Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Indução de encefalomielite autoimune experimental em camundongos e avaliação da distribuição da doença dependente de células imunes em vários tecidos

Published: May 8, 2016 doi: 10.3791/53933
* These authors contributed equally

Abstract

A esclerose múltipla é presumido ser uma doença auto-imune inflamatória, que é caracterizada pela formação de lesões no sistema nervoso central (SNC), resultando na deterioração cognitiva e motora. encefalomielite auto-imune experimental (EAE) é um modelo animal útil de EM, uma vez que também é caracterizada pela formação de lesões no sistema nervoso central, perturbações do motor e também é accionado por meio de reacções auto-imunes e inflamatórias. Um dos modelos de EAE é induzida com um péptido derivado da proteína de mielina de oligodendrócitos (MOG) 35-55 em ratos. Os ratos EAE desenvolver um curso doença progressiva. Este curso é dividido em três fases: a fase pré-clínica (dia 0-9), o início da doença (dia 10-11) e a fase aguda (dias 12-14). MS e EAE são induzidas por células T auto-reactivas que se infiltram no SNC. Estas células T segregam citocinas e quimiocinas que conduzem ao recrutamento de outras células do sistema imunológico. Por conseguinte, a distribuição de células imunes na medula espinal durante as três fases da doença foi investigado. Para realçar o ponto de tempo de doença em que a activação / proliferação / acumulação de células T, células B e monócitos é iniciado, a distribuição de células imunes em nódulos linfáticos, baço e sangue foi também avaliada. Além disso, foram determinados os níveis de diversas citocinas (IL-1, IL-6, IL-23, TNFa, IFN-y) nas três fases da doença, para ganhar conhecimento sobre os processos inflamatórios da doença. Em conclusão, os dados fornecem uma visão geral do perfil funcional das células imunitárias durante EAE patologia.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

A esclerose múltipla (MS) e a sua correspondente modelo animal, a encefalomielite autoimune experimental (EAE), mostram alterações neuroinflamação auto-imunes do sistema nervoso central (SNC). Cedo lesões de EM e EAE activas são caracterizadas pela presença de células imunes infiltradas. A etiologia da EM é desconhecida, mas é amplamente consideradas como envolvendo a destruição de mielina mediada por células T auto-reactivas. Estas células T auto-reactivas secretam citoquinas pró-inflamatórias e quimiocinas que atraem outras células imunitárias tais como células B, monócitos e neutrófilos provenientes da circulação. Os monócitos diferenciam-se em macrófagos. O interferão gama (IFN-y) secretado por células T auto-reactivas polariza os macrófagos em macrófagos pró-inflamatórias. As citocinas pró-inflamatórias macrófagos de libertação e de espécies reativas de oxigênio que promovem a apoptose em oligodendrócitos. A morte de oligodendrócitos conduz a desmielinização. Além disso, as células B diferenciam-se em pcélulas LASMA e auto-anticorpos contra a libertação da bainha de mielina, resultando na degradação de mielina. A perda de mielina leva a degradação de axónios e neurónios e, assim, para a formação de locais de lesão no SNC, que representam a característica principal de um MS. No sistema nervoso periférico, as células T e as células B são activadas nos nódulos linfáticos, que proliferam no baço e migram através da circulação para o sistema nervoso central. Os monócitos e neutrófilos proliferam na medula óssea e também migram através da circulação para o sistema nervoso central.

Leucócitos extravasamento a partir da medula óssea, baço e nódulos linfáticos para o sangue ou a partir da corrente sanguínea para o SNC é um processo de passos múltiplos que depende de vários factores, incluindo interacções moleculares entre leucócitos e endotélio mediadas por quimiocinas e receptores de quimiocina. A produção de quimiocinas por vários tipos de células podem ser induzidas durante a reactio imuneN por citocinas como factor de necrose tumoral-α (TNFa), IFN-y e interleucina-6 (IL-6), que, subsequentemente, recruta células imunes para o local da inflamação 2,3. Células imunes apresentar um subconjunto de receptores de quimiocina na sua superfície, dependendo do tipo de célula e via de migração para o local inflamatório. Assim, CXCR2, CCR1 e CXCR1 são expressas em neutrófilos maduros na medula óssea e no sangue 4, e a ligação dos seus ligandos, CXCL2, CCL5 ou CXCL6, respectivamente, activa os neutrófilos e promove a sua adesão ao endotélio e, subsequentemente, a migração das células tecidos em 5-9. CCL2 e CCL20 atrair monócitos e células Th1 / Th17 10, que expressam CCR2 11 e 12 CCR6, respectivamente. CCR1 e CCR5, expressas por diferentes tipos de células, incluindo células T, monócitos e macrófagos, 13, ligam-se CCL3, CCL5 e CCL7 e são regulados positivamente durante 14 MS. CXCR3 é expresso em células T e liga-se CCL9, CCL10 eCCL11 15.

Uma estratégia principal no tratamento de MS é a depleção de células do sistema imunológico ou a prevenção da infiltração de células imunitárias para o SNC. Por isso, o bloqueio dos receptores de quimioquinas específicas tem sido investigada na EAE. Antagonismo ou eliminação genética de CCR1 16, CCR2 17, CCR7 18 ou CXCR2 19 reduz EAE patologia, ao passo que o antagonismo ou eliminação genética de CCR1 20, CCR5 20 ou CXCR3 21 não reduziu a patologia. Assim, a expressão de receptores específicos de quimiocinas nos leucócitos é crucial para a infiltração do último para o SNC e determina o curso da EAE.

A depleção de células imunes é uma estratégia de tratamento eficaz para pacientes com EM, porque as células imunitárias infiltrados libertar citocinas, tais como TNFa, IL-6 e IL-1β, que, por sua vez, promovem o processo inflamatório ou a degradação dos neurónios 22. Além disso, auto-células Th1 IFN-y reactivos solte, que por sua vez estimula os macrófagos para libertar o TNFa, IL-1β e IL-23.

Este manuscrito descreve a indução de EAE, a determinação da distribuição de células imunitárias e os níveis de citocinas (ARNm) em vários tecidos em ratinhos EAE. As células foram isoladas em diferentes pontos de tempo durante o curso da doença para fornecer uma visão geral dependente do tempo dos processos inflamatórios que conduzem finalmente à formação de lesões no sistema nervoso central.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

ÉTICA DECLARAÇÃO: Nossos procedimentos experimentais são aprovados pelo Comitê do Regierungspräsidium Darmstadt (Alemanha) Ética e confirme com os regulamentos nacionais e europeias. Todos os esforços foram feitos para minimizar o sofrimento dos animais e reduzir o número de animais utilizados.

1. EAE Modelo

  1. Indução do modelo de EAE
    1. Use fêmea 129S4 / SvJae × ratinhos C57BL / 6 de 10 a 13 semanas de idade, para a indução de EAE.
    2. Dar aos ratos uma injecção subcutânea, na parte superior e inferior das costas, da encef MOG 35 - peptídeo 55 (mielina de oligodendrócitos glicoproteína) (200 ug), emulsificado em 200 uL de adjuvante completo Freund`s (CFA) contendo 400 ug de Mycobacterium tuberculosis.
      Observação: Como um controlo simulado negativo, não-indução da doença, o adjuvante incompleto de Freund contendo Mycobacterium tuberculosis, no mesmo volume e pela mesma via, pode ser utilizado.
    3. TherEDepois, e novamente 24 horas mais tarde, os ratinhos dar uma injecção intraperitoneal de toxina da tosse convulsa (no total 0,2 mg, diluído em 200 ul de solução salina tamponada com fosfato, PBS). Use ratos não tratados como grupo de controlo, para poder comparar doentes com animais saudáveis.
      Nota: É também possível induzir EAE com 200-300 ug MOG 35-55 péptido, 300-500 ug de Mycobacterium tuberculosis em CFA e 0,2 - 0,3 fig de toxina da tosse convulsa, em um volume de 0,1 - 0,2 ml por injecção.
    4. Começando uma semana após a injecção, examine ratinhos diariamente para sintomas clínicos (ver o passo 1.2.1)
      Nota: No dia de início da doença varia em diferentes experimentos, mas nas condições em nosso laboratório, este é por volta do dia 11 e, portanto, aqui dia 14 é definida como 3 dias após o início da doença. Todos os ratinhos no presente estudo desenvolvido sintomas clínicos.
  2. Scoring dos ratos
    1. Classificar os sintomas clínicos por escores clínicos como segue:0) não há sinais, 0,5) paralisia distal da cauda, ​​1) paralisia completa da cauda, ​​1.5) da cauda flácida e leve fraqueza das patas posteriores, 2) da cauda flácida e fraqueza grave de patas traseiras, 2.5) da cauda flácida e paralisia do uma perna, 3) da cauda flácida e paralisia de ambas as patas traseiras, 3.5) paralisia de ambos os membros posteriores e fraqueza de um dos membros tona (ratos alcançar este resultado foram sacrificados, de acordo com diretrizes éticas locais).

2. Preparação de células individuais para Análise de Citometria de Fluxo

Nota: A mistura de anticorpo consiste de um uL de CD45-Vioblue, 2 ul CD8-eFluor650, 0,5 ul CD11b-eFluor605, 0,5 ul F4 / 80-PE-Cy7, 1 ul CD3-PE-CF594, CD4-V500, 0,5 ul CD11c -AlexaFluor700, 1 uL de CD19-APC-H7 e 1 ul Ly6G-APC-Cy7.

Nota: Se você tomar sangue, gânglios linfáticos, baço e medula espinhal, em seguida, o procedimento é o seguinte: Os ratos são profundamente anestesiados com uma combinação de isoflurane (2% em carbogénio por minuto) e cetamina (100 mg / kg de peso corporal). Em seguida, abra o tórax, remover o sangue com uma vara de intracardíaca e perfundir ratos intracardial com PBS frio. Em seguida, remover os nódulos linfáticos e baço, seguido por, finalmente, a medula espinhal. Se você não precisa perfundir os ratos intracardial então eutanásia os ratos sob anestesia profunda de luxação do pescoço.

  1. Isolamento de esplenócitos
    1. Anestesiar ratos com uma combinação de isoflurano (2% em carbogénio por minuto) e cetamina (100 mg / kg de peso corporal).
    2. área da incisão molhado com 80% isopropanol para evitar qualquer contaminação com cabelos e abrir o tórax longitudinal, sem perfurar tecidos mais profundos, com uma tesoura.
    3. Perfundir ratos intracardial com PBS frio pH 7.0 23.
      Nota: O baço está localizado no quadrante abdominal superior, esquerda abaixo da caixa torácica. Se apenas o baço é para ser estudada, esse órgão pode ser removido antes da perfusão, a fim de Retain todos os tipos de células de interesse.
    4. Remover o baço e cortado aproximadamente 1/8 e pesá-lo. Conservar a amostra em PBS em gelo.
    5. Espremer o tecido do baço através de uma peneira de malha de 70 um (colocada sobre um tubo de 50 ml), utilizando o êmbolo de uma seringa de 2 ml.
    6. Lava-se a malha com 5 ml de PBS. Centrifugar a 1.800 xg durante 3 min. Ressuspender o sedimento em 500 ul de solução de lise.
      Nota: Nesta fase, pode ser necessário fazer uma contagem de células diferenciais se, depois, um método de análise FACS alternativa é usado que não empregam contas (ver secção 3).
    7. Incubar durante 10 minutos à temperatura ambiente (TA) e adicionar 500 ul de PBS. Centrifuga-se durante 6 min a 650 x g à temperatura ambiente (TA).
    8. Repita o passo de lavagem com 500 mL PBS. Descartar o sobrenadante, ressuspender o sedimento celular em 100 uL de 0,2% de albumina de soro bovino (BSA) / PBS, adiciona-se 2 ul de um receptor Fc (FcRI) tampão de bloqueamento e incubar durante 15 min à temperatura ambiente no escuro.
    9. Adicionar 13 ul ummistura tibody, incubar 15 min a RT no escuro, adicionar 500 ul de PBS e centrifuga-se durante 6 min a 650 xg à temperatura ambiente. Descartar o sobrenadante.
      Nota: O procedimento de coloração do fabricante recomenda uma única lavagem, mas a redução da coloração de fundo adicional pode ser conseguida por, opcionalmente, repetir o passo de lavagem mais uma ou duas vezes.
    10. Ressuspender o sedimento celular em 500 ul de PBS (tampão ou, possivelmente, funcionando para a separação de proteínas, para, potencialmente, reduzir a aglutinação de células) e transferi-lo para o tubo de citometria de fluxo. Manter as células no gelo.
  2. Isolamento de células dos nódulos linfáticos
    1. Anestesiar ratos com uma combinação de isoflurano (2% em carbogénio por minuto) e cetamina (100 mg / kg de peso corporal).
    2. área da incisão molhado com 80% de isopropanol e abrir o tórax longitudinalmente com uma tesoura. Perfundir ratos intracardial com PBS frio pH 7.0 23.
    3. Para isolar o linfonodo inguinal, remova cuidadosamente a pele na região do oip e escolher o linfonodo com cuidado para fora do tecido gorduroso com uma pinça. Pesar o linfonodo inguinal e armazenar a amostra em PBS em gelo.
      Nota: Foram utilizados linfonodos inguinais em nossos estudos porque O`Connor et al. descobriram que um elevado número de monócitos activados, macrófagos, neutrófilos e células T estavam todos presentes nos nódulos linfáticos inguinais, após a indução da EAE 24.
    4. Espremer o nó de linfa através de uma peneira de malha de 70 um (colocada sobre um tubo de 50 ml) usando o êmbolo de uma seringa de 2 ml.
    5. Lava-se a malha com 5 ml de PBS. Centrifugar a 2400 xg durante 8 minutos. Ressuspender o sedimento celular em 100 uL de 0,2% de BSA / PBS, adiciona-se 2 ul de tampão de bloqueio FcRI e incubar durante 15 min à temperatura ambiente no escuro.
    6. Adicionar 13 ul de mistura de anticorpo, incubar 15 min a RT no escuro, adicionar 500 mL de PBS e centrifuga-se durante 6 min a 650 xg à temperatura ambiente.
    7. Descartar o sobrenadante, ressuspender o sedimento celular em 300 ul de PBS (ou um tampão de corrida adequado) e transferi-lopara um tubo de citometria de fluxo.
  3. O isolamento de células de sangue
    1. Adicionar 50 ul de HEPES 20 mM e 50 uL de sangue (estabilizada com EDTA) e adicionar 500 ul de solução de lise. Incubar durante 10 min à TA e adicionar 500 ul de PBS. Centrifuga-se durante 6 min a 650 xg à temperatura ambiente. Elimine o sobrenadante e repita o passo de lavagem.
    2. Ressuspender o sedimento celular em 100 uL de 0,2% de BSA / PBS, adiciona-se 2 ul de tampão de bloqueio FcRI e incubar durante 15 min à temperatura ambiente no escuro.
    3. Adicionar 13 ul de mistura de anticorpo, incubar 15 min a RT no escuro, adicionar 500 mL de PBS e centrifuga-se durante 6 min a 650 xg à temperatura ambiente. Descartar o sobrenadante, ressuspender o sedimento celular em 300 ul de PBS e transferi-lo para o tubo de citometria de fluxo.
  4. Isolamento de células da espinal medula
    1. Anestesiar ratos com uma combinação de isoflurano (2% em carbogénio por minuto) e cetamina (100 mg / kg de peso corporal).
    2. área da incisão molhado com 80% de isopropanol e o tórax aberto longitudinalmentecom uma tesoura. Perfundir ratos intracardial com PBS frio pH 7.0 23.
    3. Molhar área da incisão no dorso e fazer de novo um corte longitudinal, com um bisturi e remover a pele.
    4. Cortar a parte lombar da coluna vertebral (o qual inerva as patas traseiras) e lave-o com uma seringa PBS-cheia para extrair a medula espinhal. Cortar aproximadamente 1/3 da medula lombar, pesar isso e armazenar a amostra em PBS em gelo.
    5. Centrifuga-se a 250 xg durante 2 min a 4 ° C. Rejeitar o sobrenadante, adicionar 500 ul de solução de separação celular e HBSS (1: 1). Adiciona-se 3 mg / ml de colagenase A e 1 unidade / ml de ADNase I, as células de degolar repetido cima e para baixo de pipetagem e incubar durante 30 minutos com agitação a 37 ° C a 400 rpm.
      Nota: Se preferido, a suspensão de células podem ser eliminados de contaminar a mielina e os restos celulares por centrifugação em gradiente de densidade, que pode melhorar a sensibilidade da medição de citometria de fluxo, deste modo, reduzir o fundo de um autofluorescênciad o número de eventos que precisam ser adquiridos (ver secção 3.5).
    6. Centrifugar a 250 xg durante 2 min à temperatura ambiente. Descartar o sobrenadante, ressuspender o sedimento em 1 ml de 10% de soro fetal de vitelo (FCS) / meio Dulbecco mínimo essencial (DMEM) e degolar as células novamente repetido por cima e para baixo de pipetagem.
    7. Centrifugar a 250 xg durante 2 min à temperatura ambiente. Repita o passo de lavagem.
    8. Ressuspender o sedimento celular em 1 ml de PBS e espremer medula espinal por meio de uma peneira de malha de 70 um (colocada sobre um tubo de 50 ml) usando o êmbolo de uma seringa de 2 ml.
    9. Lava-se a malha com 4 ml de PBS. Centrifugar a 1.800 xg durante 3 minutos à temperatura ambiente. Descartar o sobrenadante, ressuspender o sedimento celular em 100 uL de 0,2% de BSA / PBS, adiciona-se 2 ul FcRI reagente de bloqueio e incubar durante 15 min à temperatura ambiente no escuro.
    10. Adicionar 13 ul de mistura de anticorpo, incubar 15 min a RT no escuro, adicionar 500 mL de PBS e centrifuga-se durante 6 min a 650 xg à temperatura ambiente.
    11. Descartar o sobrenadante, ressuspender o pelle celulart em 500 ul de PBS (ou um tampão de corrida adequado) e transferi-lo para o tubo de citometria de fluxo.

3. análise citométrica de fluxo

  1. Titular todos os anticorpos de antemão para determinar as concentrações ideais, como descrito por Olesch et al. 25.
  2. Use esferas de compensação de captura de anticorpos para a compensação de cor única para criar matrizes de compensação multi-cor de acordo com as instruções do fabricante.
  3. Controlar a calibração do instrumento diária usando esferas específicas de acordo com as instruções do fabricante.
  4. Directamente antes da citometria de fluxo de medição, adicionar 30 ul de citometria de fluxo padrão de contagem absoluta para as células (para o isolamento ver secção 2.1, 2.2, 2.3, 2.4) para determinar as contagens de células absolutos. Em vez de usar esferas de contagem as células podem ser contadas.
  5. Tome-se amostras (células de baço, nódulo linfático e sangue: 100.000 eventos, medula espinhal: 500.000 eventos) em um citômetro de fluxo umND analisar usando o software específico citometria de fluxo.
    1. Abra o software de citometria de fluxo e adicionar FCS 3,0 arquivos pressionando o botão "adicionar as amostras".
    2. Abra o arquivo adicionado clicando duas vezes. Ajuste os canais para o x e eixo y. Para seleccionar as populações de células de interesse criar um portão (ver Figura 4).

4. Análise de PCR quantitativo

  1. O isolamento de ARNm e a transcrição para ADNc
    1. Extrai-se a partir de ARNm de medula espinal lombar (1/3), baço (1/8) e nódulos linfáticos inguinais por fenol-clorofórmio e precipitado com etanol 26.
      1. Para isso, homogeneizar o tecido em 1 ml de guanidina mistura tiocianato-fenol, incubar durante 10 min. Adicionar 200 ul de clorofórmio e incubar outra vez durante 10 min.
      2. Após um passo de centrifugação (18.000 xg durante 15 min a 4 ° C), lava-se a fase aquosa superior é com 500 uL de isopropanol e centrifugação (18.000 xg durante 8 min a 4° C).
      3. Lavar o sedimento com 500 ul de etanol e depois de um passo de centrifugação (18000 xg durante 5 min a 4 ° C), secar o sedimento no concentrador de vácuo (5 min a 30 ° C). Em seguida, ressuspender o sedimento em 30 ul de água.
    2. Para extrair o ARNm a partir de sangue, de centrífuga de 500 ul de sangue estabilizado-EDTA (300 xg, 10 min 4 ° C).
      1. Aqui o revestimento de Buffy, contendo células brancas do sangue, e dilui-se em 1 ml de solução (150 mM NH 4 Cl, 100 mM de NaHCO3, 0,1 mM de Na-EDTA pH 7,4) de lise.
      2. Após 10 minutos de incubação à temperatura ambiente, centrifugar as células a 650 xg durante 6 minutos e depois lavar duas vezes com PBS.
      3. Extrai-se a partir de ARNm de células brancas do sangue (leucócitos), utilizando um kit de extracção de ARN de acordo com as instruções do fabricante.
    3. Realizar a síntese de ADNc utilizando um kit de síntese de ADNc incluindo hexâmeros aleatórios de acordo com as instruções do fabricante. Use 200 ng mRNA para o CDNUma síntese.
  2. PCR quantitativo
    1. Para quantificar a quantidade de um ARNm específico, usar um ADNc ul, 1 uM de avanço / recuo primário e um corante de ligação de acordo com as instruções do fabricante, 27 de ADN fluorescente. Ver Tabela 1 para as sequências para os conjuntos de iniciadores. Medir as CT-valores de IL-1β, IL-6, IL-23, IFN-y, TNFa e PPIA (peptidil-prolil isomerase), utilizando um sistema de PCR quantitativa.
    2. Para determinar a expressão de ARNm relativa usar o método de CT (limiar de ciclo) comparativo 27.
      1. Para isso, normalizar CT-valores dos genes-alvo para os níveis de PPIA expressão subtraindo a média CT-valor de PPIA a partir do gene alvo, tal como descrito em estudos anteriores (Barthelmes et al. 28, SCHIFFMANN et al. 29, SCHIFFMANN et ai. 30). Posteriormente, calcular os assim chamados ΔΔCT valores, usando o que, normalizar os valores ΔCTdos genes alvo a partir de ratinhos EAE para o nível dos genes alvo de ratinhos não tratados expressão, novamente, subtraindo a média ΔCT-valor nos ratinhos não tratados a partir do valor ΔCT-EAE em ratinhos.
      2. Para obter a expressão de ARNm relativa do gene alvo, calcular a relação com a seguinte fórmula: 2 - ΔΔct.
  3. Testar a especificidade de cada iniciador. Determinar o tamanho do fragmento amplificado utilizando um gel de agarose a 2% 31. O tamanho do fragmento é apresentado na Tabela 1.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

A Figura 1 apresenta uma visão esquemática dos diferentes métodos descritos neste artigo. 1) Os ratos recebem uma injecção de 35-55 antígeno MOG e desenvolver sintomas clínicos iniciais após 10,7 ± 0,3 dias 28. Um curso da doença representativo de ratos EAE é mostrado na Figura 1. 2) de vários tecidos (baço, nódulos linfáticos, lombar da medula espinal) e no sangue são extraídos a partir de ratinhos de controlo e de EAE em diferentes pontos de tempo durante a fase pré-clínica (dia 2, dia 4 , dia 6), durante o início da doença (dia 10) e durante a fase aguda da doença (dia 12, dia 14). 3) o perfil de expressão de ARNm de citoquinas, que regulam o desenvolvimento de EAE, é determinada nos diferentes tecidos extraído em diferentes pontos de tempo durante o curso da doença, utilizando PCR quantitativa. 4) as células individuais são isoladas a partir de vários tecidos extraídosem diferentes pontos de tempo durante o curso da doença e a distribuição de células imunitárias determinado utilizando citometria de fluxo.

No baço e nódulos linfáticos, células T e células B são observados como o tipo de célula mais proeminente. Em contraste com os nódulos linfáticos, no baço, adicionalmente, um elevado número de monócitos e neutrófilos estão presentes. Todas as células imunes mostram um aumento transitório nos gânglios linfáticos durante a fase aguda, ao passo que apenas macrófagos, células B, células T e de neutrófilos aumento do baço. No sangue, todas as células do sistema imunológico aumentar transitoriamente durante a fase pré-clínica. Na medula espinal lombar, um aumento dependente da doença em todas as células do sistema imunológico é observado, para além dos monócitos, o que presumivelmente se diferenciam para macrófagos após a sua entrada para a medula espinhal (figura 2). As células T CD4 + e CD8 + T mostram mudanças comparáveis ​​no baço, nódulo linfático e sangue durante os diferentes cursos de doença. Souong células infiltrantes da medula espinal, o aumento das células T CD4 + foi mais pronunciado (Figura 3). Na Figura 4, a estratégia de propagação para a determinação das diferentes populações de células é mostrada. Em detalhe, as populações de células descritos neste manuscrito foram identificados como segue: monócitos (CD45hi, CD3-, Ly6G-, CD19-, CD11c-, CD11b +), macrófagos (CD45hi, CD3-, Ly6G-, CD11c-, CD11b +, F4 / 80hi), neutrófilos (CD45hi, CD3-, CD11b +, Ly6G +), células dendríticas (CD45hi, CD3-, Ly6G-, CD19-, CD11c +), células B (CD45hi, CD3-, CD19 +), células T (CD45hi, CD3 +) , as células T CD4 + (CD45hi, CD3 +, CD4 +) e células T CD8 + (CD45hi, CD3 +, CD8 +). Os números de células estão relacionados com a quantidade de tecido (peso do baço, nódulos linfáticos, medula espinal lombar) ou o volume de sangue, reflectindo assim a contagem absoluta de células. É, no entanto, possível expressar os tipos de células como percentagens de células totais medidos.

em lymnodos de pH, a expressão de mRNA de IL-23 é transientemente aumentado durante a fase pré-clínica, ao passo que a expressão de ARNm de IL-6 é aumentada de uma maneira dependente da doença. No baço, IL-6 e IL-23 aumenta a expressão de ARNm de forma transiente na fase pré-clínica, enquanto ao início da doença, a expressão de ARNm de IL-1β é levantada. No sangue, a expressão de mRNA de TNFa é aumentada de uma maneira dependente da doença. Na medula espinal lombar, TNFa, IL-1β e aumento de IFNy, durante a fase aguda, enquanto que a IL-6 é regulada positivamente durante a fase de início (Figura 5).

figura 1

Figura 1: Esquema do fluxo de trabalho para indução e avaliação imunológica de EAE. 1) A EAE é induzida em ratinhos que conduzem ao desenvolvimento de sintomas clínicos. Os sintomas clínicos são classified por pontuações clínicas, como se segue: 0) não há sinais, 0,5) paralisia distai da cauda, ​​1) paralisia completa da cauda, ​​1,5) cauda flácida e fraqueza leve de pernas traseiras, 2) da cauda flácida e fraqueza grave dos membros posteriores , 2.5) da cauda flácida e paralisia de uma perna, 3) da cauda flácida e paralisia de ambas as patas traseiras. O número de murganhos utilizados na figura mostrada era 7. A figura foi modificado a partir do Barthelmes et al. 28, 2.) Os ratinhos são sacrificados em diferentes pontos de tempo durante o curso da doença, o baço, os nódulos linfáticos inguinais, do sangue e da medula espinal lombar células extraídas e individuais isoladas a partir destes tecidos. 3) de distribuição de células imunes em vários tecidos, tal como determinado por citometria de fluxo. 4) expressão de RNAm para várias citocinas nos diferentes tecidos, tal como determinada por PCR quantitativa. por favor clique aqui para ver uma versão maior deste figura.

Figura 2
Figura 2:. Distribuição de células imunes, determinado por FACS (activadas por fluorescência celular) Análise no baço, linfonodos, do sangue e da medula espinhal amostras de EAE ratos em diferentes fases da doença No experimento mostrado, o número de ratos por grupo foi de 2 - 10. a distribuição de neutrófilos / monócitos no sangue e neutrófilos / macrófagos na medula espinhal são adaptados e modificados a partir Barthelmes et al 28.. por favor clique aqui para ver uma versão maior desta figura.

Figura 3
Figura 3: células T CD4 + e CD8 Distribuição de células T em amostras de EAE ratos em diferentes fases da doença, determinado por análise FACS. A) nódulos linfáticos, baço B), C) no sangue e D) da medula espinhal. No experimento mostrado, o número de ratos por grupo foi de 2 - 10. Os resultados são apresentados como médias ± erros padrão (SEM). Por favor, clique aqui para ver uma versão maior desta figura.

Figura 4
Figura 4: Estratégia para bloquear da Análise de citometria de fluxo de células T, células B, neutrófilos, monócitos, células dendríticas e macrófagos de medula espinal de ratos EAE no dia 12. A) Um lote de SSC / CD45 a partir de todas as células. Gate:. CD45 + células B) Um lote de FSC-H / FSC-W a partir de células CD45 +s. Gate: células individuais C) Um lote de SSC-A / FSC-A a partir de células individuais.. Gate: células viáveis. D) A trama do FSC-H / CD3 de células viáveis. Gate: CD3 + e CD3 - células E) Um lote de CD4 / CD8 a partir de células CD3 +.. Gate: CD4 + CD8 - (células T CD4 +) e CD4 - CD8 + (células T CD8 +) F) Um lote de CD19 e Ly6G / CD11b de CD3 - células.. Gate: CD19 + CD11b - células (células B), Ly6G + CD11b + células (neutrófilos) e CD19 - Ly6G - células G) num lote de células CD11c / CD11b de CD19 - Ly6G - células:. Portão CD11c + células (células dendríticas ) e CD11c - células H) num lote de SSC / F4 / 80 fr.om CD11c - células. Gate: F4 / 80 - células (monócitos) e F4 / 80 + células (macrófagos). Uma parcela representativa de 9 é mostrado. Por favor clique aqui para ver uma versão maior desta figura.

Figura 5
Figura 5:. Perfil de citocinas (IL-1β, IL-6, IL-23, TNFa, IFN-y) em amostras de EAE Os ratinhos em diferentes fases da doença A) nódulo linfático, baço B), C), sangue e D) da medula espinal. os níveis de expressão de ARNm foram normalizados para peptidilo propil isomerase a (PPIA) e foram calculados usando o nível de ARNm de ratinhos não tratados da mesma idade. As medições foram realizadas em triplicado. O número de murganhos por grupo foi 2 - 3. Os resultados são apresentados como médias ± STAerros ndard (SEM). Por favor clique aqui para ver uma versão maior desta figura.

Gene para a frente reverso tamanho fragement (PA)
IL-1β CTGGTGTGTGACGTTCCCATTA CCGACAGCACGAGGCTTT 76
IL-6 TAGTCCTTCCTACCCCAATTTCC TTGGTCCTTAGCCACTCCTTC 76
IL-23 GAGCAGCAACTCTGACTGAGCC GAACAGCACAAGTCCTAATGGGTTA 127
IFN-y CACGGCACAGTCATTGAAAGC CACCATCCTTTTGCCAGTTCC 118
TNFa TGACAAGCCTGTAGCCCACG GCCTTGTCCCTTGAAGAGAACC 178
PPIA GCTGGACCAAACACAAACGG GCCATTCCTGGACCCAAAAC 144

Tabela 1: Os pares de iniciadores.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

O modelo de EAE descrito aqui tem recebido mais atenção como um modelo de MS e é utilizado rotineiramente em testar estratégias terapêuticas para MS 32. A doença do rato apresenta muitas características clínicas e histológicas de MS e é causada pela indução de auto-imunidade a antígenos neuronais. A sensibilidade aos antigénios de mielina está associada com disfunção cerebral barreira sangue e, desse modo, a infiltração de células imunes para o SNC. Nossos resultados mostram que as células imunes aumentar transitoriamente nos gânglios linfáticos na fase aguda. As células do baço T e células B diminuir na fase pré-clínica da doença. Em sangue em circulação, células T, células B, células dendríticas e monócitos aumentar transitoriamente na fase pré-clínica, enquanto que os neutrófilos aumentar de forma dependente da doença. Finalmente, na medula espinhal, um aumento das células imunitárias é detectável (Figura 2). Estes dados indicam que as células T e células B migram a partir do baço, que actuaum reservatório para estas células, para os gânglios linfáticos, onde eles são activados e proliferam. Subsequentemente, elas migram através da circulação para a medula espinhal. Os neutrófilos, monócitos e células dendríticas, por outro lado, migra a partir da medula óssea através da circulação para o SNC.

Os dados revelam que na medula espinal, IFNy, TNFa e IL-1β são reguladas de um modo dependente da doença, enquanto que a IL-6 é transitoriamente regulada no início da doença. Estes dados suportam a hipótese de que a EAE patologia é conduzida por células Th1 e Th17. Células Th1 IFN-y solte, que por sua vez activa os macrófagos para libertar o TNFa e IL-1β 33. Além disso, a IL-6 é conhecida por conduzir a diferenciação de células Th1 e Th17 e, assim, promover o desenvolvimento de EAE 34.

O dia de aparecimento de sintomas clínicos e a gravidade da doença é variável em ratinhos EAE. Com base em nossa experiência, há vários rOTIVOS para isso. Os ratos expostos a stress durante a fase de pré-clínicos mostram uma redução da gravidade da doença e um atraso no início da doença. O alojamento dos ratinhos também influencia a gravidade da EAE e também o dia de início. Recentemente, foi mostrado que a microbiota comensal de ratinhos influenciar o desenvolvimento de EAE e 35 diferentes situações de habitação pode influenciar a microbiota e, desse modo, a patologia de EAE. Além disso, é muito importante sempre o uso de toxina pertussis preparada de fresco. Pertussis toxina danos a barreira hematoencefálica, que é um pré-requisito para o desenvolvimento de EAE. Não use emulsionado MOG 35-55 peptídeo após a data de validade. A idade dos ratos também influencia EAE patologia. Assim, há algumas regras que devem ser cumpridas de modo a gerar um modelo de EAE reprodutível. Use camundongos com idade entre 10 e 13 semanas e ratos do mesmo fornecedor, se possível. Se os ratos são solicitados a um fornecedor externo, permitem que os ratinhos a aclimatizar durante doissemanas na casa dos animais. Lidar com os ratos com cuidado antes da indução EAE para que eles se acostumar com o manuseio. Evite o manuseio desnecessário após a indução da EAE. Fornecer os ratos com comida e água que pode chegar facilmente assim que eles mostram sintomas clínicos. Se os ratinhos são para ser tratado com um fármaco, o melhor é misturá-lo na comida ou água potável, para evitar confundir os efeitos do stress. Se sonda gástrica ou uma injecção é essencial para a administração do fármaco, é importante utilizar o mesmo percurso para o veículo.

Além do modelo de EAE progressiva primária aqui descrito, os modelos de EAE de recaída-remissão também existem. O curso da doença diferente é induzida pela administração de diferentes antígenos em várias linhagens de camundongos. Assim, a aplicação de MOG 35-55 em estirpes de murganhos, tais como C57BL / 6, Sv129, B10, NOD e ratos Biozzi, conduz a uma forma de doença progressiva primária. Curiosamente, o dia de início é diferente nas várias estirpes de ratinho. enquanto queC57BL / 6, SV129 e ratos B10 desenvolver primeiros sintomas clínicos de cerca de dia 11 a 12, os ratos Biozzi mostrar primeiros sintomas clínicos após 21 dias 36. Num estudo anterior, verificou-se que 129S4 / SvJae × C57BL / 6 híbridos primeira exibem sintomas clínicos desde cerca de 11 dias 28. A injecção da proteína proteolipidica (PLP) 131-151 leva em ratinhos SJL para a indução de uma remitente- curso da doença 37. O melhor modelo de EAE para usar dependerá do foco da pesquisa. Assim, se a fase de recaída é de interesse, o modelo-remitente recaída deve ser empregado ao passo que se o início da doença é o foco principal, deve ser utilizado o modelo progressivo. Se o papel de uma proteína específica deve ser investigado no modelo de EAE, utilizando camundongos knock-out, é importante ter em mente que nem todas as estirpes pode ser usado para induzir a EAE e possivelmente backcrossing da estirpe knock-out para um estirpe sensível é necessário.

Os três mais amplamente utilizados types de modelos animais de MS são (1) autoantig�io induzida EAE; (2) viralmente induzidas, doença desmielinizante crónica espontânea, e (3) toxina induzida por desmielinização 38. Os modelos de EAE são caracterizados pela indução de inflamação e respostas auto-imunes pela aplicação de um péptido autoantigenic tais como a proteína de mielina de oligodendrócitos ou proteína proteolipídica 38. Espontânea desenvolve EAE em ratinhos transgénicos que sobre-expressam um receptor de células T contra um péptido da proteína de oligodendrócitos de mielina 39. Para induzir a inflamação crónica induzida por vírus, uma infecção neurotrófico do sistema nervoso central pode ser induzida, por exemplo, com o vírus da encefalomielite Theiler`s murino. As células infectadas com o vírus é atacado por ambas as células T e uma resposta humoral e conduzir assim à desmielinização crónica 40,41. Induzida por toxina da desmielinização pode ser induzida, por exemplo, com o quelante de cobre cuprizona 42. Este modelo conduz especificamente a demyelinação, porque cuprizona ataca os oligodendrócitos e leva, assim, a ativação de astroglia e microglia, enquanto que processos inflamatórios desempenham apenas um papel menor. Após a eliminação da toxina, novos oligodendrócitos são gerados e uma nova bainha de mielina é formada. A utilização destes três modelos, de uma forma complementar, permite a avaliação dos efeitos da droga sobre os diferentes aspectos da patogénese da EM, porque os modelos diferem no que diz respeito a processos inflamatórios e imunes e desmielinizantes. Em EAE e a induzida por vírus modelo, a inflamação e dirigir processos auto-imunes, principalmente da doença, enquanto que no modelo induzido por toxina, desmielinização e remielinização processos são predominantes. Para testes pré-clínicos de potenciais fármacos para o tratamento de MS, pelo menos, três modelos, o modelo induzido por toxina, um EAE de recaída-remissão e um EAE progressiva primária ou um modelo induzida por vírus deve ser utilizado para verificar a eficácia da droga.

O modelo de EAE descreveu suae podem ser usadas para obter mais conhecimentos sobre o mecanismo do desenvolvimento do processo da doença MS-like, identificando os principais factores celulares da doença, tais como Th1, Th17 e células B 43,44. Quanto melhor a compreensão dos processos inflamatórios e imunológicos envolvidos no desenvolvimento da EM e um dos processos que promovem e resolver as lesões, o mais provável é que novas estratégias de tratamento pode ser desenvolvido.

No entanto, o modelo de EAE descrita aqui apenas tem algumas características em comum com o MS, e apresenta algumas diferenças claras da doença humana. A diferença mais importante é que pacientes com EM variam muito em apresentação da doença, o que não é reproduzido no modelo de EAE. Isto pode ser devido a diferentes padrões de lesão em pacientes de EM e EAE ratinhos e para o facto de que os ratos são estirpes endogâmicas. Em ratinhos EAE, lesões homogéneos são mais proeminentes na medula espinal, enquanto que em pacientes com esclerose múltipla, lesões principalmente heterogéneos sãoencontrado no cérebro 45,46. Além disso, a EM e EAE partilhar a contribuição fundamental das células Th1 e Th17 células para o seu desenvolvimento, mas em contraste com MS, células T CD8 + desempenham um papel menor na EAE patologia 33. Em conclusão, o modelo EAE incide principalmente sobre os efeitos combinados de auto-imunidade, processos inflamatórios e neurodegeneração enquanto os processos desmielinizantes são menos passíveis de avaliação seletiva. Portanto, outros modelos animais, tais como o modelo cuprizona pode ser usado para o estudo distinto de desmielinizante processa 47. O modelo EAE é imperfeito, mas, no entanto, um modelo útil de MS 33.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
ABI Prism 7500 Sequence Detection System  Applied Biosystems, Austin, USA quantitative PCR system
Accutase Sigma Aldrich Munich, Germany A6964 cell detachment solution
CD3-PE-CF594 BD, Heidelberg, Germany 562286
CD4-V500 BD, Heidelberg, Germany 560782
CD8-eFluor650 eBioscience, Frankfurt, Germany 95-0081-42
CD11b-eFluor605 eBioscience, Frankfurt, Germany 93-0112-42
CD11c-AlexaFluor700 BD, Heidelberg, Germany 560583
CD19-APC-H7  BD, Heidelberg, Germany 560143
CD45-Vioblue  Miltenyi Biotec, Bergisch Gladbach, Germany 130-092-910
CompBeads BD, Heidelberg, Germany 552843 compensation beads
Collagenase A Sigma Aldrich Munich, Germany C0130
Cytometric absolute count standard  Polyscience, Eppelheim, Germany BLI-580-10
Cytometer Setup and Tracking beads  BD, Heidelberg, Germany 642412
DNase I Sigma Aldrich Munich, Germany D5025
EAE Kit Hooke Laboratories, Lawrence, USA EK2110
F4/80-PE-Cy7  BioLegend, Fell, Germany 123114
First Strand cDNA-Synthesis kit  Thermo Scientific, Schwerte, Germany K1612
Fc receptor-1 blocking buffer  Miltenyi Biotec, Bergisch Gladbach, Germany 130-092-575
Flow cytometric absolute count standard Polyscience, Eppelheim, Germany 580
FlowJo software v10  Treestar, Ashland, USA flow cytometry software
LSRII/Fortessa  BD, Heidelberg, Germany flow cytometer
Ly6G-APC-Cy7  BD, Heidelberg, Germany 560600
Lysing solution  BD, Heidelberg, Germany 349202
Maxima SYBR Green  Thermo Scientific, Schwerte, Germany K0221 fluorescent DNA binding dye 
RNeasy Mini Kit  Qiagen, Hilden, Germany 74104 RNA extraction kit

DOWNLOAD MATERIALS LIST

References

  1. McFarland, H. F., Martin, R. Multiple sclerosis: a complicated picture of autoimmunity. Nat Immunol. 8, 913-919 (2007).
  2. Proudfoot, A. E. Chemokine receptors: multifaceted therapeutic targets. Nat Rev Immunol. 2, 106-115 (2002).
  3. Mihara, M., Hashizume, M., Yoshida, H., Suzuki, M., Shiina, M. IL-6/IL-6 receptor system and its role in physiological and pathological conditions. Clin Sci (Lond). 122, 143-159 (2012).
  4. Strydom, N., Rankin, S. M. Regulation of circulating neutrophil numbers under homeostasis and in disease. J Innate Immun. 5, 304-314 (2013).
  5. Kerstetter, A. E., Padovani-Claudio, D. A., Bai, L., Miller, R. H. Inhibition of CXCR2 signaling promotes recovery in models of multiple sclerosis. Exp Neurol. 220, 44-56 (2009).
  6. Kolaczkowska, E., Kubes, P. Neutrophil recruitment and function in health and inflammation. Nat Rev Immunol. 13, 159-175 (2013).
  7. Fan, X., et al. Murine CXCR1 is a functional receptor for GCP-2/CXCL6 and interleukin-8/CXCL8. J Biol Chem. 282, 11658-11666 (2007).
  8. Hartl, D., et al. Infiltrated neutrophils acquire novel chemokine receptor expression and chemokine responsiveness in chronic inflammatory lung diseases. J Immunol. 181, 8053-8067 (2008).
  9. Barcelos, L. S., et al. Role of the chemokines CCL3/MIP-1 alpha and CCL5/RANTES in sponge-induced inflammatory angiogenesis in mice. Microvasc Res. 78, 148-154 (2009).
  10. Wojkowska, D. W., Szpakowski, P., Ksiazek-Winiarek, D., Leszczynski, M., Glabinski, A. Interactions between neutrophils, Th17 cells, and chemokines during the initiation of experimental model of multiple sclerosis. Mediators Inflamm. 590409 (2014).
  11. Bose, S., Cho, J. Role of chemokine CCL2 and its receptor CCR2 in neurodegenerative diseases. Arch Pharm Res. 36, 1039-1050 (2013).
  12. Mony, J. T., Khorooshi, R., Owens, T. Chemokine receptor expression by inflammatory T cells in EAE. Front Cell Neurosci. 8, 187 (2014).
  13. Katschke, K. J. Jr, et al. Differential expression of chemokine receptors on peripheral blood, synovial fluid, and synovial tissue monocytes/macrophages in rheumatoid arthritis. Arthritis Rheum. 44, 1022-1032 (2001).
  14. Trebst, C., et al. CCR1+/CCR5+ mononuclear phagocytes accumulate in the central nervous system of patients with multiple sclerosis. Am J Pathol. 159, 1701-1710 (2001).
  15. Karin, N., Wildbaum, G. The role of chemokines in adjusting the balance between CD4+ effector T cell subsets and FOXp3-negative regulatory T cells. Int Immunopharmacol. (2015).
  16. Rottman, J. B., et al. Leukocyte recruitment during onset of experimental allergic encephalomyelitis is CCR1 dependent. Eur J Immunol. 30, 2372-2377 (2000).
  17. Izikson, L., Klein, R. S., Charo, I. F., Weiner, H. L., Luster, A. D. Resistance to experimental autoimmune encephalomyelitis in mice lacking the CC chemokine receptor (CCR)2. J Exp Med. 192, 1075-1080 (2000).
  18. Kuwabara, T., et al. CCR7 ligands are required for development of experimental autoimmune encephalomyelitis through generating IL-23-dependent Th17 cells. J Immunol. 183, 2513-2521 (2009).
  19. Liu, L., et al. Myelin repair is accelerated by inactivating CXCR2 on nonhematopoietic cells. J Neurosci. 30, 9074-9083 (2010).
  20. Matsui, M., et al. Treatment of experimental autoimmune encephalomyelitis with the chemokine receptor antagonist Met-RANTES. J Neuroimmunol. 128, 16-22 (2002).
  21. Liu, L., et al. Severe disease, unaltered leukocyte migration, and reduced IFN-gamma production in CXCR3-/- mice with experimental autoimmune encephalomyelitis. J Immunol. 176, 4399-4409 (2006).
  22. Lee, M., Suk, K., Kang, Y., McGeer, E., McGeer, P. L. Neurotoxic factors released by stimulated human monocytes and THP-1 cells. Brain Res. 1400, 99-111 (2011).
  23. Gage, G. J., Kipke, D. R., Shain, W. Whole animal perfusion fixation for rodents. J Vis Exp. (2012).
  24. O'Connor, R. A., et al. Adjuvant immunotherapy of experimental autoimmune encephalomyelitis: immature myeloid cells expressing CXCL10 and CXCL16 attract CXCR3+CXCR6+ and myelin-specific T cells to the draining lymph nodes rather than the central nervous system. J Immunol. 188, 2093-2101 (2012).
  25. Olesch, C., et al. MPGES-1-derived PGE2 suppresses CD80 expression on tumor-associated phagocytes to inhibit anti-tumor immune responses in breast cancer. Oncotarget. 6, 10284-10296 (2015).
  26. Chomczynski, P., Sacchi, N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem. 162, 156-159 (1987).
  27. Livak, K. J., Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 25, 402-408 (2001).
  28. Barthelmes, J., et al. Lack of ceramide synthase 2 suppresses the development of experimental autoimmune encephalomyelitis by impairing the migratory capacity of neutrophils. Brain Behav Immun. 46, 280-292 (2015).
  29. Schiffmann, S., et al. Ceramide synthase 6 plays a critical role in the development of experimental autoimmune encephalomyelitis. J Immunol. 188, 5723-5733 (2012).
  30. Schiffmann, S., et al. PGE2/EP4 signaling in peripheral immune cells promotes development of experimental autoimmune encephalomyelitis. Biochem Pharmacol. 87, 625-635 (2014).
  31. Giglio, S., Monis, P. T., Saint, C. P. Demonstration of preferential binding of SYBR Green I to specific DNA fragments in real-time multiplex PCR. Nucleic Acids Res. 31, e136 (2003).
  32. Vesterinen, H. M., et al. Improving the translational hit of experimental treatments in multiple sclerosis. Mult Scler. 16, 1044-1055 (2010).
  33. 't Hart, B. A., Gran, B., Weissert, R. EAE: imperfect but useful models of multiple sclerosis. Trends Mol Med. 17, 119-125 (2011).
  34. Serada, S., et al. IL-6 blockade inhibits the induction of myelin antigen-specific Th17 cells and Th1 cells in experimental autoimmune encephalomyelitis. Proc Natl Acad Sci U S A. 105, 9041-9046 (2008).
  35. Berer, K., et al. Commensal microbiota and myelin autoantigen cooperate to trigger autoimmune demyelination. Nature. 479, 538-541 (2011).
  36. Shetty, A., et al. Immunodominant T-cell epitopes of MOG reside in its transmembrane and cytoplasmic domains in EAE. Neurol Neuroimmunol Neuroinflamm. 1, 22-22 (2014).
  37. Schmitz, K., et al. R-flurbiprofen attenuates experimental autoimmune encephalomyelitis in mice. EMBO Mol Med. 6, 1398-1422 (2014).
  38. Procaccini, C., De Rosa, V., Pucino, V., Formisano, L., Matarese, G. Animal models of Multiple Sclerosis. Eur J Pharmacol. 759, 182-191 (2015).
  39. Pollinger, B., et al. Spontaneous relapsing-remitting EAE in the SJL/J mouse: MOG-reactive transgenic T cells recruit endogenous MOG-specific B cells. J Exp Med. 206, 1303-1316 (2009).
  40. Rodriguez, M., Oleszak, E., Leibowitz, J. Theiler's murine encephalomyelitis: a model of demyelination and persistence of virus. Crit Rev Immunol. 7, 325-365 (1987).
  41. Lipton, H. L. Theiler's virus infection in mice: an unusual biphasic disease process leading to demyelination. Infect Immun. 11, 1147-1155 (1975).
  42. Matsushima, G. K., Morell, P. The neurotoxicant, cuprizone, as a model to study demyelination and remyelination in the central nervous system. Brain Pathol. 11, 107-116 (2001).
  43. El-behi, M., Rostami, A., Ciric, B. Current views on the roles of Th1 and Th17 cells in experimental autoimmune encephalomyelitis. J Neuroimmune Pharmacol. 5, 189-197 (2010).
  44. Mann, M. K., Ray, A., Basu, S., Karp, C. L., Dittel, B. N. Pathogenic and regulatory roles for B cells in experimental autoimmune encephalomyelitis. Autoimmunity. 45, 388-399 (2012).
  45. Lassmann, H., Bruck, W., Lucchinetti, C. F. The immunopathology of multiple sclerosis: an overview. Brain Pathol. 17, 210-218 (2007).
  46. Simmons, S. B., Pierson, E. R., Lee, S. Y., Goverman, J. M. Modeling the heterogeneity of multiple sclerosis in animals. Trends Immunol. 34, 410-422 (2013).
  47. Praet, J., Guglielmetti, C., Berneman, Z., Vander Linden, A., Ponsaerts, P. Cellular and molecular neuropathology of the cuprizone mouse model: clinical relevance for multiple sclerosis. Neurosci Biobehav Rev. 47, 485-505 (2014).
Indução de encefalomielite autoimune experimental em camundongos e avaliação da distribuição da doença dependente de células imunes em vários tecidos
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Barthelmes, J., Tafferner, N., Kurz, J., de Bruin, N., Parnham, M. J., Geisslinger, G., Schiffmann, S. Induction of Experimental Autoimmune Encephalomyelitis in Mice and Evaluation of the Disease-dependent Distribution of Immune Cells in Various Tissues. J. Vis. Exp. (111), e53933, doi:10.3791/53933 (2016).More

Barthelmes, J., Tafferner, N., Kurz, J., de Bruin, N., Parnham, M. J., Geisslinger, G., Schiffmann, S. Induction of Experimental Autoimmune Encephalomyelitis in Mice and Evaluation of the Disease-dependent Distribution of Immune Cells in Various Tissues. J. Vis. Exp. (111), e53933, doi:10.3791/53933 (2016).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter