Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Medicine

आंतों उपकला बैरियर कार्य पर पूरक पोषाहार के लाभदायक प्रभाव का विश्लेषण प्रायोगिक कोलाइटिस के दौरान

doi: 10.3791/55095 Published: January 5, 2017

Summary

भड़काऊ आंत्र रोग (IBD) के मौजूदा उपचार रोग के लक्षणों को समाप्त करने के उद्देश्य लेकिन गंभीर दुष्प्रभाव हो सकता है। इस प्रकार, वैकल्पिक रणनीतियों पशु कोलाइटिस मॉडल में जांच की जा रही है। यहाँ, हम कैसे नैदानिक ​​आईबीडी संकेत पर पूरक आहार के लाभदायक प्रभाव इस तरह के एक कोलाइटिस मॉडल में विश्लेषण कर रहे हैं समझाओ।

Abstract

सूजन आंत्र रोग (IBD), क्रोहन रोग और अल्सरेटिव कोलाइटिस सहित, आंतों की पुरानी relapsing विकारों हैं। वे इस तरह के पेट में ऐंठन, खूनी दस्त, और वजन घटाने के रूप में गंभीर समस्याओं, प्रभावित व्यक्तियों में, कारण। दुर्भाग्य से, वहाँ कोई इलाज नहीं अभी तक है, और उपचार केवल लक्षणों को कम करना है। वर्तमान उपचार विरोधी भड़काऊ और immunosuppressive दवाओं है कि गंभीर दुष्प्रभाव हो सकते हैं शामिल। इस तरह के पोषक तत्वों की खुराक के रूप में वैकल्पिक उपचार के विकल्प, कि दुष्प्रभाव का कारण नहीं है के लिए खोज वारंट। नैदानिक ​​अध्ययन में अपने आवेदन करने से पहले, ऐसे यौगिकों कड़ाई प्रभावशीलता और पशु मॉडल में सुरक्षा के लिए परीक्षण किया जाना चाहिए। एक विश्वसनीय प्रयोगात्मक मॉडल चूहों में dextran सल्फेट सोडियम (डीएसएस) कोलाइटिस मॉडल है, जो मनुष्यों में अल्सरेटिव कोलाइटिस के नैदानिक ​​लक्षण के कई reproduces है। हमने हाल ही में एक पोषण युक्त पूरक के लाभदायक प्रभाव का परीक्षण करने के लिए इस मॉडल लागू कियाविटामिन सी और ई, एल arginine, और ω3-पॉलीअनसेचुरेटेड फैटी एसिड (PUFA)। हम विभिन्न रोग मापदंडों का विश्लेषण किया और पाया कि इस पूरक शोफ गठन, ऊतकों को नुकसान, ल्युकोसैट घुसपैठ, oxidative तनाव, और समर्थक भड़काऊ साइटोकिन्स के उत्पादन को सुधारने के लिए, रोग गतिविधि सूचकांक में एक समग्र सुधार के लिए अग्रणी में सक्षम था। इस अनुच्छेद में, हम C57BL / 6 चूहों में इस के बारे कोलाइटिस मॉडल का उपयोग पूरक पोषण का सही आवेदन, साथ ही साथ कैसे इस तरह के ऊतक विज्ञान, oxidative तनाव, और सूजन के रूप में रोग मापदंडों के मूल्यांकन कर रहे हैं विस्तार से समझाओ। अलग आहार की खुराक के लाभदायक प्रभाव का विश्लेषण फिर अंत में वैकल्पिक उपचार के लिए रणनीति है कि आईबीडी लक्षणों को कम और / या कि गंभीर साइड इफेक्ट के कारण के बिना छूट के चरणों को लम्बा खींच के विकास के लिए नए रास्ते खोल सकता है।

Introduction

कोलाइटिस बृहदान्त्र कि दस्त और पेट में दर्द पैदा कर सकता है की एक सूजन शर्त है। कोलाइटिस संक्रमण के लिए या तनाव को तीव्र हो सकता है, के जवाब में, या यह एक ऐसी अल्सरेटिव कोलाइटिस (यूसी) है, जो सूजन आंत्र रोग (IBD) के समूह के अंतर्गत आता है के रूप में, एक पुरानी बीमारी के रूप में विकसित कर सकते हैं। हालांकि यूसी के नैदानिक लक्षण अच्छी तरह से वर्णित किया गया है, रोगजनन अभी भी खराब 1 समझा जाता है। यह विशेषज्ञों के बीच स्वीकार किया है कि यूसी, एक multifactorial रोग है आनुवंशिक परिवर्तन और एक प्रमुख भूमिका निभा रहा है 2 न्यायपालिका प्रतिरक्षा प्रतिक्रिया के साथ। हालांकि, इस तरह के रहने वाले और पोषण की शैली के रूप में पर्यावरणीय कारकों ने भी इस बीमारी के विकास और प्रगति के लिए 3 योगदान करते हैं।

दुर्भाग्य से, आईबीडी इलाज नहीं है, लेकिन वहाँ कई उपचार विकल्प है कि नैदानिक ​​लक्षणों को कम करने के लिए लक्ष्य कर रहे हैं। वर्तमान उपचार ऐसे sulfasalazine और corticosteroids के रूप में विरोधी भड़काऊ दवाओं, शामिल हैं; ऐसे azathio रूप immunosuppressants,PRINE; मोनोक्लोनल एंटीबॉडी कि इस तरह के इंटेग्रिन के रूप में इस तरह के ट्यूमर नेक्रोसिस फैक्टर-α (TNF-α), या ब्लॉक आसंजन अणुओं के रूप में कब्जा समर्थक भड़काऊ साइटोकिन्स, अत्यधिक ल्युकोसैट भर्ती को कम करने के लिए; और अवरोधकों कि kinases है कि ट्रिगर ऐसे जानूस काइनेज (जे ए) 4 के रूप में समर्थक भड़काऊ रास्ते, लक्ष्य। नहीं सभी रोगियों को सभी उपचार के लिए जवाब है, तो चिकित्सीय रणनीतियों individualized होना चाहिए 5। इसके अलावा, इन चिकित्सीय औषधियों का सबसे चयापचय और प्रतिरक्षा प्रतिक्रिया के साथ हस्तक्षेप, अक्सर गंभीर साइड इफेक्ट के कारण। इस कारण से, वैकल्पिक उपचार के विकल्प जांच की गई है।

वैकल्पिक उपचार प्रोबायोटिक्स और पोषक तत्वों की खुराक है, जो सफलता 6.7 के स्तर पर अलग से पशु मॉडल और नैदानिक परीक्षणों में लागू किया गया है शामिल हैं। हमने हाल ही में पाया गया है कि इस तरह के विरोधी ऑक्सीडेटिव विटामिन या ω3-पाली-असंतृप्त वसीय अम्लों के रूप में अलग ही पोषक तत्वों की खुराक के आवेदन (पीUFAS), कोलाइटिस और हृदय रोग के लक्षण 8,9 को समाप्त करने में इस तरह की खुराक का एक संयोजन के आवेदन से हीन है। ये अध्ययन चूहों में प्रदर्शन किया गया है, इसलिए नैदानिक ​​अध्ययन मानव में प्रदर्शन किया जाना चाहिए निर्धारित करने के लिए कि क्या इन निष्कर्षों को भी मनुष्य के लिए लागू होगी। इससे पहले नैदानिक ​​अध्ययन शुरू कर रहे हैं, प्रभावशीलता और नए उपचार के विकल्प की सुरक्षा के पशु मॉडल में मूल्यांकन किया जाना चाहिए।

आईबीडी के लिए, dextran सल्फेट सोडियम (डीएसएस) मॉडल व्यापक रूप से रोग के विकास के तंत्र और दवाओं और पोषक तत्वों की खुराक 6,10 के लाभदायक प्रभाव का अध्ययन करने के लिए इस्तेमाल किया गया है। ज्यादातर अध्ययनों में, केवल सात दिनों के लिए प्रेरित किया जाता है की एक समय अवधि में एक गंभीर बीमारी; फिर भी, नैदानिक इन पशुओं में मनाया संकेत बारीकी आईबीडी रोगियों में मनाया उन जैसे लगते हैं (यानी, खूनी दस्त, वजन घटाने, उपकला रोग, और प्रतिरक्षा सेल घुसपैठ) 10। डीएसएस म्यूकोसा में अपरदन को लाती है,बाधा रोग में और वृद्धि की आंतों उपकला पारगम्यता 11 में जिसके परिणामस्वरूप। सटीक व्यवस्था अज्ञात है। हालांकि, एक अध्ययन से पता चलता है कि इस के बारे मध्यम श्रृंखला लंबाई फैटी एसिड के साथ सूचना का आदान-नैनो lipocomplexes कि उपकला कोशिकाओं में प्रवेश करने और भड़काऊ संकेत दे रास्ते 12 के लिए प्रेरित करने में सक्षम हैं के रूप में। इस अनुच्छेद में, हम कैसे कोलाइटिस प्रेरित और चूहों, कैसे पोषक तत्वों की खुराक प्रत्येक जानवर में एक निरंतर खुराक सुनिश्चित करने के लिए gavage द्वारा लागू कर रहे हैं में विश्लेषण किया है विस्तार से वर्णन है, और कैसे विभिन्न कोलाइटिस लक्षणों पर इस तरह की खुराक के प्रभाव की जांच कर रहे हैं।

Subscription Required. Please recommend JoVE to your librarian.

Protocol

सभी पशु प्रयोगों Cinvestav के संस्थागत पशु की देखभाल और उपयोग समिति द्वारा अनुमोदित किया गया है।

1. DSS पीने के पानी की तैयारी और कोलाइटिस की प्रेरण

  1. एक 3.5% w / वी dextran सल्फेट सोडियम (डीएसएस) Autoclaved पीने के पानी में घोल तैयार करें। इस के बारे में आसानी से घुल और यह अंतिम समाधान फिल्टर करने के लिए आवश्यक नहीं है।
    नोट: इस के बारे इलाज के 7 दिनों के गंभीर कोलाइटिस लाती है। हल्के कोलाइटिस उत्प्रेरण हैं, 3 - उपचार के 4 दिनों सिफारिश कर रहे हैं। जब तक इस के बारे पीने का पानी साफ रहता है, यह पानी बदलने के लिए आवश्यक नहीं है। लेकिन, अगर यह परेशान बदल जाता है, इसे बदला जाना चाहिए।
  2. नर चूहों के आधारभूत वजन रिकॉर्ड। सुनिश्चित करें कि वे 8 हैं - उम्र के 12 सप्ताह और 21 की एक सीमा के भीतर - 25 ग्राम वजन।
    ध्यान दें: उचित DSS एकाग्रता प्रत्येक प्रयोगशाला में अनुकूलित किया जाना चाहिए। परिणाम भिन्न हो सकते हैं, आवास की स्थिति पर निर्भर करता है। 2.5 के बीच सांद्रता - 5% आम तौर पर मजबूत ग प्रेरित करने के लिए रिपोर्ट कर रहे हैंC57BL / 6J WT चूहों 10 में olitis। विभिन्न कंपनियों और विभिन्न बहुत से DSS, परीक्षण किया जाना चाहिए के रूप में परिणाम भी डीएसएस के विभिन्न स्रोतों के साथ भिन्न हो सकते हैं।
  3. पानी यथेच्छ प्रदान करें और ताजा 3.5% DSS पानी के साथ की जगह यदि आवश्यक है।

Gavage द्वारा पूरक पोषाहार की 2. आवेदन

  1. एक उपयुक्त विलायक में वांछित पोषक तत्वों की खुराक के लिए एक "feedable" समाधान तैयार है। इस अध्ययन के लिए, हम डीएचए 200 मिलीग्राम / किग्रा एल arginine, 83 मिलीग्राम / किग्रा विटामिन सी, 46 मिलीग्राम / किग्रा विटामिन ई, 77 मिलीग्राम / किग्रा eicosapentaenoic एसिड (ईपीए), और 115 मिलीग्राम / किग्रा docosahexaenoic एसिड युक्त एक मिश्रण (प्रयुक्त ) एक 1: पानी और कुसुम तेल की 1 समाधान।
  2. एक 1-एमएल एक gavage सुई से जुड़े सिरिंज भरें (15 ग्राम x 50 मिमी) पूरक पोषण मिश्रण के साथ। gavage सुई के बाहर साफ कर लें सुई के बाहर किसी भी यौगिक को दूर करने और उचित खुराक आवेदन सुनिश्चित करने के लिए।
  3. साथ पूंछ के आधार लोभी द्वारा माउस को नियंत्रित करनाएक हाथ और मजबूती से अंगूठे और दूसरे हाथ की तर्जनी के साथ गर्दन के पीछे एक त्वचा गुना मनोरंजक द्वारा। तीसरी उंगली और एक ही हाथ है कि गर्दन धारण के अंगूठे के आधार के बीच पूंछ रखें।
  4. एक ईमानदार स्थिति में माउस को बनाए रखने, पशु के मुंह के बाईं ओर में सुई डालने और ध्यान से मुंह घेघा पता लगाने के लिए की छत का पालन करें। कोई प्रतिरोध का सामना करना पड़ा है, तो पेट की ओर सुई अग्रिम।
    नोट: सत्यापित करें कि पशु आगे बढ़ने से पहले ठीक से साँस ले रहा है।
  5. मिश्रण को धीरे-धीरे प्रशासन, धीरे-धीरे सिरिंज बाहर खींच कर ट्यूब को हटाने, और माउस रिलीज। कोलाइटिस प्रयोग के दौरान gavage द्वारा पोषक तत्वों की खुराक लागू करें एक बार दैनिक।

3. रोग गतिविधि सूचकांक का निर्धारण

नोट: रोग गतिविधि सूचकांक जो ओबी हैं वजन घटाने, perianal खून बह रहा है, और मल स्थिरता के लिए स्कोर, का संयोजन हैदैनिक 13 tained।

  1. दैनिक वजन को मापने और वजन घटाने के प्रतिशत के हिसाब से 4 करने के लिए 0 के स्कोर आवंटित (0: 0%, 1: 1 - 5%, 2: 5 - 10%, 3: 10 - 20%, और 4:> 20 %)।
    नोट: Bodyweight नुकसान DSS-कोलाइटिस की प्रेरण और वास्तविक वजन से पहले बेसल वजन प्रतिशत के बीच में अंतर की गणना के द्वारा निर्धारित किया जाता है।
  2. perianal रक्तस्राव के स्तर को निर्धारित करने के लिए, एक ताजा मल का नमूना इकट्ठा करने और एक guaiac मल मनोगत रक्त परीक्षण किट से एक स्लाइड पर एक पतली धब्बा लागू करने के लिए प्रदान की applicators का उपयोग करें। प्रत्येक नमूने के लिए एक ताजा applicator का प्रयोग करें।
    1. मोर्चे पर कवर बंद और स्लाइड की पीठ पर खिड़की खुली। नमूना स्थान पर वापस करने के लिए डेवलपर समाधान की दो बूँदें लागू करें।
    2. 30 एस के बाद परिणाम पढ़ें। नीले रंग के किसी भी ट्रेस मनोगत रक्त के लिए सकारात्मक है। सकारात्मक guaiac मल मनोगत रक्त परीक्षण (सिग्नल की शक्ति पर निर्भर करता है), और 3 - 4: - 2.5 से कोई भी, 0.5: 0 से 4 (0 के स्कोर निरुपित groएसएस खून बह रहा है)।
      नोट: यदि मल में खून दिखाई दे रहा है, guaiac मल मनोगत रक्त परीक्षण किया जा करने के लिए 3.5 नहीं है, और 3 के स्कोर, या 4 सौंपा है, दिखाई रक्त की मात्रा पर निर्भर करता है।
  3. एक ताजा मल का नमूना देख कर मल स्थिरता का निर्धारण करते हैं। 4 0 से एक अंक निरुपित (0: सामान्य / ठोस, 0.5 - 2.5: पीले मल, और 3 - 4: दस्त)।

4. इवांस ब्लू परख द्वारा विवो में आंतों उपकला पारगम्यता निर्धारण

  1. उन्हें एक ketamine के (100 मिलीग्राम / किलो वजन के) (13 मिलीग्राम / किलो वजन के) नमकीन घोल (0.9% NaCl) में पतला मिश्रण और xylazine साथ intraperitoneally इंजेक्शन द्वारा जानवरों anesthetize, और चुटकी निगरानी के द्वारा संज्ञाहरण की गहराई का आकलन वापसी पलटा।
  2. एक लापरवाह स्थिति में anesthetized जानवरों की जगह और आंतों को बेनकाब करने के लिए एक laparotomy प्रदर्शन करते हैं।
  3. अंधान्त्र जानें, और पेट के एक के समीपस्थ क्षेत्र में एक छोटा सा चीरा बनानेscendens (आदर्श, तुरंत अंधान्त्र से सटे)।
  4. एक खिला सुई (G22) डालें और एक संयुक्ताक्षर एक आम रेशम के धागे का उपयोग कर के साथ सुरक्षित। ध्यान से पेट के सभी से मल बाहर कुल्ला करने के लिए फ्लश ट्यूब के माध्यम से प्रचुर मात्रा में पीबीएस। बृहदान्त्र में इवांस नीले समाधान (1.5% w / पीबीएस में v) टपकाना जब तक यह गुदा तक पहुँचता है।
  5. 15 मिनट के लिए इवांस नीले सेते हैं। प्रचुर मात्रा में पीबीएस के साथ ट्यूब निस्तब्धता तक perianal वार्शआउट स्पष्ट है के द्वारा डाई बाहर धो लें।
  6. ग्रीवा अव्यवस्था से जानवरों euthanize।
  7. पेट के आबकारी एवं इसे फिर से कुल्ला प्रचुर मात्रा में पीबीएस के साथ। किसी भी डाई colonic बलगम से चिपके हुए समाप्त करने के लिए पीबीएस में 6 मिमी एन -acetylcysteine के 1 एमएल के साथ एक बार कुल्ला।
  8. पेट के longitudinally कट और एक बार फिर यह कुल्ला पीबीएस और 6 मिमी एन -acetylcysteine के 1 एमएल के साथ।
  9. वजन और लंबाई रिकॉर्ड। इवांस नीले रंग की डाई निकालने के लिए, कोमल agitatio के साथ कमरे के तापमान पर रात भर एन के 2 एमएल में पेट के लिए जगह, एन -dimethylformamideएन। डाई एकाग्रता spectrophotometrically उपाय 610 एनएम पर।

5. ऊतक संग्रह

  1. उन्हें एक ketamine के (100 मिलीग्राम / किलो वजन के) (13 मिलीग्राम / किलो वजन के) नमकीन घोल (0.9% NaCl) में पतला मिश्रण और xylazine साथ intraperitoneally इंजेक्शन द्वारा जानवरों anesthetize, और चुटकी निगरानी के द्वारा संज्ञाहरण की गहराई का आकलन वापसी पलटा।
  2. ग्रीवा अव्यवस्था से जानवरों euthanize।
  3. एक लापरवाह स्थिति में जानवरों की जगह और उदर गुहा का पर्दाफाश करने के लिए एक laparotomy प्रदर्शन करते हैं।
  4. कैंची का प्रयोग, पूरे पेट के टुकड़े करना और इसकी लंबाई रिकॉर्ड है।
  5. पेट के ठंडा पीबीएस के साथ सावधानी से कई बार फ्लश मल को दूर करने के लिए। ऊतक वजन रिकॉर्ड और कदम 5.6 में वर्णित के रूप में, निम्न प्रयोगों के लिए तैयार - 5.8।
  6. शाही सेना अलगाव और myeloperoxidase (एमपीओ) assays के लिए, एक उचित आकार के ऊतक का नमूना काट (100 मिलीग्राम आमतौर पर पर्याप्त है), एक ट्यूब के अंदर यह जगह है, और एसएनएयह तरल नाइट्रोजन में पी-फ्रीज। भविष्य में उपयोग के लिए -80 डिग्री सेल्सियस पर ऊतकों स्टोर।
  7. immunofluorescence धुंधला और oxidative तनाव दृढ़ संकल्प (देखें नीचे) के लिए, एक छोटे से पेट के नमूना कटौती (0.5 - 1 सेमी) और छोटे एल्यूमीनियम इष्टतम काटने तापमान (अक्टूबर) परिसर के साथ भरा कप में यह डुबोना। सूखी बर्फ पर कप प्लेस और उन्हें धीरे-धीरे स्थिर है, आदेश बुलबुला गठन से बचने के लिए करते हैं। जमे हुए ऊतकों के नमूनों भविष्य में उपयोग के लिए -80 डिग्री सेल्सियस पर संग्रहित किया जा सकता है।
  8. स्विस रोल के लिए 14, पेट के longitudinally खोलने के लिए और ध्यान से संदंश का उपयोग मल को हटा दें। यह ऊपर रोल, म्यूकोसा अंदर की ओर का सामना करना पड़ ठीक इत्तला दे दी संदंश या एक पतली, गोल लकड़ी की छड़ी का उपयोग के साथ। ध्यान से एक embedding कैसेट के अंदर जगह और कदम 6.1 के साथ जारी है।
    नोट: इस के बारे में पेट के नुकसान लाती है। हालांकि, नुकसान वितरण सबसे अधिक नुकसान आम तौर पर बाहर का बृहदान्त्र और मलाशय में देखा के साथ, बाहर का पेट के लिए समीपस्थ से भिन्न होता है। इस प्रकार, हम या तो बाहर का कर्नल में ऊतक विज्ञान का विश्लेषण करने की सिफारिशपर या पूरे पेट के स्विस भूमिकाओं में हैं।

Hematoxylin-eosin धुंधला द्वारा पेट के प्रोटोकॉल का विश्लेषण 6.

  1. ऊतक तैयार
    1. ऊतकीय विश्लेषण के लिए, उचित निर्धारण प्राप्त करने के लिए कमरे के तापमान (आर टी) में 48 घंटे के लिए 10% formaldehyde के 5 एमएल में या तो स्विस रोल या नियंत्रण के कुछ क्षेत्रों से पेट के छोटे ऊतक टुकड़े और इलाज चूहों डूब।
      नोट: चरण 6 में सभी आगे कदम, आरटी पर बाहर किया जाता है जब तक अन्यथा इंगित।
    2. 18 घंटे के लिए नल के पानी से धो लें।
    3. 1 घंटे, 1 घंटे के लिए 96%, और 1 घंटे के लिए पूर्ण इथेनॉल के लिए 70% इथेनॉल के 15 एमएल के साथ उन्हें निर्जलीकरण। अगले एकाग्रता के लिए आगे बढ़ने से पहले ताजा शराब के साथ प्रत्येक चरण को दोहराएँ।
    4. पूर्ण इथेनॉल के 7.5 एमएल और 1 घंटे के लिए पूर्ण xylene के 7.5 एमएल का एक मिश्रण में निर्जलीकरण जारी रखें। 1 घंटे के लिए पूर्ण xylene के 15 एमएल के लिए नमूने पारित करने से पहले एक बार दोहराएँ। ताजा xylene के साथ एक बार इस चरण को दोहराएँ।
    5. पैराफिन में पेट के ऊतकों के नमूनों एम्बेड
      1. 17 घंटे के लिए तरल आयल के 50 एमएल में नमूने विसर्जित कर दिया। एक बार, लेकिन केवल 3 घंटे के लिए इस चरण को दोहराएँ।
      2. तरल आयल की 810 एमएल में: क्यूब्स में नमूने (22 x 22 x 22 मिमी प्लास्टिक, वर्ग मिट्टी, आकार) विसर्जित कर दिया।
      3. पेट के ऊतकों के नमूनों के साथ पैराफिन आरटी पर 24 घंटे के लिए जमना करने की अनुमति दें।
    6. काटना एक microtome का उपयोग ऊतक पार वर्गों
      1. एक microtome का उपयोग कर पेट के नमूनों में कटौती, निर्माता के निर्देशों के अनुसार, 5 माइक्रोन की मोटाई पर।
      2. एक पानी के स्नान (1 एल) में कटौती 0.3% जिलेटिन युक्त लीजिए। इस ऊतक पार वर्गों की तह से बचाता है। ऊतक वर्गों की वसूली और गिलास स्लाइड पर उन्हें माउंट।
    7. Hematoxylin और eosin ऊतक पार वर्गों का धुंधला
      1. एक मशीन में 60 डिग्री सेल्सियस पर 18 घंटे के लिए नमूने Deparaffinize। इस प्रयोजन के लिए उपयोग करने के लिए एक गिलास रोंLIDE एक संभाल के साथ रैक।
      2. deparaffinization के बाद, 5 मिनट के लिए पूर्ण xylene के 70 एमएल में विसर्जित स्लाइड। ताजा xylene के साथ एक बार इस चरण को दोहराएँ।
      3. 1 मिनट के लिए पूर्ण शराब के 70 एमएल में नमूने स्थानांतरण। ताजा शराब के साथ एक बार इस चरण को दोहराएँ।
      4. 1 मिनट के लिए इथेनॉल 96% से 70 एमएल में पेट के ऊतकों के नमूनों को सेते हैं। ताजा शराब के साथ एक बार इस चरण को दोहराएँ।
      5. नल के पानी में नमूने 2 एस के लिए दो बार धोएं।
      6. 7 मिनट के लिए हैरिस hematoxylin में ऊतकों को सेते हैं।
      7. नल के पानी में नमूने 2 एस के लिए दो बार धोएं।
      8. अम्लीय शराब में नमूने (70% इथेनॉल के 70 एमएल और 1 एम हाइड्रोक्लोरिक एसिड के 700 μL) 7 के लिए सेते हैं।
      9. नल के पानी में नमूने 2 एस के लिए दो बार धोएं।
      10. लिथियम कार्बोनेट 7 के लिए (distillated पानी की 100 मिलीलीटर में लिथियम कार्बोनेट की 1 ग्राम) का 70 एमएल में ऊतकों के नमूनों को सेते हैं।
      11. नल के पानी में नमूने 2 एस के लिए दो बार धोएं।
      12. इथेनॉल 80 से 70 एमएल में नमूने सेते1 मिनट के लिए%।
      13. 15 एस के लिए 70 एमएल Eosin-Y में नमूने स्थानांतरण।
      14. 1 मिनट के लिए 96% इथेनॉल के 70 एमएल में उन्हें सेते हैं। ताजा शराब के साथ एक बार इस चरण को दोहराएँ।
      15. 1 मिनट के लिए पूर्ण इथेनॉल (इथाइल अल्कोहल पूर्ण निर्जल) के 70 एमएल में ऊतकों के नमूनों को सेते हैं। ताजा शराब के साथ एक बार इस चरण को दोहराएँ।
      16. पूर्ण शराब के 35 एमएल के एक मिश्रण है और 1 मिनट के लिए पूर्ण xylene के 35 एमएल की 70 मिलीलीटर में नमूने सेते हैं।
      17. 1 मिनट के लिए पूर्ण xylene के 70 एमएल में नमूने स्थानांतरण। ताजा पूर्ण xylene के 70 एमएल में 5 मिनट के लिए इस चरण को दोहराएँ।
      18. सिंथेटिक राल के 80 μL पेट के ऊतकों के नमूनों को जोड़ें, उन्हें coverslips के साथ कवर किया, और उन्हें आरटी पर 24 घंटे के लिए सूखी। अंत में, उज्ज्वल क्षेत्र माइक्रोस्कोपी 8 का उपयोग नमूनों का विश्लेषण।

    इम्यूनोफ्लोरेसेंस द्वारा 7. विश्लेषण जंक्शन संरचना

    1. कदम 5.7 में वर्णित के रूप में ऊतक को तैयार है और कटौती 8 माइक्रोन मोटी पार वर्गोंएक cryostat का उपयोग कर।
    2. फिक्स और 20 मिनट के लिए -20 डिग्री सेल्सियस पर 96% इथेनॉल के साथ पेट के पार वर्गों permeabilize।
      नोट: सभी बाद incubations बाहर सुखाने और fluorochrome लुप्त होती रोकने के लिए एक नम अंधेरे बॉक्स में, आरटी पर किया जाना चाहिए जब तक अन्यथा कहा।
    3. हवा शुष्क नमूने, और फिर उन्हें 5 मिनट के लिए 3 बार प्रत्येक कुल्ला 1x पीबीएस के साथ
    4. अवरुद्ध समाधान 2 घंटे के लिए (पीबीएस युक्त 0.01% बीच और 2% बीएसए) के साथ नमूने सेते हैं।
    5. अवरुद्ध समाधान निकालें और 10 मिनट के लिए पीबीएस 0.01% बीच के साथ यह कुल्ला।
    6. इस समय के दौरान, पीबीएस 0.01% बीच में वांछित सांद्रता के लिए प्राथमिक एंटीबॉडी पतला।
    7. धोने के समाधान निकालें, पिछले चरण से एंटीबॉडी समाधान लागू होते हैं, और एक humidified बॉक्स में 4 डिग्री सेल्सियस पर रातोंरात सेते हैं।
    8. एंटीबॉडी समाधान निकालें और 3 बार पीबीएस 0.01% बीच के साथ 5 मिनट प्रत्येक के लिए विआयनीकृत पानी के साथ 10 मिनट के लिए, बहुत कोमल आंदोलन से धो लें और एक बार।
    9. जबकि धोने, सेंट्रीफ्यूज स्त्रावochromeconjugated, प्रजाति विशेष के 4 डिग्री सेल्सियस पर 20 मिनट के लिए 14,000 XG पर माध्यमिक एंटीबॉडी।
    10. के रूप में पीबीएस 0.01% बीच में प्रदाता ने संकेत दिया अवक्षेप बिना माध्यमिक एंटीबॉडी पतला, उन्हें लागू होते हैं, और आरटी पर 1 घंटे के लिए सेते हैं।
    11. दोहराएँ कदम 7.8 और संभव के रूप में पूरी तरह से धोने के समाधान निकाल दें।
    12. पिपेट 4 μL स्लाइड पर प्रत्येक नमूना भर विरोधी लुप्त होती एजेंट।
    13. एक coverslip के साथ नमूनों को कवर किया।
    14. 1 घंटे के लिए शुष्क हवा।
    15. नेल पॉलिश के साथ सील स्लाइड। स्लाइड ° आगे के विश्लेषण तक सी -20 पर संग्रहित किया जा सकता है।
    16. एक लेजर confocal खुर्दबीन 8 के आधार पर विश्लेषण।

    Ethidium के ऑक्सीकरण द्वारा oxidative तनाव के निर्धारण 8.

    1. डीएसएस कोलाइटिस के 7 दिनों के बाद, ऊतक 5 माइक्रोन की मोटाई पर एक cryostat में कदम 5.7 में वर्णित है और पेट के वर्गों में कटौती के रूप में तैयार करते हैं। गिलास स्लाइड पर माउंट पार वर्गों पाली एल lysine समाधान के साथ इलाज किया और नमूने बुद्धि सेतेh 5 अंधेरे में 30 मिनट के लिए 37 डिग्री सेल्सियस पर पानी में dihydroethidium (DHE) की माइक्रोन।
    2. पीबीएस (पीएच 7.6) आरटी पर कोमल आंदोलन के साथ 15 मिनट प्रत्येक के लिए तीन बार के साथ नमूने धो लें। एयर नमूने सूखी और बढ़ते मध्यम रोशनी की रक्षा के लिए की एक बूंद जोड़ें। एक लेजर स्कैनिंग confocal खुर्दबीन पर ऑक्सीकरण ethidium (40x बढ़ाई, 568 एनएम तरंगदैर्ध्य) के प्रतिदीप्ति का निरीक्षण करें।

    एमपीओ परख द्वारा ल्युकोसैट भर्ती की 9. विश्लेषण

    1. डीएसएस कोलाइटिस के 7 दिनों के बाद, पेट के ऊतक को इकट्ठा करने और नमूने homogenize - hexadecyltrimethylammonium के 1 एमएल (HTAB) बफर (50 मिमी में 0.5% HTAB फॉस्फेट बफर, पीएच 6.0) के साथ (200 से 400 मिलीग्राम) बर्फ पर एक homogenizer का उपयोग।
    2. 1 HTAB एमएल बफर के साथ दो बार homogenizer की नोक कुल्ला lysate में सभी ऊतक 40% आयाम पर पांच बार प्रत्येक 10 S के लिए शामिल हैं और यह sonicate करने के लिए। तरल नाइट्रोजन में तीन बार में फ्रीज पिघलना।
    3. 15 मिनट के लिए 14,000 XG पर अपकेंद्रित्र और सतह पर तैरनेवाला इकट्ठा।सोडियम साइट्रेट (पानी में 1 मीटर), हाइड्रोजन पेरोक्साइड के 0.1 एमएल की ABTS, 5 एमएल के मिश्रण से 2,2'-azino-बीआईएस (3-ethylbenzothiazoline-6-sulphonic एसिड) (ABTS) समाधान तैयार है, और द्वि के 45 एमएल -आसुत जल।
    4. एक 96 अच्छी तरह से फ्लैट तली थाली में 0.1 ABTS एमएल समाधान के साथ प्रत्येक सतह पर तैरनेवाला के 0.1 एमएल मिक्स। 10 मिनट के बाद, 460 एक स्पेक्ट्रोफोटोमीटर का उपयोग एनएम पर absorbance के उपाय।

    10 पीसीआर द्वारा की समर्थक भड़काऊ साइटोकिन्स अभिव्यक्ति का मूल्यांकन

    1. ऊतक homogenization
      1. एक शक्ति homogenizer का उपयोग कर एक एसिड guanidinium thiocyanate फिनोल के क्लोरोफॉर्म मिश्रण का 1 एमएल में पेट के ऊतकों के नमूनों की 50 से 100 मिलीग्राम Homogenize।
      2. 15 मिनट के लिए कमरे के तापमान पर यह सेते हैं।
    2. चरण पृथक्करण
      1. क्लोरोफॉर्म की 0.2 एमएल जोड़ें और 30 एस के लिए सख्ती से हिला।
      2. 30 मिनट के लिए 4 डिग्री सेल्सियस पर सेते हैं।
      3. 4 डिग्री सेल्सियस पर 60 मिनट के लिए 12,000 XG पर अपकेंद्रित्र।
      4. यू स्थानांतरणएक ताजा ट्यूब (~ 500 μL) में pper जलीय चरण।
    3. आरएनए वर्षा और Resuspension
      1. isopropyl शराब के 0.5 एमएल जोड़ें और 60 मिनट के लिए 4 डिग्री सेल्सियस पर नमूने सेते हैं।
      2. 4 डिग्री सेल्सियस पर 30 मिनट के लिए 12,000 XG पर अपकेंद्रित्र।
      3. सतह पर तैरनेवाला पूरी तरह से निकालें।
      4. इथेनॉल 75% और भंवर के 1 एमएल जोड़ें।
      5. 4 डिग्री सेल्सियस पर 30 मिनट के लिए 12,000 XG पर अपकेंद्रित्र।
      6. सतह पर तैरनेवाला निकालें।
      7. 3-5 मिनट के लिए हवा शुष्क करने के लिए शेष इथेनॉल की अनुमति दें।
        नोट: यह शाही सेना गोली पूरी तरह से सूखे, के रूप में यह बहुत अपनी घुलनशीलता कमी होगी नहीं जाने के लिए महत्वपूर्ण है।
      8. diethylpyrocarbonate के 0.3 एमएल (DEPC) -treated पानी में गोली फिर से भंग। इसके तत्काल बाद सीडीएनए में शाही सेना के नमूने टाइप (अधिक स्थिर, कदम 10.5 देखें) -80 डिग्री सेल्सियस पर या दुकान।
    4. आरएनए मात्रा
      1. DEPC इलाज पानी के 99 μL के साथ शाही सेना के 1 μL पतला।
      2. वें पढ़ें260 एनएम और 280 एनएम एक यूवी / विज़ स्पेक्ट्रोफोटोमीटर का उपयोग नमूना एकाग्रता और पवित्रता का निर्धारण करने पर ई आयुध डिपो।
    5. सीडीएनए संश्लेषण
      1. 1 (डीटी) RNase मुक्त बाँझ ट्यूबों में oligo के μL 12-18 (0.5 माइक्रोग्राम / μL) और DEPC इलाज पानी (12 μL की कुल मात्रा) के साथ शाही सेना के नमूने (1-5 ग्राम) मिश्रण।
      2. 10 मिनट के लिए 70 डिग्री सेल्सियस पर सेते हैं।
      3. 10x पीसीआर बफर के 2 μL, 2 MgCl 50 मिमी 1 μL, 10 मिमी dNTP मिश्रण का 1 μL, और 0.1 एम dithiothreitol के 2 μL (डीटीटी) जोड़ें।
      4. 5 मिनट के लिए 4 डिग्री सेल्सियस पर सेते हैं।
      5. रिवर्स ट्रांसक्रिपटेस के 1 μL जोड़ें और 5 मिनट के लिए 42 डिग्री सेल्सियस पर सेते हैं।
      6. 15 मिनट के लिए 70 डिग्री सेल्सियस पर सेते हैं।
      7. 15 मिनट के लिए 4 डिग्री सेल्सियस पर सेते हैं। सीडीएनए ° आगे उपयोग करें जब तक सी -20 पर संग्रहित किया जा सकता है।
    6. पीसीआर
      1. मिक्स 10x पीसीआर बफर के 2.5 μL, 25 मिमी के 1.5 μL 2 MgCl, 10 मिमी dNTP के 0.5 μL मिश्रण, 0.25 μ25 μL की कुल मात्रा को Taq डीएनए पोलीमरेज़, प्रत्येक प्राइमर के 0.25 μL (10 माइक्रोन) के और सीडीएनए (100 एनजी), और बाँझ पानी के एल।
      2. एक 96 अच्छी तरह से थर्मल साइक्लर पर नमूने चलाएँ। जीनोमिक डीएनए के प्रवर्धन रोकने के लिए, आगे और रिवर्स प्राइमरों अलग एक्सॉनों में स्थित होना चाहिए करने के लिए: IL1β-परिवार कल्याण: GCAACTGTTCCTGAACTCAACT और IL1β-RE: TCTTTTGGGGTCCGTCAACT; IL6-परिवार कल्याण: CCTTCCTACCCCAATTTCCAA और IL6-RE: AGATGAATTGGATGGTCTTGGTC; के.सी.-परिवार कल्याण: TGTCAGTGCCTGCAGACCAT और के.सी.-RE: CCTGAGGGCAACACCTTCA; और actin-परिवार कल्याण: TATCCACCTTCCAGCAGATGT और actin-RE: AGCTCAGTAACAGTCCGCCTA। 15 एस, 30 एस के लिए 58 डिग्री सेल्सियस, और 30 एस के लिए 72 डिग्री सेल्सियस, प्लस 72 डिग्री सेल्सियस पर 10 मिनट के लिए एक अंतिम विस्तार के लिए 95 डिग्री सेल्सियस पर 5 मिनट के लिए 95 डिग्री सेल्सियस 30 चक्रों के बाद: निम्नलिखित पीसीआर की स्थिति का प्रयोग करें ।

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

आहार पूरक DSS कोलाइटिस से रक्षा कर सकते

इस तरह के विटामिन सी, विटामिन ई, नाइट्रिक ऑक्साइड (सं) स्रोत एल arginine, और ω3-पॉलीअनसेचुरेटेड फैटी एसिड (ω3-PUFAs) के रूप में विरोधी भड़काऊ और विरोधी ऑक्सीडेटिव पूरक आहार, पशु में बदलती सफलता के साथ इस्तेमाल किया गया है मॉडल भड़काऊ रोगों 3,6,15 के लक्षण को कम करने के लिए। कुपोषण, oxidative तनाव, और समर्थक भड़काऊ साइटोकिन्स का उत्पादन दोनों तीव्र और जीर्ण कोलाइटिस 3 को गति प्रदान कर सकते हैं। पिछले एक अध्ययन में, हम साबित कर दिया कि सूक्ष्म पोषक तत्वों का एक संयोजन vivo में DSS प्रेरित कोलाइटिस के खिलाफ सुरक्षात्मक प्रभाव दिखाया। यहाँ, हम कैसे इन प्रभावों को 8 मापा गया पर विस्तृत प्रोटोकॉल प्रदान करते हैं। सबसे पहले, हम रोग गतिविधि सूचकांक (दाई) का निर्धारण करने, वजन घटाने के तीन मानकों से मिलकर द्वारा रोग प्रगति पर पोषक तत्वों की खुराक के प्रभाव का विश्लेषण किया है,मल स्थिरता, और perianal खून बह रहा है। प्रतिनिधि परिणाम से पता चला है DSS उपचार एक लगातार बढ़ती दाई के लिए नेतृत्व किया है कि, जैसा कि उम्मीद थी, दिन सात (चित्रा 1 ए) पर 8.2 ± 0.46 की एक अधिकतम तक पहुंच गया। विरोधी भड़काऊ आहार पूरकता कोलाइटिस की शुरुआत में देरी, लेकिन बाद में समय बिंदुओं पर, जब कोलाइटिस बहुत मजबूत था, सुरक्षात्मक प्रभाव सीमांत और अब कोई सांख्यिकीय महत्वपूर्ण था, सुझाव है कि पूरक आहार ही प्रभावी हैं जब कोलाइटिस अभी तक भी मजबूत नहीं है। महत्वपूर्ण बात है, आहार हस्तक्षेप आंतों उपकला पारगम्यता में DSS प्रेरित वृद्धि हुई है, जो कोलाइटिस का एक महत्वपूर्ण विशेषता (चित्रा 1 बी) है को रोकने सकता है। डीएसएस कोलाइटिस कम हो बृहदान्त्र लंबाई करने के लिए नेतृत्व किया, और इस कमी को भी विरोधी भड़काऊ और विरोधी ऑक्सीडेटिव पूरक आहार (चित्रा 1 सी) द्वारा ameliorated किया गया था। इस प्रकार, कोलाइटिस के नैदानिक ​​लक्षण वास्तव में आहार संरचना में परिवर्तन द्वारा क्रमशः समाप्त किया जा सकता है।

क्यों बृहदांत्रशोथ प्रगति एक आहार पूरक प्राप्त पशुओं में कम गंभीर था विश्लेषण करने के लिए, ऊतक आकृति विज्ञान hematoxylin / eosin (एच / ई) आयल एम्बेडेड बाहर का पेट के ऊतकों की धुंधला के बाद जांच की गई। नियंत्रण के नमूने, एक सामान्य आकृति विज्ञान (2A चित्रा, ऊपरी पैनल) से पता चला है, जबकि 3.5% DSS के साथ इलाज जानवरों कोलाइटिस के विशिष्ट लक्षण दिखाई है (यानी, ल्युकोसैट घुसपैठ, सूजन गठन, तहखाना डिसप्लासिया, और छालों, चित्रा 2A, मध्यम पैनल)। ध्यान दें, आहार पूरकता स्पष्ट रूप से क्रमशः समाप्त कोलाइटिस प्रेरित रूपात्मक बदलाव के साथ समानांतर उपचार, आकृति विज्ञान एक समग्र कि नियंत्रण समूह (चित्रा 2A, नीचे पैनल) के लिए अधिक बराबर था के साथ। इन टिप्पणियों बहुत क्या किया गया है करने के लिए इसी तरह के थेप्रोबायोटिक बैक्टीरिया 13 और स्पष्ट रूप से साथ सह-उपचार के लिए सूचना चलता है कि आहार में परिवर्तन कोलाइटिस के विकास प्रतिक्रिया कर सकते हैं।

हम पहले से ही जानते थे कि कोलाइटिस प्रेरित आंतों उपकला पारगम्यता आहार पूरकता द्वारा counteracted जा सकता है। वृद्धि की पारगम्यता आईबीडी की एक बानगी है, और यह स्थिर adherens जंक्शनों (ए जे) और तंग जंक्शनों (टीजे) के disassembly की वजह से बड़े हिस्से में है। जंक्शनल प्रोटीन के internalization द्वारा उपकला सेल संपर्कों की अस्थिरता समर्थक भड़काऊ साइटोकिन्स, जो बहुतायत से कोलाइटिस 16 के दौरान उत्पादन किया जाता है से प्रेरित है। हम बाहर का पेट के ऊतक के immunofluorescent धुंधला के माध्यम से, पाया गया कि टी जे अणु zonula occludens-1 (ZO -1) और ए जे अणु ई cadherin DSS प्रेरित कोलाइटिस दौरान भाँति रहे थे और इन प्रोटीनों की कि सह स्थानीयकरण आंशिक रूप से खो गया था तहखाना उपकला सेल संपर्क में (चित्रा 2 बी)। मैंmportantly, ई cadherin और ZO-1 कम हो गया था जब इस के बारे इलाज चूहों सह इलाज एक विरोधी भड़काऊ और विरोधी ऑक्सीडेटिव पूरक आहार (चित्रा 2 बी) के साथ थे के internalization। कुल मिलाकर, तहखाना और जंक्शन संरचनाओं, नियंत्रण जब आहार पूरक लागू किया गया था के लिए और अधिक तुलनीय थे सुझाव है कि मनाया सुरक्षात्मक प्रभाव भाग में कम से कम ऊतक वास्तुकला के संरक्षण की वजह से था।

आहार हस्तक्षेप प्रतिक्रिया कर सकते हैं भड़काऊ न्युट्रोफिल भर्ती, oxidative तनाव, और के समर्थक भड़काऊ साइटोकिन्स उत्पादन

आईबीडी की एक और बानगी अनियंत्रित न्यूट्रोफिल घुसपैठ है। भर्ती न्यूट्रोफिल उत्पादन और प्रतिक्रियाशील ऑक्सीजन प्रजातियों (आरओएस) और proteases 17 को रिहा द्वारा ऊतकों को नुकसान करने के लिए योगदान करते हैं। एक MPO गतिविधि परख का उपयोग करना, हम इस के बारे, जो counteracted गया था के जवाब में पेट में मजबूत न्युट्रोफिल भर्ती पायाआहार पूरकता द्वारा (चित्रा 3 ए)।

ऑक्सीडेटिव तनाव कोलाइटिस का एक और महत्वपूर्ण विशेषता है, भर्ती न्यूट्रोफिल से आरओएस की रिहाई की वजह से है। इस प्रकार, हम पेट के पार वर्गों में आरओएस के उत्पादन का विश्लेषण किया। चित्रा 3 बी दर्शाता है कि इस के बारे उपचार जोरदार ऑक्सीडेटिव तनाव बढ़ गया। ध्यान से, आहार में परिवर्तन पूरी तरह से DSS प्रेरित oxidative तनाव (चित्रा 3 बी), जो सबसे अधिक संभावना कम हो न्युट्रोफिल भर्ती (चित्रा 3 ए) का परिणाम है रोका।

समर्थक भड़काऊ साइटोकिन्स और chemokines दृढ़ता से कोलाइटिस 18 के दौरान विभिन्न प्रकार की कोशिकाओं द्वारा उत्पादित कर रहे हैं। इस तरह के भड़काऊ मध्यस्थों न्युट्रोफिल भर्ती और जंक्शन प्रोटीन internalization-सुविधाओं है कि हम पहले से ही पता था कि आहार में परिवर्तन से तनु किया जा सकता है के लिए योगदान। आरटी पीसीआर द्वारा mRNA अभिव्यक्ति के विश्लेषण से पता चला है कि डीएसएसIL1β की अभिव्यक्ति, आईएल -6 वृद्धि हुई है, और keratinocyte व्युत्पन्न केमोकाइन (सी), उम्मीद के रूप में (चित्रा 3 सी), और कहा कि विरोधी भड़काऊ आहार पूरकता इस DSS प्रेरित वृद्धि (चित्रा 3 सी) कम हो गई। इन आंकड़ों से संकेत है कि आहार की आपूर्ति करता है वास्तव में आईबीडी के नैदानिक ​​लक्षण प्रतिक्रिया करने के लिए सेवा कर सकते हैं।

आकृति 1
चित्रा 1. पूरक पोषाहार रोग गतिविधि सूचकांक, आंतों उपकला पारगम्यता, और पेट छोटा कम कर सकते हैं। (ए) रोग गतिविधि सूचकांक (दाई, 0 से मूल्यों - 12) वजन घटाने, मल स्थिरता, और perianal रक्तस्राव के तीन मानकों के होते हैं और नियंत्रण (Ctrl), कोलाइटिस, और कोलाइटिस की प्रयोगात्मक समूहों में दैनिक दर्ज किया गया था + पूरक पोषण (कोलाइटिस + suppl।)। नियंत्रण समूह, कोलाइटिस के कोई लक्षण नहीं दिखा था 0 throughou की एक दाई, जिसके परिणामस्वरूपप्रयोगात्मक अवधि टी। एन = समूह प्रति 5। (बी) आंतों उपकला पारगम्यता उपरोक्त प्रयोगात्मक समूहों में इवांस नीले रिसाव द्वारा मापा गया था और प्रति ऊतक के जी 620 एनएम पर अवशोषण के रूप में व्यक्त की गई थी। एन = 8 समूह के प्रति। सभी डेटा मतलब (एसडीएम) के मानक विचलन ± मतलब के रूप में दिखाया गया है। * पी <0.05; ** पी <0.01; *** पी <0.001। सांख्यिकी एक तरह से एनोवा द्वारा गणना की गई। (सी) के इलाज के 7 दिनों के बाद संबंधित प्रयोगात्मक समूहों के पूरे कॉलन के प्रतिनिधि छवियाँ। बाईं तरफ के पैमाने सेमी में है। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

चित्र 2
चित्रा 2. ऊतक आकृति विज्ञान और जंक्शन वास्तुकला बेहतर कोलाइटिस के दौरान संरक्षित कर रहे हैं पोषाहार र को लागू करने के लिए जबpplements। (ए) 5-माइक्रोन आयल संबंधित प्रयोगात्मक समूहों के बाहर का कॉलन से ऊतक बायोप्सी के पार अनुभाग, hematoxylin / eosin के साथ दाग और ऐसे शोफ गठन (तीर), ल्युकोसैट घुसपैठ (तीर) के रूप में कोलाइटिस के विशिष्ट लक्षण, के लिए विश्लेषण किया गया और छालों (*)। कोलाइटिस + suppl के समग्र ऊतक आकृति विज्ञान। समूह अधिक, कोलाइटिस समूह की तुलना में नियंत्रण के जैसा दिखता DSS कोलाइटिस के खिलाफ एक समग्र सुरक्षात्मक प्रभाव साबित हो। छवियाँ समूह प्रति 3 स्वतंत्र ऊतक की तैयारी के प्रतिनिधि हैं। छवियाँ एक 10X उद्देश्य का उपयोग कर लिया गया था। बार = 100 माइक्रोन। (बी) 8 माइक्रोन पेट के संबंधित समूहों के क्रायो वर्गों ZO -1 के खिलाफ एंटीबॉडी (हरा) और ई cadherin (लाल) के साथ दाग रहे थे। सह स्थानीयकरण (मर्ज किए गए चित्र में पीले, तीर) ई-cadherin और तहखाना उपकला सेल संपर्क में ZO-1, जो कोलाइटिस के दौरान खो दिया है, ज्यादातर कोलाइटिस + suppl में संरक्षित है। समूह। छवियाँ 3 के प्रतिनिधि हैंस्वतंत्र ऊतक की तैयारी। बार = 50 माइक्रोन। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

चित्र तीन
चित्रा 3. न्युट्रोफिल भर्ती, oxidative तनाव, और के समर्थक भड़काऊ साइटोकिन्स उत्पादन पूरक पोषाहार से कम किया जा सकता है। (ए) Myeloperoxidase (एमपीओ) गतिविधि प्रयोगात्मक समूहों में पेट के ऊतकों में ल्युकोसैट भर्ती की राशि का विश्लेषण करने के लिए मापा गया था: नियंत्रण (Ctrl), कोलाइटिस, और कोलाइटिस + पूरक पोषण (कोलाइटिस + suppl।)। एन = समूह प्रति 5; * पी <0.05। डेटा एसडीएम ± मतलब के रूप में दिखाया गया है। सांख्यिकी एक तरह से एनोवा द्वारा गणना की गई। (बी) के ऑक्सीकरण ethidium के प्रतिदीप्ति, सह के 8 माइक्रोन क्रायो वर्गों में oxidative तनाव के उपाय के रूप में लाल रंग में दर्शायालंदन ऊतकों, लेजर confocal माइक्रोस्कोपी द्वारा दर्ज किया गया था। छवियाँ 3 स्वतंत्र ऊतक की तैयारी के प्रतिनिधि हैं। बार = 100 माइक्रोन। (सी) समर्थक भड़काऊ साइटोकिन्स IL1β और आईएल -6 और केमोकाइन के.सी. एक 1.5% agarose जेल में अर्द्ध मात्रात्मक आरटी पीसीआर द्वारा निर्धारित किया गया था के उत्पादन (काले और सफेद स्पष्टता के लिए लौट रहे थे)। β-actin गृह व्यवस्था जीन के रूप में कार्य किया। तीन स्वतंत्र सीडीएनए तैयारियों की छवियों प्रतिनिधि दिखाए जाते हैं। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

लेखकों के पास खुलासे के लिए कुछ भी नहीं है।

Materials

Name Company Catalog Number Comments
0.3% of gelatin  Bioxon 158
10% formaldehyde J.T. Baker 2106-03
96-well plate with flat bottom Corning 3368
Absolute ethanol  J.T. Baker 9000-03
Absolute xylene J.T. Baker 9490-03
ABTS Sigma Aldrich H5882
Bovine Serum Albumin Sigma-Aldrich 9048-46-8
ColoScreen Helena Laboratories 5072
Corabion (Kindly provided by Merck, Naucalpan, Mexico) Merck
Dextran Sulfate Sodium Salt Affymetrix 9011-18-1 (M.W. 40,000-50,000)
Dihydroethidium Life Technology D11347
Eosin-Y  J.T. Baker L087-03
Evans blue Sigma-Aldrich 314-13-6
Feeding  needle Cadence Science Inc. 9921
Glass slide rack with handle Electron Microscopy 70312-16
Glass Slides Corning 2947
Harris hematoxylin  Sigma-Aldrich H3136
Hexadecyltrimethyammonium (HTAB) Sigma Aldrich H6269
Histosette (Embedding cassette) Simport M498.2
Hydrochloric acid 1 M J.T. Baker 9535-62
Hydrogen peroxide Sigma Aldrich H3410
Ketamine PiSA Agropecuaria Q-7833-028
Liquid paraffin  Paraplast 39501-006
Lithium carbonate  Sigma-Aldrich 2362
N,N-dimethylformamide J.T. Baker 68-12-2
N-acetylcysteine Sigma-Aldrich A9165
Plastic cubes Electron Microscopy 70181
Poly-L-Lysine Solution Sigma-Aldrich 25988-63-0
Prism 5 statistical software GraphPad Software Prism 5
Saline Solution 0.9% NaCl CS PiSA Q-7833-009
Sodium citrate Sigma-Aldrich W302600
Synthetic resin  Poly Mont 7987
Taq DNA polymerase Invitrogen 11615-010
Tissue-tek. O.C.T Compound Sakura Finetek 4583
Tuberculine Syringe BD Plastipak 305945
Tween 20 Sigma-Aldrich 9005-64-5
VECTASHIELD Antifade Mounting Medium with DAPI Vector Laboratories H-1200
Xylazine PiSA Agropecuaria Q-7833-099

DOWNLOAD MATERIALS LIST

References

  1. Souza, H. S., Fiocchi, C. Immunopathogenesis of IBD: current state of the art. Nat Rev Gastroenterol Hepatol. 13, 13-27 (2016).
  2. Xavier, R. J., Podolsky, D. K. Unravelling the pathogenesis of inflammatory bowel disease. Nature. 448, 427-434 (2007).
  3. Neuman, M. G., Nanau, R. M. Inflammatory bowel disease: role of diet, microbiota, life style. Transl Res. 160, 29-44 (2011).
  4. Lowenberg, M., D'Haens, G. Next-Generation Therapeutics for IBD. Current Gastroenterol Rep. 17, 21 (2015).
  5. Bernstein, C. N. Does everyone with inflammatory bowel disease need to be treated with combination therapy. Curr Opin Gastroenterol. (2016).
  6. Nanau, R. M., Neuman, M. G. Nutritional and probiotic supplementation in colitis models. Dig Dis Sci. 57, 2786-2810 (2012).
  7. Yamamoto, T. Nutrition and diet in inflammatory bowel disease. Curr Opin Gastroenterol. 29, 216-221 (2013).
  8. Vargas Robles, H., et al. Experimental Colitis Is Attenuated by Cardioprotective Diet Supplementation That Reduces Oxidative Stress, Inflammation, and Mucosal Damage. Ox Med Cell Longev. 8473242 (2016).
  9. Vargas-Robles, H., Rios, A., Arellano-Mendoza, M., Escalante, B. A., Schnoor, M. Antioxidative diet supplementation reverses high-fat diet-induced increases of cardiovascular risk factors in mice. Ox Med Cell Longev. 2015, 467471 (2015).
  10. Perse, M., Cerar, A. Dextran sodium sulphate colitis mouse model: traps and tricks. J Biomed Biotechnol. 2012, 718617 (2012).
  11. Chassaing, B., Aitken, J. D., Malleshappa, M., Vijay-Kumar, M. Dextran sulfate sodium (DSS)-induced colitis in mice. Curr. Protoc. Immunol. 104, Unit 15 25 (2014).
  12. Laroui, H., et al. Dextran sodium sulfate (DSS) induces colitis in mice by forming nano-lipocomplexes with medium-chain-length fatty acids in the colon. PLoS One. 7, 32084 (2009).
  13. Mennigen, R., et al. Probiotic mixture VSL#3 protects the epithelial barrier by maintaining tight junction protein expression and preventing apoptosis in a murine model of colitis. Am J Physiol Gastrointest Liver Physiol. 296, 1140-1149 (2009).
  14. Park, C. M., Reid, P. E., Walker, D. C., MacPherson, B. R. A simple, practical 'swiss roll' method of preparing tissues for paraffin or methacrylate embedding. J Microsc. 145, 115-120 (1987).
  15. Shen, W., Gaskins, H. R., McIntosh, M. K. Influence of dietary fat on intestinal microbes, inflammation, barrier function and metabolic outcomes. J Nutr Biochem. (2013).
  16. Bruewer, M., et al. Interferon-gamma induces internalization of epithelial tight junction proteins via a macropinocytosis-like process. FASEB J. 19, 923-933 (2005).
  17. Fournier, B. M., Parkos, C. A. The role of neutrophils during intestinal inflammation. Muc Immunol. 5, 354-366 (2012).
  18. Yan, Y., et al. Temporal and spatial analysis of clinical and molecular parameters in dextran sodium sulfate induced colitis. PLoS One. 4, 6073 (2009).
  19. Maxwell, J. R., Viney, J. L. Overview of mouse models of inflammatory bowel disease and their use in drug discovery. Curr Prot Pharmacol, S.J. Enna. Chapter 5, Unit 5.57 (2009).
  20. Ostanin, D. V., et al. T cell transfer model of chronic colitis: concepts, considerations, and tricks of the trade. Am J Physiol Gastrointest Liver Physiol. 296, 135-146 (2009).
  21. Randhawa, P. K., Singh, K., Singh, N., Jaggi, A. S. A review on chemical-induced inflammatory bowel disease models in rodents. Kor J Physiol Pharmacol. 18, 279-288 (2014).
  22. Whittem, C. G., Williams, A. D., Williams, C. S. Murine Colitis modeling using Dextran Sulfate Sodium (DSS). JoVE. (2010).
  23. Wirtz, S., Neufert, C., Weigmann, B., Neurath, M. F. Chemically induced mouse models of intestinal inflammation. Nat Prot. 2, 541-546 (2007).
  24. Naydenov, N. G., et al. Nonmuscle Myosin IIA Regulates Intestinal Epithelial Barrier in vivo and Plays a Protective Role During Experimental Colitis. Sci Rep. 6, 24161 (2016).
  25. Sumagin, R., Robin, A. Z., Nusrat, A., Parkos, C. A. Transmigrated neutrophils in the intestinal lumen engage ICAM-1 to regulate the epithelial barrier and neutrophil recruitment. Muc Immunol. 7, 905-915 (2014).
  26. Laukoetter, M. G., et al. JAM-A regulates permeability and inflammation in the intestine in vivo. J Exp Med. 204, 3067-3076 (2007).
  27. Viennois, E., Chen, F., Laroui, H., Baker, M. T., Merlin, D. Dextran sodium sulfate inhibits the activities of both polymerase and reverse transcriptase: lithium chloride purification, a rapid and efficient technique to purify RNA. BMC Res Notes. 6, 360 (2013).
आंतों उपकला बैरियर कार्य पर पूरक पोषाहार के लाभदायक प्रभाव का विश्लेषण प्रायोगिक कोलाइटिस के दौरान
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Vargas Robles, H., Castro Ochoa, K. F., Nava, P., Silva Olivares, A., Shibayama, M., Schnoor, M. Analyzing Beneficial Effects of Nutritional Supplements on Intestinal Epithelial Barrier Functions During Experimental Colitis. J. Vis. Exp. (119), e55095, doi:10.3791/55095 (2017).More

Vargas Robles, H., Castro Ochoa, K. F., Nava, P., Silva Olivares, A., Shibayama, M., Schnoor, M. Analyzing Beneficial Effects of Nutritional Supplements on Intestinal Epithelial Barrier Functions During Experimental Colitis. J. Vis. Exp. (119), e55095, doi:10.3791/55095 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter