Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Çeşitli Dokularda Bağışıklık Hücreleri Hastalık bağımlı Dağıtım Fareler ve Değerlendirilmesi Deneysel Otoimmün Ensefalomyelitli indüksiyon

Published: May 8, 2016 doi: 10.3791/53933
* These authors contributed equally

Abstract

Multipl skleroz, bilişsel, motor bozukluğu ile sonuçlanan santral sinir sistemi (CNS) lezyon formasyonu ile karakterize bir enflamatuar otoimmün hastalık, olduğu tahmin edilmektedir. Ayrıca, CNS'de lezyon oluşması, motor hasar ile karakterizedir ve otoimmün ve enflamatuar reaksiyonların etkili olduğu için, deneysel otoimmün ensafalomiyelitis (EAE), MS için yararlı bir hayvan modelidir. EAE modelleri bir miyelin oligodendrosit proteini farede (MOG) 35-55 türetilmiş bir peptit ile indüklenir. EAE fareler ilerleyici bir hastalık seyrini gelişir. Bu ders, üç aşamaya ayrılır: preklinik faz (gün 0-9), hastalık başlangıcı (gün 10 - 11) ve akut faz (gün 12 - 14). MS ve 'EAE CNS infiltre otoreaktif T-hücreleri tarafından indüklenir. Bu T hücreleri, daha bağışıklık hücrelerinin işe neden kemokinler ve sitokinler salgılarlar. Omurilik d nedenle, immün hücre dağılımıÜç hastalık evrelerini uring araştırılmıştır. T hücreleri, B hücreleri ve monositler aktivasyonu / çoğalması / toplama başladığı hastalığın zaman noktası vurgulamak için, lenf düğümleri, dalak ve kan immün hücre dağılımı da değerlendirildi. Ayrıca, üç hastalık aşamalarında çeşitli sitokinlerin (IL-1β, IL-6, IL-23, TNFa, IFNy) seviyeleri, hastalığın enflamatuar süreçleri hakkında bilgi edinmek için, tespit edilmiştir. Sonuç olarak, veri EAE patoloji sırasında bağışıklık hücrelerinin fonksiyonel profilinin bir bakış sağlar.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Multipl skleroz (MS) ve karşılık gelen bir hayvan modeli, deneysel otoimmün ensefalomiyelit (EAE), merkezi sinir sisteminde (CNS) otoimmün nöroenflamasyon değişiklikleri göstermektedir. Erken aktif MS ve 'EAE lezyonlar infiltre bağışıklık hücrelerinin varlığı ile karakterize edilir. Etiolojisi bilinmemektedir, ancak yaygın reaktif T hücrelerinin aracılık ettiği miyelin yıkımına dahil kabul edilir. Bu oto-reaktif T-hücreleri, dolaşım B hücreleri, monositler ve nötrofiller gibi diğer bağışıklık hücreleri çekmek pro-enflamatuar sitokinler ve kemokinleri salgılar. Monositler makrofajlar içine ayırt. reaktif T hücresi tarafından salgılanan interferon gamma (IFNy) pro-enflamatuar makrofajlar içine makrofajları polarizes. oligodendrositlere apoptozu teşvik pro-inflamatuar makrofajlar bırakma sitokinler ve reaktif oksijen türleri. oligodendrosit ölüm demiyelinizasyon yol açar. Bundan başka, B hücreleri, p ayırtsonuçta miyelin bozulması ile sonuçlanan lasma hücreleri ve miyelin kılıf karşı bırakma otoantikorlar. Miyelin kaybı akson ve nöronların bozulması ve böylece MS 1 temel özelliklerini temsil CNS'de lezyon sitelerinin oluşumuna yol açar. Çevresinde, T hücreleri ve B hücreleri, lenf nodüllerinde aktive edilir, bu dalakta çoğalır ve merkezi sinir sistemi içine dolaşım içinden yer değiştirmektedir. Monosit ve nötrofillerin kemik iliğinde çoğalır ve merkezi sinir sistemi içine dolaşımla göç de.

kana veya MSS içine kan kemik iliği, dalak ve lenf düğümleri lökosit ekstravazasyon kemokin ve kemokin reseptörlerinin aracılık ettiği lökositler ve endotel arasındaki moleküler etkileşimler de dahil olmak üzere birçok faktöre bağlıdır çok aşamalı bir süreçtir. çeşitli hücre tipleri tarafından kemokinlerin üretimini bağışıklık reaksiyonunun ne indüklenebilirDaha sonra enflamasyon 2,3 siteye bağışıklık hücrelerini toplayan, tümör nekroz faktörü-a (TNFa), IFNy ve interlökin-6 (IL-6) gibi sitokinlerle n. Bağışıklık hücreleri enflamatuar sitesine hücre tipine ve taşıma yolunun bağlı olarak, kendi yüzeyi üzerinde kemokin reseptörlerinin bir alt sunulmaktadır. Bu nedenle, CXCR2, CCR1 ve CXCR1, kemik iliği ve kanda 4 olgun nötrofiller üzerinde tanımlı ve onun ligandlan, CXCL2, CCL5 ya CXCL6 bağlanması sırasıyla, nötrofil aktive eder ve daha sonra hücre göçü endotele yapışıklıklarını teşvik eder ve dokulara 5-9 içine. CCL2 ve CCL20 sırasıyla CCR2 11 ve CCR6 12 ifade monositler ve Th1 / Th17 hücreleri 10, çekmek. T hücreleri, monositler ve makrofajlar dahil olmak üzere, 13 farklı hücre tipleri tarafından eksprese CCR1 ve CCR5, CCI3, CCL5 ve CCL7 bağlanan ve MS 14 sırasında yukarı düzenlenen edilir. CXCR3 T hücreleri üzerinde ifade edilir ve CCL9, CCL10 bağlanır veCCL11 15.

MS tedavisinde bir ana strateji bağışıklık hücrelerinin azalması veya merkezi sinir sistemi içine bağışıklık hücre infiltrasyonu önlenmesidir. Bu nedenle, belirli bir kemokin reseptörlerinin blokajı EAE de araştırılmıştır. Antagonizma veya CCR1 16, CCR2 17 genetik silme, CCR7 18 veya CXCR2 19 düşmanlık veya CCR1 20 genetik silinmesi ise, CCR5 20 veya CXCR3 21 patolojiye azaltmak vermedi, EAE patoloji azaltır. Bu nedenle, lökositler üzerinde belirli kemokin reseptörlerinin ifadesi MSS içine ikincisi infiltrasyonu için çok önemlidir ve EAE seyrini belirler.

Infiltre bağışıklık hücreleri, sırayla, enflamatuar süreç veya nöron 22 parçalanmasını teşvik, TNFa, IL-6 ve IL-1 gibi sitokinler, serbest, immün hücrelerin tüketiminin MS hastalar için etkili bir tedavi stratejisidir. Ayrıca, otomatikReaktif Th1 hücreleri sırayla TNFa, IL-1 ve IL-23 serbest bırakmak için makrofajları uyarır IFNy, bırakın.

Bu yazıda EAE, immün hücre dağılımı ve EAE farelerde çeşitli dokularda sitokin seviyeleri (mRNA) belirlenmesi indüklenmesini tarif etmektedir. Hücreler son CNS'de lezyon oluşumuna yol enflamatuar süreçlerin bir zamana bağlı bir genel bakış sağlamak amacıyla, hastalığın seyri sırasında farklı zaman noktalarında izole edilmiştir.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

ETİK TABLOSU: Bizim deneysel prosedürler Regierungspräsidium Darmstadt (Almanya) Etik Komitesi tarafından onaylanmış Ulusal ve Avrupa düzenlemelerine teyit edilmiştir. Tüm çabalar hayvan acı en aza indirmek ve kullanılan hayvanların sayısını azaltmak için yapılmıştır.

1. EAE Modeli

  1. EAE modeli indüksiyonu
    1. EAE uyarılması için 10 ila 13 haftalık dişi 129S4 / SvJae x C57BL / 6 fareleri kullanın.
    2. Üst içine farelere subkutan enjeksiyon verin ve ensefalitojenik MOG 35, bel - 400 ug Mycobacterium tuberculosis içeren 200 ul komple Freund`s adjuvan (CFA) emülsifiye 55 (miyelin oligodendrosit glikoprotein) peptid (200 ug).
      Not: negatif olmayan hastalık yapıcı sham kontrol olarak, aynı hacimde, aynı yoldan, Mycobacterium tuberculosis ihtiva eden tam olmayan Freund katkı maddesi kullanılabilir.
    3. Thereafter ve tekrar 24 saat sonra, fareler (200 ul fosfat tamponlu tuzlu su, PBS içinde seyreltilmiş, toplam 0.2 ug), boğmaca toksininin intraperitoneal verir. sağlıklı hayvanlar ile hastalıklı karşılaştırma yapabilmek için, kontrol grubu olarak tedavi görmeyen farelere kullanın.
      Not: 200 EAE uyarılması da mümkündür - 300 ug MOG 35-55 peptidi, 300 - CFA içinde Mycobacterium tuberculosis, 500 ug ve 0.2 - enjeksiyon başına 0.2 ml - 0.3 ug pertussis toksin 0.1 hacminde.
    4. fareler klinik semptomlar günlük, enjeksiyondan sonra bir hafta Schulabschluss başlayarak (adım 1.2.1 bakınız)
      Not: Hastalık başlama gün farklı deneylerde değişir, ancak laboratuarımızda koşullar altında, bu gün 11 civarındadır ve bu nedenle, burada gün 14 3 gün hastalığın başlangıcından sonra, olarak tanımlanır. Mevcut çalışmadaki tüm fareler, klinik semptomlar geliştirmiştir.
  2. Farelerin Puanlama
    1. aşağıdaki gibi klinik skorlar tarafından klinik belirtiler sınıflandırır:0) hiçbir işaret, kuyruk 0.5) distal felci, 1) kuyruk tam felç, 1.5) gevşek kuyruk ve arka bacaklarda hafif güçsüzlük, 2) gevşek kuyruk ve arka bacaklarda şiddetli halsizlik, 2.5) gevşek kuyruk ve felç bir arka bacak, 3) gevşek kuyruk ve her iki arka ayakları felç, arka bacaklarda ve bir ön bacak zayıflığı hem 3.5) paralizi (bu puanı elde fareler) yerel etik kurallara uygun olarak, ötenazi uygulandı.

Sitometrisi Analizi Tek Hücre 2. Hazırlık

Not: Antikor karışımı 1 ul CD45-Vioblue, 2 ul CD8-eFluor650, 0.5 ul CD11b-eFluor605, 0.5 ul F4 / 80-PE-Cy7, 1 ul CD3 PE-CF594, CD4 V500, 0.5 ul CD11c oluşmaktadır -AlexaFluor700, 1 ul CD19-APC-H7 ve 1 ul Ly6G-APC-Cy7.

Not: Eğer kan, lenf düğümü, dalak ve omuriliği alırsak aşağıdaki şekilde prosedür: Fareler derinden isofl bir kombinasyonu ile anestezi edilirURANE ve ketamin (100 mg / kg vücut ağırlığı) (dakika başına karbojen içinde% 2). Sonraki, Toraks açmak bir Intracardial sopayla kan kaldırmak ve soğuk PBS ile intrakardiyak fareler serpmek. Sonra dalak tarafından takip lenf düğümleri ve nihayet omuriliği çıkarın. Eğer intrakardiyak fareler serpmek gerek yoksa o zaman boyun çıkık ile derin anestezi altında fareler euthanize.

  1. splenositlerin izole edilmesi
    1. izofluran (dakika başına karbojen içinde% 2) ve ketamin (100 mg / kg vücut ağırlığı) bir kombinasyonu ile fareler anestezi uygulayın.
    2. % 80 izopropanol ile ıslak kesi alanı makas kullanarak, kıllar ile herhangi bir kirlenmeyi önlemek ve daha derin dokulara delmeden, uzunlamasına toraks açın.
    3. Soğuk PBS pH 7.0 23 intrakardiyak fareler serpmek.
      Not: dalak göğüs kafesine altında sol superior kadranda yer almaktadır. Dalak incelenmesi gereken yalnızca, bu organın retai için perfüzyon önce kaldırılmış olabilirilgi N, tüm hücre tipleri.
    4. dalak çıkarın ve yaklaşık 1/8 kesti ve tartın. Buz üzerinde PBS içerisinde örnek saklayın.
    5. 2 ml şırınga pistonu kullanarak, (50 ml'lik bir tüp üzerine yerleştirilen) 70 mikron elekten dalak doku sıkın.
    6. 5 ml PBS ile örgü yıkayın. 3 dakika boyunca 1.800 xg'de santrifüj. çözüm yokedici 500 ul pelletini.
      Not: Bu aşamada, daha sonra, alternatif bir FACS analizi yöntemi boncuk (bölüm 3) kullanmaz kullanılırsa, eğer farklı hücre sayısı için gerekli olabilir.
    7. Oda sıcaklığında (RT) 10 dakika boyunca inkübe ve 500 ul PBS ilave edin. Oda sıcaklığında 650 xg (RT) 6 dakika santrifüjlenir.
    8. 500 ul PBS ile yıkama adımı yineleyin. 100 ul% 0.2 sığır serum albümini (BSA) hücre pelletini, Süpernatant atılır / PBS, 2 ul Fc reseptörü-1 (FcRI) bloke tampon eklemek ve karanlıkta oda sıcaklığında 15 dakika inkübe edilir.
    9. 13 ul bir eklemetibody Karışım karanlıkta oda sıcaklığında 15 dakika inkübe oda sıcaklığında 650 x g'de 6 dakika boyunca 500 ul PBS ve santrifüj ekleyin. süpernatant atın.
      Not: Üreticinin boyama işlemi, tek bir yıkama önerir, ancak arka plan boyaması ek bir azalma, isteğe bağlı olarak yıkama aşamasından, bir ya da iki kez daha tekrarlanarak elde edilebilir.
    10. (Potansiyel hücre topaklanma azaltmak için protein ayırma veya muhtemelen çalışan tampon) ve tüp flow sitometri transfer hücre 500 ul PBS içinde pelletini. hücreleri buz üzerinde tutun.
  2. Lenf nod hücrelerinin izolasyonu
    1. izofluran (dakika başına karbojen içinde% 2) ve ketamin (100 mg / kg vücut ağırlığı) bir kombinasyonu ile fareler anestezi uygulayın.
    2. % 80 izopropanol ile ıslak kesi alanı ve makas kullanılarak boyuna toraks açın. Soğuk PBS pH 7.0 23 intrakardiyak fareler serpmek.
    3. kasık lenf nodu izole etmek, dikkatli hi bölgesinde cilt kaldırmakp ve forseps ile yağ dokusunun dikkatlice lenf düğümü seçin. kasık lenf düğümü tartılır ve buz üzerinde PBS içerisinde örnek saklayın.
      Not: Biz çalışmaları nedeniyle O`Connor ark kasık lenf nodları kullanılır. aktive edilmiş monositler, makrofajlar, nötrofiller ve T-hücrelerinin yüksek değerleri, tüm EAE indüksiyon 24 sonra, kasık lenf düğümleri içinde mevcut olduğu görülmüştür.
    4. 2 ml şırınga pistonu kullanarak (50 ml'lik bir tüp üzerine yerleştirilen) 70 mikron elekten lenf nodu sıkın.
    5. 5 ml PBS ile örgü yıkayın. 8 dakika boyunca 2.400 xg'de santrifüj. 100 ul% 0.2 BSA / PBS içinde hücre pelletini, 2 ul FcRI bloke tampon eklemek ve karanlıkta oda sıcaklığında 15 dakika inkübe edilir.
    6. 13 mcL antikor karışımı ilave karanlıkta oda sıcaklığında 15 dakika inkübe oda sıcaklığında 650 x g'de 6 dakika boyunca 500 ul PBS ve santrifüj ekleyin.
    7. Süpernatantı atın 300 ul PBS içinde hücre pelletini (ya da, uygun bir çalışma tamponu) tekrar süspansiyon ve transferbir akış sitometrisi tüpüne.
  3. kan hücrelerinin izolasyonu
    1. (EDTA ile stabilize edilmiş) 50 ul kan 50 ul 20 mM HEPES ilave edin ve solüsyonu yokedici 500 ul ilave edin. Oda sıcaklığında 10 dakika boyunca inkübe ve 500 ul PBS ilave edin. Oda sıcaklığında 650 x g'de 6 dakika santrifüjlenir. Süpernatantı atın ve yıkama adımı tekrarlayın.
    2. 100 ul% 0.2 BSA / PBS içinde hücre pelletini, 2 ul FcRI bloke tampon eklemek ve karanlıkta oda sıcaklığında 15 dakika inkübe edilir.
    3. 13 mcL antikor karışımı ilave karanlıkta oda sıcaklığında 15 dakika inkübe oda sıcaklığında 650 x g'de 6 dakika boyunca 500 ul PBS ve santrifüj ekleyin. Süpernatantı atın 300 ul PBS içinde hücre pelletini ve tüp flow sitometri aktarın.
  4. spinal kord hücrelerinin izolasyonu
    1. izofluran (dakika başına karbojen içinde% 2) ve ketamin (100 mg / kg vücut ağırlığı) bir kombinasyonu ile fareler anestezi uygulayın.
    2. Islak kesi% 80 izopropanol ile alan ve uzunlamasına toraks açınmakas kullanılarak. Soğuk PBS pH 7.0 23 intrakardiyak fareler serpmek.
    3. arkasındaki kesi alanı ıslatın ve tekrar bir neşter ile uzunlamasına kesim yapmak ve cilt kaldırmak.
    4. (Arka bacaklarda innerve) omurganın bel kısmını kesip omuriliği ayıklamak için PBS dolu şırınga ile yıkayın. Lomber kablosunun yaklaşık 1/3 kesip bu tartmak ve buz üzerinde PBS örnek saklayın.
    5. 4 ° C'de 2 dakika boyunca 250 x g'de santrifüjleyin. Süpernatantı atın 500 ul hücre dekolmanı çözümü ve HBSS ekleyin (1: 1). , 3 mg / ml kolajenaz A ve 1 birim / mL DNase I ekleme kadar tekrar aşağı pipetleme hücreleri decollate 400 rpm'de 37 ° C'de çalkalama ile 30 dakika boyunca inkübe edin.
      Not: Eğer tercih edilirse, hücre süspansiyonu arka otofloresan An azaltır ve böylece, ölçüm akış sitometrisi duyarlılığını artırmak olabilir yoğunluk gradyan santrifüjü ile miyelin ve hücre artıklarının kontamine silinebilirkazanılmış gereken olayların sayısını d (bakınız bölüm 3.5).
    6. Oda sıcaklığında 2 dakika boyunca 250 x g'de santrifüjleyin. Süpernatantı atın 1 mi,% 10 fetal dana serumu (FCS), pelet tekrar süspansiyon / Dulbecco Minimum Essential Medium (DMEM) ve tekrarlanabilir aşağı pipetleme yeniden hücreleri decollate.
    7. Oda sıcaklığında 2 dakika boyunca 250 x g'de santrifüjleyin. Yıkama adımı yineleyin.
    8. 1 ml PBS içinde hücre pelletini ve 2 ml şırınga pistonu kullanarak (50 ml'lik bir tüp üzerine yerleştirilir), 70 mikron gözenekli bir elekten omurilik sıkın.
    9. 4 mL PBS ile örgü yıkayın. Oda sıcaklığında 3 dakika boyunca 1,800 x g'de santrifüjleyin. Süpernatantı atın 100 ul% 0.2 BSA içinde, hücre pelletini / PBS, 2 ul FcRI bloke reaktif ekleme ve karanlıkta oda sıcaklığında 15 dakika inkübe edilir.
    10. 13 mcL antikor karışımı ilave karanlıkta oda sıcaklığında 15 dakika inkübe oda sıcaklığında 650 x g'de 6 dakika boyunca 500 ul PBS ve santrifüj ekleyin.
    11. Süpernatantı atın hücre Pelle tekrar süspansiyon500 ul PBS içinde T (ya da, uygun bir çalışma tamponu) ve borunun akış sitometrisi aktarın.

3. Akım Sitometrisi Analizi

  1. Olesch ve ark., 25 tarif edildiği gibi uygun konsantrasyonlarını belirlemek için önceden tüm antikorlar titre edilir.
  2. üreticinin talimatlarına göre çok renkli tazminat matrisleri oluşturmak için tek renkli tazminat antikor yakalama tazminat boncuk kullanın.
  3. Günlük üreticinin talimatlarına göre belirli boncuklar kullanılarak alet kalibrasyonu kontrol edin.
  4. Doğrudan ölçüm flow sitometri önce hücrelere 30 ul akım sitometri mutlak sayım standardını eklemek mutlak hücre sayılarını belirlemek için (izolasyon için bölüm 2.1, 2.2, 2.3, 2.4). Bunun yerine sayma boncuklar kullanarak hücreleri sayılabilir.
  5. Bir sitometresi bir akış içine örnekleri (500.000 olayları: 100.000 olaylar, omurilik, dalak, lenf bezi ve kan hücreleri) toplayınnd belirli akış sitometri yazılımını kullanarak analiz eder.
    1. Akış sitometri yazılımını açın ve düğme "örnekleri eklemek" tuşuna basarak FC'ler 3,0 dosyaları ekleyin.
    2. çift ​​tıklayarak eklenen dosyayı açın. x ve y ekseni için kanallar ayarlayın. Ilgi hücre popülasyonlarının bir kapı oluşturmak seçmek için (Şekil 4).

4. Kantitatif PCR Analizi

  1. cDNA içine mRNA izolasyonu ve transkripsiyonu
    1. Fenol-kloroform ile lomber spinal kord (1/3), dalak (1/8) ve inguinal lenf düğümleri mRNA Özü ve etanol 26 ile hızlandırabilir.
      1. Bunun için, 10 dakika süre ile inkübe 1 mi guanidinyum tiosianat-fenol karışımı içinde dokuyu homojenleştirin. 200 ul kloroform eklenir ve 10 dakika boyunca tekrar inkübe edin.
      2. Santrifüj adımının (4 ° C'de 15 dakika boyunca 18,000 x g), üst akıcı faz yıkama 500 ul izopropanol ve santrifüj (4 ° C'de 8 dakika boyunca 18,000 x g ile° C).
      3. 500 ul etanol ile bir santrifüjleme aşama (4 ° C'de 5 dakika boyunca 18,000 x g) işleminden sonra, pelet yıkanır, vakum konsantratör pelet (30 ° C'de 5 dakika) kurutun. Daha sonra, 30 ul su içinde pelletini.
    2. Kan mRNA çıkarmak için santrifüj 500 ul EDTA stabilize kan (300 xg 10 dakika, 4 ° C).
      1. , Ince beyaz tabaka al beyaz kan hücreleri içeren ve çözelti (150 mM NH4CI, 100 mM NaHCO 3, 0.1 mM Na-EDTA, pH 7.4) lize 1 ml seyreltin.
      2. Oda sıcaklığında 10 dakika inkübasyondan sonra, 6 dakika boyunca 650 xg'de hücreleri santrifüj ve daha sonra PBS ile iki kez yıkanır.
      3. Üreticinin talimatlarına uygun olarak, RNA ekstraksiyonu için bir kit kullanılarak, beyaz kan hücreleri (lökosit) mRNA ekstrakte edin.
    3. üreticinin talimatlarına göre rasgele heksamerler içeren cDNA sentezi için bir kit kullanılarak cDNA sentez gerçekleştirir. CDN 200 ng mRNA kullanınBir sentez.
  2. nicel PCR
    1. Belirli bir mRNA'nın miktarının nicelleştirilmesi için, 1 ul cDNA, 1 uM ileri / geri primeri ve üretici talimatlarına 27 göre olan boya bağlayıcı bir fluoresan DNA kullanımı. Primer setleri için diziler için Tablo 1'e bakınız. IL-1 p, CT-değerleri ölçün, IL-6, IL-23, kantitatif PCR sistemi kullanılarak IFNy, TNFa ve PPIA (peptidil prolil izomeraz).
    2. Göreceli mRNA ifadesi karşılaştırmalı BT (çevrim eşik) yöntemini 27 kullanmak belirlemek.
      1. (Önceki çalışmalarda Barthelmes ve ark., 28, Schiffmann ve ark., 29, Schiffmann tarif edildiği gibi, bu için, hedef genden PPIA ortalama CT-değeri çıkarılarak PPIA ekspresyon seviyeleri, hedef genlerin CT-değerlerini normalize ve ark., 30). Daha sonra, ACt-değerlerini normalize hangi kullanarak, sözde ΔΔCT-değerlerini hesaplamakmuamele edilmemiş farelerin hedef genlerin ekspresyonu seviyesine EAE farelerden hedef genlerin yeniden EAE farelerde ACt-değeri tedavi edilmeyen farelerdeki ortalama ACt değer çıkarılarak.
      2. Hedef genin göreceli mRNA ifadesini elde etmek için, aşağıdaki formülü kullanarak oranını hesaplamak: 2 - ΔΔct.
  3. Her astar özgünlüğünü test edin. % 2 agaroz jeli 31 kullanarak amplifiye fragman boyutunu belirler. Parçası boyutu Tablo 1 'de gösterilmiştir.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Şekil 1, bu makalede açıklanan farklı yöntemler şematik bir bakış verir. 1) Fare MOG 35-55 antijen enjeksiyonu almak ve 10.7 ± 0.3 gün 28 sonra ilk klinik belirtiler gelişir. EAE farelerin bir temsilci hastalık kursu. Şekil 1'de 2) Çeşitli dokular (dalak, lenf düğümleri, bel omurilik) gösterilir ve kan preklinik faz (Günlük 2 gün 4 sırasında farklı zaman noktalarında kontrolü ve EAE fareler elde edilir , gün 6), hastalığın başlangıcında (gün 10) ve hastalık (gün 12, gün 14). 3) EAE gelişimini düzenleyen sitokinler, mRNA ekspresyon profili akut fazında çeşitli belirlenir dokular nicel PCR ile, hastalık sırasında farklı zaman noktalarında ekstre edildi. 4) Tek hücre özü, çeşitli dokulardan izole edilirhastalık seyri ve immün hücre dağılımı sırasında farklı zaman noktalarında akış sitometresi ile tespit edildi.

dalak ve lenf düğümleri, T hücreleri ve B hücreleri en önemli hücre tipi olarak görülmektedir. Lenf düğümleri aksine, dalakta, buna ek olarak, monositler ve nötrofillerin yüksek sayıda mevcuttur. Bütün bağışıklık hücreleri, akut fazda lenf düğümlerinde geçici bir artış olduğunu göstermektedir, dalak, sadece makrofajlar, B hücreleri, T hücreleri ve nötrofiller artışı ise. kan, tüm bağışıklık hücrelerinin preklinik aşamasında geçici artar. Lumbar spinal kord, tüm bağışıklık hücreleri bir hastalığa bağlı bir artış dışında, muhtemelen omuriliğe girişlerinin (Şekil 2) sonra, makrofajlara ayırt monositler, gelen görülmektedir. CD4 + ve CD8 + T hücreleri, farklı hastalık aşamalarında sıvı dalak, lenf düğümü ve kanda mukayese edilebilir bir değişiklik gösterir. Amomurilik infiltre Ong hücreleri, CD4 + T hücreleri artış çok (Şekil 3) belirgindir. Şekil 4'te, farklı hücre popülasyonlarının belirlenmesi için yolluk stratejisi gösterilmektedir. monositler (CD45hi, CD3, Ly6G-, CD19-, CD11c-, CD11b +), makrofajlar (CD45hi, CD3, Ly6G-, CD11c-, CD11b +, F4 / aşağıdaki gibidir: ayrıntılı olarak, bu yazıda anlatılan hücre popülasyonları tespit edildi 80hi), nötrofil (CD45hi, CD3-, CD11 b + Ly6G +), dendritik hücreler (CD45hi, CD3, Ly6G-, CD19-, CD11c +), B hücreleri (CD45hi, CD3-, CD19 +), T hücreleri (CD45hi, CD3 +) CD4 + T hücreleri (CD45hi, CD3 +, CD4 +) ve CD8 + T hücreleri (CD45hi, CD3 +, CD8 +). hücre sayısı ve böylece mutlak hücre sayımı yansıtan doku miktarı (dalak ağırlığı, lenf düğümleri, bel omurilik) ya da kan hacmi ile ilgilidir. Toplam hücrelerin yüzdeleri ölçülen hücre tipleri ifade Ancak mümkündür.

LYM içindeIL-6, mRNA'nın sentezlenmesi hastalığa bağlı bir şekilde artmıştır, oysa pH düğümleri, IL-23 mRNA sentezlenmesi, geçici olarak, klinik öncesi fazı sırasında artar. hastalığın başlangıcında IL-1β mRNA ekspresyonu kaldırılırken dalak, IL-6 ve IL-23 mRNA ekspresyonu, klinik öncesi aşamada geçici artar. Kanda, TNFa mRNA'sının ifadesi bir hastalık bağımlı bir şekilde artar. Lumbar spinal kord olarak, TNFa, IL-1β ve akut faz esnasında IFNy artış, IL-6 başlangıçlı faz (Şekil 5) sırasında düzenlenen ise.

Şekil 1

Şekil 1: İndüksiyon ve EAE İmmünolojik Değerlendirme Çalışma Akış Şeması. 1) EAE klinik belirtilerin gelişmesine yol açan farelerde edilir. Klinik bulgular sınıfl vardır0) belirtisi, kuyruk 0.5) distal felç, 1) kuyruk tam felç, 1.5) gevşek kuyruk ve arka bacaklarda hafif güçsüzlük, 2) gevşek kuyruk ve arka bacaklarda şiddetli zayıflık: aşağıdaki gibi klinik puanlarıyla ed 2.5) gevşek ve bir arka bacak, 3) gevşek ve her iki arka bacak paralizi felç. Gösterilen şekil kullanılan fare sayısı farenin hastalık seyri, dalak, kasık lenf düğümleri, kan ve lumbar spinal kord sırasında farklı zaman noktalarında öldürülür) 7. Şekil Barthelmes ve ark., 28 modifiye edilmiştir. 2 olduğu bu dokulardan izole çıkartılan ve tek hücre. 3) çeşitli dokularda Bağışıklık hücre dağılımı, flow sitometri tarafından belirlendiği gibi. 4) kantitatif PCR ile belirlendiği gibi, farklı dokularda farklı sitokinler için mRNA ifadesi. büyük halini görmek için tıklayınız Bu fŞEKIL.

şekil 2
Şekil 2:. Bağışıklık Hücre Dağılımı, FACS (Floresan-Aktif Hücre Sıralama) Dalak Analiz, Lenf düğümü Farklı Hastalık Dönemlerinde EAE fareler ile Kan ve Omurilik Örnekleri tarafından belirlenir deneyde gösterilen, grup başına farelerin sayısı 2 oldu - 10. nötrofillerin dağıtım / kan ve nötrofillerde monositler / omurilikte makrofajlar adapte Barthelmes ark 28 modifiye edilmiştir.. Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

Şekil 3,
Şekil 3: CD4 + T hücresi ve CD8 FACS Analizi ile belirlenir Farklı Hastalık Dönemlerinde EAE fareler ile Örneklerde p> + T hücre dağılımı. A) lenf nodu, B) dalak, C) kan ve D) omurilik. . ± standart hatalar (SEM) anlamına gelir 10. Sonuçları sunulmaktadır - gösterilen deneyde, grup başına farelerin sayısı 2 Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

Şekil 4,
Şekil 4: T Hücreler, Gün 12.) tüm hücrelerden SSC / CD45 bir arsa üzerinde EAE Fare Omurilik B Hücreleri, Nötrofiller, monositler, dendritik hücreler ve Makrofagların akım sitometri analizi için Yolluk Stratejisi. Kapısı:. CD45 + hücresinden CD45 + hücreler B) FSC-H / A arsa FSC-Ws. Kapısı: tek hücre C) Tek hücrelerden SSC-A'nın arsa / FSC-A.. Kapısı: canlı hücreler. D) canlı hücrelerinden FSC H / CD3 bir çizimi. Kapı: CD3 + ve CD3 - hücreleri E) CD3 + hücrelerinden CD4 / CD8 bir arsa.. Kapı: CD4 + CD8 - (CD4 + T hücreleri) ve CD4 -, CD8 + (CD8 + T hücreleri), f) CD3, CD19 ve Ly6G / CD11b bir arsa - hücreleri.. Kapı: CD19 + CD11 - hücreleri (B hücreleri), Ly6G + CD11b + hücrelerinin (nötrofiller) ve CD19 - Ly6G - Hücreler G) CD19 ile CD11c / CD11b hücrelerinin bir arsa - Ly6G - hücre. Kapı CD11c + hücreleri (dendritik hücreler, ) ve CD11c - hücreler H) SSC / F4 / 80 fr bir arsa.om CD11c - hücrelerdir. Kapı: F4 / 80 - hücreler (monositler) ve F4 / 80 + hücreleri (makrofajlar) vardır. 9 Bir temsilci arsa gösterilmiştir. Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

Şekil 5,
Şekil 5:. Sitokin profili (IL-1β, IL-6, IL-23, TNFa, IFNy) değişik hastalık evrelerinde EAE farelerden gelen numuneler içindeki A), lenf düğümü, B) dalak, c) kan ve D), omurilik. mRNA ekspresyon düzeyleri propil izomeraz A (PPIA) peptidil normalize edilmiş ve aynı yaşta tedavi edilmemiş farelerin mRNA düzeyleri hesaplanmıştır. Ölçümler üç kopya halinde yapıldı. 3. Sonuçlar sta ± aracı olarak sunulmuştur - grup başına farelerin sayısı 2 olduard hatalar (SEM). Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

Gen ileri geri Fragement boyutu (bp)
IL-1β CTGGTGTGTGACGTTCCCATTA CCGACAGCACGAGGCTTT 76
IL-6, TAGTCCTTCCTACCCCAATTTCC TTGGTCCTTAGCCACTCCTTC 76
IL-23 GAGCAGCAACTCTGACTGAGCC GAACAGCACAAGTCCTAATGGGTTA 127
IFNy CACGGCACAGTCATTGAAAGC OAKKATCCTTTTGCCAGTTCC 118
TNFa TGACAAGCCTGTAGCCCACG GCCTTGTCCCTTGAAGAGAACC 178
PPIA GCTGGACCAAACACAAACGG GCCATTCCTGGACCCAAAAC 144

Tablo 1: Primer çiftleri.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Burada anlatılan EAE modeli MS bir model olarak çok dikkat çeken ve rutin MS 32 için terapötik stratejilerin test kullanılır. Fare hastalık MS'in birçok klinik ve histolojik özellikleri sergiler ve nöronal antijenlere otoimmünite indüksiyon kaynaklanır. miyelin antijenlerine sensitizasyon CNS, kan-beyin bariyeri bozukluğu ve böylece, bağışıklık hücresi infiltrasyonu ile ilişkilidir. Bulgularımız, bağışıklık hücreleri, akut fazda lenf nodlarında geçici artış olduğunu göstermektedir. Dalak T hücreleri ve B hücreleri, hastalığın klinik öncesi fazı azalmaktadır. Nötrofiller hastalığı bağımlı artış ise kan dolaşımında, T hücreleri, B hücreleri, dendritik hücreler ve monositler, klinik öncesi aşamada geçici artar. Son olarak, omurilik, bağışıklık hücrelerinde bir artış tespit (Şekil 2). Bu veriler, T hücreleri ve B hücreleri hareket dalak, göç göstermektedirBu hücreler için, onlar devreye girer ve çoğalırlar olan lenf düğümlerine bir rezervuar. Daha sonra, bu omuriliğe dolaşım ile göç ederler. Nötrofiller, monositler ve dendritik hücreler, diğer yandan, merkezi sinir sistemi içine hava sirkülasyonu kemik iliğinden göç ederler.

IL-6, geçici hastalığın başlangıcında yukarı regüle edilir ise Verilerimiz, omurilik, IFNy, TNFa ve IL-1β hastalığa bağlı bir şekilde düzenlenmiş göstermektedir. Bu veriler EAE patoloji Th1 ve Th17 hücreleri tarafından tahrik olduğu hipotezini desteklemektedir. Th1 hücreleri sırayla TNFa ve 33, IL-1β serbest bırakmak için makrofajları aktive IFNy, bırakın. Bundan başka, IL-6 Th1 ve Th17 hücrelerinin farklılaşmasını sürücü ve böylece EAE 34 gelişmesini teşvik ettiği bilinir.

Klinik belirtilerin başlamasından hastalığın şiddeti gün EAE farelerde değişkendir. bizim deneyime dayalı, çeşitli r vardırBunun için easons. Klinik öncesi safhasında strese maruz bırakılan farelerde hastalık düşük şiddeti ve hastalığın başlamasında bir gecikme göstermiştir. Farelerin Mahfaza, aynı zamanda EAE şiddetini ve başlangıç ​​gün etkiler. Son zamanlarda, bu farelerin ortakçı Mikrobiyota böylece mikrobiyomu ve EAE patoloji etkileyebilir EAE 35 ve farklı gövde durumların gelişimini etkileyen gösterilmiştir. Ayrıca, taze hazırlanmış boğmaca toksini kullanımı her zaman çok önemlidir. Boğmaca toksini zarar EAE gelişimi için bir ön koşuldur kan beyin bariyeri. Son kullanma tarihinden sonra emülsifiye MOG 35-55 peptid kullanmayın. Farelerin yaşı da EAE patoloji etkiler. Böylece, tekrarlanabilir EAE modeli oluşturmak amacıyla yerine getirilmesi gereken bazı kurallar vardır. mümkünse, aynı tedarikçiden 10 ve 13 hafta ve fareler yaş arası fareler kullanın. Fareler harici bir tedarikçiden sipariş ise, fareler iki iklime alıştırmak için izinHayvan evin içinde haftadır. Onlar işleme alışmak şekilde hafifçe EAE indüksiyon öncesi fareler anlaştım. EAE indüksiyon sonrası gereksiz kullanım kaçının. kolayca kısa sürede klinik belirtiler gösterdiği gibi ulaşabilir gıda ve su ile fareler sağlamak. Fareler bir ilaç ile tedavi edilmesi ise, stres karıştırıcı etkisi önlemek için, yiyecek ya da içme suyu içine karıştırmak için en iyisidir. gavaj veya bir enjeksiyon, ilaç uygulaması için gerekli ise, araç için aynı yol kullanmak önemlidir.

Burada tarif edilen primer progresif EAE modelinde ek olarak, nüks-remisyon EAE modelleri de bulunmaktadır. Farklı seyri çeşitli fare soylarında farklı antijenlerin uygulanması ile indüklenir. Böylece, MOG 35 uygulama - örneğin C57BL / 6, Sv129, B10, NOD ve Biozzi fareler gibi fare suşları, 55 primer progresif hastalık forma yol açar. İlginç bir şekilde, başlangıç ​​günü çeşitli fare soylarında farklıdır. oysaC57BL / 6, SV129 ve B10 fareler Biozzi fareler 21 gün 36 sonra ilk klinik belirtiler gösteren, 12 gün yaklaşık 11 ilk klinik belirtiler gelişir. Önceki bir çalışmada, 129S4 / SvJae x C57BL / 6 melez ilk günden 11 yaklaşık 28 arasında, klinik semptomları sergiledikleri gösterilmiştir. Proteolipid proteininin enjeksiyonu (PLP) 131-151 indüksiyonuna SJL farelerinde açan bir tekrarlayan-düzelen hastalık kursu 37. En iyi EAE modeli araştırma odak bağlıdır kullanın. nüks faz ilgi çekicidir Böylece, eğer nüks-remisyon modeli hastalık başlangıcı ana odak ise oysa istihdam edilmelidir, ilerici bir model kullanılmalıdır. Belirli bir protein rolü knock-out fareler kullanılarak, EAE modelinde de araştırıldı edilecekse, tüm suşlar üzerine EAE hem nakavt soyunun muhtemelen geri çaprazlama uyarılması için kullanılabileceğini akılda tutmak önemlidir duyarlı suş gereklidir.

En çok kullanılan TMS hayvan modellerinin Dosya türleri (1) otoantijen EAE -kaynaklı edilir; (2) viral kendiliğinden kronik demiyelinasyon hastalığı ile indüklenen, ve (3) demiyelinizasyon 38 toksin kaynaklı. EAE modelleri, miyelin oligodendrosit protein veya proteolipid proteini 38 gibi bir oto-antijenik peptidin uygulanması ile enflamasyon ve oto-bağışıklık tepkilerinin indüklenmesi ile karakterize edilir. Spontan EAE miyelin oligodendrosit protein 39 bir peptide karşı bir T hücresi reseptörü aşırı ifade eden transgenik farelerde gelişir. viral kaynaklı kronik enflamasyonu teşvik etmek için, merkezi sinir sisteminin bir nörotrofik enfeksiyonu Theiler`s sıçangil ensefalomiyelit virüsü, örneğin, indüklenebilir. Virüs ile enfekte hücreler hem de T-hücreleri ve humoral tepki saldırısına ve kronik demiyelinasyon 40,41 için ve böylece yol açar. Toksin kaynaklı demiyelinasyon bakır kenetleme maddesi cuprizone 42 örneğin indüklenebilir. Bu model demyeli özellikle yol açarulus cuprizone inflamatuar süreçler sadece küçük bir rol oynar iken, astroglial ve mikroglia aktivasyonu, böylece oligodendrositleri ve potansiyel saldırıları nedeniyle. toksin giderildiğinde, yeni oligodendrosit oluşturulacak yeni bir miyelin kılıfı oluşturulur. Modeller inflamatuar ve immün ve demiyelinizan süreçlere ilişkin farklı olduğundan bu üç modellerin kullanımı, tamamlayıcı bir şekilde, MS patogenezinde farklı yönleri üzerinde ilaç etkisi değerlendirilmesine olanak verir. EAE ve virüs kaynaklı modeli, enflamasyon ve oto-imün süreçlerde öncelikle toksin kaynaklı modelinde ise, hastalık sürücü demiyelinizan ve remyelinating işlemler hâkimdir. MS tedavisi için potansiyel ilaç klinik öncesi testler, en az üç model, bir toksin kaynaklı modeli bir nüks-remisyon EAE ve bir birincil ilerleyici EAE veya viral kaynaklı modelinde ilacın etkinliğini doğrulamak için kullanılır.

EAE modeli onu tarifE gibi Th1, Th17 ve B hücreleri 43,44 olarak hastalığın önemli hücresel sürücüleri belirleme, MS-benzeri hastalık sürecinin gelişiminin mekanizması içine daha fazla fikir edinmek için kullanılabilir. MS gelişmesinde ve teşvik etmek ve lezyonlar çözmek süreçlerin rol inflamatuar ve immün süreçlerin daha iyi anlaşılması, daha büyük olasılıkla yeni tedavi stratejileri geliştirilebilir olmasıdır.

Bununla birlikte, burada açıklanan EAE modeli sadece MS ile ortak bazı özellikleri vardır ve insan hastalığı birkaç belirgin farklılıklar vardır. En önemli fark, MS hastaları EAE modelinde yeniden değil hastalık sunumunda, yaygın farklılık olmasıdır. Bu, MS hastaları ve EAE farelerde ve fareler doğal ırklar olduğu gerçeğine farklı lezyon desen bağlı olabilir. MS hastalarında, öncelikle heterojen lezyonlar iken EAE farelerde, homojen lezyonlar, omurilikte en belirginbeyin 45,46 bulundu. Ayrıca, MS ve EAE bunların geliştirilmesi için, Th1 hücreleri ve Th17 hücrelerinin önemli bir katkı paylaşır, ancak MS aksine, CD8 + T hücreleri EAE patoloji 33 küçük bir rol oynamaktadır. demiyelinizan süreçleri seçici değerlendirmenin daha az yatkın iken Sonuç olarak, EAE modeli otoimmünite, inflamatuar süreçler ve nörodejenerasyon birleşik etkileri üzerinde yoğunlaşmaktadır. Demiyelinizan tat çalışmada 47 işlemler için Bu nedenle, cuprizone modeli gibi başka hayvan modelleri de kullanılabilir. EAE modeli, yine MS 33 faydalı model kusurlu olduğunu, ancak.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
ABI Prism 7500 Sequence Detection System  Applied Biosystems, Austin, USA quantitative PCR system
Accutase Sigma Aldrich Munich, Germany A6964 cell detachment solution
CD3-PE-CF594 BD, Heidelberg, Germany 562286
CD4-V500 BD, Heidelberg, Germany 560782
CD8-eFluor650 eBioscience, Frankfurt, Germany 95-0081-42
CD11b-eFluor605 eBioscience, Frankfurt, Germany 93-0112-42
CD11c-AlexaFluor700 BD, Heidelberg, Germany 560583
CD19-APC-H7  BD, Heidelberg, Germany 560143
CD45-Vioblue  Miltenyi Biotec, Bergisch Gladbach, Germany 130-092-910
CompBeads BD, Heidelberg, Germany 552843 compensation beads
Collagenase A Sigma Aldrich Munich, Germany C0130
Cytometric absolute count standard  Polyscience, Eppelheim, Germany BLI-580-10
Cytometer Setup and Tracking beads  BD, Heidelberg, Germany 642412
DNase I Sigma Aldrich Munich, Germany D5025
EAE Kit Hooke Laboratories, Lawrence, USA EK2110
F4/80-PE-Cy7  BioLegend, Fell, Germany 123114
First Strand cDNA-Synthesis kit  Thermo Scientific, Schwerte, Germany K1612
Fc receptor-1 blocking buffer  Miltenyi Biotec, Bergisch Gladbach, Germany 130-092-575
Flow cytometric absolute count standard Polyscience, Eppelheim, Germany 580
FlowJo software v10  Treestar, Ashland, USA flow cytometry software
LSRII/Fortessa  BD, Heidelberg, Germany flow cytometer
Ly6G-APC-Cy7  BD, Heidelberg, Germany 560600
Lysing solution  BD, Heidelberg, Germany 349202
Maxima SYBR Green  Thermo Scientific, Schwerte, Germany K0221 fluorescent DNA binding dye 
RNeasy Mini Kit  Qiagen, Hilden, Germany 74104 RNA extraction kit

DOWNLOAD MATERIALS LIST

References

  1. McFarland, H. F., Martin, R. Multiple sclerosis: a complicated picture of autoimmunity. Nat Immunol. 8, 913-919 (2007).
  2. Proudfoot, A. E. Chemokine receptors: multifaceted therapeutic targets. Nat Rev Immunol. 2, 106-115 (2002).
  3. Mihara, M., Hashizume, M., Yoshida, H., Suzuki, M., Shiina, M. IL-6/IL-6 receptor system and its role in physiological and pathological conditions. Clin Sci (Lond). 122, 143-159 (2012).
  4. Strydom, N., Rankin, S. M. Regulation of circulating neutrophil numbers under homeostasis and in disease. J Innate Immun. 5, 304-314 (2013).
  5. Kerstetter, A. E., Padovani-Claudio, D. A., Bai, L., Miller, R. H. Inhibition of CXCR2 signaling promotes recovery in models of multiple sclerosis. Exp Neurol. 220, 44-56 (2009).
  6. Kolaczkowska, E., Kubes, P. Neutrophil recruitment and function in health and inflammation. Nat Rev Immunol. 13, 159-175 (2013).
  7. Fan, X., et al. Murine CXCR1 is a functional receptor for GCP-2/CXCL6 and interleukin-8/CXCL8. J Biol Chem. 282, 11658-11666 (2007).
  8. Hartl, D., et al. Infiltrated neutrophils acquire novel chemokine receptor expression and chemokine responsiveness in chronic inflammatory lung diseases. J Immunol. 181, 8053-8067 (2008).
  9. Barcelos, L. S., et al. Role of the chemokines CCL3/MIP-1 alpha and CCL5/RANTES in sponge-induced inflammatory angiogenesis in mice. Microvasc Res. 78, 148-154 (2009).
  10. Wojkowska, D. W., Szpakowski, P., Ksiazek-Winiarek, D., Leszczynski, M., Glabinski, A. Interactions between neutrophils, Th17 cells, and chemokines during the initiation of experimental model of multiple sclerosis. Mediators Inflamm. 590409 (2014).
  11. Bose, S., Cho, J. Role of chemokine CCL2 and its receptor CCR2 in neurodegenerative diseases. Arch Pharm Res. 36, 1039-1050 (2013).
  12. Mony, J. T., Khorooshi, R., Owens, T. Chemokine receptor expression by inflammatory T cells in EAE. Front Cell Neurosci. 8, 187 (2014).
  13. Katschke, K. J. Jr, et al. Differential expression of chemokine receptors on peripheral blood, synovial fluid, and synovial tissue monocytes/macrophages in rheumatoid arthritis. Arthritis Rheum. 44, 1022-1032 (2001).
  14. Trebst, C., et al. CCR1+/CCR5+ mononuclear phagocytes accumulate in the central nervous system of patients with multiple sclerosis. Am J Pathol. 159, 1701-1710 (2001).
  15. Karin, N., Wildbaum, G. The role of chemokines in adjusting the balance between CD4+ effector T cell subsets and FOXp3-negative regulatory T cells. Int Immunopharmacol. (2015).
  16. Rottman, J. B., et al. Leukocyte recruitment during onset of experimental allergic encephalomyelitis is CCR1 dependent. Eur J Immunol. 30, 2372-2377 (2000).
  17. Izikson, L., Klein, R. S., Charo, I. F., Weiner, H. L., Luster, A. D. Resistance to experimental autoimmune encephalomyelitis in mice lacking the CC chemokine receptor (CCR)2. J Exp Med. 192, 1075-1080 (2000).
  18. Kuwabara, T., et al. CCR7 ligands are required for development of experimental autoimmune encephalomyelitis through generating IL-23-dependent Th17 cells. J Immunol. 183, 2513-2521 (2009).
  19. Liu, L., et al. Myelin repair is accelerated by inactivating CXCR2 on nonhematopoietic cells. J Neurosci. 30, 9074-9083 (2010).
  20. Matsui, M., et al. Treatment of experimental autoimmune encephalomyelitis with the chemokine receptor antagonist Met-RANTES. J Neuroimmunol. 128, 16-22 (2002).
  21. Liu, L., et al. Severe disease, unaltered leukocyte migration, and reduced IFN-gamma production in CXCR3-/- mice with experimental autoimmune encephalomyelitis. J Immunol. 176, 4399-4409 (2006).
  22. Lee, M., Suk, K., Kang, Y., McGeer, E., McGeer, P. L. Neurotoxic factors released by stimulated human monocytes and THP-1 cells. Brain Res. 1400, 99-111 (2011).
  23. Gage, G. J., Kipke, D. R., Shain, W. Whole animal perfusion fixation for rodents. J Vis Exp. (2012).
  24. O'Connor, R. A., et al. Adjuvant immunotherapy of experimental autoimmune encephalomyelitis: immature myeloid cells expressing CXCL10 and CXCL16 attract CXCR3+CXCR6+ and myelin-specific T cells to the draining lymph nodes rather than the central nervous system. J Immunol. 188, 2093-2101 (2012).
  25. Olesch, C., et al. MPGES-1-derived PGE2 suppresses CD80 expression on tumor-associated phagocytes to inhibit anti-tumor immune responses in breast cancer. Oncotarget. 6, 10284-10296 (2015).
  26. Chomczynski, P., Sacchi, N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem. 162, 156-159 (1987).
  27. Livak, K. J., Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 25, 402-408 (2001).
  28. Barthelmes, J., et al. Lack of ceramide synthase 2 suppresses the development of experimental autoimmune encephalomyelitis by impairing the migratory capacity of neutrophils. Brain Behav Immun. 46, 280-292 (2015).
  29. Schiffmann, S., et al. Ceramide synthase 6 plays a critical role in the development of experimental autoimmune encephalomyelitis. J Immunol. 188, 5723-5733 (2012).
  30. Schiffmann, S., et al. PGE2/EP4 signaling in peripheral immune cells promotes development of experimental autoimmune encephalomyelitis. Biochem Pharmacol. 87, 625-635 (2014).
  31. Giglio, S., Monis, P. T., Saint, C. P. Demonstration of preferential binding of SYBR Green I to specific DNA fragments in real-time multiplex PCR. Nucleic Acids Res. 31, e136 (2003).
  32. Vesterinen, H. M., et al. Improving the translational hit of experimental treatments in multiple sclerosis. Mult Scler. 16, 1044-1055 (2010).
  33. 't Hart, B. A., Gran, B., Weissert, R. EAE: imperfect but useful models of multiple sclerosis. Trends Mol Med. 17, 119-125 (2011).
  34. Serada, S., et al. IL-6 blockade inhibits the induction of myelin antigen-specific Th17 cells and Th1 cells in experimental autoimmune encephalomyelitis. Proc Natl Acad Sci U S A. 105, 9041-9046 (2008).
  35. Berer, K., et al. Commensal microbiota and myelin autoantigen cooperate to trigger autoimmune demyelination. Nature. 479, 538-541 (2011).
  36. Shetty, A., et al. Immunodominant T-cell epitopes of MOG reside in its transmembrane and cytoplasmic domains in EAE. Neurol Neuroimmunol Neuroinflamm. 1, 22-22 (2014).
  37. Schmitz, K., et al. R-flurbiprofen attenuates experimental autoimmune encephalomyelitis in mice. EMBO Mol Med. 6, 1398-1422 (2014).
  38. Procaccini, C., De Rosa, V., Pucino, V., Formisano, L., Matarese, G. Animal models of Multiple Sclerosis. Eur J Pharmacol. 759, 182-191 (2015).
  39. Pollinger, B., et al. Spontaneous relapsing-remitting EAE in the SJL/J mouse: MOG-reactive transgenic T cells recruit endogenous MOG-specific B cells. J Exp Med. 206, 1303-1316 (2009).
  40. Rodriguez, M., Oleszak, E., Leibowitz, J. Theiler's murine encephalomyelitis: a model of demyelination and persistence of virus. Crit Rev Immunol. 7, 325-365 (1987).
  41. Lipton, H. L. Theiler's virus infection in mice: an unusual biphasic disease process leading to demyelination. Infect Immun. 11, 1147-1155 (1975).
  42. Matsushima, G. K., Morell, P. The neurotoxicant, cuprizone, as a model to study demyelination and remyelination in the central nervous system. Brain Pathol. 11, 107-116 (2001).
  43. El-behi, M., Rostami, A., Ciric, B. Current views on the roles of Th1 and Th17 cells in experimental autoimmune encephalomyelitis. J Neuroimmune Pharmacol. 5, 189-197 (2010).
  44. Mann, M. K., Ray, A., Basu, S., Karp, C. L., Dittel, B. N. Pathogenic and regulatory roles for B cells in experimental autoimmune encephalomyelitis. Autoimmunity. 45, 388-399 (2012).
  45. Lassmann, H., Bruck, W., Lucchinetti, C. F. The immunopathology of multiple sclerosis: an overview. Brain Pathol. 17, 210-218 (2007).
  46. Simmons, S. B., Pierson, E. R., Lee, S. Y., Goverman, J. M. Modeling the heterogeneity of multiple sclerosis in animals. Trends Immunol. 34, 410-422 (2013).
  47. Praet, J., Guglielmetti, C., Berneman, Z., Vander Linden, A., Ponsaerts, P. Cellular and molecular neuropathology of the cuprizone mouse model: clinical relevance for multiple sclerosis. Neurosci Biobehav Rev. 47, 485-505 (2014).
Çeşitli Dokularda Bağışıklık Hücreleri Hastalık bağımlı Dağıtım Fareler ve Değerlendirilmesi Deneysel Otoimmün Ensefalomyelitli indüksiyon
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Barthelmes, J., Tafferner, N., Kurz, J., de Bruin, N., Parnham, M. J., Geisslinger, G., Schiffmann, S. Induction of Experimental Autoimmune Encephalomyelitis in Mice and Evaluation of the Disease-dependent Distribution of Immune Cells in Various Tissues. J. Vis. Exp. (111), e53933, doi:10.3791/53933 (2016).More

Barthelmes, J., Tafferner, N., Kurz, J., de Bruin, N., Parnham, M. J., Geisslinger, G., Schiffmann, S. Induction of Experimental Autoimmune Encephalomyelitis in Mice and Evaluation of the Disease-dependent Distribution of Immune Cells in Various Tissues. J. Vis. Exp. (111), e53933, doi:10.3791/53933 (2016).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter