Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Medicine

Analyse Gavnlige virkninger af kosttilskud på Intestinal epitelbarriere funktioner under Eksperimentel Colitis

doi: 10.3791/55095 Published: January 5, 2017

Summary

Nuværende behandlinger af inflammatoriske tarmsygdomme (IBD) sigter mod at afhjælpe sygdomssymptomer, men kan forårsage alvorlige bivirkninger. Således er alternative strategier, der undersøges i animalske colitis modeller. Her forklarer vi, hvordan de gavnlige virkninger af kosttilskud på kliniske IBD tegn analyseres i et sådant colitis model.

Abstract

Inflammatoriske tarmsygdomme (IBD), herunder Crohns sygdom og ulcerativ colitis, er kronisk tilbagevendende sygdomme i tarmene. De forårsager alvorlige problemer, såsom mavekramper, blodig diarré og vægttab, i berørte individer. Desværre er der ingen kur endnu, og behandlinger kun til formål at lindre symptomerne. Aktuelle behandlinger omfatter anti-inflammatoriske og immunosuppressive lægemidler, der kan forårsage alvorlige bivirkninger. Det forudsætter en søgen efter alternative behandlingsmuligheder, såsom kosttilskud, som ikke forårsager bivirkninger. Før deres anvendelse i kliniske studier, skal sådanne forbindelser være grundigt testet for effektivitet og sikkerhed i dyremodeller. En pålidelig eksperimentel model er den dextransulfat-natrium (DSS) colitis model i mus, som gengiver mange af de kliniske tegn på colitis ulcerosa i mennesker. Vi har for nylig anvendt denne model til at teste de gavnlige virkninger af et kosttilskud indeholdendevitamin C og E, L-arginin, og w3-polyumættede fedtsyrer (PUFA). Vi analyserede forskellige sygdomstilstande parametre og fandt, at dette supplement kunne lindre ødemdannelse, vævsbeskadigelse, leukocytinfiltration, oxidativ stress, og produktionen af ​​pro-inflammatoriske cytokiner, der fører til en generel forbedring af sygdomsaktiviteten indeks. I denne artikel, vi forklare i detaljer den korrekte anvendelse af kosttilskud ved hjælp af DSS colitis modellen i C57BL / 6 mus, samt hvordan sygdom parametre såsom histologi, oxidativ stress, og inflammation vurderes. Analysere de gavnlige virkninger af forskellige kosttilskud kan så i sidste ende åbne nye muligheder for udvikling af alternative behandlingsstrategier, der lindrer IBD symptomer og / eller at forlænge faser remission uden at forårsage alvorlige bivirkninger.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Colitis er en inflammatorisk tilstand i tyktarmen som kan forårsage diarré og mavesmerter. Colitis kan være akut som reaktion på infektion eller stress, eller det kan udvikle sig som en kronisk sygdom, såsom i ulcerativ colitis (UC), der tilhører gruppen af ​​inflammatoriske tarmsygdomme (IBD). Skønt de kliniske tegn på UC er blevet godt beskrevet, er patogenesen stadig dårligt forstået 1. Det accepteres blandt eksperter, at UC er en multifaktoriel sygdom, med genetiske mutationer og afvigende immunreaktioner spiller en stor rolle 2. Men miljømæssige faktorer, såsom livsstil og ernæring, også bidrager til sygdommens udvikling og progression 3.

Desværre, IBD er ikke helbredes, men der er mange behandlingsmuligheder, der har til formål at lindre kliniske symptomer. Nuværende behandlinger omfatter anti-inflammatoriske lægemidler, såsom sulfasalazin og kortikosteroider; immunosuppressiva, såsom azathioPrine; monoklonale antistoffer som fanger proinflammatoriske cytokiner, såsom tumornekrosefaktor-α (TNF-α), eller blokere adhæsionsmolekyler, såsom integriner, begrænse overdrevent leukocytrekruttering; og inhibitorer, der er målrettet kinaser, der udløser proinflammatoriske veje, såsom Janus kinase (JAK) 4. Ikke alle patienter reagerer på alle behandlinger, så terapeutiske strategier skal individualiseres 5. Endvidere er de fleste af disse terapeutiske lægemidler interfererer med metabolismen og immunresponser, ofte forårsager alvorlige bivirkninger. Af denne grund har alternative behandlingsmuligheder blevet undersøgt.

Alternative behandlinger omfatter probiotika og kosttilskud, der er anvendt i dyremodeller og kliniske forsøg med varierende grad af succes 6,7. Vi har for nylig fundet, at anvendelsen af ​​forskellige enkelt kosttilskud, såsom anti-oxidative vitaminer eller ω3-poly-umættede fedtsyrer (PUFAs), er ringere end anvendelsen af en kombination af sådanne kosttilskud til lindring colitis og hjerte-kar-sygdom symptomer 8,9. Disse undersøgelser blev udført på mus, så kliniske undersøgelser skal udføres på mennesker for at afgøre, om resultaterne også vil være gældende for mennesker. Før kliniske studier igangsættes, skal effektiviteten og sikkerheden af ​​nye behandlingsmuligheder vurderes i dyremodeller.

For IBD, har dextransulfat-natrium (DSS) model er ofte blevet brugt til at undersøge mekanismerne for sygdomsudvikling og de gavnlige virkninger af lægemidler og kosttilskud 6,10. I de fleste undersøgelser, kun en akut sygdom i løbet af en periode på syv dage er induceret; ikke desto mindre, de kliniske tegn observeret i disse dyr ligner dem observeret i IBD-patienter (dvs. blodig diarré, vægttab, epithelial dysfunktion og immun celleinfiltration) 10. DSS inducerer erosioner i slimhinden,resulterer i barriere dysfunktion og øget intestinal epithelial permeabilitet 11. Den nøjagtige mekanisme stadig ukendt. En undersøgelse tyder på, at DSS interagerer med medium kædelængde fedtsyrer til dannelse nano-lipocomplexes der er i stand til at indtaste epitelceller og fremkalde inflammatoriske signalveje 12. I denne artikel beskriver vi i detaljer, hvordan colitis induceres og analyseret i mus, hvor kosttilskud der anvendes ved tvangsfodring at sikre en konstant dosering i hvert dyr, og hvordan virkningerne af sådanne kosttilskud på forskellige colitis symptomer er undersøgt.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Alle eksperimenter dyr er blevet godkendt af Institutional Animal Care og brug Udvalg Cinvestav.

1. Udarbejdelse af DSS drikkevand og Induktion af Colitis

  1. Der fremstilles en 3,5% w / v dextransulfat-natrium (DSS) opløsning i autoklaveret drikkevand. DSS opløser nemt, og det er ikke nødvendigt at filtrere den endelige løsning.
    BEMÆRK: 7 dage DSS behandling inducerer svær colitis. Hvis inducere milde colitis, 3 - er 4 dages behandling anbefales. Så længe DSS drikkevand forbliver klar, er det ikke nødvendigt at skifte vand. Men hvis det viser grumset, skal den udskiftes.
  2. Man noterer basisniveau-vægt af hanmus. Sørg for, at de er 8 - 12 uger og inden for et interval på 21 - 25 g kropsvægt.
    BEMÆRK: Den passende DSS koncentration skal optimeres i hvert laboratorium. Resultaterne kan i høj grad variere, afhængigt af boligforhold. Koncentrationer mellem 2,5 - 5% sædvanligvis rapporteret at inducere stærke colitis i C57BI / 6J WT mus 10. DSS fra forskellige virksomheder og forskellige partier skal testes, da resultaterne også kan variere med forskellige kilder til DSS.
  3. Giv vand ad libitum og erstatte det med frisk 3,5% DSS vand, hvis det er nødvendigt.

2. Anvendelse af Kosttilskud med sonde

  1. Forbered en "kan tilføres" løsning af de ønskede kosttilskud i et passende opløsningsmiddel. Til denne undersøgelse anvendte vi en blanding indeholdende 200 mg / kg L-arginin, 83 mg / kg C-vitamin, 46 mg / kg E-vitamin, 77 mg / kg eicosapentaensyre (EPA), og 115 mg / kg docosahexaensyre (DHA ) i en 1: 1 opløsning af vand og saflorolie.
  2. Fyld en 1 ml sprøjte forbundet med en sonde nål (15 g x 50 mm) med ernæringstilskud blandingen. Tør den sonde nål til at fjerne hvilken som helst forbindelse uden for nål og for at sikre korrekt dosis ansøgning.
  3. Begrænse musen ved at tage fat i haleroden medene side og af fast gribende en hudfold på bagsiden af ​​halsen med tommel- og pegefinger på den anden hånd. Placer halen mellem den tredje finger og bunden af ​​tommelfingeren af ​​den samme hånd, som holder halsen.
  4. Samtidig med at musen i en oprejst position, indsætte nålen ind i venstre side af dyrets mund og følg nøje taget af munden for at finde spiserøret. Hvis der findes ingen modstand føres nålen mod maven.
    BEMÆRK: Kontroller, at dyret trækker vejret ordentligt, før du fortsætter.
  5. Administrer blandingen langsomt, fjerne røret ved langsomt at trække sprøjten, og slipper musen. Påfør kosttilskud gang dagligt med sonde i løbet af colitis eksperiment.

3. Bestemmelse af Disease Activity Index

BEMÆRK: sygdomsaktiviteten indeks er kombinationen af ​​scorer for vægttab, perianal blødning, og afføring konsistens, som er obindeholdt dagligt 13.

  1. Mål legemsvægt dagligt og tildele en score fra 0 til 4 ifølge vægttab procent (0: 0%, 1: 1 - 5%, 2: 5 - 10%, 3: 10 - 20%, og 4:> 20 %).
    BEMÆRK: Kropsvægt tab bestemmes ved at beregne forskellen i procent mellem det basale vægt før induktionen af ​​DSS-colitis og den aktuelle vægt.
  2. For at bestemme niveauet af perianal blødning, indsamle en frisk afføringsprøve og de medfølgende applikatorer til at anvende en tynd smøre på et dias fra en guaiac fækal okkult blodprøve kit. Brug en ny applikator for hver prøve.
    1. Luk dækslet på forsiden og åbne vinduet på bagsiden af ​​objektglasset. Påfør to dråber udvikleren løsning til bagsiden på prøvestedet.
    2. Læs resultaterne efter 30 s. Alle spor af blå farve er positivt for okkult blod. Tildel en score på 0 til 4 (0: ingen, 0,5-2,5: positiv guaiac fækal okkult blodprøve (afhængigt af signalstyrken), og 3 - 4: gross blødning).
      BEMÆRK: Hvis blod i afføringen er synlig, har guaiac fækalt okkult blodprøve ikke at blive udført, og en score på 3, 3,5 eller 4 er tildelt, afhængigt af mængden af ​​synlig blod.
  3. Bestem afføringskonsistens ved at observere en frisk afføringsprøve. Tildel en score på 0 til 4 (0: normal / fast, 0,5-2,5: dejagtig afføring, og 3 - 4: diarré).

4. Bestemmelse Intestinal epithelial permeabilitet in vivo af Evans Blå Assay

  1. Bedøve dyr ved at injicere dem intraperitonealt med en blanding af ketamin (100 mg / kg legemsvægt) og xylazin (13 mg / kg kropsvægt) fortyndet i saltvandsopløsning (0,9% NaCl), og vurdere dybden af ​​bedøvelse ved at overvåge pinch tilbagetrækning refleks.
  2. Placer bedøvede dyr i rygleje og udføre en laparotomi for at blotlægge tarmene.
  3. Find coecum og lave et lille snit i det proximale segment af tyktarmen ascendens (ideelt, umiddelbart tilgrænsende til coecum).
  4. Sæt en fodring nål (G22) og fastgør den med en ligatur ved hjælp af en fælles silketråd. Omhyggeligt flush rigelige PBS gennem røret for at skylle alle afføring fra tyktarmen. Indgyde Evans blue-opløsning (1,5% vægt / volumen i PBS) i colon, indtil den når anus.
  5. Inkubér Evans blåt i 15 min. Skyl farvestoffet ved at skylle rør med rigelige PBS indtil perianale udvaskning er klar.
  6. Aflive dyrene ved cervikal dislokation.
  7. Forbrugsafgifter tyktarmen og skyl det igen med rigelige PBS. Skyl en gang med 1 ml 6 mM N -acetylcysteine i PBS for at fjerne enhver farvestof klæber til colon slim.
  8. Skær tyktarmen på langs og skyl det endnu en gang med PBS og 1 ml 6 mM N -acetylcysteine.
  9. Noterer vægten og længden. For at ekstrahere Evans blue farvestof, placere tyktarmen i 2 ml N, N-dimethylformamid natten over ved stuetemperatur under forsigtig agitation. Mål farvestofkoncentrationen spektrofotometrisk ved 610 nm.

5. Tissue Collection

  1. Bedøve dyr ved at injicere dem intraperitonealt med en blanding af ketamin (100 mg / kg legemsvægt) og xylazin (13 mg / kg kropsvægt) fortyndet i saltvandsopløsning (0,9% NaCl), og vurdere dybden af ​​bedøvelse ved at overvåge pinch tilbagetrækning refleks.
  2. Aflive dyrene ved cervikal dislokation.
  3. Placer dyrene i rygleje og udføre en laparotomi for at blotlægge den abdominale kavitet.
  4. Ved hjælp af en saks, dissekere hele tyktarmen og optage dens længde.
  5. Skyl tyktarmen omhyggeligt adskillige gange med afkølet PBS for at fjerne fæces. Optag vævet vægt og forberede de følgende forsøg, som beskrevet i trin 5.6 - 5.8.
  6. For RNA isolation og myeloperoxidase (MPO) analyser, afbrød en passende størrelse vævsprøve (100 mg er normalt tilstrækkeligt), placere den inde i et rør, og SNAp-fryse den i flydende kvælstof. Opbevar vævene ved -80 ° C til senere brug.
  7. For immunfluorescensfarvning og oxidativt stress bestemmelse (se nedenfor), skæres et lille kolon prøve (0,5 - 1 CM) og submerse det i små aluminium kopper fyldt med optimal opskæring temperatur (OCT) forbindelse. Placer kopper på tøris og lad dem fryse langsomt, for at undgå bobledannelse. Frosne vævsprøver kan lagres ved -80 ° C til senere brug.
  8. For schweizisk ruller 14, åbne tyktarmen på langs og fjern forsigtigt afføring med en pincet. Rul den op, med slimhinden vender indad, med fin spids pincet eller en tynd, rund træpind. placere den forsigtigt inde i en indlejring kassette og fortsætte med trin 6.1.
    BEMÆRK: DSS inducerer skader i tyktarmen. Imidlertid skader fordeling varierer fra den proximale til den distale colon, med størst skade normalt ses i den distale colon og rektum. Således anbefaler vi analysere histologi enten i den distale colpå eller i schweiziske roller hele tyktarmen.

6. Analyse af Colon Histologi hematoxylin-eosinfarvning

  1. Vævspræparation
    1. For den histologiske analyse, nedsænkes enten de schweiziske ruller og de små vævsstykker fra visse kolon regioner i kontrol og behandlede mus i 5 ml 10% formaldehyd i 48 timer ved stuetemperatur (RT) at opnå ordentlig fiksering.
      BEMÆRK: Alle yderligere skridt i trin 6 udføres ved stuetemperatur, medmindre andet er angivet.
    2. Vask dem med ledningsvand i 18 timer.
    3. Dehydrere dem med 15 ml 70% ethanol i 1 time, 96% i 1 time, og absolut ethanol i 1 time. Gentag hvert trin med frisk alkohol, før man går videre til den næste koncentration.
    4. Fortsæt dehydrering i en blanding af 7,5 ml absolut ethanol og 7,5 ml absolut xylen i 1 time. Gentag en gang før den ledes prøverne til 15 ml absolut xylen i 1 time. Gentag dette trin én gang med frisk xylen.
    5. Integrering Colon vævsprøver i Paraffin
      1. Fordybe prøverne i 50 ml flydende paraffin i 17 timer. Gentag dette trin én gang, men kun for 3 timer.
      2. Fordyb prøverne i tern (plast, firkantede skimmel, størrelse: 22 x 22 x 22 mm) i 810 ml flydende paraffin.
      3. Tillad paraffin med colon vævsprøver de at størkne i 24 timer ved stuetemperatur.
    6. Skæring Tissue Tværsnit ved hjælp af en Mikrotom
      1. Skær kolon prøver under anvendelse af en mikrotom, ifølge producentens anvisninger ved en tykkelse på 5 um.
      2. Saml de nedskæringer i et vandbad (1 L), der indeholder 0,3% gelatine. Dette forhindrer foldningen af ​​væv tværsnit. Gendan vævssnit og montere dem på objektglas.
    7. Hematoxylin og Eosin Farvning af Tissue Tværsnit
      1. Afparaffiniser prøver i 18 timer ved 60 ° C i en inkubator. Til dette formål bruge et glas sLiDE rack med et håndtag.
      2. Efter afparaffinering, fordybe dias i 70 ml absolut xylen i 5 min. Gentag dette trin én gang med frisk xylen.
      3. Overfør prøverne i 70 ml absolut alkohol i 1 min. Gentag dette trin én gang med frisk alkohol.
      4. Inkubér colon vævsprøver i 70 ml ethanol 96% i 1 min. Gentag dette trin én gang med frisk alkohol.
      5. Vask prøverne i ledningsvand to gange i 2 s.
      6. Inkubér væv i Harris hematoxylin i 7 min.
      7. Vask prøverne i ledningsvand to gange i 2 s.
      8. Inkubér prøverne i sure alkohol (70 ml ethanol 70% og 700 pi 1 M saltsyre) i 7 s.
      9. Vask prøverne i ledningsvand to gange i 2 s.
      10. Inkubér vævsprøver i 70 ml lithiumcarbonat (1 g lithiumcarbonat i 100 ml destilleres vand) i 7 s.
      11. Vask prøverne i ledningsvand to gange i 2 s.
      12. Inkuber prøverne i 70 ml ethanol 80% I 1 min.
      13. Overfør prøverne i 70 ml Eosin Y i 15 s.
      14. Inkuber dem i 70 ml 96% ethanol i 1 minut. Gentag dette trin én gang med frisk alkohol.
      15. Inkuber vævsprøverne i 70 ml absolut ethanol (ethylalkohol absolut vandfrit) i 1 min. Gentag dette trin én gang med frisk alkohol.
      16. Inkuber prøverne i 70 ml af en blanding af 35 ml absolut alkohol og 35 ml absolut xylen i 1 min.
      17. Overfør prøverne i 70 ml absolut xylen i 1 min. Gentag dette trin for 5 min i 70 ml frisk absolut xylen.
      18. Der tilsættes 80 pi af syntetisk harpiks til tyktarmen vævsprøver, dække dem med dækglas, og lad dem tørre i 24 timer ved stuetemperatur. Endelig, analysere prøverne ved hjælp af lys-field mikroskopi 8.

    7. Analyse Junction Sammensætning ved immunofluorescens

    1. Forbered væv som beskrevet i trin 5.7 og skær 8 um tykke tværsnitunder anvendelse af en kryostat.
    2. Fix og permeabilisere kolon tværsnit med 96% ethanol ved -20 ° C i 20 minutter.
      BEMÆRK: Alle efterfølgende inkubationer skal udføres ved RT, med mindre andet er anført, i et fugtigt mørkt felt for at forhindre udtørring og fluorokrom fading.
    3. Air-tørre prøver, og derefter skylle dem 3 gange i 5 minutter hver med 1x PBS
    4. Inkuber prøverne med blokeringsopløsning (PBS indeholdende 0,01% Tween og 2% BSA) i 2 timer.
    5. Den blokerende opløsning fjernes, og skyl den med PBS-0,01% Tween i 10 min.
    6. I dette tidsrum fortyndes de primære antistoffer til de ønskede koncentrationer i PBS-0,01% Tween.
    7. Fjern vaskeopløsningen, anvende antistofopløsningen fra det foregående trin, og inkuberes natten over ved 4 ° C i en befugtet kasse.
    8. Fjern antistofopløsningen og vask 3 gange med PBS-0,01% Tween i 5 minutter hver og én gang med deioniseret vand i 10 minutter, med meget forsigtig omrøring.
    9. Mens vask, centrifuge fluorochromeconjugated, artsspecifikke sekundære antistoffer ved 14.000 xg i 20 min ved 4 ° C.
    10. Fortynd de sekundære antistoffer uden udfældninger som angivet af leverandøren i PBS-0,01% Tween, anvende dem, og inkuberes i 1 time ved stuetemperatur.
    11. Gentag trin 7.8 og fjern vaskevandet så fuldstændigt som muligt.
    12. Pipette 4 pi anti-fading middel over hver prøve på diaset.
    13. Dæk prøverne med et dækglas.
    14. Lufttørre i 1 time.
    15. Seal slide med neglelak. Slides kan opbevares ved -20 ° C indtil yderligere analyse.
    16. Analyser på en konfokal laser mikroskop 8.

    8. Bestemmelse af oxidativt stress ved oxidation af Ethidium

    1. Efter 7 dages DSS colitis, forberede væv som beskrevet i trin 5.7 og skæres kolon sektioner i en kryostat med en tykkelse på 5 um. Mount tværsnit på objektglas behandlet med poly-L-lysin-opløsning og inkuber prøverne with 5 uM dihydroethidium (DHE) i vand ved 37 ° C i 30 minutter i mørke.
    2. Vask prøverne med PBS (pH 7,6) tre gange i 15 minutter hver med forsigtig omrøring ved stuetemperatur. Lufttørre prøverne og tilsæt en dråbe monteringsmedium til beskyttelse af fluorescensen. Observere fluorescensen af ​​oxideret ethidium på en laser-scanning konfokal mikroskop (40X forstørrelse, 568 nm bølgelængde).

    9. Analyse af leukocyt Rekruttering af MPO Assay

    1. Efter 7 dages DSS colitis, indsamle kolon væv og homogeniseres prøverne (200 - 400 mg) med 1 ml hexadecyltrimethylammonium (HTAB) puffer (0,5% HTAB i 50 mM phosphatbuffer, pH 6,0) under anvendelse af en homogenisator på is.
    2. Skyl spidsen af ​​homogenisatoren to gange med 1 ml HTAB puffer til at omfatte alle væv i lysatet og sonikeres det fem gange ved 40% amplitude i 10 s hver. Fryse-tø i flydende nitrogen tre gange.
    3. Centrifuger ved 14.000 xg i 15 minutter og den ovenstående væske opsamles.Forbered 2,2'-azino-bis (3-ethylbenzothiazolin-6-sulfonsyre) (ABTS) opløsning ved blanding ABTS, 5 ml natriumcitrat (1 M i vand), 0,1 ml hydrogenperoxid, og 45 ml bi -destilleret vand.
    4. Bland 0,1 ml af hver supernatant med 0,1 ml ABTS-opløsning i en 96-brønds fladbundet plade. Efter 10 minutter måles absorbansen ved 460 nm ved anvendelse af et spektrofotometer.

    10. Evaluering af Expression af Pro-inflammatoriske cytokiner ved PCR

    1. tissue Homogenisering
      1. Homogenisere 50 til 100 mg af kolon vævsprøver i 1 ml af en sur guanidiniumthiocyanat-phenol-chloroform-blanding med en mekanisk homogenisator.
      2. Inkuber ved stuetemperatur i 15 minutter.
    2. faseadskillelse
      1. Tilføj 0,2 ml chloroform og rystes kraftigt i 30 s.
      2. Der inkuberes ved 4 ° C i 30 minutter.
      3. Centrifuger ved 12.000 xg i 60 minutter ved 4 ° C.
      4. Overfør upper vandig fase i et frisk rør (~ 500 uL).
    3. RNA Nedbør og Resuspension
      1. Tilsæt 0,5 ml isopropylalkohol og inkuberes prøverne ved 4 ° C i 60 minutter.
      2. Centrifuger ved 12.000 xg i 30 minutter ved 4 ° C.
      3. Fjern supernatanten fuldstændigt.
      4. Tilsæt 1 ml ethanol 75% og vortex.
      5. Centrifuger ved 12.000 xg i 30 minutter ved 4 ° C.
      6. Fjern supernatanten.
      7. Tillad det resterende ethanol lufttørre i 3-5 min.
        BEMÆRK: Det er vigtigt ikke at lade RNA pellet tørre helt, da det i høj grad vil mindske dets opløselighed.
      8. Re-pellet opløses i 0,3 ml diethylpyrocarbonat (DEPC) -behandlet vand. Umiddelbart transskribere RNA-prøver i cDNA (mere stabile, se trin 10.5) eller opbevares ved -80 ° C.
    4. RNA Kvantificering
      1. Fortynd 1 pi RNA med 99 pi DEPC-behandlet vand.
      2. Læs the OD ved 260 nm og 280 nm ved anvendelse af et UV / VIS spektrofotometer til bestemmelse prøvekoncentration og renhed.
    5. cDNA Synthesis
      1. Bland RNA-prøver (1-5 ug) med 1 pi oligo (dT) 12-18 (0,5 ug / pi) og DEPC-behandlet vand (samlet volumen på 12 pi) i RNase-fri sterile rør.
      2. Inkuber ved 70 ° C i 10 min.
      3. Tilsæt 2 pi 10x PCR-buffer, 1 pi 50 mM MgCl2, 1 pi 10 mM dNTP-blanding, og 2 pi 0,1 M dithiothreitol (DTT).
      4. Der inkuberes ved 4 ° C i 5 min.
      5. Tilsæt 1 pi af revers transkriptase og inkuberes ved 42 ° C i 5 min.
      6. Inkuber ved 70 ° C i 15 minutter.
      7. Der inkuberes ved 4 ° C i 15 min. cDNA kan opbevares ved -20 ° C indtil yderligere anvendelse.
    6. PCR
      1. Bland 2,5 pi 10x PCR-buffer, 1,5 pi 25 mM MgCl2, 0,5 pi 10 mM dNTP mix, 0,25 μL af Taq DNA polymerase, 0,25 pi af hver primer (10 uM) og cDNA (100 ng) og sterilt vand til et samlet volumen på 25 pi.
      2. Kør prøverne på en 96-brønds thermocycler. For at forhindre opformering af genomisk DNA, frem og bak primere skal placeres i forskellige exons: IL1β-FW: GCAACTGTTCCTGAACTCAACT og IL1β-RE: TCTTTTGGGGTCCGTCAACT; IL6-FW: CCTTCCTACCCCAATTTCCAA og IL6-RE: AGATGAATTGGATGGTCTTGGTC; KC-FW: TGTCAGTGCCTGCAGACCAT og KC-RE: CCTGAGGGCAACACCTTCA; og actin-FW: TATCCACCTTCCAGCAGATGT og actin-RE: AGCTCAGTAACAGTCCGCCTA. Brug følgende PCR-betingelser: 95 ° C i 5 minutter efterfulgt af 30 cykler ved 95 ° C i 15 s, 58 ° C i 30 s og 72 ° C i 30 s, plus en endelig forlængelse på 10 minutter ved 72 ° C .

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Kost Kosttilskud kan beskytte fra DSS Colitis

Anti-inflammatoriske og anti-oxidative kosttilskud, såsom vitamin C, vitamin E, nitrogenoxid (NO)-source L-arginin og w3-polyumættede fedtsyrer (w3-PUFA), er blevet anvendt med varierende succes i dyr modeller til at lindre symptomer på inflammatoriske sygdomme 3,6,15. Fejlernæring, oxidativ stress, og produktionen af proinflammatoriske cytokiner kan udløse både akutte og kroniske colitis 3. I en tidligere undersøgelse, vi bevist, at en kombination af mikronæringsstoffer viste beskyttende virkninger mod DSS-induceret colitis in vivo. Her giver vi detaljerede protokoller om, hvordan disse effekter blev målt 8. Først analyserede vi virkningerne af kosttilskud på sygdomsprogression ved bestemmelse af sygdomsaktivitet indeks (DAI), som består af de tre parametre for vægttab,afføring konsistens, og endetarmsåbning blødning. Repræsentative resultater viste, at DSS behandling førte til en kontinuerligt stigende DAI, som forventet, med et maksimum på 8,2 ± 0,46 på dag syv (figur 1A). Anti-inflammatorisk kost tilskud forsinket indtræden af ​​colitis, men på senere tidspunkter, da colitis var meget stærk, den beskyttende virkning var marginal og ikke længere statistisk signifikant, hvilket antyder, at kosttilskud er kun effektive, når colitis er endnu ikke for stærk. Vigtigere, kunne kostintervention forhindre DSS-inducerede stigning i intestinal epithelial permeabilitet, hvilket er et vigtigt træk ved colitis (figur 1B). DSS colitis førte til reducerede kolon længder, og denne shortening blev også forbedres ved den anti-inflammatoriske og anti-oxidativ kosttilskud (figur 1C). Således kan kliniske symptomer på colitis faktisk afhjælpes ved ændringer i kosten sammensætning.

For at analysere, hvorfor colitis progression var mindre alvorlige i dyr, der fik en kost supplement, blev vævet morfologi undersøgt efter hæmatoxylin / eosin (H / E) farvning af paraffinindlejrede distal colon væv. Kontrolprøver viste en normal morfologi (figur 2A, øverste panel), hvorimod dyr behandlet med 3,5% DSS viste typiske tegn på colitis (dvs. leukocyt infiltration, ødem dannelse, krypt dysplasi, og sår, figur 2A, midterste panel). Notatet parallel behandling med kost kosttilskud klart afhjælpes colitis-induceret morfologiske ændringer, med en samlet morfologi, der var mere sammenlignelig med kontrolgruppen (figur 2A, nederste panel). Disse observationer var meget lig hvad der har væretrapporteret for co-behandlinger med probiotiske bakterier 13 og tydeligt viser, at ændringer i kosten kan modvirke udviklingen af colitis.

Vi vidste allerede, at colitis-induceret intestinal epitel permeabilitet kan modvirkes ved kost tilskud. Forøget permeabilitet er kendetegnende for IBD, og ​​det er for en stor del skyldes demonteringen af ​​de stabiliserende adherensovergange (AJ) og tætte sammenføjninger (TJ). Destabilisering af epiteliale celle-kontakter ved internalisering af forbindelsesepitoper proteiner induceres af pro-inflammatoriske cytokiner, der er rigeligt produceret under colitis 16. Vi fandt, gennem immunfluorescensfarvning af distal colon væv, at TJ molekyle zonula occludens-1 (ZO-1) og AJ molekylet E-cadherin blev internaliseret i DSS-induceret colitis og at co-lokalisering af disse proteiner var delvist tabt ved krypt epiteliale celle-kontakter (figur 2B). jegmportantly, internalisering af E-cadherin og ZO-1 blev reduceret, når DSS-behandlede mus blev co-behandlet med et anti-inflammatorisk og anti-oxidativ kosttilskud (figur 2B). Samlet, krypt og junction strukturer var mere sammenlignelig med kontrollen, når kosttilskuddet blev anvendt, hvilket antyder, at den observerede beskyttende virkning var mindst delvis skyldes bevarelsen af ​​vævsopbygning.

Dietary Intervention kan modvirke inflammatorisk neutrofilrekruttering, oxidativ stress, og produktionen af ​​Pro-inflammatoriske cytokiner

En anden kendetegnende for IBD er ukontrolleret neutrofil infiltration. Rekrutteret neutrofiler bidrager til vævsbeskadigelse ved at producere og frigive reaktive oxygenarter (ROS) og proteaser 17. Ved anvendelse af en MPO aktivitet assay fandt vi stærke neutrofil rekruttering i colon som reaktion på DSS, som blev modvirketmed diæt tilskud (figur 3A).

Oxidativ stress er en anden vigtig funktion af colitis forårsaget af frigivelsen af ​​ROS fra rekrutteret neutrofiler. Således har vi analyseret produktionen af ​​ROS i kolon tværsnit. Figur 3B viser, at DSS behandling stærkt forøget oxidativt stress. Af note, ændringer i kosten fuldstændig forhindret DSS-induceret oxidativt stress (figur 3B), som er mest sandsynligt en følge af den nedsatte neutrofil rekruttering (figur 3A).

Pro-inflammatoriske cytokiner og chemokiner er stærkt produceres af forskellige celletyper under colitis 18. Sådanne inflammatoriske mediatorer bidrager til neutrofile rekruttering og vejkryds protein internalisering-funktioner, som vi allerede vidste kunne dæmpes ved ændringer i kosten. Analyse af mRNA-ekspression med RT-PCR viste, at DSSøgede ekspression af IL1β, IL-6, og keratinocytafledt chemokin (KC), som forventet (figur 3C), og at anti-inflammatorisk kost tilskud formindsket denne DSS-inducerede stigning (figur 3C). Disse data indebærer, at kosttilskud faktisk kan tjene til at modvirke kliniske tegn på IBD.

figur 1
Figur 1. Kosttilskud kan lindre Disease Activity Index, Intestinal epithelial permeabilitet, og Colon Afkortning. (A) Sygdommen aktivitet indeks (DAI, værdier fra 0-12) består af de tre parametre for vægttab, afføring konsistens og endetarmsåbning blødning og blev registreret dagligt i de eksperimentelle grupper af kontrol (ctrl), colitis og colitis + ernæringstilskud (colitis + suppl.). Kontrolgruppen viste ingen tegn på colitis, hvilket resulterer i en DAI af 0 throughout forsøgsperioden. n = 5 pr gruppe. (B) Intestinal epithelial permeabilitet blev målt ved Evans blue lækage i ovennævnte forsøgsgrupper og blev udtrykt som absorption ved 620 nm pr g væv. n = 8 pr gruppe. Alle data er vist som middelværdi ± standardafvigelse af middelværdien (SDM). * P <0,05; ** P <0,01; *** P <0,001. Statistik blev beregnet ved envejs ANOVA. (C) Repræsentative billeder af hele koloner af de respektive forsøgsgrupper efter 7 dages behandling. Skalaen til venstre er i cm. Klik her for at se en større version af dette tal.

Figur 2
Figur 2. Tissue Morfologi og Junction Arkitektur bevares bedre i løbet af Colitis Ved ansøgning Nutritional Supplements. (A) 5-um paraffin tværsnit af vævsbiopsier fra de distale koloner af de respektive forsøgsgrupper blev farvet med hematoxylin / eosin og analyseret for typiske tegn på colitis, såsom ødemdannelse (pile), leukocytinfiltration (pilespidser), og ulceration (*). Samlet væv morfologi colitis + suppl. gruppe mere ligner den for kontrol end den colitis gruppen, som beviser en samlet beskyttende virkning mod DSS colitis. Billeder er repræsentative for 3 uafhængige vævspræparater per gruppe. Billeder blev taget ved anvendelse af et 10X objektiv. Bar = 100 um. (B) 8 um kolon cryo-sektioner af de respektive grupper blev farvet med antistoffer mod ZO-1 (grøn) og E-cadherin (rød). Co-lokalisering (gul i de sammenlagte billeder; pile) af E-cadherin og ZO-1 ved krypt epitel celle kontakter, der går tabt under colitis, er for det meste bevaret i colitis + suppl. gruppe. Billeder er repræsentative for 3uafhængige vævspræparater. Bar = 50 um. Klik her for at se en større version af dette tal.

Figur 3
Figur 3. Neutrofil Rekruttering, oxidativ stress, og produktionen af Pro-inflammatoriske cytokiner kan reduceres ved Kosttilskud. (A) Myeloperoxidase (MPO) aktivitet blev målt til at analysere mængden af leukocyt rekruttering til kolon væv i de eksperimentelle grupper: kontrol (ctrl), colitis og colitis + ernæringstilskud (colitis + suppl.). n = 5 pr gruppe; * P <0,05. Data er vist som middelværdi ± SDM. Statistik blev beregnet ved envejs ANOVA. (B) Fluorescensen af oxideret ethidium, afbildet i rødt som mål for oxidativ stress i 8-um cryo-sektioner af colon væv, blev indspillet af laser konfokal mikroskopi. Billeder er repræsentative for 3 uafhængige vævspræparater. Bar = 100 um. (C) Produktionen af de pro-inflammatoriske cytokiner IL1β og IL-6 og kemokin KC blev bestemt ved semikvantitativ RT-PCR i en 1,5% agarosegel (sort og hvid blev vendt for klarhedens skyld). β-actin tjente som husholdning genet. Repræsentative billeder af tre uafhængige cDNA præparationer er vist. Klik her for at se en større version af dette tal.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

For at kunne bruge kosttilskud i kliniske studier, skal fordele og sikkerheden omkring disse tilskud evalueres nøje in vivo i dyreforsøg. I tilfælde af colitis, har flere egnede dyremodeller, der ligner de kliniske tegn på IBD blevet etableret, herunder kemiske modeller med DSS, TNBS eller eddikesyre; knock-out (KO) modeller som IL10-KO; og immun-cellemedieret colitis under anvendelse adoptiv T-celle overdragelse 19-21. The DSS model af colitis er en hurtig og pålidelig metode til at inducere colitis, der ligner mange sygdomssymptomer af human IBD og er blevet brugt i en overflod af studier, der undersøger de molekylære mekanismer i colitis 22. Desuden DSS colitis er reversibel og dermed også muliggør studiet af vævsheling efter colitogenic stimulus er fjernet. Den angivne protokol beskriver detaljeret DSS colitis model, der tidligere er blevet optimeret i vores laboratorium 8.

23. Desuden skal DSS være i en molekylvægt fra 40 - 50 kDa at inducere colitis. For unexperienced forsker, vil det være vigtigt at udvikle et øje for en fordomsfri vurdering af DAI parametre for afføring konsistens og endetarmsåbning blødning. Hvis vurderingen foretages af en unexperienced forsker, er det anbefalelsesværdigt at have en kollega at bekræfte vurderingen, ideelt i et blindet måde.

For at analysere den intestinale epitel permeabilitet for makromolekyler, har tre store metoder blevet anvendt i hele litteraturen: Evans blåt farvestof-assay, som beskrevet her; inddrypning af 4-kDa FITC-dextran i en intestinal loop; og fodring af 4-kDa FITC-dextran 13,24,25. I sidstnævnte assay FITC-dextran fodret med sonde, Og mængden af ​​FITC-dextran, der passerede epitel og lækket ind i blodstrømmen måles fluorometrisk fra serumprøver. I dette assay er permeabiliteten af ​​hele mavetarmkanalen målt, idet sporstoffet passerer hele vejen fra spiserøret til rektum og det meste af sporstof vil passere, før de når tyktarmen. I loop model er permeabiliteten måles i et lukket tarm regionen anvendes til sløjfen (normalt tyndtarmen) 25. I modsætning hertil Evans blue assay har den fordel, at kun epitelial permeabilitet i tyktarmen måles, idet sporstoffet er direkte instillation i hele tyktarmen. Ved anvendelse af dette assay, kan vi konkludere, at den tyktarmsepitelet er beskyttet af kosttilskuddet.

Det er altid vigtigt at registrere tyktarmen vægt og længde efter ekstraktion og før du bruger væv til andre analyser, fordi nogle data (f.eks lækket Evans blå i permeabilitet ASSAy) er udtrykt pr g væv. Endvidere vægt-til-længde forholdet er en uafhængig udlæsning af vævsbeskadigelse 26. Generelt er vævsmorfologi analyseret under anvendelse paraffinindlejrede væv farvet med hematoxylin og eosin, som beskrevet her. Paraffinindlejring har den fordel, at vævet morfologi er meget bedre konserveret i forhold til andre indstøbningsmetoder. Dette giver mulighed for utvetydig identifikation af forskellige celletyper i slimhinden (dvs. immunceller, epitel, slimceller, etc.) og analyse af vævsforandringer under colitis, såsom ødemdannelse, leukocytinfiltration, og epiteliale apikale erosioner. På den anden side, paraffin den ulempe, at immunfluorescensfarvning kun kan gennemføres efter tidskrævende epitop recovery. Derfor har vi altid forberede forskellige frosne væv biopsier indlejret i OCT-forbindelse. Sådanne vævsprøver kan let snit under anvendelse af en kryostat og viser lave niveauer af autofluorescence. Vi bruger ethanol til fiksering af dehydrering, fordi heller ikke forstyrrer actinfilamenter (methanol gør), heller ikke udløse autofluorescens (som PFA gør). Ved anvendelse af disse teknikker, fandt vi, at et anti-inflammatorisk og anti-oxidativ diæt supplement kan forbedre vævsmorfologi og junction arkitektur under colitis (sammenlign figur 2).

Overdreven neutrofil rekruttering er en kritisk hændelse under colitis, der er foranlediget af produktion af kemoattraktanter som reaktion på inflammation 17. Neutrofilrekruttering er en fysiologisk begivenhed, fordi neutrofiler bidrager til fjernelsen af ​​den inflammatoriske cue og efterfølgende sårheling. Men hvis det medfødte immunrespons ikke styres ordentligt, og afsluttes, kan neutrofiler i slimhinden bidrage til vævsskade ved at frigive proteaser og reaktive ilt arter. Neutrofiler indeholder MPO, som let kan måles og kvantificeres ved anvendelse af etkolorimetrisk assay, hvor mængden af ​​MPO er direkte proportional med antallet af neutrofiler. Figur 3A viser, at neutrofile rekruttering stiger under colitis, og at kosten indgriben kan forhindre denne overdrevne og ukontrollerede immunrespons. I overensstemmelse med den rigelige neutrofil tilstedeværelse i slimhinden, oxidativ stress stiger i løbet colitis (figur 3B).

Vores kost tilskud klart beskytter slimhinden mod oxidativ stress, som er mest sandsynligt en følge af den nedsatte neutrofil rekruttering. Som nævnt er neutrofiler tiltrukket af kemokiner og produktionen af ​​kemokiner induceres af pro-inflammatoriske cytokiner, der udskilles af forskellige celletyper under colitis. Således antog vi, at reduceret neutrofil rekruttering er en konsekvens af reduceret cytokin og chemokin produktion. Figur 3C viser, at de pro-inflammatoriske cytokiner IL-1β og IL-6, samtkemokin KC, opreguleres under DSS-induceret colitis. Kosttilskuddet vendt niveauerne af IL-6 tilbage til kontrolniveauer og lindres den øgede produktion af IL-1β og KC. Af note, KC er den vigtigste kemoattraktant for neutrofiler hos mus.

Således er det fristende at spekulere, at den observerede bevarelse af vævsmorfologi skyldes reduceret neutrofil infiltration, der er på sin side en konsekvens af nedsat produktion af KC. Analysere RNA-produktion i DSS-behandlede væv ved RT-PCR er problematisk, når resterende DSS er til stede i det isolerede RNA. Dette skyldes, DSS inhiberer både revers transkriptase og Taq-polymeraser. Hvis der kan opnås ingen amplifikation, vil det være nødvendigt yderligere at oprense RNA-prøver af LiCl-medieret præcipitering, som beskrevet andetsteds 27.

Sammenfattende beskriver vi i detaljer forskellige metoder til analyse af vævsskade under DSS colitis og hvordan denne dAmage kan lindres ved kosttilskud. Viden fra sådanne dyreforsøg kan retfærdiggøre etablering af patientkohorter at undersøge de beskyttende virkninger af de analyserede kosttilskud i human IBD. Data fra kliniske studier kan derefter åbne nye veje til at udvikle alternative strategier for forvaltningen af ​​IBD behandlingsmuligheder.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har intet at afsløre.

Acknowledgments

Dette arbejde blev støttet af tilskud fra den mexicanske Råd for Videnskab og Teknologi (CONACYT, 207.268 og 233.395 til Michael Schnoor). KFCO er en modtager af en CONACYT stipendium (396.260) for at opnå en MSc grad.

Materials

Name Company Catalog Number Comments
0.3% of gelatin  Bioxon 158
10% formaldehyde J.T. Baker 2106-03
96-well plate with flat bottom Corning 3368
Absolute ethanol  J.T. Baker 9000-03
Absolute xylene J.T. Baker 9490-03
ABTS Sigma Aldrich H5882
Bovine Serum Albumin Sigma-Aldrich 9048-46-8
ColoScreen Helena Laboratories 5072
Corabion (Kindly provided by Merck, Naucalpan, Mexico) Merck
Dextran Sulfate Sodium Salt Affymetrix 9011-18-1 (M.W. 40,000-50,000)
Dihydroethidium Life Technology D11347
Eosin-Y  J.T. Baker L087-03
Evans blue Sigma-Aldrich 314-13-6
Feeding  needle Cadence Science Inc. 9921
Glass slide rack with handle Electron Microscopy 70312-16
Glass Slides Corning 2947
Harris hematoxylin  Sigma-Aldrich H3136
Hexadecyltrimethyammonium (HTAB) Sigma Aldrich H6269
Histosette (Embedding cassette) Simport M498.2
Hydrochloric acid 1 M J.T. Baker 9535-62
Hydrogen peroxide Sigma Aldrich H3410
Ketamine PiSA Agropecuaria Q-7833-028
Liquid paraffin  Paraplast 39501-006
Lithium carbonate  Sigma-Aldrich 2362
N,N-dimethylformamide J.T. Baker 68-12-2
N-acetylcysteine Sigma-Aldrich A9165
Plastic cubes Electron Microscopy 70181
Poly-L-Lysine Solution Sigma-Aldrich 25988-63-0
Prism 5 statistical software GraphPad Software Prism 5
Saline Solution 0.9% NaCl CS PiSA Q-7833-009
Sodium citrate Sigma-Aldrich W302600
Synthetic resin  Poly Mont 7987
Taq DNA polymerase Invitrogen 11615-010
Tissue-tek. O.C.T Compound Sakura Finetek 4583
Tuberculine Syringe BD Plastipak 305945
Tween 20 Sigma-Aldrich 9005-64-5
VECTASHIELD Antifade Mounting Medium with DAPI Vector Laboratories H-1200
Xylazine PiSA Agropecuaria Q-7833-099

DOWNLOAD MATERIALS LIST

References

  1. Souza, H. S., Fiocchi, C. Immunopathogenesis of IBD: current state of the art. Nat Rev Gastroenterol Hepatol. 13, 13-27 (2016).
  2. Xavier, R. J., Podolsky, D. K. Unravelling the pathogenesis of inflammatory bowel disease. Nature. 448, 427-434 (2007).
  3. Neuman, M. G., Nanau, R. M. Inflammatory bowel disease: role of diet, microbiota, life style. Transl Res. 160, 29-44 (2011).
  4. Lowenberg, M., D'Haens, G. Next-Generation Therapeutics for IBD. Current Gastroenterol Rep. 17, 21 (2015).
  5. Bernstein, C. N. Does everyone with inflammatory bowel disease need to be treated with combination therapy. Curr Opin Gastroenterol. (2016).
  6. Nanau, R. M., Neuman, M. G. Nutritional and probiotic supplementation in colitis models. Dig Dis Sci. 57, 2786-2810 (2012).
  7. Yamamoto, T. Nutrition and diet in inflammatory bowel disease. Curr Opin Gastroenterol. 29, 216-221 (2013).
  8. Vargas Robles, H., et al. Experimental Colitis Is Attenuated by Cardioprotective Diet Supplementation That Reduces Oxidative Stress, Inflammation, and Mucosal Damage. Ox Med Cell Longev. 8473242 (2016).
  9. Vargas-Robles, H., Rios, A., Arellano-Mendoza, M., Escalante, B. A., Schnoor, M. Antioxidative diet supplementation reverses high-fat diet-induced increases of cardiovascular risk factors in mice. Ox Med Cell Longev. 2015, 467471 (2015).
  10. Perse, M., Cerar, A. Dextran sodium sulphate colitis mouse model: traps and tricks. J Biomed Biotechnol. 2012, 718617 (2012).
  11. Chassaing, B., Aitken, J. D., Malleshappa, M., Vijay-Kumar, M. Dextran sulfate sodium (DSS)-induced colitis in mice. Curr. Protoc. Immunol. 104, Unit 15 25 (2014).
  12. Laroui, H., et al. Dextran sodium sulfate (DSS) induces colitis in mice by forming nano-lipocomplexes with medium-chain-length fatty acids in the colon. PLoS One. 7, 32084 (2009).
  13. Mennigen, R., et al. Probiotic mixture VSL#3 protects the epithelial barrier by maintaining tight junction protein expression and preventing apoptosis in a murine model of colitis. Am J Physiol Gastrointest Liver Physiol. 296, 1140-1149 (2009).
  14. Park, C. M., Reid, P. E., Walker, D. C., MacPherson, B. R. A simple, practical 'swiss roll' method of preparing tissues for paraffin or methacrylate embedding. J Microsc. 145, 115-120 (1987).
  15. Shen, W., Gaskins, H. R., McIntosh, M. K. Influence of dietary fat on intestinal microbes, inflammation, barrier function and metabolic outcomes. J Nutr Biochem. (2013).
  16. Bruewer, M., et al. Interferon-gamma induces internalization of epithelial tight junction proteins via a macropinocytosis-like process. FASEB J. 19, 923-933 (2005).
  17. Fournier, B. M., Parkos, C. A. The role of neutrophils during intestinal inflammation. Muc Immunol. 5, 354-366 (2012).
  18. Yan, Y., et al. Temporal and spatial analysis of clinical and molecular parameters in dextran sodium sulfate induced colitis. PLoS One. 4, 6073 (2009).
  19. Maxwell, J. R., Viney, J. L. Overview of mouse models of inflammatory bowel disease and their use in drug discovery. Curr Prot Pharmacol, S.J. Enna. Chapter 5, Unit 5.57 (2009).
  20. Ostanin, D. V., et al. T cell transfer model of chronic colitis: concepts, considerations, and tricks of the trade. Am J Physiol Gastrointest Liver Physiol. 296, 135-146 (2009).
  21. Randhawa, P. K., Singh, K., Singh, N., Jaggi, A. S. A review on chemical-induced inflammatory bowel disease models in rodents. Kor J Physiol Pharmacol. 18, 279-288 (2014).
  22. Whittem, C. G., Williams, A. D., Williams, C. S. Murine Colitis modeling using Dextran Sulfate Sodium (DSS). JoVE. (2010).
  23. Wirtz, S., Neufert, C., Weigmann, B., Neurath, M. F. Chemically induced mouse models of intestinal inflammation. Nat Prot. 2, 541-546 (2007).
  24. Naydenov, N. G., et al. Nonmuscle Myosin IIA Regulates Intestinal Epithelial Barrier in vivo and Plays a Protective Role During Experimental Colitis. Sci Rep. 6, 24161 (2016).
  25. Sumagin, R., Robin, A. Z., Nusrat, A., Parkos, C. A. Transmigrated neutrophils in the intestinal lumen engage ICAM-1 to regulate the epithelial barrier and neutrophil recruitment. Muc Immunol. 7, 905-915 (2014).
  26. Laukoetter, M. G., et al. JAM-A regulates permeability and inflammation in the intestine in vivo. J Exp Med. 204, 3067-3076 (2007).
  27. Viennois, E., Chen, F., Laroui, H., Baker, M. T., Merlin, D. Dextran sodium sulfate inhibits the activities of both polymerase and reverse transcriptase: lithium chloride purification, a rapid and efficient technique to purify RNA. BMC Res Notes. 6, 360 (2013).
Analyse Gavnlige virkninger af kosttilskud på Intestinal epitelbarriere funktioner under Eksperimentel Colitis
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Vargas Robles, H., Castro Ochoa, K. F., Nava, P., Silva Olivares, A., Shibayama, M., Schnoor, M. Analyzing Beneficial Effects of Nutritional Supplements on Intestinal Epithelial Barrier Functions During Experimental Colitis. J. Vis. Exp. (119), e55095, doi:10.3791/55095 (2017).More

Vargas Robles, H., Castro Ochoa, K. F., Nava, P., Silva Olivares, A., Shibayama, M., Schnoor, M. Analyzing Beneficial Effects of Nutritional Supplements on Intestinal Epithelial Barrier Functions During Experimental Colitis. J. Vis. Exp. (119), e55095, doi:10.3791/55095 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter