik lokalizasyonunu etkileyebilir olduğu düşünülmektedir.

Mevcut protokollerde, tespit yerli devlete mümkün olduğunca yakın bir durum gibi hücresel yapı ve çevre korumak için kritik bir adımdır. Hücreler düzeltildikten sonra bir inte protein kaybını önlemek için boyama protokolü ile devam etmelidirdinlenme veya hücrenin geri kalanı. Bununla birlikte, sabitleme zaman antigenik mahalleri yok eder ve farklı bir antikor-antijen kombinasyonları bir çok iyi bir sabitleme maddesi ile zayıf çalışır, ancak. 21 için bu varyasyonun, sabitleyici seçimi, büyük ölçüde ilgili protein (ler) bağlıdır. Tespitin zaman uzunluğu önemli ölçüde immün protein (ler) tespiti etkileyebilir ve kısa tespit antijeniteyi korumak için genellikle daha iyidir. 57 Bu nedenle, özellikle belirsiz, diğer sentromer-kinetochore proteinlerin yeni bir hedef için boyama prosedürlerini belirlerken yeni bir antikor ile çalışırken yerelleştirme veya bir optimum durumun bulmak için fiksasyon ve tamponların çeşitli yöntemler test etmelidir. Mevcut protokollerde popüler fiksatif iki sınıf seçildi: aldehit fiksatif (Protokol 2) ve organik çözücüler (Protokoller 3 ve 4). fiksatif saflık, son derece önemlidir. Protokol 4'te,% 4 keçi serumu especia kullanılanlly spesifik olmayan fonun azaltılması için hücre yüzeyi üzerindeki IgG reseptörleri bloke etmek için. 57 Genel olarak, serum birincil antikora olmayan ve tercihen sekonder antikor olarak aynı türün bir türden olmalıdır IgG reseptörleri bloke etmek için. 57

Mevcut protokollerin her birinde, birincil antikor seçimi başarılı immün ulaşmada en kritik adımdır. büyük özgüllük, saflık, afinite ve aviditede antikorun arzu edilir. monoklonal antikorlar için iyi bir başlangıç ​​konsantrasyonu genellikle 1-5 ug / ml'dir. Poliklonal antikorların stok hazırlama tipik seyreltme 1:20 ila 1 arasında değişir. 500 57 bir deneysel birincil antikor, uygun konsantrasyon ve her numune için seyreltici belirlemek gerekmektedir. Numuneler hafifçe sarsan ancak homojen boyama inkübasyon sırasında kuru değil edilmelidir. birincil antikor ve ikincil a inkübasyon arasındaki geniş yıkamantibody diğer türlerden immünoglobulinler ile çapraz reaksiyon önlemek için gerekli olabilir. Ancak, optimum yıkama koşulu tamamlamaktadır ve (yani, mitoz sallamak-off) sarsıldı zaman ayırmak. Başarısı için 58 hücreleri, özellikle mitotik hücrelerin kaybını önlemek için ampirik olarak tespit edilmelidir, bir ikincil antikor bağlamak için seçilmelidir yüksek afinite ile birincil antikor. Örneğin, spesifik olmayan IgG Fc reseptörlerine ikincil antikor Fc kısmına bağlanması önlemek için, Fb (ab ') 2 fragmanları, tamamı yerine antikorun kullanılabilir. 57 birçok ikincil antikorlar için inkübasyon süresi, 30 dakika için minimize edilebilir oda sıcaklığında nonspesifik arka plan azaltmak için.

Protokol 5 ek olarak, lazer tarama konfokal mikroskopi tespit ve lokalizasyonu ve flüoresan özelliklere sahip sentromer kinetochore protein işlevinin analiz edilmesi avantajlı olabilir. Malzemeleri / sanayii listesi gösterildiği gibint, Alexa Fluor 488 ve Alexa Fluor 594 muhtemelen mevcut protokollerde en sık kullanılan floresan boyalardır. Örnek iki ve / veya birden fazla farklı sentromer kinetochore proteinleri saptamak için, bir bir protein tespit etmek için kullanılan antikorlar, ikinci protein algılama engellemez sağlamalıdır. Bu protokoller 57, iki primer antikorlar karıştırılır ve uygulanır aynı zamanda. Bununla birlikte, tek bir ayrı ayrı bir araya birincil ya da ikincil antikor uygulamadan önce, her bir protein için immün koşulları optimize edilmelidir: İki proteinler iki sentromer kinetochore bileşenleri olduğu gibi, birbirine çok yakın olması halinde, bir birincil antikor yapısal bağlanmasını önleyebilir ikinci primer antikor. Başka bir spektral kanal içine bir boya "sızıntı" sinyali önlenmesinde zorluk: birden fazla sinyal algılama bir başka endişe spektral örtüşme sorunudur. Bu sorun kongre için daha zor olural parazit filtresi boyalar sayısı arttıkça çözmek için ayarlar veya numune overenhanced sinyalleri içeriyorsa (örneğin, bu çalışmada ACA veya anti-Bayrak sinyalleri) otofloresansı müdahale de dahil olmak üzere. Otofloresansı giderme diğer çalışmalarda gerçekleştirilmiştir. Bu çalışmada 57,59,60, her kanalda tek etiketli kontrol floresan filtre kümesi optimize bu sorunları (aşağıya bakınız) önlemek için çoğu durumda yeterli olacaktır.

Bu protokol her birinde, uygun bir kontrol gereklidir. immün başlamadan önce her yeni primer antikor ile karakterize edilmelidir. uygunsa antikorun spesifikliği, Western blot analizi ile teyit edilmelidir. Buna ek olarak, lekeli hücre yüzeyine spesifik olmayan bağlanma tarafından neden olduğu doğrulandı alınmalıdır, ve belirli bir birincil antikor optimal çalışma konsantrasyonu seri dilüsyonları kullanılarak belirlenmelidir(Örneğin, bağlayıcı bir eğrisi geliştirilmelidir). Bir negatif kontrol (yani, boyama işleminden birincil antikor olmaması) dahil edilmelidir. negatif kontrolün Başka bir seçenek birincil antikor için aynı türden, normal IgG'nin ikamesidir. Birden fazla etiket tespiti için, bir spektral örtüşme eserler (yani, kanama-through, geçit, karışmasını önlemek için ikincil antikorlar (arka plan kontrol) yanı sıra tek etiketli kontrolleri olmadan kontrolleri hazırlamak, ya da yukarıda açıklandığı gibi "sızıntı" boya gerekir ). Bir doğru sinyali ile "yanlış" filtreler aracılığıyla sinyalleri karşılaştırarak hesaplama kaldırmak için bu oranlar kullanılarak "sızıntı" ve gerçek dağıtım ve / veya floresan etiket ko-lokalizasyonunu hesaplayarak "sızıntı" fraksiyonu ölçmek. 60 arka plan kontrol sinyali kazanç sınırlarını belirlemek için her bir kanal ile bağımsız incelenmiş ve ada olması mahsup edilmelidirNihai görüntüleme için pted. Her bir kanal otofloresan seviyesi esas olarak değişir, çünkü bir çok etiketli numunenin bir görüntü elde etmek için kullanılacak olan tüm kanallar, bağımsız plan düzeltmesi tabi tutulmalıdır. Yukarıdaki komşu kanal içine "sızıntı" tespit olmadan her kanalda olası sinyal kazancı miktarını belirlemek için gerekli olan açıklandığı gibi "sızıntı" kontrol eder. 60

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Yazarlar hiçbir rakip mali çıkarları olduğunu beyan ederim.

Acknowledgments

Bu çalışma NIH hibe GM68418 tarafından desteklenmiştir.

Materials

Name Company Catalog Number Comments
Lipofectamin 2000 Life Technologies/Invitrogen 11668 transfection reagent I
Lipofectamin RNAiMAX Life Technologies/Invitrogen 13778 transfection reagent II
Opti-MEM I Life Technologies/Invitrogen 31985 Reduced serum media, warm in 37 °C water bath before use
High-glucose DMEM (Dulbecco’s modified Eagle’s medium) Life Technologies/BioWhittaker 12-604 high-glucose DMEM, warm in 37 °C water bath before use
Fetal Bovine Serum, certified, heat inactivated, US origin Life Technologies/Gibco 10082 FBS (fetal bovine serum)
Poly-L-Lysine SOLUTION SIGMA-SLDRICH P 8920 Poly-L-Lysine, 0.1% w/v, in water
UltraPure Distilled Water Life Technologies/Invitrogen/Gibco 10977 Sterile tissue culture grade water 
Micro Cover glass (22 mm x 22 mm)  Surgipath 105 Cover glass (22 mm x 22 mm) 
6 Well Cell Culture Cluster Fisher/Corning Incorporated 07-200-83 6-well polystyrene plate 
Penicillin, Streptomycin; Liquid Fisher/Gibco 15-140 Penicillin-streptomycin
PAP PEN  Binding Site AD100.1 Hydrophobic barrier pen (for a water repellant barrier in immunofluorescent staining)
Paclitaxel (Taxol) SIGMA-SLDRICH T7402 Taxol for mitotic cell analysis
TN-16, microtubule inhibitor (TN16) Enzo Life Sciences BML-T120 TN16 for mitotic cell analysis
BSA (bovine serum albumin) SIGMA-SLDRICH A7906 Blocking reagent
Triton X-100 SIGMA-SLDRICH T8787 Detergent for permeabilization
Paraformaldehyde SIGMA-SLDRICH P6148 Fixation reagant
DAPI SIGMA-SLDRICH D9542 For nuclear staining
p-phenylenediamine SIGMA-SLDRICH P6001 For mounting medium
VWR Micro Slides, Frosted VWR International 48312-013 Micro slides 
Anti-CENP-A antibody Stressgen/Enzo Life Sciences KAM-CC006 Mouse monoclonal antibody; dilution ratio of 1:100 (IIF), 1:5000 (WB)
Anti-CENP-B antibody Novus Biologicals H00001059-B01P Mouse monoclonal antibody; dilution ratio of 1:200 (IIF, methanol/acetone fixation)-1:400 (IIF, paraformaldehyde fixation)
Anti-CENP-B antibody  abcam ab25734 Rabbit polyclonal antibody; dilution ratio of 1:200 (IIF, methanol/acetone fixation)-1:400 (IIF, paraformaldehyde fixation)
Anti-centromere antibody (ACA) Fitzgerald Industries International, Inc. 90C-CS1058 Human centromere antiserum; dilution ratio of 1:2000 (IIF)
Anti-CENP-H antibody Bethyl Laboratories BL1112 (A400-007A) Rabbit polyclonal antibody; dilution ratio of 1:200 (IIF)
Anti-CENP-H antibody BD 612142 Mouse monoclonal antibody; dilution ratio of 1:200 (IIF)
Anti-CENP-I antibody N/A, Dr. Katusmi Kitagawa N/A, Dr. Katusmi Kitagawa Rabbit polyclonal antibody; dilution ratio of 1:1000 (IIF); Niikura et al., Oncogene, 4133-4146 (2006)
Anti-KNL1 antibody Novus Biologicals NBP1-89223 Rabbit polyclonal antibody; dilution ratio of 1:100 (IIF)
Anti-Hec1 antibody Novus Biologicals / GeneTex NB 100-338 / GTX70268 Mouse monoclonal antibody; dilution ratio of 1:100 (IIF)
Anti-Hec1 antibody GeneTex GTX110735 Rabbit polyclonal antibody; dilution ratio of 1:100 (IIF)
Anti-Ska1 antibody abcam ab46826 Rabbit polyclonal antibody; dilution ratio of 1:100 (IIF)
Anti-Flag antibody SIGMA-ALDRICH F3165 Mouse monoclonal antibody; dilution ratio of 1:1000 (IIF), 1:5000 (WB)
Anti-Flag antibody SIGMA-ALDRICH F7425 Rabbit polyclonal antibody; dilution ratio of 1:1000 (IIF), 1:5000 (WB)
Anti-CUL4A antibody N/A, Dr. Pradip Raychaudhuri N/A, Dr. Pradip Raychaudhuri Rabbit polyclonal antibody; dilution ratio of 1:3000 (WB); Shiyanov et al., The Journal of biological chemistry, 35309-35312 (1999)
Anti-RBX1 antibody Cell Signaling 4397 Rabbit polyclonal antibody; dilution ratio of 1:2000 (WB)
Anti-GAPDH antibody Chemicon MAB374 Mouse monoclonal antibody; dilution ratio of 1:5000 (WB)
Alexa Fluor 488 Goat Anti-Mouse IgG Life Technologies/Invitrogen A11001 fluorophore-conjugated secondary antibody (Affinity-purified secondary antibody)
Alexa Fluor 594 Goat Anti-Mouse IgG Life Technologies/Invitrogen A11005 fluorophore-conjugated secondary antibody (Affinity-purified secondary antibody)
Alexa Fluor 488 Goat Anti-Rabbit IgG Life Technologies/Invitrogen A11008 fluorophore-conjugated secondary antibody (Affinity-purified secondary antibody)
Alexa Fluor 594 Goat Anti-Rabbit IgG Life Technologies/Invitrogen A11012 fluorophore-conjugated secondary antibody (Affinity-purified secondary antibody)
Non fat powdered milk (approved substitution for carnation powdered milk) Fisher Scientific NC9255871 (Reorder No. 190915; Lot# 90629) Skim milk
Leica DM IRE2 motorized fluorescence microscope  Leica motorized fluorescence microscope 
HCX PL APO 63x oil immersion lens Leica LEICA HCX PL APO NA 1.40 OIL PH 3 CS 63X oil immersion lens
HCX PL APO 100x oil immersion lens Leica LEICA HCX PL APO NA 1.40 OIL PHE 100X oil immersion lens
Leica EL6000 compact light source Leica External compact light source for fluorescent excitation
ORCA-R2 Digital CCD camera  Hamamatsu C10600-10B digital CCD camera 
Openlab version 5.5.2 Scientific Imaging Software  Perkin Elmer/Improvision For image observation, acquisition, quantification, and analysis
Velocity version 6.1.1 3D Image Analysis Software  Perkin Elmer/Improvision For image observation, acquisition, quantification, and analysis
Complete EDTA-free protease inhibitor cocktail Roche 11873580001/11836170001 Protease inhibitor cocktail tablets
PlusOne 2-D Quant Kit Amersham Biosciences 80-6483-56 Commercial protein assay reagent I for measurement of protein concentration (compatible with 2% SDS)
Bio-Rad Protein Assay Bio-Rad 500-0006 Commercial protein assay reagent II for measurement of protein concentration (compatible with 0.1% SDS)
Immobilon-FL EMD Millipore IPFL00010 PVDF membrane for transferring
IRDye 800CW Goat Anti-Mouse IgG LI-COR Biosciences 926-32210 IR fluorescent dye-conjugated secondary antibody (Affinity-purified secondary antibody); dilution ratio of 1:20000 (IIF)
IRDye 680 Goat Anti-Rabbit IgG LI-COR Biosciences 926-32221 IR fluorescent dye-conjugated secondary antibody (Affinity-purified secondary antibody); dilution ratio of 1:20000 (IIF)
Goat anti-Mouse IgG DyLight 549 Fisher Scientific PI35507 DyLight-conjugated secondary antibodyIR fluorescent dye-conjugated secondary antibody (Affinity-purified secondary antibody); dilution ratio of 1:20000 (IIF)
Goat anti-Rabbit DyLight 649 Fisher Scientific PI35565 DyLight-conjugated secondary antibodyIR fluorescent dye-conjugated secondary antibody (Affinity-purified secondary antibody); dilution ratio of 1:20000 (IIF)
Goat anti-mouse IgG-HRP Santa Cruz SC-2005 HRP-conjugated secondary antibodyDyLight-conjugated secondary antibodyIR fluorescent dye-conjugated secondary antibody (Affinity-purified secondary antibody); dilution ratio of 1:10000 (IIF)
Goat anti-rabbit IgG-HRP Santa Cruz SC-2004 HRP-conjugated secondary antibodyDyLight-conjugated secondary antibodyIR fluorescent dye-conjugated secondary antibody (Affinity-purified secondary antibody); dilution ratio of 1:10000 (IIF)
Openlab version 5.5.2. Scientific Imaging Software  Improvision/PerkinElmer Software A
Volocity version 6.3 3D Image Analysis Software (Volocity Acquisition) PerkinElmer Software B1
Volocity version 6.3 3D Image Analysis Software (Volocity Quantification) PerkinElmer Software B2
Branson SONIFIER 450 Sonicator
Branson Ultrasonics sonicator Microtip Step, Solid, Threaded 9.5 mm VWR Scientific Products Inc.  33995-325 Disruptor horn for sonication
Branson Ultrasonics sonicator Microtip Tapered 6.5 mm VWR Scientific Products Inc.  33996-185 Microtip for sonication
Odyssey CLx Infrared imaging System  LI-COR Biosciences Infrared imaging system for immunoblot detection
Image Studio Analysis Software Ver 4.0  LI-COR Biosciences Software C
Molecular Imager Versadoc MP4000 System  Bio-Rad Chemiluminescence imager for immunoblot detection
Quantity One 1-D analysis software  Bio-Rad Software D
SuperSignal West Femto Maximum Sensitivity Substrate Thermo 34095 Ultra-sensitive enhanced chemiluminescent (ECL) substrate

DOWNLOAD MATERIALS LIST

References

  1. DeLuca, J. G., et al. Hec1 and nuf2 are core components of the kinetochore outer plate essential for organizing microtubule attachment sites. Molecular biology of the cell. 16, 519-531 (2005).
  2. Earnshaw, W. C., Halligan, N., Cooke, C., Rothfield, N. The kinetochore is part of the metaphase chromosome scaffold. J Cell Biol. 98, 352-357 (1984).
  3. Hoffman, D. B., Pearson, C. G., Yen, T. J., Howell, B. J., Salmon, E. D. Microtubule-dependent changes in assembly of microtubule motor proteins and mitotic spindle checkpoint proteins at PtK1 kinetochores. Molecular biology of the cell. 12, 1995-2009 (2001).
  4. Regnier, V., et al. CENP-A is required for accurate chromosome segregation and sustained kinetochore association of BubR1. Mol Cell Biol. 25, 3967-3981 (2005).
  5. Bernad, R., Sanchez, P., Losada, A. Epigenetic specification of centromeres by CENP-A. Exp Cell Res. 315, 3233-3241 (2009).
  6. Black, B. E., Cleveland, D. W. Epigenetic centromere propagation and the nature of CENP-a nucleosomes. Cell. 144, 471-479 (2011).
  7. Warburton, P. E., et al. Immunolocalization of CENP-A suggests a distinct nucleosome structure at the inner kinetochore plate of active centromeres. Curr Biol. 7, 901-904 (1997).
  8. Karpen, G. H., Allshire, R. C. The case for epigenetic effects on centromere identity and function. Trends Genet. 13, 489-496 (1997).
  9. Black, B. E., et al. Structural determinants for generating centromeric chromatin. Nature. 430, 578-582 (2004).
  10. Black, B. E., et al. Centromere identity maintained by nucleosomes assembled with histone H3 containing the CENP-A targeting domain. Mol Cell. 25, 309-322 (2007).
  11. Fachinetti, D., et al. A two-step mechanism for epigenetic specification of centromere identity and function. Nat Cell Biol. 15, 1056-1066 (2013).
  12. Zeitlin, S. G., Shelby, R. D., Sullivan, K. F. CENP-A is phosphorylated by Aurora B kinase and plays an unexpected role in completion of cytokinesis. The Journal of cell biology. 155, 1147-1157 (2001).
  13. Zhang, X., Li, X., Marshall, J. B., Zhong, C. X., Dawe, R. K. Phosphoserines on maize CENTROMERIC HISTONE H3 and histone H3 demarcate the centromere and pericentromere during chromosome segregation. The Plant cell. 17, 572-583 (2005).
  14. Goutte-Gattat, D., et al. Phosphorylation of the CENP-A amino-terminus in mitotic centromeric chromatin is required for kinetochore function. Proc Natl Acad Sci U S A. 110, 8579-8584 (2013).
  15. Bailey, A. O., et al. Posttranslational modification of CENP-A influences the conformation of centromeric chromatin. Proc Natl Acad Sci U S A. 110, 11827-11832 (2013).
  16. Samel, A., Cuomo, A., Bonaldi, T., Ehrenhofer-Murray, A. E. Methylation of CenH3 arginine 37 regulates kinetochore integrity and chromosome segregation. Proc Natl Acad Sci U S A. 109, 9029-9034 (2012).
  17. Niikura, Y., et al. CENP-A K124 Ubiquitylation Is Required for CENP-A Deposition at the Centromere. Dev Cell. (2015).
  18. Chan, G. K., Liu, S. T., Yen, T. J. Kinetochore structure and function. Trends in cell biology. 15, 589-598 (2005).
  19. Hori, T., Okada, M., Maenaka, K., Fukagawa, T. CENP-O class proteins form a stable complex and are required for proper kinetochore function. Molecular biology of the cell. 19, 843-854 (2008).
  20. Fukagawa, T., Earnshaw, W. C. The centromere: chromatin foundation for the kinetochore machinery. Developmental cell. 30, 496-508 (2014).
  21. Kedersha, N. The Proteintech Blog.Proteintech. Grainger, D. Proteintech Group. (2012).
  22. Clontech Laboratories, Inc. HeLa Tet-Off Advanced Cell Line. Available from: http://www.clontech.com/CR/Products/Inducible_Systems/Tetracycline-Inducible_Expression/ibcGetAttachment.jsp?cItemId=26908&fileId=6712191&sitex=10020:22372:US (2012).
  23. Meraldi, P., Sorger, P. K. A dual role for Bub1 in the spindle checkpoint and chromosome congression. EMBO J. 24, 1621-1633 (2005).
  24. Niikura, Y., et al. 17-AAG, an Hsp90 inhibitor, causes kinetochore defects: a novel mechanism by which 17-AAG inhibits cell proliferation. Oncogene. 25, 4133-4146 (2006).
  25. Yang, Z., et al. Silencing mitosin induces misaligned chromosomes, premature chromosome decondensation before anaphase onset, and mitotic cell death. Mol Cell Biol. 25, 4062-4074 (2005).
  26. Wang, H., et al. Histone H3 and H4 ubiquitylation by the CUL4-DDB-ROC1 ubiquitin ligase facilitates cellular response to DNA damage. Mol Cell. 22, 383-394 (2006).
  27. Lamb, J. R., Tugendreich, S., Hieter, P. Tetratrico peptide repeat interactions: to TPR or not to TPR? Trends Biochem Sci. 20, 257-259 (1995).
  28. Kitagawa, K., Skowyra, D., Elledge, S. J., Harper, J. W., Hieter, P. SGT1 encodes an essential component of the yeast kinetochore assembly pathway and a novel subunit of the SCF ubiquitin ligase complex. Mol Cell. 4, 21-33 (1999).
  29. Niikura, Y., Dixit, A., Scott, R., Perkins, G., Kitagawa, K. BUB1 mediation of caspase-independent mitotic death determines cell fate. J Cell Biol. 178, 283-296 (2007).
  30. Niikura, Y., Kitagawa, K. Identification of a novel splice variant: human SGT1B (SUGT1B). DNA Seq. 14, 436-441 (2003).
  31. Niikura, Y., Ogi, H., Kikuchi, K., Kitagawa, K. BUB3 that dissociates from BUB1 activates caspase-independent mitotic death (CIMD). Cell Death Differ. 17, 1011-1024 (2010).
  32. Ando, S., Yang, H., Nozaki, N., Okazaki, T., Yoda, K. CENP-A, -B, and -C chromatin complex that contains the I-type alpha-satellite array constitutes the prekinetochore in HeLa cells. Mol Cell Biol. 22, 2229-2241 (2002).
  33. Izuta, H., et al. Comprehensive analysis of the ICEN (Interphase Centromere Complex) components enriched in the CENP-A chromatin of human cells. Genes to cells : devoted to molecular & cellular mechanisms. 11, 673-684 (2006).
  34. Obuse, C., et al. Proteomics analysis of the centromere complex from HeLa interphase cells: UV-damaged DNA binding protein 1 (DDB-1) is a component of the CEN-complex, while BMI-1 is transiently co-localized with the centromeric region in interphase. Genes Cells. 9, 105-120 (2004).
  35. Merlet, J., Burger, J., Gomes, J. E., Pintard, L. Regulation of cullin-RING E3 ubiquitin-ligases by neddylation and dimerization. Cell Mol Life Sci. 66, 1924-1938 (2009).
  36. Bennett, E. J., Rush, J., Gygi, S. P., Harper, J. W. Dynamics of cullin-RING ubiquitin ligase network revealed by systematic quantitative proteomics. Cell. 143, 951-965 (2010).
  37. Antonelli, A., et al. Efficient inhibition of macrophage TNF-alpha production upon targeted delivery of K48R ubiquitin. Br J Haematol. 104, 475-481 (1999).
  38. Codomo, C. A., Furuyama, T., Henikoff, S. CENP-A octamers do not confer a reduction in nucleosome height by AFM. Nat Struct Mol Biol. 21, 4-5 (2014).
  39. Thrower, J. S., Hoffman, L., Rechsteiner, M., Pickart, C. M. Recognition of the polyubiquitin proteolytic signal. The EMBO journal. 19, 94-102 (2000).
  40. Yoda, K., et al. Human centromere protein A (CENP-A) can replace histone H3 in nucleosome reconstitution in vitro. Proc Natl Acad Sci U S A. 97, 7266-7271 (2000).
  41. Shelby, R. D., Vafa, O., Sullivan, K. F. Assembly of CENP-A into centromeric chromatin requires a cooperative array of nucleosomal DNA contact sites. J Cell Biol. 136, 501-513 (1997).
  42. Majumder, S., Fisk, H. A. Quantitative immunofluorescence assay to measure the variation in protein levels at centrosomes. J Vis Exp. (2014).
  43. Masumoto, H., Masukata, H., Muro, Y., Nozaki, N., Okazaki, T. A human centromere antigen (CENP-B) interacts with a short specific sequence in alphoid DNA, a human centromeric satellite. J Cell Biol. 109, 1963-1973 (1989).
  44. Yoda, K., Kitagawa, K., Masumoto, H., Muro, Y., Okazaki, T. A human centromere protein, CENP-B, has a DNA binding domain containing four potential alpha helices at the NH2 terminus, which is separable from dimerizing activity. J Cell Biol. 119, 1413-1427 (1992).
  45. Sugata, N., et al. Human CENP-H multimers colocalize with CENP-A and CENP-C at active centromere--kinetochore complexes. Hum Mol Genet. 9, 2919-2926 (2000).
  46. Earnshaw, W. C., Ratrie, H. 3rd, Stetten, G. Visualization of centromere proteins CENP-B and CENP-C on a stable dicentric chromosome in cytological spreads. Chromosoma. 98, 1-12 (1989).
  47. Goshima, G., Kiyomitsu, T., Yoda, K., Yanagida, M. Human centromere chromatin protein hMis12, essential for equal segregation, is independent of CENP-A loading pathway. J Cell Biol. 160, 25-39 (2003).
  48. Liu, S. T., Rattner, J. B., Jablonski, S. A., Yen, T. J. Mapping the assembly pathways that specify formation of the trilaminar kinetochore plates in human cells. J Cell Biol. 175, 41-53 (2006).
  49. Gascoigne, K. E., Cheeseman, I. M. T time for point centromeres. Nat Cell Biol. 14, 559-561 (2012).
  50. Gascoigne, K. E., et al. Induced ectopic kinetochore assembly bypasses the requirement for CENP-A nucleosomes. Cell. 145, 410-422 (2011).
  51. Nishino, T., et al. CENP-T provides a structural platform for outer kinetochore assembly. EMBO J. 32, 424-436 (2013).
  52. Malvezzi, F., et al. A structural basis for kinetochore recruitment of the Ndc80 complex via two distinct centromere receptors. EMBO J. 32, 409-423 (2013).
  53. Schleiffer, A., et al. CENP-T proteins are conserved centromere receptors of the Ndc80 complex. Nat Cell Biol. 14, 604-613 (2012).
  54. Rago, F., Gascoigne, K. E., Cheeseman, I. M. Distinct organization and regulation of the outer kinetochore KMN network downstream of CENP-C and CENP-T. Curr Biol. 25, 671-677 (2015).
  55. Nishino, T., et al. CENP-T-W-S-X forms a unique centromeric chromatin structure with a histone-like fold. Cell. 148, 487-501 (2012).
  56. Bodor, D. L., et al. The quantitative architecture of centromeric chromatin. Elife. 3, e02137 (2014).
  57. Oliver, C. Ch 58. Molecular Biomethods Handbook. Rapely, R., Walker, J. M. Humana Press. 1063-1079 (2008).
  58. Terasima, T., Tolmach, L. J. Changes in x-ray sensitivity of HeLa cells during the division cycle. Nature. 190, 1210-1211 (1961).
  59. Levenson, G. B. R. Ch 8. Biomedical Photonics Handbook. Vo-Dinh, T. uan CRC Press LLC. 8-19 (2003).
  60. Sanderson, J. Fluorescence bleed-though. Available from: http://www.gum2012.fionastoreydesign.co.uk/Downloads/Bleed through text.pdf (2011).
Endojen ve İmmünofloresan Analizi ve Eksojen Sentromer-kinetochore Proteinler
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Niikura, Y., Kitagawa, K. Immunofluorescence Analysis of Endogenous and Exogenous Centromere-kinetochore Proteins. J. Vis. Exp. (109), e53732, doi:10.3791/53732 (2016).More

Niikura, Y., Kitagawa, K. Immunofluorescence Analysis of Endogenous and Exogenous Centromere-kinetochore Proteins. J. Vis. Exp. (109), e53732, doi:10.3791/53732 (2016).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter